ANTIBODIES
20240043507 · 2024-02-08
Inventors
Cpc classification
C07K2317/41
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
C07K16/1003
CHEMISTRY; METALLURGY
G01N33/54373
PHYSICS
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to antibodies capable of binding to the spike protein of coronavirus SARS-CoV-2, and methods and uses thereof in the prevention, treatment and/or diagnosis of coronavirus infections, and diseases and/or complications associated with coronavirus infections, including COVID-19.
Claims
1. An antibody capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein the antibody: (a) comprises at least three CDRs of antibody 222, or of any one of the 41 antibodies in Table 1; and/or (b) binds to the same epitope as or competes with antibody 159, 45 or 384.
2. The antibody according to claim 1, comprising: (a) at least four, five, or all six CDRs of an antibody in Table 1; (b) a heavy chain variable domain having at least 80% sequence identity to the heavy chain variable domain of an antibody in Table 1; (c) a light chain variable domain having at least 80% sequence identity to the light chain variable domain of an antibody in Table 1; and/or (d) a heavy chain variable domain and a light chain variable domain having at least 80% identity to the heavy chain variable domain and light chain domain, respectively, of an antibody in Table 1.
3. The antibody of claim 1 or claim 2, wherein the antibody in Table 1 is: (a) 222, 253H55L, 253H165L, 318, 253, 55, 165, 384, 159, 88, 40 or 316; or (b) 58, 222, 253 or 253H55L.
4. The antibody according to any one of the preceding claims, comprising: (a) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 265, 266, 267, 68, 69 and 70, respectively; (b) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 265, 266, 267, 188, 189 and 190, respectively; (c) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 255 to 260, respectively; (d) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 335 to 340, respectively; (e) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 65 to 70, respectively; (f) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 185 to 190, respectively; (g) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 265 to 270, respectively; (h) a CDRH1, CDRH2 and CDRH3 having the amino acid sequences set forth in SEQ ID NOs: 175 to 177, respectively; (i) a CDRH2, CDRH3, CDRL1 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 376, 377, 378 and 380, respectively; (j) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 105 to 110, respectively; or (k) a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 having an amino acid sequence set forth in SEQ ID NOs: 25 to 30, respectively.
5. The antibody according to claim 1 or 2, comprising a heavy chain variable domain amino acid sequence having at least 80% sequence identity to the heavy chain variable domain from a first antibody in Table 1, and a light chain variable domain amino acid sequence having at least 80% sequence identity to the light chain variable domain from a second antibody in Table 1, wherein the first and second antibodies derive from the same germline heavy chain v-region, optionally wherein the heavy chain v-region is IGHV3-53, IGHV1-58 or IGHV3-66; for example wherein: (a) the first antibody is 150 and the second antibody is 222; (b) the first antibody is 253 and the second antibody is 55; (c) the first antibody is 253 and the second antibody is 165; or (d) the second antibody is 222.
6. The antibody according to any one of the preceding claims, wherein the antibody binds to an epitope that is: (a) defined by residues 144-147, 155-158 and 250-253 of the N-terminal domain of the spike protein of coronavirus SARS-CoV-2; or (b) defined by residues F104, L105, L455, F456 and G482 to F486 of the receptor binding domain of the spike protein of coronavirus SARS-CoV-2.
7. The antibody according claim 1 or claim 2, wherein the antibody in Table 1 is 1, 88, 132, 253, 263, 316, 337 or 382, and wherein the N-glycosylation sequon of the antibody in Table 1 is retained.
8. The antibody according to any one of the preceding claims, which is a full-length antibody, e.g. comprising a IgG1 constant region.
9. The antibody according to one of the preceding claims, which comprises an Fc region comprising at least one modification such that serum half-life is extended.
10. A combination of antibodies comprising two or more antibodies according to any one of claims 1 to 9.
11. The combination of antibodies according to claim 10, comprising two, three or four antibodies according to any one of claims 1 to 9.
12. The combination of antibodies according to claim 10 or claim 11, comprising: (a) a combination of two antibodies listed in a row of Table 4; (b) a combination of two antibodies, listed in a row of Table 5; (c) a combination of three antibodies listed in a row of Table 4; (d) a combination of two antibodies listed in a row of Table 4, and antibody 159; (e) a combination of two antibodies listed in a row of Table 5, and antibody 159; or (f) a combination of three antibodies listed in a row of Table 5, and antibody 159.
13. One or more polynucleotides encoding the antibody according to any one of claims 1 to 9, one or more vectors comprising said polynucleotides, or a host cell comprising said vectors.
14. A method for producing an antibody that is capable of binding to the spike protein of coronavirus SARS-CoV-2, comprising culturing the host cell of claim 13 and isolating the antibody from said culture.
15. A pharmaceutical composition comprising: (a) the antibody according to any one of claims 1 to 9, or the combination of antibodies according to any one of claims 10 to 12, and (b) at least one pharmaceutically acceptable diluent or carrier.
16. The antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for use in a method for treatment of the human or animal body by therapy.
17. The antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for use in a method of treating or preventing coronavirus infection, or a disease or complication associated with coronavirus infection.
18. A method of treating a subject comprising administering a therapeutically effective amount of the antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, to said subject.
19. The method according to claim 17 or 18, wherein the method is for treating SARS-CoV-2 infection, or a disease or complication associated therewith.
20. A method of identifying the presence of coronavirus, or a protein or a protein fragment thereof, in a sample, comprising: (i) contacting the sample with the antibody according to any one of claims 1 to 9, or the combination according to any one of claims 10 to 12, and (ii) detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates the presence of coronavirus, or a protein or a protein fragment thereof, in the sample.
21. The method of claim 20, wherein the antibody is antibody 45 or the combination comprises antibody 45.
22. A method of treating or preventing coronavirus infection, or a disease or complication associated therewith, in a subject, comprising identifying the presence of coronavirus according to the method of claim 20 or claim 21 in a sample, and treating the subject with an anti-viral drug or an anti-inflammatory agent.
23. Use of the antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for: (i) preventing, treating and/or diagnosing coronavirus infection, or a disease or complication associated therewith, or (ii) identifying the presence of coronavirus, or a protein or a protein fragment thereof, in a sample.
24. The use of the antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for the manufacture of a medicament for treating or preventing coronavirus infection, or a disease or complication associated therewith.
25. The antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for use in a method of preventing, treating or diagnosing coronavirus infections caused by a SARS-CoV-2 strain comprising substitution at positions 417, 484 and/or 501 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 strain, e.g. it is a member of lineage B.1.1.7, B.1.351, P.1, or B.1.1.529.
26. A method of preventing, treating or diagnosing coronavirus infections caused by a SARS-CoV-2 strain in a subject, wherein the method comprises administering the antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, to the subject, wherein the SARS-CoV-2 strain comprises mutation at positions 417, 484 and/or 501 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 strain, e.g. it is a member of lineage B.1.1.7, B.1.351, P.1, or B.1.1.529.
27. The use of the antibody according to any one of claims 1 to 9, the combination according to any one of claims 10 to 12, or the pharmaceutical composition according to claim 15, for the manufacture of a medicament for preventing, treating or diagnosing coronavirus infections caused by a SARS-CoV-2 strain comprising substitution at positions 417, 484 and/or 501 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 strain, e.g. it is a member of lineage B.1.1.7, B.1.351, P.1, or B.1.1.529.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
DETAILED DESCRIPTION OF THE INVENTION
Antibodies of the Invention
[0072] An antibody of the invention specifically binds to the spike protein of SAR-CoV-2. In particular, it specifically binds to the 51 subunit of the spike protein, such as the receptor binding domain (RBD) or N-terminal domain (NTD).
[0073] An antibody of the invention may comprise at least three CDRs of an antibody in Table 1. Table 1 lists 42 individual antibodies that were identified from recovered COVID-19 patients. Table 1 also lists the SEQ ID NOs for the heavy chain variable region and light chain variable region nucleotide and amino acid sequences, and the complementarity determining regions (CDRs) of the variable chains, of each of the antibodies. The CDRs of the heavy chain (CDRH) and light chain variable domain (CDRL) are located at residues 27-38 (CDR1), residues 56-65 (CDR2) and residues 105-117 (CDR3) of each chain according to the IMGT numbering system (http://www.imgt.org; Lefranc M P, 1997, J, Immunol. Today, 18, 509). This numbering system is used in the present specification except where otherwise indicated.
[0074] The antibody in Table 1 may be any antibody selected from the group consisting of: 253H55L, 253H165L, 253, 222, 318, 55, 165, 384, 159, 88, 40 and 316. The antibody in Table 1 may be any antibody selected from the group consisting of: 253H55L, 253H165L, 253, 222, 318, 55 and 165. The antibody in Table 1 may be any antibody selected from the group consisting of: 384, 159, 253H55L, 253H165L, 253, 88, 40 and 316.
[0075] Antibodies 253H/55L, 253H/165L, 253, 222, 318, 55 and 165 are all highly potent neutralising mAbs that have been shown to neutralize the Victoria, Kent (B.1.1.7), South Africa (B.1.351) and Brazilian (P.1) strains, without a loss in potency.
[0076] The antibody in Table 1 may be any antibody selected from the group consisting of 88, 159, 222, 281, 316, 384 and 398. These antibodies were found to have potent cross-lineage neutralisation effects, e.g. they are effective against the Victoria and B.1.1.7 strains (e.g. a B.1.1.7:Victoria ratio of less than 2 and/or an IC50 as shown in Table 11 of less than 0.1 g/ml).
[0077] The antibody in Table 1 may be any antibody selected from the group consisting of: 55, 58, 150, 165, 222, 253, 278, 318, 253H55L and 253H165L. These antibodies were found to have potent cross-lineage neutralisation effects, e.g. they are effective against the Victoria and B.1.351 strains (e.g. a B.1.1.7:Victoria ration of less than 3 and/or an IC50 of less than 0.1 g/ml, see Tables 11 and 16A).
[0078] The antibody in Table 1 may be any antibody selected from the group consisting of: 222, 318, 253H55L and 253H165. These antibodies were found to have potent cross-lineage neutralisation effects, e.g. they are effective against the Victoria and B.1.351 strains (e.g. a B.1.1.7:Victoria ration of less than 3 and/or an IC50 of less than 0.1 g/ml, see Tables 11 and 16A) and bind to the spike protein with high affinity, e.g. having KD4 nM (see Table 16A).
[0079] The antibody in Table 1 may be 222 or 253H165L. These antibodies were found to have potent cross-lineage neutralisation effects, e.g. they have an IC50 of 0.02 g/ml against the Victoria strain, B.1.1.7 strain, B.1.351 strain and P.1 strain, and bind to the spike protein with high affinity (see Table 18).
[0080] The antibody in Table 1 may be any antibody selected from the group consisting of: 58, 222, 253 and 253H/55L. These antibodies were found to neutralize the omicron (B.1.1.529) strain with an IC50 of 5 g/ml. The antibody in Table 1 may be 58 or 222. These antibodies were found to strongly neutralize the omicron strain with an IC50 of 0.25 g/ml.
[0081] The 253H55L antibody is generated from the combination of antibody 253 and antibody 55. These antibodies individually were not the most potent antibodies identified. However, once the heavy chain from antibody 253, and the light chain from antibody 55 were combined, the resultant antibody unexpectedly had improved neutralisation and antigen-binding. For example, 253H55L conferred one of the greatest reductions in viral RNA levels in in vivo models of SARS-CoV-2 infection. Therefore, in a preferred embodiment, the antibody in Table 1 is 253H55L.
[0082] Hence, an antibody of the invention may comprise at least three CDRs of antibody 253H55L. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively.
[0083] Antibody 253H/165L was identified in a similar manner to 253H165L. It was surprisingly found that 253H/165L bound more strongly to SARS-CoV-2 than antibody 253 or antibody 165 alone (Table 3).
[0084] Accordingly, an antibody of the invention may comprise at least three CDRs of antibody 253H165L. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively.
[0085] Furthermore, it was identified that antibodies 253, 165 and 55 unexpectedly retained potent neutralisation of SARS-CoV-2 variants B.1.1.7 and B.1.351.
[0086] Accordingly, an antibody of the invention may comprise at least three CDRs of antibody 253, 165 or 55. In one embodiment, an antibody may comprise the heavy chain CDRs of antibody 253, 165 or 55, and the light chain CDRs of antibody 253, 165 or 55. In one embodiment, an antibody may comprise the light chain CDRs of a first antibody and the heavy chain CDRs of a second antibody, wherein the two antibodies were derived from the same public v-regions. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 65, 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively.
[0087] Antibody 222 was surprisingly found to retain strong neutralisation of the SARS-CoV-2 variants, Victoria, B.1.1.7, B.1.351 and P.1 strains, e.g. an IC50 of 0.02 g/ml against the Victoria, B.1.1.7, B.1.351 and P.1 strains (see Table 18). Accordingly, in one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively.
[0088] Interestingly, antibodies comprising the light chain of antibody 222 exhibited potent cross-lineage neutralisation effects, e.g. they are effective against all tested SARS-CoV-2 strains in the Examples (as shown in Table 18 and
[0089] Antibody 318 was surprisingly found to retain strong neutralisation of the SARS-CoV-2 variants, Victoria, B.1.1.7 and B.1.351. Accordingly, in one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively.
[0090] Antibody 316 was one of the most potent neutralising antibodies identified and was surprisingly found to retain strong neutralisation of the B.1.1.7 strain. Accordingly, in one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 325, 326 and 32, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 328, 329 and 330, respectively.
[0091] Antibodies 159, 384, 88, 40 and 253H55L are all highly potent neutralising mAbs, which have been shown to protect, prophylactically or therapeutically, in animal models.
[0092] Antibody 159 binds to the NTD of the spike protein and did not block ACE2 binding, but was unexpectedly one of the most potent neutralising antibodies observed. Prior art antibodies that co-localised to the NTD, in comparison, did not show appreciable neutralisation in the assays used herein. Antibody 159 has also been shown to have beneficial properties in animal models. Therefore, in a preferred embodiment, the antibody in Table 1 is 159.
[0093] Hence, an antibody of the invention may comprise at least three CDRs of antibody 159. For example, an antibody of the invention may comprise the CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. In one embodiment, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively.
[0094] Antibody 384 binds to a unique epitope of the RBD and is distinct from all previously reported binding modes, and was the most potently neutralising mAb described herein. The increased potency of antibody 384, when compared to other antibodies derived from the same v-region, is suggested to be due to the 18-residue long CDRH3 which forms an extended interaction across the ACE2 binding site of the RBD. Antibody 384 has also been shown to have beneficial properties in animal models. Therefore, in a preferred embodiment, the antibody in Table 1 is 384.
[0095] Hence, an antibody of the invention may comprise at least three CDRs of antibody 384. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 375, 376 and 377, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 378, 379 and 380, respectively.
[0096] In one embodiment, an antibody of the invention may comprise a CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 376 and 377, respectively, and a CDRL1 and CDRL3 set forth in SEQ ID NOs: 378 and 380, respectively.
[0097] Antibody 88 was one of the most potent neutralising antibodies discovered herein. Antibody 99 comprises an N-glycosylation site in CDRH1 that is not essential for RBD binding, but is essential for neutralisation. Antibody 88 has also been shown to have beneficial properties in animal models. Therefore, in a preferred embodiment, the antibody in Table 1 is 88.
[0098] Hence, an antibody of the invention may comprise at least three CDRs of antibody 88. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 105, 106 and 107, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 108, 109 and 110, respectively.
[0099] Antibody 40 comprises a heavy chain derived from the IGHV3-66 v-region and was one of the potent neutralizers identified herein. Antibody 40 has also been shown to have beneficial properties in animal models. Therefore, in a preferred embodiment, the antibody in Table 1 is 40.
[0100] Hence, an antibody of the invention may comprise at least three CDRs of antibody 40. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 28, 29 and 30, respectively.
[0101] Antibodies 58, 222, 253 and 253H/55L are mAbs that have been shown to neutralize the omicron strain.
[0102] Antibody 58 was unexpectedly one of the most potent neutralising antibodies observed against the omicron strain. Therefore, in a preferred embodiment, the antibody in Table 1 is 58.
[0103] Hence, an antibody of the invention may comprise at least three CDRs of antibody 58. For example, an antibody of the invention may comprise the CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 75, 76 and 77, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 78, 79 and 80, respectively.
[0104] Antibody 222 was one of the most potent neutralising antibodies observed against the omicron strain. Antibody 222 also potently neutralizes all other strains tested in Table 26. Therefore, in a preferred embodiment, the antibody in Table 1 is 222.
[0105] Hence, an antibody of the invention may comprise at least three CDRs of antibody 222. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively.
[0106] Antibody 253 was found to neutralize the omicron strain. Antibody 253 also potently neutralizes all other strains tested in Table 26. Therefore, in a preferred embodiment, the antibody in Table 1 is 253.
[0107] Hence, an antibody of the invention may comprise at least three CDRs of antibody 253. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively.
[0108] Antibody 253H/55L was found to neutralize the omicron strain. Antibody 253H/55L also potently neutralizes all other strains tested in Table 26. Therefore, in a preferred embodiment, the antibody in Table 1 is 253H/55L.
[0109] Hence, an antibody of the invention may comprise at least three CDRs of antibody 253h/55L. For example, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively.
[0110] The antibody of the invention may comprise at least four, five, or all six CDRs of an antibody in Table 1. The antibody may comprise at least one, at least two or all three heavy chain CDRs (CDRHs). The antibody may comprise at least one, at least two or all three light chain CDRs (CDRLs). The antibody typically comprises all six (i.e. three heavy and three light chain) CDRs.
[0111] The antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain amino acid sequence of an antibody in Table 1 (e.g. 253H/55L, 253H/165L, 222, 318, 165, 55, 159, 384, 88, 318 or 40).
[0112] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 150 (i.e. SEQ ID NO: 152).
[0113] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 158 (i.e. SEQ ID NO: 162).
[0114] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 253H55L (i.e. SEQ ID NO: 262).
[0115] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 222 (i.e. SEQ ID NO: 252).
[0116] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 58 (i.e. SEQ ID NO: 72). In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 318 (i.e. SEQ ID NO: 332).
[0117] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 165 (i.e. SEQ ID NO: 182).
[0118] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 55 (i.e. SEQ ID NO: 62).
[0119] In the embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 159 (i.e. SEQ ID NO: 172).
[0120] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 384 (i.e. SEQ ID NO: 372).
[0121] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 88 (i.e. SEQ ID NO: 102).
[0122] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 40 (i.e. SEQ ID NO: 22).
[0123] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the heavy chain variable domain of antibody 316 (i.e. SEQ ID NO: 322).
[0124] The antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain amino acid sequence of an antibody in Table 1 (e.g. 253H/55L, 253H/165L, 222, 318, 253, 165, 55, 159, 384, 88, 40 or 316).
[0125] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 150 (i.e. SEQ ID NO: 154).
[0126] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 158 (i.e. SEQ ID NO: 164).
[0127] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 253H55L (i.e. SEQ ID NO: 64).
[0128] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 253H165L (i.e. SEQ ID NO: 184).
[0129] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 222 (i.e. SEQ ID NO: 254).
[0130] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 253 (i.e. SEQ ID NO: 264).
[0131] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 58 (i.e. SEQ ID NO: 74).
[0132] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 318 (i.e. SEQ ID NO: 334).
[0133] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 253 (i.e. SEQ ID NO: 264).
[0134] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 159 (i.e. SEQ ID NO: 174).
[0135] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 384 (i.e. SEQ ID NO: 374).
[0136] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 88 (i.e. SEQ ID NO: 104).
[0137] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 40 (i.e. SEQ ID NO: 24).
[0138] In one embodiment, an antibody of the invention may comprise a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the light chain variable domain of antibody 316 (i.e. SEQ ID NO: 324).
[0139] The antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain amino acid sequence and light chain variable domain amino acid sequence, respectively, of an antibody in Table 1 (e.g. 253H/55L, 253H/165L, 222, 318, 253, 165, 55, 159, 384, 88, 40 or 316).
[0140] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 253H55L (SEQ ID NOs: 262 and 64, respectively).
[0141] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 253H165L (SEQ ID NOs: 262 and 184, respectively).
[0142] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 222 (SEQ ID NOs: 252 and 254, respectively).
[0143] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 58 (SEQ ID NOs: 72 and 74, respectively).
[0144] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 253 (SEQ ID NOs: 262 and 264, respectively).
[0145] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 318 (SEQ ID NOs: 332 and 334, respectively).
[0146] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 253 (SEQ ID NOs: 262 and 264, respectively).
[0147] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 165 (SEQ ID NOs: 182 and 184, respectively).
[0148] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 55 (SEQ ID NOs: 62 and 64, respectively).
[0149] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 159 (SEQ ID NOs: 172 and 174, respectively).
[0150] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 384 (SEQ ID NOs: 372 and 374, respectively).
[0151] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 88 (SEQ ID NOs: 102 and 104, respectively).
[0152] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 40 (SEQ ID NOs: 22 and 24, respectively).
[0153] In one embodiment, an antibody of the invention may comprise a heavy chain variable domain and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain and light chain variable domain, respectively, of antibody 316 (SEQ ID NOs: 322 and 324, respectively).
[0154] Alternatively, an antibody of the invention may comprise the light chain variable domain amino acid sequence from one antibody in Table 1 and the heavy chain variable domain amino acid sequence from another antibody in Table 1. Hence, an antibody of the invention may comprise: (a) a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain of a first antibody in Table 1; and (b) a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% of the light chain variable domain of a second antibody in Table 1.
[0155] In one embodiment, the first antibody in Table 1 is 253 and the second antibody in Table 1 is 55, resulting in the antibody 253H55L. In another embodiment, the first antibody in Table 1 is 253 and the second antibody in Table 1 is 165, resulting in the antibody 253H165L.
[0156] The first and/or second antibody in Table 1 may be derived from a major public v-region. The first and second antibodies in Table 1 may be derived from the same germline heavy chain v-region. The heavy chain v-region may be IGHV3-53, IGHV1-58 or IGHV3-66 (described further below).
[0157] For example, an antibody of the invention may comprise a heavy chain variable domain amino acid sequence having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the heavy chain variable domain from a first antibody in Table 1, and a light chain variable domain amino acid sequence having 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to the light chain variable domain from a second antibody in Table 1, wherein the first and second antibodies derive from the same germline heavy chain v-region, optionally wherein the heavy chain v-region is IGHV3-53, IGHV1-58 or IGHV3-66.
[0158] In one embodiment, the invention provides any one of the antibodies listed in Table 1, 21, 22, 23, 24 or 25.
[0159] An antibody of the invention may be or may comprise a modification from the amino acid sequence of an antibody in Table 1, whilst maintaining the activity and/or function of the antibody. The modification may a substitution, deletion and/or addition. For example, the modification may comprise 1, 2, 3, 4, 5, up to 10, up to 20, up to 30 or more amino acid substitutions and/or deletions from the amino acid sequence of an antibody in Table 1. For example, the modification may comprise an amino acid substituted with an alternative amino acid having similar properties. Some properties of the 20 main amino acids, which can be used to select suitable substituents, are as follows:
TABLE-US-00001 Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral Asp polar, hydrophilic, charged () Pro hydrophobic, neutral Glu polar, hydrophilic, charged () Gln polar, hydrophilic, neutral Phe aromatic, hydrophobic, neutral Arg polar, hydrophilic, charged (+) Gly aliphatic, neutral Ser polar, hydrophilic, neutral His aromatic, polar, hydrophilic, Thr polar, hydrophilic, neutral charged (+) Ile aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral Lys polar, hydrophilic, charged (+) Trp aromatic, hydrophobic, neutral Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic
[0160] The modification may comprise a derivatised amino acid, e.g. a labelled or non-natural amino acid, providing the function of the antibody is not significantly adversely affected.
[0161] Modification of antibodies of the invention as described above may be prepared during synthesis of the antibody or by post-production modification, or when the antibody is in recombinant form using the known techniques of site-directed mutagenesis, random mutagenesis, or enzymatic cleavage and/or ligation of nucleic acids.
[0162] Antibodies of the invention may be modified (e.g. as described above) to improve the potency of said antibodies or to adapt said antibodies to new SARS-CoV-2 variants. The modifications may be amino acid substitutions to adapt the antibody to substitutions in a virus variant. For example, the known mode of binding of an antibody to the spike protein (e.g. by crystal structure determination, or modelling) may be used to identify the amino acids of the antibody that interact with the substitution in the virus variant. This information can then be used to identify possible substitutions of the antibody that will compensate for the change in the epitope characteristics. For example, a substitution of a hydrophobic amino acid in the spike protein to a negatively changes amino acid may be compensated by substituting the amino acid from the antibody that interacts with said amino acid in the spike protein to a positively charged amino acid. Methods for identifying residues of an antibody that may be substituted are encompassed by the present disclosure, for example, by determining the structure of antibody-antigen complexes as described herein.
[0163] The antibodies of the invention may contain one or more modifications to increase their cross-lineage neutralisation property. For example, E484 of the spike protein, which is a key residue that mediates the interaction with ACE2, is mutated in some SARS-CoV-2 strains (e.g. Victoria strain which contains E484, but P.1 and B.1.351 strains contain E484K) resulting in differing neutralisation effects of the antibodies (see Example 24). Thus, antibodies that bind to E484 can be modified to compensate for the changes in E484 of the spike protein. For example, E484 is mutated from a positively charge to negatively charged amino acid in SAR-CoV-2 strains of B.1.351 or P.1 lineage. The amino acid residues of antibodies that bind to or near E484 may be mutated to compensate for the change in charge. Examples of such amino acid residues may be G104 and/or K108 in SEQ ID NO: 102 of antibody 88, or R52 in SEQ ID NO: 372 of antibody 384 (see Example 24).
[0164] Antibodies of the invention may be isolated antibodies. An isolated antibody is an antibody which is substantially free of other antibodies having different antigenic specificities.
[0165] The term antibody as used herein may relate to whole antibodies (i.e. comprising the elements of two heavy chains and two light chains inter-connected by disulphide bonds) as well as antigen-binding fragments thereof. Antibodies typically comprise immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. By specifically binds or immunoreacts with is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react with other polypeptides. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and at least one heavy chain constant region. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, Fab, Fab and F(ab)2 fragments, scFvs, and Fab expression libraries
[0166] An antibody of the invention may be a monoclonal antibody. Monoclonal antibodies (mAbs) of the invention may be produced by a variety of techniques, including conventional monoclonal antibody methodology, for example those disclosed in Monoclonal Antibodies: a manual of techniques (Zola H, 1987, CRC Press) and in Monoclonal Hybridoma Antibodies: techniques and applications (Hurrell J G R, 1982 CRC Press).
[0167] An antibody of the invention may be multispecific, such as bispecific, i.e. one arm of the body binds the spike protein of SARS-CoV-2, and the other arm binds a different antigen. In one embodiment, a bispecific antibody of the invention may bind to two separate epitopes on the spike protein. In one embodiment, a bispecific antibody of the invention binds to the NTD of the spike protein with one arm and to the RBD of the spike protein with another arm. In one embodiment, a bispecific antibody of the invention binds to two different antibodies on the RBD of the spike protein. In one embodiment, a bispecific antibody of the invention binds to different proteins with each arm. For example, one or more (e.g. two) antibodies of the invention can be coupled to form a multispecific (e.g. bispecific) antibody.
[0168] An antibody may be selected from the group consisting of single chain antibodies, single chain variable fragments (scFvs), variable fragments (Fvs), fragment antigen-binding regions (Fabs), recombinant antibodies, monoclonal antibodies, fusion proteins comprising the antigen-binding domain of a native antibody or an aptamer, single-domain antibodies (sdAbs), also known as VHH antibodies, nanobodies (Camelid-derived single-domain antibodies), shark IgNAR-derived single-domain antibody fragments called VNAR, diabodies, triabodies, Anticalins, aptamers (DNA or RNA) and active components or fragments thereof.
[0169] The constant region domains of an antibody molecule of the invention, if present, may be selected having regard to the proposed function of the antibody molecule, and in particular the effector functions which may be required. For example, the constant region domains may be human IgA, IgD, IgE, IgG or IgM domains. Typically, the constant regions are of human origin. In particular, human IgG (i.e. IgG1, IgG2, IgG3 or IgG4) constant region domains may be used. Typically, a human IgG1 constant region.
[0170] The light chain constant region may be either lambda or kappa.
[0171] Antibodies of the invention may be mono-specific or multi-specific (e.g. bispecific). A multi-specific antibody comprises at least two different variable domains, wherein each variable domain is capable of binding to a separate antigen or to a different epitope on the same antigen.
[0172] An antibody of the invention may be a chimeric antibody, a CDR-grafted antibody, a nanobody, a human or humanised antibody. Typically, the antibody is a human antibody. Fully human antibodies are those antibodies in which the variable regions and the constant regions (where present) of both the heavy and the light chains are all of human origin, or substantially identical to sequences of human origin, but not necessarily from the same antibody.
[0173] The antibody of the invention may be a full-length antibody. Hence, the invention also provides an antibody which is a full length antibody of any one of the antibodies in Tables 1 and 21 to 25. In other words, an antibody of the invention comprises a heavy chain variable domain and a light chain variable domain consisting of the heavy chain variable domain and light chain variable domain, respectively, of any one of the antibodies in Tables 1 and 21 to 25, and a IgG (e.g. IgG1) constant region. For example, the full-length antibody may be 222, 253H55L, 253H165L, 318, 253, 55, 165, 384, 159, 88, 40, 316, or 58.
[0174] The antibody of the invention may be an antigen-binding fragment. An antigen-binding fragment of the invention binds to the same epitope of the parent antibody, i.e. the antibody from which the antigen-binding fragment is derived. An antigen-binding fragment of the invention typically retains the parts of the parent antibody that interact with the epitope. The antigen-binding fragment typically comprise the complementarity-determining regions (CDRs) that interact with the antigen, such as one, two, three, four, five or six CDRs. In some embodiments, the antigen-binding fragment further comprises the structural scaffold surrounding the CDRs of the parent antibody, such as the variable region domains of the heavy and/or light chains. Typically, the antigen-binding fragment retains the same or similar binding affinity to the antigen as the parent antibody.
[0175] An antigen-binding fragment does not necessarily have an identical sequence to the parent antibody. In one embodiment, the antigen-binding fragment may have 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity with the respective CDRs of the parent antibody. In one embodiment, the antigen-binding fragment may have 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity with the respective variable region domains of the parent antibody. Typically, the non-identical amino acids of a variable region are not in the CDRs.
[0176] The antigen-binding fragments of antibodies of the invention retain the ability to selectively bind to an antigen. Antigen-binding fragments of antibodies include single chain antibodies (i.e. a full-length heavy chain and light chain); Fab, modified Fab, Fab, modified Fab, F(ab)2, Fv, Fab-Fv, Fab-dsFv, single domain antibodies (e.g. VH or VL or VHH), scFv.
[0177] An antigen-binding function of an antibody can be performed by fragments of a full-length antibody. The methods for creating and manufacturing these antibody fragments are well known in the art (see for example Verma R et al., 1998, J. Immunol. Methods, 216, 165-181).
[0178] Methods for screening antibodies of the invention that do not share 100% amino acid sequence identity with one of the antibodies disclosed herein, that possess the desired specificity, affinity and functional activity include the methods described herein, e.g. enzyme linked immunosorbent assays, biacore, focus reduction neutralisation assay (FRNT), and other techniques known within the art.
[0179] With regards to function, an antibody of the invention may be able to neutralize at least one biological activity of SAR-CoV-2 (a neutralising antibody), particularly to neutralize virus infectivity.
[0180] Neutralisation may also be determined using IC.sub.50 or IC.sub.90 values. For example, the antibody may have an IC.sub.50 value of 0.1 g/ml, 0.05 g/ml, 0.01 g/ml or 0.005 g/ml. In some instances an antibody of the invention may have an IC.sub.50 value of between 0.005 g/ml and 0.1 g/ml, sometimes between 0.005 g/ml and 0.05 g/ml or even between g/ml and 0.05 g/ml.
[0181] For example, the IC.sub.50 values of some of the antibodies of Table 1 are provided in Tables 3 and 9.
[0182] The ability of an antibody to neutralize virus infectivity may be measured using an appropriate assay, particularly using a cell-based neutralisation assay, as shown in the Examples. For example, the neutralisation ability may be measured in a focus reduction neutralisation assay (FRNT) where the reduction in the number of cells (e.g. human cells) infected with the virus (e.g. for 2 hours at 37 C.) in the presence of the antibody is compared to a negative control in which no antibodies were added.
[0183] The Examples show that the neutralisation activity may be influenced by N-glycosylation sequins (having a consensus sequence of N-X-S/T; X is any amino acid except proline) in the heavy chain variable region. In particular, it was shown that some of the Table 1 antibodies are potently inhibitory antibodies having a neutralisation IC50 of less than 0.1 g/ml, and mutations of these antibodies to remove the N glycan has a negative effect on neutralisation even though they could be de-glycosylated without denaturation or loss of RBD affinity.
[0184] In one embodiment, an antibody of the invention comprises an N-glycosylation sequon starting at position 35 (KABAT numbering, using EU Index) of the heavy chain variable region (having a consensus sequence of N-X-S/T). In one embodiment, an antibody of the invention comprises CDRH1 of antibody 88 as specified in SEQ ID NO: 105. In one embodiment, an antibody of the invention comprises CDRH1, CDRH2 and CDRH3 of antibody 88 as specified in SEQ ID NOs: 105, 106 and 107, respectively. In one embodiment, an antibody of the invention comprises the VH domain of antibody 88 as specified in SEQ ID NOs: 102.
[0185] In one embodiment, an antibody of the invention comprises an N-glycosylation sequon starting at positions 59 (KABAT numbering, using EU Index) of the heavy chain variable region (having a consensus sequence of N-X-S/T). In one embodiment, an antibody of the invention comprises CDRH1 of antibody 316 as specified in SEQ ID NO: 326 and extended so as to include the N-glycosylation sequon. In one embodiment, an antibody of the invention comprises CDRH1, CDRH2 and CDRH3 of antibody 316 as specified in SEQ ID NOs: 325, 326 and 327, respectively. In one embodiment, an antibody of the invention comprises the VH domain of antibody 316 as specified in SEQ ID NOs: 322.
[0186] In one embodiment, an antibody of the invention comprises an N-glycosylation sequon starting at positions 102 of the heavy chain variable region (having a consensus sequence of N-X-S/T). In one embodiment, an antibody of the invention comprises CDRH1 of antibody 253 as specified in SEQ ID NO: 267. In one embodiment, an antibody of the invention comprises CDRH1, CDRH2 and CDRH3 of antibody 253 as specified in SEQ ID NOs: 265, 266 and 267, respectively. In one embodiment, an antibody of the invention comprises the VH domain of antibody 253 as specified in SEQ ID NOs: 262.
[0187] An antibody of the invention may block the interaction between the spike protein of SAR-CoV-2 with the cell surface receptor, angiotensin-converting enzyme 2 (ACE2), of the target cell, e.g. by direct blocking or by disrupting the pre-fusion conformation of the spike protein.
[0188] Blocking of the interaction between spike and ACE2 can be total or partial. For example, an antibody of the invention may reduce spike-ACE2 formation by 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100%. Blocking of spike-ACE2 formation can be measured by any suitable means known in the art, for example, by ELISA.
[0189] Most antibodies showing neutralisation also showed blocking of the interaction between the spike protein and ACE2. (see
[0190] In terms of binding kinetics, an antibody of the invention may have an affinity constant (K.sub.D) value for the spike protein of SARS-CoV-2 of 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM or 0.1 nM. The K D values of some of the antibodies of Table 1 are provided in Tables 3 and 9.
[0191] The KD value can be measured by any suitable means known in the art, for example, by ELISA or Surface Plasmon Resonance (Biacore) at 25 C.
[0192] Binding affinity (K.sub.D) may be quantified by determining the dissociation constant (K.sub.d) and association constant (K.sub.a) for an antibody and its target. For example, the antibody may have an association constant (K.sub.a) of 10000 M.sup.1s.sup.1, 50000 M.sup.1s.sup.1, 100000 M.sup.1s.sup.1, 200000 M.sup.1s.sup.1 or 500000 M.sup.1s.sup.1 and/or a dissociation constant (K.sub.a) of 0.001 s.sup.1, 0.0005 s.sup.1, 0.004 s.sup.1, 0.003 s.sup.1, 0.002 s.sup.1 or 0.0001 s.sup.1. For example, see Table 3.
[0193] An antibody of the invention is preferably able to provide in vivo protection in coronavirus (e.g. SARS-CoV-2) infected animals. For example, administration of an antibody of the invention to coronavirus (e.g. SARS-CoV-2) infected animals may result in a survival rate of 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%. Survival rates may be determined using routine methods.
[0194] Antibodies of the invention may have any combination of one or more of the above properties.
[0195] Antibodies of the invention may bind to the same epitope as, or compete for binding to SARS-CoV-2 spike protein with, any one of the antibodies described herein (i.e. in particular with antibodies with the heavy and light chain variable regions described above). Methods for identifying antibodies binding to the same epitope, or cross-competing with one another, are used in the Examples and discussed further below.
[0196] An antibody may bind to the same epitope as or competes with antibody 159. Antibody 159 binds to the NTD of the spike protein. In one embodiment, the antibody of the invention binds the NTD such that it does not block ACE2 binding. In one embodiment, the antibody of the invention binds to an epitope comprising residues 144-147, 155-158 and 250-253 of the NTD (numbering of the NTD and RBD is based on the spike protein as a whole, as used herein, unless stated otherwise). All 3 CDRs of antibody 159 contribute to the binding footprint, whereas the light chain has little contact. Accordingly, in one embodiment, the antibody of the invention comprises CDRH1, CDRH2 and CDRH3 of antibody 159, as set forth in SEQ ID NOs: 175 to 177, respectively. In one embodiment, an antibody of the invention comprises the heavy chain variable region of antibody 159, as set forth in SEQ ID NO: 172.
[0197] An antibody of the invention may bind to the same epitope as or competes with antibody 45. In one embodiment, an antibody does not compete for binding with the potent neutralizer S309 0 Piccoli et al., 2020). In one embodiment, an antibody of the invention competes for binding to SARS-CoV-2 spike protein with antibody 45.
[0198] In one aspect, an antibody binds to the same epitope as or competes with antibody 384. The binding epitope of antibody 384 is unique among SARS-CoV-2 antibodies reported to date. This epitope comprises residues F104, L105, L455, F456 and G482 to F486 of the RBD domain, which are bound by the CDRH3 of antibody 384. In one embodiment, an antibody of the invention binds to this epitope using interactions from CDRH3 alone. In one embodiment, an antibody of the invention comprises CDRH3 of antibody 384, as set forth in SEQ ID NO: 377. In another embodiment, an antibody of the invention comprises CDRH2 and CDRH3 of antibody 384, as set forth in SEQ ID NOs: 376 and 377. Antibody 384 interacts with the spike protein through CDRH2 and CDRH3 of the heavy chain alone. In one embodiment, an antibody of the invention comprises CDRL1 of antibody 384, as set forth in SEQ ID NO: 378 and CDRL3 of antibody 384, as set forth in SEQ ID NOs: 380. In one embodiment, an antibody of the invention comprises CDRH2, CDRH3, CDRL1 and CDRL3 of antibody 384, as set forth in SEQ ID NOs: 376-378 and 380, respectively. Antibody 384 interacts with the spike protein through CDRH2, CDRH3, CDRL1 and CDRL3 of the antibody alone. In another aspect, an antibody binds to the same epitope as CDRH2 and CDRH3 of antibody 384. In a further embodiment, the an antibody of the invention does not contact the right chest of the RBD domain of the spike protein. In an embodiment, an antibody of the invention comprises the heavy chain CDRs set forth in SEQ ID NOs: 375, 376 and 377, and optionally, the light chain CDRs set forth in SEQ ID NOs: 378, 379 and 380. In another aspect, an antibody of the invention, W107 of CDRH3 makes strong -interactions with G485 of the RBD, Y59 of CDRH2 contacts V483 and makes bifurcated H-bonds to the carbonyl oxygen of G482 and amino nitrogen of E484 of RBD, which in turn salt-bridges with R52 and H-bonds to the side-chains of T57 and Y59. E484-F486 of RBD also form a two-stranded antiparallel (3-sheet with residues A92-A94 of CDRL3 and make stacking interactions from F486 to Y32 of CDRL1. The preponderance of main-chain RBD interactions may confer resilience to mutational escape.
[0199] The skilled person is readily able to determine the binding site (epitope) of an antibody using standard techniques, such as those described in the Examples of the application. The skilled person could also readily determine whether an antibody binds to the same epitope as, or competes for binding with, an antibody described herein by using routine methods known in the art.
[0200] For example, to determine if a test antibody (i.e. where it is not known whether the test antibody competes with other antibodies for binding to an antigen) binds to the same epitope as an antibody described herein (referred to a reference antibody in the following paragraphs), the reference antibody is allowed to bind to a protein or peptide under saturating conditions. Next, the ability of a test antibody to bind to the protein or peptide is assessed. If the test antibody is able to bind to the protein or peptide following saturation binding with the reference antibody, it can be concluded that the test antibody binds to a different epitope than the reference antibody. On the other hand, if the test antibody is not able to bind to protein or peptide following saturation binding with the reference antibody, then the test antibody may bind to the same epitope as the epitope bound by the reference antibody of the invention.
[0201] To determine if an antibody competes for binding with a reference antibody, the above-described binding methodology is performed in two orientations. In a first orientation, the reference antibody is allowed to bind to a protein/peptide under saturating conditions followed by assessment of binding of the test antibody to the protein/peptide molecule. In a second orientation, the test antibody is allowed to bind to the protein/peptide under saturating conditions followed by assessment of binding of the reference antibody to the protein/peptide. If, in both orientations, only the first (saturating) antibody is capable of binding to the protein/peptide, then it is concluded that the test antibody and the reference antibody compete for binding to the protein/peptide. As will be appreciated by the skilled person, an antibody that competes for binding with a reference antibody may not necessarily bind to the identical epitope as the reference antibody, but may sterically block binding of the reference antibody by binding an overlapping or adjacent epitope.
[0202] Two antibodies bind to the same or overlapping epitope if each competitively inhibits (blocks) binding of the other to the antigen. Alternatively, two antibodies have the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
[0203] Additional routine experimentation (e.g., peptide mutation and binding analyses) can then be carried out to confirm whether the observed lack of binding of the test antibody is in fact due to binding to the same epitope as the reference antibody or if steric blocking (or another phenomenon) is responsible for the lack of observed binding. Experiments of this sort can be performed using ELISA, RIA, surface plasmon resonance, flow cytometry or any other quantitative or qualitative antibody-binding assay available in the art.
[0204] As well as sequences defined by percentage identity or number of sequence changes, the invention further provides an antibody defined by its ability to cross-compete with one of the specific antibodies set out herein. It may be that the antibody also has one of the recited levels of sequence identity or number of sequence changes as well.
[0205] Cross-competing antibodies can be identified using any suitable method in the art, for example by using competition ELISA or BIAcore assays where binding of the cross competing antibody to a particular epitope on the spike protein prevents the binding of an antibody of the invention or vice versa. In one embodiment, the antibody produces 50%, 60%, 70%, 80%, 90% or 100% reduction of binding of the specific antibody disclosed herein.
[0206] The antibodies described below in the Examples may be used as reference antibodies.
[0207] Other techniques that may be used to determine antibody epitopes include hydrogen/deuterium exchange, X-ray crystallography and peptide display libraries (as described in the Examples). A combination of these techniques may be used to determine the epitope of the test antibody.
[0208] The approaches used herein could be applied equally to other data, e.g. surface plasmon resonance or ELISA, and provides a general way of rapidly determining locations from highly redundant competition experiments.
Fc Regions
[0209] An antibody of the invention may or may not comprise an Fc domain.
[0210] The antibodies of the invention may be modified in the Fc region in order to improve their stability. Such modifications are known in the art. Modifications may improve the stability of the antibody during storage of the antibody. The in vivo half-life of the antibody may be improved by modifications of the Fc-region.
[0211] For example, cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulphide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al., J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922 (1992)). Alternatively, an antibody can be engineered that has dual Fc regions and can thereby have enhanced complement lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989)).
[0212] For example, an antibody of the invention may be modified to promote the interaction of the Fc domain with FcRn. The Fc domain may be modified to improve the stability of the antibody by affecting Fc and FcRn interaction at low pH, such as in the endosome. The M252Y/S254T/T256E (YTE) mutation may be used to improve the half-life of an IgG1 antibody.
[0213] The antibody may be modified to affect the interaction of the antibody with other receptors, such as FcRI, FcRIIA, FcRIIB, FcRIII, and FcR. Such modifications may be used to affect the effector functions of the antibody.
[0214] In one embodiment, an antibody of the invention comprises an altered Fc domain as described herein below. In another preferred embodiment an antibody of the invention comprises an Fc domain, but the sequence of the Fc domain has been altered to modify one or more Fc effector functions.
[0215] In one embodiment, an antibody of the invention comprises a silenced Fc region. For example, in one embodiment an antibody of the invention does not display the effector function or functions associated with a normal Fc region. An Fc region of an antibody of the invention does not bind to one or more Fc receptors.
[0216] In one embodiment, an antibody of the invention does not comprise a CH.sub.2 domain. In one embodiment, an antibody of the invention does not comprise a CH.sub.3 domain. In one embodiment, an antibody of the invention comprises additional CH.sub.2 and/or CH.sub.3 domains.
[0217] In one embodiment, an antibody of the invention does not bind Fc receptors. In one embodiment, an antibody of the invention does not bind complement. In an alternative embodiment, an antibody of the invention does not bind FcR, but does bind complement.
[0218] In one embodiment, an antibody of the invention in general may comprise modifications that alter serum half-life of the antibody. Hence, in another embodiment, an antibody of the invention has Fc region modification(s) that alter the half-life of the antibody. Such modifications may be present as well as those that alter Fc functions. In one preferred embodiment, an antibody of the invention has modification(s) that alter the serum half-life of the antibody.
[0219] In one embodiment, an antibody of the invention may comprise a human constant region, for instance IgA, IgD, IgE, IgG or IgM domains. In particular, human IgG constant region domains may be used, especially of the IgG1 and IgG3 isotypes when the antibody molecule is intended for therapeutic uses where antibody effector functions are required. Alternatively, IgG2 and IgG4 isotypes may be used when the antibody molecule is intended for therapeutic purposes and antibody effector functions are not required.
[0220] In one embodiment, the antibody heavy chain comprises a CH.sub.1 domain and the antibody light chain comprises a CL domain, either kappa or lambda. In one embodiment, the antibody heavy chain comprises a CH.sub.1 domain, a CH.sub.2 domain and a CH.sub.3 domain and the antibody light chain comprises a CL domain, either kappa or lambda.
[0221] The four human IgG isotypes bind the activating Fc receptors (FcRI, FcRIIa, FcRIIc, FcRIIIa), the inhibitory FcRIIb receptor, and the first component of complement (C1q) with different affinities, yielding very different effector functions (Bruhns P. et al., 2009. Specificity and affinity of human Fc receptors and their polymorphic variants for human IgG subclasses. Blood. 113(16):3716-25), see also Jeffrey B. Stavenhagen, et al. Cancer Research 2007 Sep. 15; 67(18):8882-90. In one embodiment, an antibody of the invention does not bind to Fc receptors. In another embodiment of the invention, the antibody does bind to one or more type of Fc receptors.
[0222] In one embodiment the Fc region employed is mutated, in particular a mutation described herein. In one embodiment the Fc mutation is selected from the group comprising a mutation to remove or enhance binding of the Fc region to an Fc receptor, a mutation to increase or remove an effector function, a mutation to increase or decrease half-life of the antibody and a combination of the same. In one embodiment, where reference is made to the impact of a modification it may be demonstrated by comparison to the equivalent antibody but lacking the modification.
[0223] Some antibodies that selectively bind FcRn at pH 6.0, but not pH 7.4, exhibit a higher half-life in a variety of animal models. Several mutations located at the interface between the CH.sub.2 and CH.sub.3 domains, such as T250Q/M428L (Hinton P R. et al., 2004. Engineered human IgG antibodies with longer serum half-lives in primates. J Biol Chem. 279(8):6213-6) and M252Y/S254T/T256E+H433K/N434F (Vaccaro C. et al., 2005. Engineering the Fc region of immunoglobulin G to modulate in vivo antibody levels. Nat Biotechnol. 23(10):1283-8), have been shown to increase the binding affinity to FcRn and the half-life of IgG1 in vivo. Hence, modifications may be present at M252/5254/T256+H44/N434 that alter serum half-life and in particular M252Y/S254T/T256E+H433K/N434F may be present. In one embodiment, it is desired to increase half-life. In another embodiment, it may be actually desired to decrease serum half-life of the antibody and so modifications may be present that decrease serum half-life.
[0224] Numerous mutations have been made in the CH.sub.2 domain of human IgG1 and their effect on ADCC and CDC tested in vitro (Idusogie E E. et al., 2001. Engineered antibodies with increased activity to recruit complement. J Immunol. 166(4):2571-5). Notably, alanine substitution at position 333 was reported to increase both ADCC and CDC. Hence, in one embodiment a modification at position 333 may be present, and in particular one that alters ability to recruit complement. Lazar et al. described a triple mutant (S239D/I332E/A330L) with a higher affinity for FcRIIIa and a lower affinity for FcRIIb resulting in enhanced ADCC (Lazar G A. et al., 2006). Hence, modifications at S239/I332/A330 may be present, particularly those that alter affinity for Fc receptors and in particular S239D/I332E/A330L. Engineered antibody Fc variants with enhanced effector function. PNAS 103(11): 4005-4010). The same mutations were used to generate an antibody with increased ADCC (Ryan M C. et al., 2007. Antibody targeting of B-cell maturation antigen on malignant plasma cells. Mol. Cancer Ther., 6: 3009-3018). Richards et al. studied a slightly different triple mutant (S239D/I332E/G236A) with improved FcRIIIa affinity and FcRIIa/FcRIIb ratio that mediates enhanced phagocytosis of target cells by macrophages (Richards J O et al 2008. Optimization of antibody binding to Fcgamma RIIa enhances macrophage phagocytosis of tumor cells. Mol Cancer Ther. 7(8):2517-27). In one embodiment, S239D/I332E/G236A modifications may be therefore present.
[0225] In another embodiment, an antibody of the invention may have a modified hinge region and/or CH.sub.1 region. Alternatively, the isotype employed may be chosen as it has a particular hinge regions.
SARS-CoV-2 Variants
[0226] The B.1.1.7 variant was first identified in a sequence taken from a patient at the end of September 2020 (Rambaut et al., 2020). The variant has rapidly become dominant in many areas of the UK which has coincided with a rapid increase of infections during the second wave of the pandemic, with cases and hospitalizations in excess of those seen during the first phase. The B.1.1.7 variant is estimated to be 30-60% more infectious than strains encountered in the first wave (Walker et al., 2021) and able to overcome public health efforts to contain infection.B.1.1.7 contains a total of 9 changes in the spike protein: residues 69-70 are deleted, 144 is deleted, N501Y, A570D, D614G, P681H, T716I, S982A and D1118H of which the N501Y is potentially of the greatest concern as it has the potential to increase RBD/ACE2 affinity whilst also disrupting the binding of potent neutralizing antibodies (
[0227] The B.1.351 variant has acquired mutations in the ACE2-interactive surface of the RBD at positions K417N, E484K and N501Y. B.1.351 has 10 changes relative to the Wuhan sequence: L18F, D80A, D215G, L242-244 deleted, R246I, K417N, E484K, N501Y, D614G, A701V. The 501Y.V2 variant has acquired mutations in the ACE2-interactive surface of the RBD at positions K417T, E484K and N501Y.
[0228] The B.1.617.2 (delta) variant has acquired the mutations L452R, T478K in the RBDrelative to the Wuhan sequence. The B.1.1.529 (omicron) variant has acquired the mutations G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H relative to the Wuhan sequence.
[0229] Where not otherwise specified herein, the strain referred to is SARS-CoV-2/human/AUS/VIC01/2020 (see Example 13, FRNT assay). This strain is an early strain related to the original Wuhan strain hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124) and differs in a single amino acid.
[0230] It has been discovered that serum recovered from convalescent samples from patients in the first wave of COVID19 is less effective at neutralising variant strains. For example, convalescent serum was found to be 3-fold less effective against the B.1.1.7 variant when compared to the Victoria strain used herein and 13.3-fold less effective against the B.1.351 variant when compared to the Victoria strain. Serum from subjects vaccinated with the Pfizer and AstraZeneca vaccines was found to be 3-fold less-effective against the B.1.1.7 variant and 7.6-fold and 9-fold less effective against the B.1.351 variant, when compared to the Victoria strain. Accordingly, it is expected that antibodies are less effective than these variants.
[0231] However, the inventors have surprisingly discovered that a number of antibodies described herein retain their neutralisation potency against the UK Kent (B.1.1.7) variant and the South Africa (B.1.351) variant. The neutralisation IC50s of the highly potent mAbs identified herein, against the variant strains, are shown in
[0232] Accordingly, in one embodiment, an antibody of the invention comprises at least 3, 4, 5 or all 6 of the CDRs of an antibody shown in Tables 12 or 16A. In one embodiment, an antibody of the invention retains strong neutralisation against the B.1.1.7 and/or the B.1.351 strain (such as less than a 10 fold drop in the IC50). In one embodiment, an antibody of the invention retains strong neutralisation against the B.1.1.7, the B.1.351 and/or the P.1 strain (such as less than a 10 fold drop in the IC50). A fold drop in the IC50 can be calculated by comparison to the IC50 of a reference strain, such as the Victoria strain tested used herein.
Major Public V Regions
[0233] Public V-regions, also described as public V-genes herein, are the V regions of the germline heavy chain and light chain regions that are found in a large proportion of the population. That is to say, many individuals share the same public v-regions in their germline v-region repertoire.
[0234] As used herein, an antibody derived from a specific v-region refers to antibodies that were generated by V(D)J recombination using that germline v-region sequence. For example, the germline IGHV3-53 v-region sequence may undergo somatic recombination and somatic mutation to arrive at an antibody that specifically binds to the spike protein of SARS-CoV-2. The nucleotide sequence encoding the antibody may no longer comprise a sequence identical to the IGHV3-53 germline sequence, nevertheless, the antibody is still derived from this v-region. An antibody of the invention typically comprises no more than 20 non-silent mutations in the v-region, when compared to the germline sequence, such as no more than 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 non-silent mutations. Germline v-region sequences are well known in the art, and methods of identifying whether a certain region of an antibody is derived from a particular germline v-region sequence are also well known in the art.
[0235] In one embodiment, an antibody of the invention derives from a v-region selected from IGHV3-53, IGHV1-58 and IGHV3-66. The inventors found that the potent neutralising antibodies identified herein comprised relatively few mutations in the CDRs of these v-regions. Thus, in one embodiment, an antibody of the invention encoded by a v-region selected from IGHV3-53, IGHV1-58 and IGHV3-66 and having 3-10 non-silent amino acid mutations, or 2-5 non-silent mutations, such as 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less 3 or less or 2 non-silent mutations when compared to the naturally occurring germline sequence.
[0236] In one embodiment, an antibody of the invention comprises the CDRs of an heavy chain variable domain of an antibody derived from a major public v-region selected from IGHV3-53, IGHV1-58 and IGHV3-66, such as antibodies 150, 158, 175, 222 and 269 for IGHV3-53, antibodies 55, 165, 253 and 318 for IGHV1-58, and antibodies 40 and 282 for IGHV3-66. The SEQ ID NOs corresponding to the CDRs of each of these antibodies are shown in Table 1.
[0237] In one embodiment, an antibody of the invention comprises the heavy chain variable domain of an antibody derived from a major public v-region selected from IGHV3-53, IGHV1-58 and IGHV3-66, such as antibodies 150, 158, 175, 222 and 269 for IGHV3-53, antibodies 55, 165, 253 and 318 for IGHV1-58, and antibodies 40 and 282 for IGHV3-66. The SEQ ID NOs corresponding to the heavy chain variable domains of each of these antibodies are shown in Table 1.
[0238] In a preferred embodiment, an antibody of the invention comprises the heavy chain CDRs 1-3 set forth in SEQ ID NOs: 265 to 267, respectively. In another embodiment, an antibody comprises the heavy chain variable domain of antibody 253 set forth in SEQ ID NO: 262.
[0239] There is a close association between potent neutralizers and public V-genes suggesting that vaccination responses should be strong (Yuan et al., 2020b). Three public V-region genes are represented at least twice in the set of 21, i) IGHV3-53: mAbs 150, 158, 175, 222 and 269, ii) IGHV1-58: 55, 165, 253 and 318 and iii) IGHV3-66: 282 and 40. In all cases the potent binders focus around the neck cluster, often with binding pose determined by the H1 and H2 loops. By switching light chains within these sets, antibody 253 could improve functionally by an order of magnitude by using an alternate light chain to achieve better hydrophobic interactions with the key bridging region identified, E484-F486. The most highly potent mAb, 384, adopts a unique pose, with a footprint extending from the left shoulder epitope across to the neck epitope via an extended H3.
[0240] Five of the potent monoclonal antibodies used herein (150, 158, 175, 222 and 269), belong to the VH3-53 family and a further 2 (282 and 40) belong to the almost identical VH3-66. Accordingly, embodiments related to the VH3-53 family may equally apply to the VH3-66 family.
[0241] As shown in
[0242] In on embodiment, an antibody comprises a heavy chain variable domain sequence derived from a V-region selected from: IGHV1-58, IGHV1-18 or IGHV3-9; and/or a light chain variable domain sequence derived from a V-region selected from: IGV3-20, IG 3-21, or IG1-39 or 1D-39. Antibodies derived from these regions (e.g. antibody 55, 58, 165, 253, 278 and 318) have shown to be particularly effective in cross-lineage neutralisation effects (e.g. against both Victoria and B.1.351 strains) and have good binding affinity to spike protein (see Table 16A).
[0243] Furthermore, and as described in the examples, it has been surprisingly shown that antibodies derived from particular public V-regions are able to maintain or improve neutralisation against the B.1.1.7 and/or B.1.351 strains when compared to the Victoria strain. In particular, an antibody of the invention is derived from a IGHV1-58 v-region (antibodies 55, 165, 253 and 318). In one embodiment, the light chains of an antibody with a heavy chain derived from IGHV1-58 may be exchanged with the light chain of a second antibody also derived from the same heavy chain V-region. When exchanging the chains of antibodies, the light chain and heavy chain of each antibody are preferably derived from the same V-regions. For example, antibodies 55, 165 and 253 all have heavy chains derived from the IGHV1-58 v-region, and light chains derived from Kappa 3-20. It is shown herein that combining the light chains of 55 or 165 with the heavy chain of 253 leads to a >1 log increase in neutralization titres. Other combinations may be envisaged as the structures of 253 and of 253/55 and 253/165 with either RBD or Spike show that they bind almost identically to the same epitope and don't contact any of the three mutation site residues in the B.1.351 variant.
[0244] Accordingly, in one embodiment, the invention provides a method of generating an antibody that binds specifically to the spike protein of SARS-CoV-2 (e.g. a SARS-CoV-2 strain of the B.1.351 lineage), the method comprising identifying two or more antibodies derived from the same light chain and/or heavy chain v-regions, replacing the light chain of a first antibody with the light chain of a second antibody, to thereby generate a mixed-chain antibody comprising the heavy chain of the first antibody and the light chain of the second antibody. In one embodiment, the method further comprises determining the affinity for and/or neutralisation of SARS-CoV-2 of the mixed-chain antibody. The method may further comprise comparing the affinity of the mixed-chain antibody with that of the first and/or second antibodies. The method may further comprise selecting a mixed chain antibody that has the same or greater affinity than the first and/or second antibodies. In some embodiments, the heavy chain v-region is IGHV 1-58 and/or the light chain v-region is IGLV Kappa 3-20.
[0245] In one embodiment, the antibody of the invention comprises at least three CDRs of antibody 222. A number of the antibodies identified herein use the public HC V-region IGHV3-53. Four of these, 150, 158, 175 and 269, have their neutralization and binding abilities against the B.1.351 variant severely compromised or abolished. However, antibody 222 is an exception, since its binding is unaffected by the B.1.351 variant. The family of IGHV3-53 antibodies bind at the same epitope at the back of the neck of the RBD with very similar approach orientations also shared by the IGHV3-66 Fabs. The majority of these make direct contacts to K417 and N501, but none of them contact E484. The rather short HC CDR3s of these Fabs are usually positioned directly above K417, making hydrogen bonds or salt bridges as well as hydrophobic interactions, while N501 interacts with the LC CDR-1 loop. MAb 150 is a little different, forming both a salt-bridge between K417 and the LC CDR3 D92 and a H-bond between N501 and S30 in the LC CDR1 (
[0246] Surprisingly, the neutralisation of antibodies 150, 158, 175 and 269 against the B.1.1.7, B.1.351 and/or P.1 variants can be restored by switching the original light chain of antibodies 150, 158, 175 and 269 with the light chain of 222. As described in the Examples, the CDRH3 of the IGHV3-53-derived antibodies makes a relatively weak contact with the RBD.
[0247] Accordingly, an antibody of the invention comprises: (i) the CDRL1, CDRL2 and CDRL3 of antibody 222 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively; and (ii) the CDRH1 and CDRH2 independently selected from any one of the antibodies consisting of: 150, 158, 175, 269, 40 and 398. The antibody may optionally further comprise the CDRH3 of any one of the antibodies selected from: 150, 158, 175, 269, 40 and 398. In one embodiment, the CDRH1 and CDRH2 are independently selected from: 150, 158, 175 and 269, most preferably 150, 158.
[0248] Based on sequence similarity between antibodies 150, 158, 175, 269, 40 and 398, a consensus sequence for CDRH1 and CDRH2 of the antibody may be obtained as follows:
TABLE-US-00002 CDRH1: (SEQIDNO:407) G-X.sup.1-T-C-X.sup.2-X.sup.3-N-Y CDRH2: (SEQIDNO:408) I-Y-X.sup.4-G-G-X.sup.5-T
X.sup.n may be any amino acid. X.sup.1 is preferably non-polar, more preferably L, V or F, most preferably L or V. X.sup.2 is preferably a polar side chain, more preferably S or N, most preferably S. X.sup.3 is preferably a polar or charged side chain, more preferably, S or R, most preferably S. X.sup.4 is preferably a polar or non-polar side chain, more preferably S or P. X.sup.5 is preferably a non-polar side chain, more preferably S or T. Accordingly, an antibody of the invention may comprise a CDRH1 and CDRH2 according to the consensus sequence, for example, in combination with the CDRL1, CDRL2 and CDRL3 of antibody 222.
[0249] Based on the known CDR sequences of antibodies derived from the same public v-regions, together with structural data showing the interactions between said antibodies and the viral spike protein, a consensus sequence for the CDRs from antibodies 55, 165 and 253 may be obtained, as follows:
TABLE-US-00003 CDRH1: (SEQIDNO:401) G-F-T-F-T-X1-S-A CDRH2: (SEQIDNO:402) I-V-V-G-S-G-N-T CDRH3: (SEQIDNO:403) A-A-P-X2-C-X3-X4-S/T-C-X5-D-X6-F-D-I CDRL1: (SEQIDNO:404) Q-S-V-X7-S-S-Y CDRL2: (SEQIDNO:405) G-A-S CDRL3: (SEQIDNO:406) Q-Q-Y-G-S-S-P-X8-T
[0250] X1-X8 may be any amino acid. X1 is preferably a polar amino acid or is S or T. The structural data provided in
[0251] Hence, an antibody of the invention may comprise at least three CDRs of the consensus sequence as defined in the previous paragraph, i.e. as selected from SEQ ID NOs: 401 to 406. For example, the antibody may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 401, 402 and 403, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 404, 405 and 406, respectively. Such antibodies have effective cross-lineage neutralisation effects, e.g. against the Victoria, B.1.1.7 and B.1.351 strains described herein.
[0252] Furthermore, it is envisaged that although it is plausible that any antibody comprising the consensus CDRs are effective against SARS-CoV-2, the skilled person can readily screen for antibodies having the desired effect. Thus, the invention also comprises methods for screening said antibodies using any method known to the skilled person, such as those described herein.
Mixed Chain Antibodies
[0253] An antibody of the invention may comprise a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a first antibody in Table 1 and a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a second antibody in Table 1. Such antibodies are referred to as mixed chain antibodies or chimeric antibodies herein. Examples of the mixed chain antibodies are provided in Tables 21 to 25. The mixed chain antibodies have particularly potent cross-lineage neutralisation effects, as demonstrated in the Examples.
[0254] Hence, in one embodiment, an antibody of the invention comprises a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1. The antibody may comprise a heavy chain variable domain amino acid sequence having at least 80% sequence identity to the heavy chain variable domain from a first antibody in Table 1, and a light chain variable domain amino acid sequence having at least 80% sequence identity to the light chain variable domain from a second antibody in Table 1.
[0255] The first and second antibodies in Table 1 may be derived from the same germline heavy chain or light chain v-region. For example, the heavy chain v-region may be IGHV3-53, IGHV1-58 or IGHV3-66. The light chain v-region may be IGV3-20 or IGV1-9. In one embodiment, the first antibody is 150 and the second antibody is 222. In another embodiment, the first antibody is 253 and the second antibody is 55. In another embodiment, the first antibody is 253 and the second antibody is 165.
[0256] In one embodiment, the second antibody is 222. Hence, in one embodiment, the CDRL1, CDRL2 and CDRL3 have the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively.
[0257] It was unexpectedly found that the light chain of antibody 222 could act as a universal light chain when combined with the heavy chain of another antibody in Table 1, such as an antibody derived from IGHV3-53 or IGHV3-66. The 222 light chain was able to cause the resultant mixed chain antibody to bind to and neutralize SARS-CoV-2 strains that would otherwise not have been bound or neutralised by the parent antibody of the heavy chain.
[0258] In particular, it was found that by combing the light chain of antibody 222 with the heavy chain of another antibody derived from IGHV3-53 (e.g. antibodies 150, 158, 175 and 269), the resultant mixed chain antibodies showed increased neutralisation when compared to a parent antibody. For example, by combining the 222 light chain with the 175 or 269 heavy chain, the resultant mixed chain antibodies had increased neutralisation effects against the B.1.1.7 variant (see Table 18 and
[0259] Due to the similarity between IGHV3-53 and IGHV3-66, it is expected that similar results would be achieved by combining the light chain of antibody 222 with the heavy chains from antibodies derived from IGHV3-53 or IGHV3-66.
[0260] It appears however that the heavy chain of 222 may not be useful as a universal heavy chain for the IGH3-53 antibodies because the modelling studies in Example 33 show that when the light chains of the VH3-53 mAbs (e.g. 348 150, 158, 175 and 269) were docked onto the heavy chain of antibody 222, there may be some steric clashes (see
[0261] The antibody may comprise a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, wherein the first and second antibodies are derived from the same germline heavy chain IGHV3-53. Hence, the first or second Table 1 antibody may be selected from 150, 158, 175, 222 and 269.
[0262] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 150H222L. This antibody has potent cross-lineage neutralisation effects, e.g. it is effective against all tested SARS-CoV-2 strains in the Examples (as shown in Table 18 and
[0263] In one embodiment, the first antibody may be 158 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 165, 166 and 167, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 162 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 162 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 158H222L. This antibody has potent cross-lineage neutralisation effects, e.g. it is effective against all tested SARS-CoV-2 strains in the Examples (as shown in Table 18 and
[0264] In one embodiment, the first antibody may be 175 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 205, 206 and 207, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 202 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 202 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 175H222L. This antibody is capable of exhibiting potent cross-lineage neutralisation effects, e.g. it is effective against the Victoria strain and B.1.1.7 strain (see
[0265] In one embodiment, the first antibody may be 269 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 275, 276 and 277, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 272 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 272 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 269H222L. This antibody is capable of exhibiting potent cross-lineage neutralisation effects, e.g. it is effective against the Victoria strain and B.1.1.7 strain (see
[0266] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 150H158L.
[0267] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 150H175L.
[0268] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 150H269L.
[0269] In one embodiment, the first antibody may be 158 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 165, 166 and 167, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 162 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 162 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 158H150L.
[0270] In one embodiment, the first antibody may be 158 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 165, 166 and 167, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 162 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 162 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 158H175L.
[0271] In one embodiment, the first antibody may be 158 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 165, 166 and 167, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 162 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 162 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 158H269L.
[0272] In one embodiment, the first antibody may be 175 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 205, 206 and 207, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 202 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 202 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 175H150L.
[0273] In one embodiment, the first antibody may be 175 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 205, 206 and 207, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 202 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 202 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 175H158L.
[0274] In one embodiment, the first antibody may be 175 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 205, 206 and 207, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 202 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 202 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 175H269L.
[0275] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 222H150L.
[0276] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 222H158L.
[0277] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 222H175L.
[0278] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 222H269L.
[0279] In one embodiment, the first antibody may be 269 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 275, 276 and 277, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 272 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 272 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 269H150L.
[0280] In one embodiment, the first antibody may be 269 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 275, 276 and 277, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 272 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 272 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 269H158L.
[0281] In one embodiment, the first antibody may be 269 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 275, 276 and 277, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 272 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 272 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 269H175L.
[0282] Furthermore, due to the similarity between IGHV3-53 and IGHV3-66, swapping the light chain and heavy chain of these antibodies may generate antibodies useful for the invention. Hence, an antibody of the invention may comprise a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, wherein the first and second antibodies are derived from either the germline heavy chain IGHV3-53 or IGHV3-66. Hence, the first or second Table 1 antibody may be selected from 150, 158, 175, 222, 269, 40, 398.
[0283] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 40 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 28, 29 and 30, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 24. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 24, i.e. the antibody is 150H40L.
[0284] In one embodiment, the first antibody may be 150 from Table 1 and the second antibody may be 398 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 155, 156 and 157, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 398, 399 and 400, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 394. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 152 and a light chain variable domain consisting of SEQ ID NO: 394, i.e. the antibody is 150H398L.
[0285] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 40H150L.
[0286] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 40H158L.
[0287] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 40H175L.
[0288] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 40H222L.
[0289] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 40H269L.
[0290] In one embodiment, the first antibody may be 40 from Table 1 and the second antibody may be 398 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 25, 26 and 27, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 398, 399 and 400, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 394. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 22 and a light chain variable domain consisting of SEQ ID NO: 394, i.e. the antibody is 40H398L.
[0291] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 150 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 158, 159 and 160, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 154, i.e. the antibody is 398H150L.
[0292] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 158 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 168, 169 and 170, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 164. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 164, i.e. the antibody is 398H158L.
[0293] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 175 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 208, 209 and 210, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 204. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 204, i.e. the antibody is 398H175L.
[0294] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 398H222L.
[0295] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 269 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 278, 279 and 280, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 274. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 274, i.e. the antibody is 398H269L.
[0296] In one embodiment, the first antibody may be 398 from Table 1 and the second antibody may be 40 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 395, 396 and 397, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 28, 29 and 30, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 392 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 24. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 392 and a light chain variable domain consisting of SEQ ID NO: 24, i.e. the antibody is 398H40L.
[0297] The antibody may comprise a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, wherein the first and second antibodies are derived from the same germline light chain IGV3-20. Hence, the first or second Table 1 antibody may be selected from 55, 159, 165, 222, 253 and 318.
[0298] In one embodiment, the first antibody may be 55 from Table 1 and the second antibody may be 159 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 65, 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 62 and a light chain variable domain consisting of SEQ ID NO: 174, i.e. the antibody is 55H159L.
[0299] In one embodiment, the first antibody may be 55 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 62 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 55H222L.
[0300] In one embodiment, the first antibody may be 159 from Table 1 and the second antibody may be 55 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 172 and a light chain variable domain consisting of SEQ ID NO: 64, i.e. the antibody is 159H55L.
[0301] In one embodiment, the first antibody may be 159 from Table 1 and the second antibody may be 165 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 184. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 172 and a light chain variable domain consisting of SEQ ID NO: 184, i.e. the antibody is 159H165L.
[0302] In one embodiment, the first antibody may be 159 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 172 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 159H222L.
[0303] In one embodiment, the first antibody may be 159 from Table 1 and the second antibody may be 253 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 264. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 172 and a light chain variable domain consisting of SEQ ID NO: 264, i.e. the antibody is 159H253L.
[0304] In one embodiment, the first antibody may be 159 from Table 1 and the second antibody may be 318 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 175, 176 and 177, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 334. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 172 and a light chain variable domain consisting of SEQ ID NO: 334, i.e. the antibody is 159H318L.
[0305] In one embodiment, the first antibody may be 165 from Table 1 and the second antibody may be 159 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 182 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 182 and a light chain variable domain consisting of SEQ ID NO: 174, i.e. the antibody is 165H159L.
[0306] In one embodiment, the first antibody may be 165 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 182 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 182 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 165H222L.
[0307] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 55 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 64, i.e. the antibody is 222H55L.
[0308] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 159 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 174, i.e. the antibody is 222H159L.
[0309] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 165 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 184. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 184, i.e. the antibody is 222H165L.
[0310] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 253 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 264. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 264, i.e. the antibody is 222H253L.
[0311] In one embodiment, the first antibody may be 222 from Table 1 and the second antibody may be 318 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 255, 256 and 257, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 252 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 334. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 252 and a light chain variable domain consisting of SEQ ID NO: 334, i.e. the antibody is 222H318L.
[0312] In one embodiment, the first antibody may be 253 from Table 1 and the second antibody may be 159 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 262 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 262 and a light chain variable domain consisting of SEQ ID NO: 174, i.e. the antibody is 253H159L.
[0313] In one embodiment, the first antibody may be 253 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 262 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 262 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 253H222L.
[0314] In one embodiment, the first antibody may be 318 from Table 1 and the second antibody may be 159 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 178, 179 and 180, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 332 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 332 and a light chain variable domain consisting of SEQ ID NO: 174, i.e. the antibody is 318H159L.
[0315] In one embodiment, the first antibody may be 318 from Table 1 and the second antibody may be 222 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 258, 259 and 260, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 332 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 254. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 332 and a light chain variable domain consisting of SEQ ID NO: 254, i.e. the antibody is 318H222L.
[0316] The antibody may comprise a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, wherein the first and second antibodies are derived from the same germline light chain IGV1-9. Hence, the first or second Table 1 antibody may be selected from 150, 158 and 269.
[0317] The antibody may comprise a heavy chain variable domain comprising CDRH1, CDRH2 and CDRH3 from a first antibody in Table 1 and a light chain variable domain comprising CDRL1, CDRL2 and CDRL3 from a second antibody in Table 1, wherein the first and second antibodies are derived from the same germline heavy chain IGHV1-58. Hence, the first or second Table 1 antibody may be selected from 55, 165, 253 and 318.
[0318] In one embodiment, the first antibody may be 253 from Table 1 and the second antibody may be 55 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 262 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 262 and a light chain variable domain consisting of SEQ ID NO: 64, i.e. the antibody is 253H55L. This antibody has potent cross-lineage neutralisation effects, e.g. it is effective against all tested SARS-CoV-2 strains in the Examples (as shown in Table 18 and
[0319] In one embodiment, the first antibody may be 253 from Table 1 and the second antibody may be 165 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 262 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 186. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 262 and a light chain variable domain consisting of SEQ ID NO: 186, i.e. the antibody is 253H165L. This antibody has potent cross-lineage neutralisation effects, e.g. it is effective against all tested SARS-CoV-2 strains in the Examples (as shown in Table 18 and
[0320] In one embodiment, the first antibody may be 55 from Table 1 and the second antibody may be 165 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 184. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 62 and a light chain variable domain consisting of SEQ ID NO: 184, i.e. the antibody is 55H165L.
[0321] In one embodiment, the first antibody may be 55 from Table 1 and the second antibody may be 253 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 264. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 62 and a light chain variable domain consisting of SEQ ID NO: 264, i.e. the antibody is 55H253L.
[0322] In one embodiment, the first antibody may be 55 from Table 1 and the second antibody may be 318 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 65, 66 and 67, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 334. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 62 and a light chain variable domain consisting of SEQ ID NO: 334, i.e. the antibody is 55H318L.
[0323] In one embodiment, the first antibody may be 165 from Table 1 and the second antibody may be 55 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 182 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 182 and a light chain variable domain consisting of SEQ ID NO: 62, i.e. the antibody is 165H55L.
[0324] In one embodiment, the first antibody may be 165 from Table 1 and the second antibody may be 253 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 182 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 264. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 182 and a light chain variable domain consisting of SEQ ID NO: 264, i.e. the antibody is 165H253L.
[0325] In one embodiment, the first antibody may be 165 from Table 1 and the second antibody may be 318 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 185, 186 and 187, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 182 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 334. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 182 and a light chain variable domain consisting of SEQ ID NO: 334, i.e. the antibody is 165H318L.
[0326] In one embodiment, the first antibody may be 253 from Table 1 and the second antibody may be 318 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 265, 266 and 267, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 338, 339 and 340, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 262 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 334. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 262 and a light chain variable domain consisting of SEQ ID NO: 334, i.e. the antibody is 253H318L.
[0327] In one embodiment, the first antibody may be 318 from Table 1 and the second antibody may be 55 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 68, 69 and 70, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 332 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 332 and a light chain variable domain consisting of SEQ ID NO: 64, i.e. the antibody is 318H55L.
[0328] In one embodiment, the first antibody may be 318 from Table 1 and the second antibody may be 165 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 188, 189 and 190, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 332 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 184. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 332 and a light chain variable domain consisting of SEQ ID NO: 184, i.e. the antibody is 318H165L.
[0329] In one embodiment, the first antibody may be 318 from Table 1 and the second antibody may be 253 from Table 1. Hence, an antibody of the invention may comprise a CDRH1, CDRH2 and CDRH3 having the amino acid sequences specified in SEQ ID NOs: 335, 336 and 337, respectively, and a CDRL1, CDRL2 and CDRL3 having the amino acid sequences specified in SEQ ID NOs: 268, 269 and 270, respectively. The antibody may comprise a heavy chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 332 and a light chain variable domain having 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 264. The antibody may comprise a heavy chain variable domain consisting of SEQ ID NO: 332 and a light chain variable domain consisting of SEQ ID NO: 264, i.e. the antibody is 318H253L.
Antibody Conjugates
[0330] The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate). Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein-coupling agents known in the art.
[0331] An antibody, of the invention may be conjugated to a molecule that modulates or alters serum half-life. An antibody, of the invention may bind to albumin, for example in order to modulate the serum half-life. In one embodiment, an antibody of the invention will also include a binding region specific for albumin. In another embodiment, an antibody of the invention may include a peptide linker which is an albumin binding peptide. Examples of albumin binding peptides are included in WO2015/197772 and WO2007/106120 the entirety of which are incorporated by reference.
Polynucleotides, Vectors and Host Cells
[0332] The invention also provides one or more isolated polynucleotides (e.g. DNA) encoding the antibody of the invention. In one embodiment, the polynucleotide sequence is collectively present on more than one polynucleotide, but collectively together they are able to encode an antibody of the invention. For example, the polynucleotides may encode the heavy and/or light chain variable regions(s) of an antibody of the invention. The polynucleotides may encode the full heavy and/or light chain of an antibody of the invention. Typically, one polynucleotide would encode each of the heavy and light chains.
[0333] Polynucleotides which encode an antibody of the invention can be obtained by methods well known to those skilled in the art. For example, DNA sequences coding for part or all of the antibody heavy and light chains may be synthesised as desired from the corresponding amino acid sequences.
[0334] General methods by which the vectors may be constructed, transfection methods and culture methods are well known to those skilled in the art. In this respect, reference is made to Current Protocols in Molecular Biology, 1999, F. M. Ausubel (ed), Wiley Interscience, New York and the Maniatis Manual produced by Cold Spring Harbor Publishing.
[0335] A polynucleotide of the invention may be provided in the form of an expression cassette, which includes control sequences operably linked to the inserted sequence, thus allowing for expression of the antibody of the invention in vivo. Hence, the invention also provides one or more expression cassettes encoding the one or more polynucleotides that encoding an antibody of the invention. These expression cassettes, in turn, are typically provided within vectors (e.g. plasmids or recombinant viral vectors). Hence, in one embodiment, the invention provides a vector encoding an antibody of the invention. In another embodiment, the invention provides vectors which collectively encode an antibody of the invention. The vectors may be cloning vectors or expression vectors. A suitable vector may be any vector which is capable of carrying a sufficient amount of genetic information, and allowing expression of a polypeptide of the invention.
[0336] The polynucleotides, expression cassettes or vectors of the invention are introduced into a host cell, e.g. by transfection. Hence, the invention also provides a host cell comprising the one or more polynucleotides, expression cassettes or vectors of the invention. The polynucleotides, expression cassettes or vectors of the invention may be introduced transiently or permanently into the host cell, allowing expression of an antibody from the one or more polynucleotides, expression cassettes or vectors. Such host cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, lower eukaryotic cells, such as yeast, or prokaryotic cells, such as bacteria cells. Particular examples of cells include mammalian HEK293, such as HEK293F, HEK293T, HEK293S or HEK Expi293F, CHO, HeLa, NS0 and COS cells, or any other cell line used herein, such as the ones used in the Examples. Preferably the cell line selected will be one which is not only stable, but also allows for mature glycosylation.
[0337] The invention also provides a process for the production of an antibody of the invention, comprising culturing a host cell containing one or more vectors of the invention under conditions suitable for the expression of the antibody from the one or more polynucleotides of the invention, and isolating the antibody from said culture.
Combination of Antibodies
[0338] The inventors found that certain Table 1 antibodies are particularly effective when used in combination, e.g. to maximise therapeutic effects and/or increase diagnostic power. Useful combinations include the antibodies that do not cross-compete with one another and/or bind to non-overlapping epitopes, as exemplified in Tables 4 and 5.
[0339] Thus, the invention provides a combination of the antibodies of the invention, wherein each antibody is capable of binding to the spike protein of coronavirus SARS-CoV-2, wherein each antibody: (a) comprises at least three CDRs of any one of the 42 antibodies in Table 1; or (b) binds to the same epitope as or competes with antibody 159, or 384. In certain embodiments, the Table 1 antibodies may be: [0340] a pair of antibodies listed in a row of Table 4; [0341] a pair of antibodies listed in a row of Table 5; [0342] a triplet of antibodies listed in a row of Table 5; [0343] a pair of antibodies listed in a row of Table 4 and antibody 159; [0344] a pair of antibodies listed in a row of Table 5 and antibody 159; [0345] a triplet of antibodies listed in a row of Table 5 and antibody 159; [0346] any two or more antibodies selected from the group consisting of: 384, 159, 253H55L, 253H165L, 253, 88, 40 and 316; [0347] any two or more antibodies selected from the group consisting of: 253, 253H55L and 253H165L, 222, 318, 55 and 165; [0348] any two or more antibodies selected from the group consisting of: 158H222L, 222, 150H222L, 384, 159, 253H55L, 253H165L, 253, 88, 40 and 316; or [0349] any two or more antibodies selected from the group consisting of: 158H222L, 222, 150H222L, 253, 253H55L and 253H165L, 222, 318, 55 and 165.
[0350] In one embodiment, the invention provides a combination of any of the antibodies described in Table 1.
[0351] In one embodiment, the invention provides a combination of any of the antibodies disclosed herein, such as any of the antibodies listed in Table 1, 21, 22, 23, 24 and/or 25.
[0352] A combination of the antibodies of the invention may be useful as a therapeutic cocktail. Hence, the invention also provides a pharmaceutical composition comprising a combination of the antibodies of the invention, as explained further below.
[0353] A combination of the antibodies of the invention may be useful for diagnosis. Hence, the invention also provides a diagnostic kit comprising a combination of the antibodies of the invention. Also provided herein are methods of diagnosing a disease or complication associated with coronavirus infections in a subject, as explained further below.
Pharmaceutical Composition
[0354] The invention provides a pharmaceutical composition comprising an antibody of the invention. The composition may comprise a combination (such as two, three or four) of the antibodies of the invention. The pharmaceutical composition may also comprise a pharmaceutically acceptable carrier.
[0355] The composition of the invention may include one or more pharmaceutically acceptable salts. A pharmaceutically acceptable salt refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects. Examples of such salts include acid addition salts and base addition salts.
[0356] Suitable pharmaceutically acceptable carriers comprise aqueous carriers or diluents. Examples of suitable aqueous carriers include water, buffered water and saline.
[0357] Other suitable pharmaceutically acceptable carriers include ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. In many cases, it will be desirable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
[0358] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
[0359] Pharmaceutical compositions of the invention may comprise additional therapeutic agents, for example an anti-viral agent. The anti-viral agent may bind to coronavirus and inhibit viral activity. Alternatively, the anti-viral agent may not bind directly to coronavirus but still affect viral activity/infectivity. The anti-viral agent could be a further anti-coronavirus antibody, which binds somewhere on SARS-CoV-2 other than the spike protein. Examples of an anti-viral agent useful with the invention include Remdesivir, Lopinavir, ritonavir, APN01, and Favilavir.
[0360] The additional therapeutic agent may be an anti-inflammatory agent, such as a corticosteroid (e.g. Dexamethasone) or a non-steroidal anti-inflammatory drug (e.g. Tocilizumab).
[0361] The additional therapeutic agent may be an anti-coronavirus vaccine.
[0362] The pharmaceutical composition may be administered subcutaneously, intravenously, intradermally, intramuscularly, intranasally or orally.
[0363] Also within the scope of the invention are kits comprising antibodies or other compositions of the invention and instructions for use. The kit may further contain one or more additional reagents, such as an additional therapeutic or prophylactic agent as discussed herein.
Methods and Uses of the Invention
[0364] The invention further relates to the use of the antibodies the combinations of the antibodies and the pharmaceutical compositions, described herein, e.g. in a method for treatment of the human or animal body by therapy, or in a diagnostic method. The method of treatment may be therapeutic or prophylactic.
[0365] For example, the invention relates to methods of treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19. The method may comprise administering a therapeutically effective amount of an antibody, a combination of antibodies, or a pharmaceutical composition of the invention. The method may further comprise identifying the presence of coronavirus in a sample, e.g. SARS-CoV-2, from the subject. The invention also relates to an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for use in a method of treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19.
[0366] The invention also relates to a method of formulating a composition for treating coronavirus (e.g. SARS-CoV-2) infections, a disease or complication associated therewith, e.g. COVID-19, wherein said method comprises mixing an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention with an acceptable carrier to prepare said composition.
[0367] The invention also relates to the use of an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention for the manufacture of a medicament for treating coronavirus (e.g. SARS-CoV-2) infections or a disease or complication associated therewith, e.g. COVID-19.
[0368] The invention also relates to preventing, treating or diagnosing coronavirus infections caused by any SARS-CoV-2 strain, as described herein. Coronavirus infections may be caused by any SARS-CoV-2 strain, including members of lineage A, A.1, A.2, A.3, A.5, B, B.1, B.1.1, B.2, B.3, B.4, B.1.1.7, B.1.351, P.1, B.1.617.2 or B.1.1.529. In particular, the invention relates to preventing, treating or diagnosing coronavirus infections caused by a SARS-CoV-2 strain from lineage B.1.1.7, B.1.351, P.1, B.1.617.2 or B.1.1.529. The invention also relates to preventing, treating or diagnosing coronavirus infections caused by a SARS-CoV-2 strain from lineage B.1.1.7, B.1.351, P.1, B.1.617.2, B.1.1.529, B.1.526.2, B.1.617.1, B.1.258, C.37, or C.36.3.
[0369] The invention also provides an antibody, a combination of antibodies, or a pharmaceutical composition of the invention for use in treating coronavirus infections, or a disease or complication associated therewith, caused by a SARS-CoV-2 strain comprising one or more mutations, e.g. in the spike protein, relative to the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124). In other words, the SARS-CoV-2 strain may be a modified hCoV-19/Wuhan/WIV04/2019 (WIV04) strain comprising one or more modifications, e.g. in the spike protein.
[0370] The mutations may be N501Y; residues 69-70 deleted, residue 144 deleted, A570D, D614G, P681H, T716I, S982A, and/or D1118H in the spike protein relative to the spike protein of hCoV-19/Wuhan/WIV04/2019 (WIV04). In particular, the SARS-CoV-2 strain comprises N501Y mutation in the spike protein. The SARS-CoV-2 strain may comprise all of the mutations in the spike protein listed above. The SARS-CoV-2 strain may be a member of the B.1.1.7 lineage.
[0371] For example, the SARS-CoV-2 strain may comprise deletion of residues 69-70 and N501Y in the spike protein relative to the spike protein in hCoV-19/Wuhan/WIV04/2019. Alternatively, the SARS-CoV-2 strain may comprise deletions of residues 69-70; deletions of residue 144; E484K, A570D, D614G, P681H, T716I, S982A, and D1118H in the spike protein.
[0372] The mutations may be: K417N, E484K, N501Y, L18F, D80G, D215G, 242-244 deletion, R246I, D614G, and/or A701V in the spike protein relative to the spike protein of hCoV-19/Wuhan/WIV04/2019 (WIV04). In particular, the SARS-CoV-2 strain comprises E484K mutation in the spike protein. The SARS-CoV-2 strain may comprise all of the mutations in the spike protein listed above. The SARS-CoV-2 strain may be a member of the B.1.351 lineage.
[0373] For example, the SARS-CoV-2 strain may comprise K417N, E484K, N501Y, D80G, D215G, deletion of residues 242-244, D614G, and/or A701V in the spike protein relative to the spike protein of hCoV-19/Wuhan/WIV04/2019 (WIV04). Alternatively, the SARS-CoV-2 strain may comprise deletion of residues 242-244 and N501Y in the spike protein. Alternatively, the SARS-CoV-2 strain may comprise deletion of residues 242-244 and E484K in the spike protein.
[0374] The mutations may be: K417T, E484K, N501Y, L18F, T20N, P26S, D138Y, R190S, H655Y, and/or T1027I in the spike protein relative to the spike protein of hCoV-19/Wuhan/WIV04/2019 (WIV04). In particular, the SARS-CoV-2 strain comprises E484K mutation in the spike protein. The SARS-CoV-2 strain may comprise all of the mutations in the spike protein listed above. The SARS-CoV-2 strain may be a member of the Y501.V2 lineage.
[0375] The mutations may be L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y D614G, H655Y, T1027I, and/or V1176F in the spike protein relative to the spike protein of hCoV-19/Wuhan/WIV04/2019 (WIV04). The SARS-CoV-2 strain may comprise all of the mutations in the spike protein listed above. The SARS-CoV-2 strain may be a member of the P.1 lineage.
[0376] The mutation may be a mutation (e.g. substitution) at position 417 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124), wherein the substitution is from the lysine residue to another amino acid residue, such as asparagine (N) or threonine (T).
[0377] The mutation may be a mutation (e.g. substitution) at position 501 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124), wherein the substitution is from the asparagine residue to another amino acid residue, such as tyrosine.
[0378] The mutation may be a mutation (e.g. substitution) at position 484 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124), wherein the substitution is from the glutamic acid residue to another amino acid residue, such as lysine.
[0379] The mutations may be mutation (e.g. substitution) at positions 417, 484 and 501 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124) as indicated above.
[0380] For example, the SARS-CoV-2 strain may comprise mutations at the positions 19, 142, 156, 157, 158, 452, 478, 614, 618 and/or 950 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124). The SARS-Cov-2 strain may comprise the substitutions T19R, G142D, R158G, L452R, T478K, D614G, P681R, D950N, e.g. B1.617.2 (delta) strain or a member of the lineage derived therefrom.
[0381] The mutation may be a mutation at position 452 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124). For example, the mutation may be a substitution from leucine (L) to another amino acid residue, such as arginine (R) or glutamine (Q). The SARS-Cov-2 strain may comprise the mutation L452R, e.g. a B.1.617.2 (delta) strain or a member of the lineage derived therefrom, a B.1.617.1 (kappa) strain or a member of the lineage derived therefrom, or a C.36.3 strain or a member of the lineage derived therefrom. The SARS-Cov-2 strain may comprise the mutation L452Q, e.g. a C.37 (lambda) strain or a member of the lineage derived therefrom.
[0382] The mutation may be a mutation at position 478 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124). For example, the mutation may be a substitution from threonine (T) to another amino acid residue, such as lysine (K). The SARS-Cov-2 strain may comprise the mutation T478K, e.g. a B.1.617.2 (delta) strain or a member of the lineage derived therefrom.
[0383] The mutation may be mutations at the positions 339, 371, 373, 375, 417, 440, 446, 477, 478, 484, 493, 496, 498, 501 and/or 505 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04) (GISAID accession no. EPI_ISL_402124). For example, the mutation may be a substitution from threonine (T) to another amino acid residue, such as lysine (K). The SARS-Cov-2 strain may comprise the substitutions G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, e.g. a B.1.1.529 (omicron) strain or a member of the lineage derived therefrom.
[0384] Antibodies 58, 222, 253 and 253H/55L are particularly effective in neutralising a SARS-Cov-2 strain comprising mutations at the positions 339, 371, 373, 375, 417, 440, 446, 477, 478, 484, 493, 496, 498, 501, 505 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04). Hence, the invention may relate to these antibodies for use in treating, prevent, treating or diagnosing coronavirus infection caused by a SARS-Cov-2 strain comprising mutations at the positions 339, 371, 373, 375, 417, 440, 446, 477, 478, 484, 493, 496, 498, 501, 505 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04). Similarly, the invention relates to methods of using these antibodies and uses of these antibodies in treating, prevent, treating or diagnosing coronavirus infection caused by a SARS-Cov-2 strain mutations at the positions 339, 371, 373, 375, 417, 440, 446, 477, 478, 484, 493, 496, 498, 501, 505 in the spike protein relative to the spike protein of the hCoV-19/Wuhan/WIV04/2019 (WIV04).
[0385] The SARS-CoV-2 strain may comprise all of the mutations described herein.
[0386] The methods and uses of the invention may comprise inhibiting the disease state (such as COVID-19), e.g. arresting its development; and/or relieving the disease state (such as COVID-19), e.g. causing regression of the disease state until a desired endpoint is reached.
[0387] The methods and uses of the invention may comprise the amelioration or the reduction of the severity, duration or frequency of a symptom of the disease state (such as COVID-19) (e.g. lessen the pain or discomfort), and such amelioration may or may not be directly affecting the disease. The symptoms or complications may be fever, headache, fatigue, loss of appetite, myalgia, diarrhoea, vomiting, abdominal pain, dehydration, respiratory tract infections, cytokine storm, acute respiratory distress syndrome (ARDS) sepsis, and/or organ failure (e.g. heart, kidneys, liver, GI, lungs).
[0388] The methods and uses of the invention may lead to a decrease in the viral load of coronavirus (e.g. SARS-CoV-2), e.g. by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to pre-treatment. Methods of determining viral load are well known in the art, e.g. infection assays.
[0389] The methods and uses of the invention may comprise preventing the coronavirus infection from occurring in a subject (e.g. humans), in particular, when such subject is predisposed to complications associated with coronavirus infection.
[0390] The invention also relates to identifying subjects that have a coronavirus infection, such as by SARS-CoV-2. For example, the methods and uses of the invention may involve identifying the presence of coronavirus (e.g. SARS-CoV-2), or a protein or a protein fragment thereof, in a sample. The detection may be carried out in vitro or in vivo. In certain embodiments, the invention relates to population screening.
[0391] The invention relates to identifying any SARS-CoV-2 strain, including members of lineage A, A.1, A.2, A.3, A.5, B, B.1, B.1.1, B.2, B.3, B.4, B.1.1.7, B.1.351, P.1, B.1.617.2 or B.1.1.529. In particular, the invention relates to identifying a SARS-CoV-2 strain from lineage B.1.1.7, B.1.351 or P.1. The invention also relates to identifying a SARS-CoV-2 strain from lineage B.1.1.7, B.1.351, P.1, B.1.617.2, B.1.1.529, B.1.526.2, B.1.617.1, B.1.258, C.37, or C.36.3. The various strains of SARS-CoV-2 are discussed in more detail above.
[0392] It has also been identified that many of the antibodies herein may cross-react with SARS-CoV-1. Accordingly, in one embodiment, the invention relates to identify the presence of SARS-CoV-1, e.g. for use in the diagnosis of SARS-CoV-1 infection, or a disease or complication associated therewith, using an antibody, a combination of antibodies, or a pharmaceutical composition according to the invention.
[0393] The invention may also relate to a method of identifying escape mutants of SARS-CoV-2, comprising contacting a sample with a combination of antibodies of the invention and identifying if each antibody binds to the virus. The term escape mutants refers to variants of SARS-CoV-2 comprising non-silent mutations that may affect the efficacy of existing treatments of SARS-CoV-2 infection. Typically, the non-silent mutations is on an epitope recognised by a prior art antibody and/or antibodies described herein that specifically binds to an epitope of SARS-CoV-2, e.g. on the spike protein of SARS-CoV-2. If the antibody does not bind to the target, it may indicate that the target comprises a mutation that may alter the efficacy of existing SARS-CoV-2 treatments.
[0394] The methods and uses of the invention may include contacting a sample with an antibody or a combination of the antibodies of the invention, and detecting the presence or absence of an antibody-antigen complex, wherein the presence of the antibody-antigen complex indicates that the subject is infected with SARS-CoV-2.
[0395] Methods of determining the presence of an antibody-antigen complex are known in the art. For example, in vitro detection techniques include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vivo techniques include introducing into a subject a labelled anti-analyte protein antibody. For example, the antibody can be labelled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques. The detection techniques may provide a qualitative or a quantitative readout depending on the assay employed.
[0396] Typically, the invention relates to methods and uses for a human subject in need thereof. However, non-human animals such as rats, rabbits, sheep, pigs, cows, cats, or dogs is also contemplated.
[0397] The subject may be at risk of exposure to coronavirus infection, such as a healthcare worker or a person who has come into contact with an infected individual. A subject may have visited or be planning to visit a country known or suspected of having a coronavirus outbreak. A subject may also be at greater risk, such as an immunocompromised individual, for example an individual receiving immunosuppressive therapy or an individual suffering from human immunodeficiency syndrome (HIV) or acquired immune deficiency syndrome (AIDS).
[0398] The subject may be asymptomatic or pre-symptomatic.
[0399] The subject may be early, middle or late phase of the disease.
[0400] The subject may be in hospital or in the community at first presentation, and/or later times in hospital.
[0401] The subject may be male or female. In certain embodiments, the subject is typically male.
[0402] The subject may not have been infected with coronavirus, such as SARS-CoV-2.
[0403] The subject may have a predisposition to the more severe symptoms or complications associated with coronavirus infections. The method or use of the invention may comprise a step of identifying whether or not a patient is at risk of developing the more severe symptoms or complications associated with coronavirus.
[0404] In embodiments of the invention relating to prevention or treatment, the subject may or may not have been diagnosed to be infected with coronavirus, such as SARS-CoV-2.
[0405] The invention relates to analysing samples from subjects. The sample may be tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. The sample may be blood and a fraction or component of blood including blood serum, blood plasma, or lymph. Typically, the sample is from a throat swab, nasal swab, or saliva.
[0406] The antibody-antigen complex detection assays may be performed in situ, in which case the sample is a tissue section (fixed and/or frozen) of the tissue obtained from biopsies or resections from a subject.
[0407] In the embodiments of the invention where the antibodies pharmaceutical compositions and combinations are administered, they may be administered subcutaneously, intravenously, intradermally, orally, intranasally, intramuscularly or intracranially, Typically, the antibodies pharmaceutical compositions and combinations are administered intravenously or subcutaneously.
[0408] The dose of an antibody may vary depending on the age and size of a subject, as well as on the disease, conditions and route of administration. Antibodies may be administered at a dose of about 0.1 mg/kg body weight to a dose of about 100 mg/kg body weight, such as at a dose of about 5 mg/kg to about 10 mg/kg. Antibodies may also be administered at a dose of about 50 mg/kg, 10 mg/kg or about 5 mg/kg body weight.
[0409] A combination of the invention may for example be administered at a dose of about 5 mg/kg to about 10 mg/kg for each antibody, or at a dose of about 10 mg/kg or about 5 mg/kg for each antibody. Alternatively, a combination may be administered at a dose of about 5 mg/kg total (e.g. a dose of 1.67 mg/kg of each antibody in a three antibody combination).
[0410] The antibody or combination of antibodies of the invention may be administered in a multiple dosage regimen. For example, the initial dose may be followed by administration of a second or plurality of subsequent doses. The second and subsequent doses may be separated by an appropriate time.
[0411] As discussed above, the antibodies of the invention are typically used in a single pharmaceutical composition/combination (co-formulated). However, the invention also generally includes the combined use of antibodies of the invention in separate preparations/compositions. The invention also includes combined use of the antibodies with additional therapeutic agents, as described above.
[0412] Combined administration of the two or more agents and/or antibodies may be achieved in a number of different ways. In one embodiment, all the components may be administered together in a single composition. In another embodiment, each component may be administered separately as part of a combined therapy.
[0413] For example, the antibody of the invention may be administered before, after or concurrently with another antibody, or binding fragment thereof, of the invention. The particularly useful combinations are shown in Tables 4 and 5 for example.
[0414] For example, the antibody of the invention may be administered before, after or concurrently with an anti-viral agent or an anti-inflammatory agent.
[0415] In embodiments where the invention relates to detecting the presence of coronavirus, e.g. SARS-CoV-2, or a protein or a protein fragment thereof, in a sample, the antibody contains a detectable label. Methods of attaching a label to an antibody are known in the art, e.g. by direct labelling of the antibody by coupling (i.e., physically linking) a detectable substance to the antibody. Alternatively, the antibody may be indirect labelled, e.g. by reactivity with another reagent that is directly labelled. Examples of indirect labelling include detection of a primary antibody using a fluorescently-labelled secondary antibody and end-labelling of a DNA probe with biotin such that it can be detected with fluorescently-labelled streptavidin.
[0416] The detection may further comprise: (i) an agent known to be useful for detecting the presence of coronavirus, e.g. SARS-CoV-2, or a protein or a protein fragment thereof, e.g. an antibody against other epitopes of the spike protein, or other proteins of the coronavirus, such as an anti-nucleocapsid antibody; and/or (ii) an agent known to not be capable of detecting the presence of coronavirus, e.g. SARS-CoV-2, or a protein or a protein fragment thereof, i.e. providing a negative control.
[0417] In certain embodiments, the antibody is modified to have increased stability. Suitable modifications are explained above.
[0418] The invention also encompasses kits for detecting the presence of coronavirus, e.g. SARS-CoV-2, in a sample. For example, the kit may comprise: a labelled antibody or a combination of labelled antibodies of the invention; means for determining the amount of coronavirus, e.g. SARS-CoV-2, in a sample; and means for comparing the amount of coronavirus, e.g. SARS-CoV-2, in the sample with a standard. The labelled antibody or the combination of labelled antibodies can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect coronavirus, e.g. SARS-CoV-2, in a sample. The kit may further comprise other agents known to be useful for detecting the presence of coronavirus, as discussed above.
[0419] For example, the antibodies or combinations of antibodies of the invention are used in a lateral flow test. Typically, the lateral flow test kit is a hand-held device with an absorbent pad, which based on a series of capillary beds, such as pieces of porous paper, microstructured polymer, or sintered polymer. The test runs the liquid sample along the surface of the pad with reactive molecules that show a visual positive or negative result. The test may further comprise using other agents known to be useful for detecting the presence of coronavirus, e.g. SARS-CoV-2, or a protein or a protein fragment thereof, as discussed above, such as anti- an anti-nucleocapsid antibody.
Other
[0420] It is to be understood that different applications of the disclosed antibodies combinations, or pharmaceutical compositions of the invention may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
[0421] In addition as used in this specification and the appended claims, the singular forms a, an, and the include plural references unless the content clearly dictates otherwise. Thus, for example, reference to an antibody includes two or more antibodies.
[0422] Furthermore, when referring to x herein, this means equal to or greater than x. When referred to x herein, this means less than or equal to x.
[0423] When referring to sequence identity between two sequences, their sequences are compared. Sequences with identity share identical nucleotides at defined positions within the nucleic acid molecule. Thus, a first nucleic acid sequence sharing at least 70% nucleic acid sequence identity with a second sequence requires that, following alignment of the first nucleic acid sequence with the second sequence, at least 70% of the nucleotides in the first nucleic acid sequence are identical to the corresponding nucleotides in the second sequence.
[0424] Sequences are typically aligned for identity calculations using a mathematical algorithm, such as the algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87 (1990): 2264 2268), modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90 (1993): 5873 5877). Such an algorithm is incorporated into the XBLAST programs of Altschul et al. (J. MoI. Biol. 215 (1990): 403 410). To obtain gapped alignments, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25 (1997): 3389 3402). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs can be used.
[0425] The amino acid position numberings provided herein used the IMGT numbering system (http://www.imgt.org; Lefranc M P, 1997, J, Immunol. Today, 18, 509), although in some instances the KABAT numbering system or the absolute numbering of the amino acids based on the sequence listing may be used.
[0426] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
[0427] The following examples illustrate the invention.
EXAMPLES
[0428] Antibodies are crucial to immune protection against SARS-CoV-2 with some in emergency use as therapeutics. As shown in the following Examples, the inventors identified 377 human monoclonal antibodies (mAbs) recognizing the viral spike, and focused on 80 which bind the receptor binding domain (RBD). By mapping antigenic sites using a unique computational methodology and comparing with inhibitory activity, the inventors show that binding sites are widely dispersed, but neutralizing epitopes highly focused. Nearly all highly potent neutralizing mAbs (IC50<0.1 g/ml) block receptor interaction, although one binds a unique epitope in the N-terminal domain. Many mAbs use public V-genes and are close to germline, boding well for vaccine responses. 19 Fab-antigen structures, some as RBD complexed with two Fabs, reveal two novel modes of engagement for potently inhibitory mAbs. Several Fabs are glycosylated, enhancing neutralisation for three, for two of which the sugar contacts the antigen. The most potent mAbs protect, prophylactically or therapeutically, in animal models.
Example 1. Characterization of mAbs
[0429] A cohort of 42 patients who had proven SARS-CoV-2 infection diagnosed by qRT-PCR (Table 2) was studied. ELISAs were performed against full-length stabilized S protein (Wuhan-Hu-1 strain, MN908947) where residues 986 and 987 in the linker between two helices in S2 were mutated to a Pro-Pro sequence to prevent the conversion to the post-fusion helical conformation (Walls et al., 2020; Wrapp et al., 2020), RBD (aa 330-532) or N protein (
[0430] To generate mAbs, two strategies were used. First, IgG expressing B cells were sorted, 4 cells per well, cultured with IL-2, IL-21 and 3T3-msCD40L cells for 13-14 days, and supernatants were tested for reactivity to S protein; positive clones were identified by RT-PCR (
[0431] 377 antibodies were produced, which reacted to full length S by ELISA. MAbs were further screened for reactivity to S1 (34%), S2 (53%), RBD (21%) and the NTD (11%), with the remaining 13% reactive only to full-length trimeric spike (
Example 2. Neutralisation Activity of SARS-CoV-2 mAbs
[0432] The neutralizing activity of all 377 mAbs was investigated using a focus reduction neutralisation test (FRNT). Only 5% of non-RBD mAbs showed neutralizing activity (IC.sub.50<10 g/ml), whereas 60% of RBD-specific mAbs showed neutralizing activity (
[0433] In total, 19 of 80 anti-RBD antibodies yielded IC.sub.50 levels of <0.1 g/ml (
[0434] The ability of anti-RBD mAbs to block interaction with ACE2 was measured using a competitive ELISA. For antibodies showing neutralisation, there was broad correlation between inhibitory potency and ACE2 blocking while NTD-binding mAb 159 did not block ACE2 binding (
[0435] To investigate the contribution of RBD binding antibodies to neutralisation in polyclonal serum, sera from 8 convalescent donors was immunodepleted with recombinant RBD; depletion of anti-RBD activity was confirmed by ELISA. Neutralisation assays were performed in RBD-depleted and mock-depleted samples and showed the major contribution made by anti-RBD antibodies (55-87% reduction) but also demonstrated that non-RBD antibodies have a significant role in the polyclonal neutralizing response to SARS CoV-2 (
Example 3. Mapping the RBD Antigenic Surface
[0436] Pairwise competition between antibodies was measured using biolayer interferometry (BLI) in a 96-well plate format. 79 antibodies were used, and in total 4404 of the 6340 non-diagonal elements of the square competition matrix were populated (see Example 13).
[0437] To facilitate interpretation of the results, a naming convention was used for the RBD by comparison with a torso (
[0438] The ACE2 binding site is shown in
[0439] In
[0440] There are undoubtedly mechanisms of neutralisation other than just ACE2 blocking, for instance 159 binds the NTD, remote from the ACE2 binding site (see below). Interestingly, antibodies co-locating with known neutralizing/protecting antibodies EY6A/H014 and 5309 (Huo et al., 2020; Zhou et al., 2020; Lv et al., 2020) in the left and right flank clusters respectively did not show appreciable neutralisation in the assays.
Example 4. Biophysical Characterisation of Selected Antibodies
[0441] The kinetics of RBD attachment for 20 potent RBD binders are shown in Table 3. K.sub.D values for Fab fragments ranged from 0.7 to 7.6 nM and off-rates, potentially associated with therapeutic efficacy, were in the order of 1,000-10,000 s (Ylera et al., 2013). Expression levels, thermostability, mono-dispersity, and freeze-thaw robustness for 34 mAbs are shown in Table 6. All were stable at elevated temperatures with a first observed Tm at 65-80 C. (Walter et al., 2012) with more than 99% of the mass in a single species. Nearly all were resilient to 20 freeze-thaw cycles.
Example 5. Structural Analysis of Potent Monoclonal AntibodiesFocusing on Limited Epitopes
[0442] Based on the neutralisation data (Table 3), antibodies were sent for structural analysis. Structures of 19 complexes, usually of either one or two Fabs bound to the RBD alone (8, by crystallography) or of individual Fabs or mAbs bound to trimeric spike (11, by cryo-EM) were determined, these are presented in
[0443] By selecting antibodies that are potent neutralizers in the FRNT assay, a large number of high affinity antibodies were omitted. This can be seen for instance in antibody which had a K.sub.D of 0.018 g/ml. This mAb showed weak neutralisation (IC.sub.50 2/ml) and was predicted as mapping to the right flank (
Example 6. Potent Antibody 384 Binds in a Previously Unreported Mode
[0444] Antibody 384 is the most potently neutralizing mAb reported here IC.sub.50 2 ng/ml. Its binding mode is unlike any other SARS-CoV-2 antibody reported to date. It approaches the binding site on the top of the neck and left shoulder from the front with a relatively small footprint of 630 .sup.2 (460 .sup.2 contributed by the heavy chain and 170 .sup.2 by the light chain). Although the orientation of the bound 384 Fab is similar to a group of previously reported Fabs including CV07-270, p2b-2f6 and bd629 (Kreye et al., 2020; Ju et al., 2020; Du et al., 2020), it is shifted 20 towards the left shoulder such that it does not contact the right chest (
Example 7. Repeated Usage of Heavy Chain V-Regions Demonstrates Potent Public Responses
[0445] The potent neutralizers identified frequently use public HC V-regions (shared by most people, compared to private, patient specific responses). Five potent mAbs use IGVH3-53 (bearing 3-10 non-silent mutations) (
[0446] A second V-region which repeatedly confers potent (IC.sub.50<0.1 g/ml) neutralisation is IGVH1-58 (mAbs: 55, 165, 253 and 318 all of which are potent). These have even fewer non-silent mutations (2 to 5) and longer HC CDR3s (12-16 residues). Three antibodies (55, 165, 253) harbour a disulphide bond in their CDR3s, compete strongly with each other for binding and map to the neck epitope, but do not compete with mAb 318. In mAb 253 the disulphide brackets a glycosylation sequon (see below). The crystal structure of a complex including Fab 253 confirmed that it binds within the dominant neck epitope (
[0447] The final V-region with at least 2 potent neutralizers is IGHV3-66, which was found a total of 5 times with 2 potent neutralizers (282 and 40). These two (with rather few mutations from germline and CDR3 lengths 12 and 13 respectively) compete strongly. Once again, a complex structure was determined for one (Fab 40) and demonstrated that, as expected from the competition data, this antibody binds squarely in the dominant neck epitope, almost indistinguishable from those using IGHV3-53 (
[0448] IGHV3.11 is found in the most potent neutralizer, 384 but is also used by CV07-270 (Kreye et al., 2020). CV07-270 is swung forward and sideways (compared to 384,
[0449] Whilst IGHV3-30 is found in 11 RBD binders, none are potent neutralizers. The structure of two representatives was determined, 75 (in a ternary complex with 253) and 45 (in a ternary complex with 88) (Table 7). 75 binds on the right shoulder and overlaps the ACE2 binding site (
[0450] In summary, the major public V-regions used by potent antibodies generally target the neck epitope, often with a common mode of binding dictated by the V-region (although they can occasionally switch epitopes), but this is not true for weaker neutralizers. This likely explains the overwhelming representation of a common mode of binding at the neck epitope in the structures determined to date (
Example 8. Light Chain Mixing can Increase Neutralisation Titre
[0451] For the three potent anti-RBD antibody clusters where >2 members shared the same IGVH (IGHV3-53, IGHV1-58 and IGHV3-66), a mixing experiment was performed, where each IGVH was matched with all the IGVL within that cluster (
[0452] In summary, the mapping method defines five binding clusters or epitopes. By analogy with a human torso four of these clusters form a continuous swathe running from the left shoulder to the neck, right shoulder and down the right flank of the torso whilst the fifth forms a more discrete site towards the left flank. These sites are widely distributed over the surface, however all but one of the 21 most potent (IC.sub.50<0.1 g/ml) neutralizing mAbs block receptor attachment to the neck. The single exception, mAb 159, binds the NTD and the mechanism of neutralisation is unclear, the lack of neutralisation by Fab 159 suggests that aggregation may play a role, however this domain is frequently associated with receptor-binding in other coronaviruses and 159 might conceivably interfere with co-receptor binding (Li, 2015).
[0453] There is now a substantial database of antibody/antigen complexes for the SARS-CoV-2 spike (84 PDB depositions as of 12 Dec. 2020, including nanobody structures). The number of unique structures is much smaller than this and the focus on potently neutralising public V-regions means that many of these have near identical binding modes (
Example 9. The Role of N-Linked Glycan in Antibody Interaction
[0454] It is known that 15-25% of IgGs bear N-linked glycans in their variable regions, sometimes with impact on antigen binding. Of 80 RBD-binding antibodies described here, 14 (17.5%) contain glycosylation sequins arising from somatic mutations in their variable region. For 8 mAbs (1, 88, 132, 253, 263, 316, 337, 382) the sequins are in the HC and for they lie in a CDR. Several of the HC mutations, but none of the LC mutations, are in potently inhibitory antibodies (neutralisation IC.sub.50<0.1 g/ml). Two of these (88 and 316) could be de-glycosylated without denaturation, and BLI analysis showed that this had negligible effect on RBD/Fab affinities (K.sub.D=0.8/1.2 nM and 1.0/2.0 nM, de-glycosylated/glycosylated respectively for 88 and 316), although the on-rate was a little faster in the absence of sugar (e.g. 3.810.sup.5 1/Ms compared to 1.410.sup.5 1/Ms for mAb 88. However mutations that eliminate glycosylation had a deleterious effect on neutralisation for these two and for the 253H165L chimera (
[0455] Antibodies 88 and 316 contain glycosylation sites in H1 (N35) and H2 (N59) respectively. The crystal structure of the RBD-316 Fab complex at 2.3 resolution shows well-defined density for 3 glycans including an 1,6 linked fucose (
[0456] In all cases the sugar is presented close to the top of the left shoulder, and in 2 out of 3 cases interacts directly but rather weakly with the antigen. The high frequency of sequon generation despite the rather few somatic mutations is intriguing and suggests positive selection.
[0457] Despite the most potently neutralizing mAbs being close to germline, somatic mutations introduce N-linked glycosylation sites into the variable region of 17.5% of the potent neutralizers. These can contribute to the interaction with the RBD, and although they appear to have relatively little effect on affinity they significantly enhance neutralisation.
Example 10. Binding in the Context of the Trimeric Spike
[0458] On isolated stabilised spikes the RBD is found in two orientations; up and down (Roy et al., 2020). Both of these form a family of conformations, up conformations vary by up to 20 (Zhou et al., 2020) and down can include a tighter packed locked conformation (Ke et al., 2020; Toelzer et al., 2020; Carrique et al., 2020; Xiong et al., 2020). The structures seen by cryo-EM have the RBD in either the classic up or down conformation (see
[0459] Fab 384 predominantly binds one RBD per trimer, although analysis of different particle classes revealed some weak density decorating the other RBDs, also in the down position, while a subtle movement can be seen between the RBDs of different classes (
[0460] To visualize the binding of the highly potent mAb 159, it was necessary to incubate spike with 159 IgG (the Fab alone showed no binding). This revealed all three NTDs of the spike decorated by 159 with RBDs in either one-up or all-down configurations (
Example 11. Valency of Interaction
[0461] Binding of full-length and Fab fragments to whole SARS-CoV-2 by ELISA was measured and compared these with neutralisation curves for a selection of antibodies for which structural information was available (
[0462] Loss in binding and neutralisation with Fabs compared to IgG is quite modest for mAb-88, which attaches in the all-up conformation (
[0463] A correlation was identified between Fab vs IgG binding/neutralisation and the mode of attachment to the prefusion spike as seen by cryoEM. Those antibodies which bind the spike in the down conformation appear to show a marked avidity boost to binding and neutralisation when Fab and full length IgG1 are compared (e.g. 316 and 384), suggesting that there is a relationship between the mode of attachment and neutralisation, as also seen from the potent neutralisation reported for antibodies that bind at the left and right flank (S309 and EY6A/H014 (Pinto et al., 2020; Zhou et al., 2020; Lv et al., 2020) epitopes that do not report strong neutralisation in the assay used herein.
Example 12. In Vivo Efficacy
[0464] The efficacy of the most promising neutralizing human mAbs was determined in vivo. The K18-hACE2 transgenic mouse model of SARS-CoV-2 pathogenesis was used wherein human ACE2 expression is driven by an epithelial cell specific, cytokeratin-18 gene promoter (McCray et al., 2007; Winkler et al., 2020). In this model, SARS-CoV-2 infected animals develop severe pulmonary disease and high levels of viral infection in the lung that is accompanied by immune cell infiltration and tissue damage (Winkler et al., 2020). Initially, a single 250 g (10 mg/kg) dose of mAbs 40 and 88 were administered as prophylaxis by intraperitoneal injection 1-day prior (D-1) to intranasal (i.n.) challenge with 10.sup.3 PFU of SARS-CoV-2. Passive transfer of mAb 40 or 88, but not an isotype control mAb (hE16), prevented SARS-CoV-2-induced weight loss (
[0465] To further evaluate the in vivo potency of the mAbs, the therapeutic activity of a larger panel at 1 dpi (D+1) was assessed with 10.sup.3 PFU of SARS-CoV-2. Although varying degrees of protection were observed for individual mAbs, weight loss was significantly reduced in all animals treated with anti-SARS-CoV-2 mAbs at 6 and 7 dpi compared to the isotype control (
[0466] In summary, the most potent antibodies identified were demonstrated to protect in an animal model, when administered prophylactically and therapeutically. The competition mapping method devised suggests a series of combinations of antibodies with non-overlapping epitopes. These results might therefore contribute to immunotherapy.
Example 13. Materials and Methods
[0467] Materials and methods for Examples 1 to 12.
Trimeric Spike of SARS-CoV-2
[0468] To construct the expression plasmids for SARS-CoV-2 spike protein, a gene encoding residues 1-1208 of the spike ectodomain with a mutation at the furin cleavage site (residues 682-685) from RRAR (SEQ ID NO: 409) to GSAS (SEQ ID NO: 410), proline substitutions at residues 986 and 987, followed by the T4 fibritin trimerization domain, a HRV3C protease cleavage site, a twin Strep Tag and an 8XHisTag (SEQ ID NO: 411), was synthesized and optimized for mammalian expression (Wrapp et al., 2020). An optimized coding sequence was cloned into the mammalian expression vector pHLsec.
Trimeric Spike of SARS-CoV, MERS-CoV, 0C63-CoV, HKU1-CoV, 229E-Cov, NL63-CoV
[0469] Expression plasmids were constructed using synthetic fragments coding for human codon-optimized spike glycoprotein sequences from CoV-229E (GenBank accession number NC_002645.1; amino acids 1-1113), CoV-HKU1 (GenBank accession number NC_006577.2; amino acids 1-1300), CoV-NL63 (GenBank accession number NC_005831.2; amino acids 1-1289), CoV-0C43 (GenBank accession number NC_006213.1; amino acids 1-1297), CoV-MERS (GenBank accession number AFS88936.1; amino acids 1-1291) (Zhao et al., 2013), CoV-SARS1 (GenBank accession number AY27874; amino acids 11-1195) (Simmons et al., 2004) and CoV-SARS2 (GenBank accession number MN908947; amino acids 1-1208). Fragments were cloned as previously reported by Wrapp et al. (Wrapp et al., 2020)
[0470] Mutations coding for stabilising proline residues and to eliminate putative furin cleavage sites were inserted in each sequence as follows: For CoV-229E, TI>PP (aa 871-872); for CoV-HKU1, RRKR (SEQ ID NO: 412)>GSAS (SEQ ID NO: 410) (aa 756-759) and AL>PP (aa 1071-1072); for CoV-NL63, RRSR (SEQ ID NO: 413)>GSAS (SEQ ID NO: 410) (aa 754-757) and SI>PP (aa 1052-1053); for CoV-0C43, AL>PP (aa 1070-1071); for CoV-MERS, RSVG (SEQ ID NO: 414)>ASVG (SEQ ID NO: 415) (aa 748), RSAR (SEQ ID NO: 416)>GSAS (SEQ ID NO: 410) (aa 884-887) and VL>PP 1060-1061; for CoV-SARS1, KV>PP (aa 968-969); for CoV-SARS2, RRAR (SEQ ID NO: 409)>GSAS (SEQ ID NO: 410) (aa 682-685) and KV>PP (aa 986-987). All sequences were verified by DNA sequencing.
[0471] DNA plasmids encoding the Strep-Tag-tagged spike proteins were transfected into HEK293T cells and incubated at 37 C. for 7 days. CoV spike protein trimers were affinity-purified. In the case of CoV-229E and CoV-NL63, the spike proteins were further purified by SEC.
Depletion of Anti-RBD Antibodies from Plasma Samples.
[0472] Nickel charged agarose beads were incubated overnight with His-tagged RBD. Beads incubated in the absence of RBD antigen were used as a beads-only, mock control. The beads were precleared with a pooled SARS-CoV-2 negative plasma. Beads were incubated with the human plasma samples of interest. The remaining depleted samples were collected, filter sterilized, and tested for complete depletion by RBD direct ELISA. ACE2 and RBD. Constructs are as described in Huo et al. 2020 (Huo et al., 2020) and production was as described in Zhou et al. 2020 (Zhou et al., 2020).
Isolation of Human Monoclonal Antibodies from Peripheral B Cells by Memory B Cell Stimulation
[0473] To generate human monoclonal antibodies from peripheral blood B cells, CD22+ B cells were isolated from PBMCs using CD22 Microbeads (130-046-401; Miltenyi Biotec). Pre-enriched B cells were stained with anti-IgM-APC, IgA-FITC and IgD-FITC. Double negative memory B cells (IgM-,IgA-/D-cells) were sorted by FACS and plated on 384-well plates at a density of 4 B cells per well. Cells were stimulated to proliferate and produce IgG by culturing with irradiated 3T3-msCD40L feeder cells (12535; NID AIDS Reagent Program), 100 U/ml IL-2 (200-02; Peprotech) and 50 ng/ml IL-21 (200-21; Peprotech) for 13-14 days. Supernatants were harvested from each well and screened for SARS-CoV-2 binding specificity by ELISA. Lysis buffer was added to positive wells containing SARS-CoV-2-specific B cells and immediately stored at 80 C. for future use in Ig gene amplification and cloning.
Isolation of Spike and RBD-Specific Single B Cells by FACS
[0474] To isolate spike and RBD-specific B cells, PBMCs were sequentially stained with LIVE/DEAD Fixable Aqua dye (Invitrogen) followed by recombinant trimeric spike-twin-Strep or RBD-biotin. Cells were then stained with antibody cocktail consisting of CD3-FITC, CD14-FITC, CD56-FITC, CD16-FITC, IgM-FITC, IgA-FITC, IgD-FITC, IgG-BV786, CD19-BUV395 and Strep-MAB-DY549 (iba) or streptavidin-APC (Biolegend) to probe the Strep tag of spike or biotin of RBD. spike or RBD-specific single B cells were gated as CD19+, IgG+, CD3, CD14, CD56, CD16, IgM, IgA, IgD, spike+ or RBD+ and sorted into each well of 96-well PCR plates containing RNase inhibitor (N2611; Promega). Plates were centrifuged briefly and frozen on dry ice before storage at 80 C. for future use in Ig gene amplification and cloning.
Cloning and Expression of SARS CoV2-Specific Human mAbs.
[0475] Genes encoding Ig VH, Ig V and V from positive wells were recovered using RT-PCR (210210; QIAGEN). Nested PCR (203205; Qiagen) was then performed to amplify genes encoding -chain, -chain and -chain with cocktails of primers specific for human IgG. PCR products of genes encoding heavy and light chains were joined with the expression vector for human IgG1 or immunoglobulin -chain or -chain (gifts from H. Wardemann) by Gibson assembly. For the expression of antibodies, plasmids encoding heavy and light chains were co-transfected into the 293T cell line by the polyethylenimine method (408727; Sigma), and antibody-containing supernatants were harvested for further characterization.
Construction of Fab Expression Plasmids
[0476] Heavy chain expression plasmids of specific antibodies were used as templates to amplify the first fragment, heavy chain vector include the variable region and CH1 until Kabat amino acid number 233. The second fragment of thrombin cleavage site and twin-Strep-tag with overlapping ends to the first fragment were amplified. The two fragments were ligated by Gibson assembly to make the Fab heavy chain expression plasmid.
Construction of scFv Antibody Plasmid
[0477] Heavy chain and light chain expression plasmids of specific antibodies were used as a template to amplify variable region gene of heavy and light chain respectively. Firstly, heavy chain gene products having the AgeI-SalII restriction enzyme sites were cloned into a scFv vector which is a modified human IgG expression vector which has a linker between the H chain and L chain genes followed by a thrombin cleavage site and twin-Strep-tags. Light chain gene products having NheI-NotI restriction enzyme site were cloned into scFv vector containing the heavy chain gene insert to produce scFv expression plasmids.
Fab and scFv Production and Purification
[0478] Protein production was done in HEK293T cells by transient transfection with polyethylenimine in FreeStyle 293 medium. For Fab antibody production, Fab heavy chain expression plasmids were co-transfected with the corresponding light chain. For scFv antibody production, scFv expression plasmid of specific antibody was used for transfection. After 5 days of culture at 37 C. and 5% CO2, culture supernatant was harvested and filtered using a 0.22 mm polyethersulfone (PES) filter. Fab and scFv antibody were purified by Strep-Tactin affinity chromatography (IBA lifescience) according to the Strep-Tactin XT manual.
Determination of Plasma and Antibody Binding to Recombinant Protein by ELISA
[0479] MAXISORP immunoplates (442404; NUNC) were coated with 0.125 g of StrepMAB-Classic were incubated with double strep-tag recombinant spike of SARS-CoV-2, SARS-CoV, MERS-CoV, 0C43-CoV, HKU1-CoV, 229E-CoV and NL43-CoV. Serially diluted plasma or mAbs were added, followed by ALP-conjugated anti-human IgG (A9544; Sigma). The reaction was developed by the addition of PNPP substrate and stopped with NaOH. To determine the binding to SARS-CoV-2 RBD, SARS-CoV-2 NP, SARS-CoV-2 spike S1 (40591-V08H; Sino Biological Inc) and SARS-CoV-2 spike S2 (40590-V08B; Sino Biological Inc), immunoplates were coated with Tetra-His antibody (34670; QIAGEN) followed by 5 g/mL of His-tag recombinant SARS-CoV-2 RBD, SARS-CoV-2 NP, SARS-CoV-2 spike S1 and SARS-CoV-2 spike S2. The plasma endpoint titres (EPTs) were defined as reciprocal plasma dilutions that corresponded to two times the average OD values obtained with mock. EC50 of mAbs were evaluated using non-linear regression (curve-fit).
Whole Virus ELISA
[0480] To determine the binding affinity of antibody to SARS-CoV-2 virus, virus was captured onto plates coated with mouse anti-SARS-CoV-2 spike (mAb31 with murine Fc) and then incubated with serial dilutions of SARS-CoV-2-specific human mAbs (full length IgG or Fab) followed by ALP-conjugated anti-human IgG (A8542, Sigma). The reaction was developed with PNPP substrate and stopped with NaOH. Results are expressed as the percentage of total binding.
Focus Reduction Neutralisation Assay (FRNT)
[0481] The neutralisation potential of Ab was measured using a Focus Reduction Neutralisation Test (FRNT), where the reduction in the number of the infected foci is compared to a no antibody negative control well. Briefly, serially diluted Ab was mixed with authentic SARS-CoV-2/human/AUS/VIC01/2020 (Caly et al., 2020) and incubated for 1 hr at 37 C. The mixtures were then transferred to Vero cell monolayers and incubated for 2 hrs followed by the addition of 1.5% semi-solid carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion. A focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) were visualized by adding TrueBlue Peroxidase Substrate. The percentage of focus reduction was calculated and IC.sub.50 was determined.
NTD Binding Assay
[0482] MAbs were screened for binding to MDCK-SIAT1 cells expressing the N-terminal domain (NTD) of SARS-CoV-2 spike glycoprotein (MDCK-NTD, from Prof. Alain Townsend). In brief, MDCK-NTD cells were incubated overnight. mAbs supernatants from transfected 293T cells were added and incubated. A second antibody Goat anti-human IgG Fc specific-FITC (F9512, Sigma-Aldrich) was then added (50 l per well) and incubated. After washing twice, the wells were fixed with 1% formaldehyde in PBS. The binding antibodies were detected by fluorescence intensities.
ELISA Based ACE2 Binding Inhibition Assay
[0483] For the ACE2 competition ELISA, 250 ng of ACE2 protein was immobilized to a MAXIXORP immunoplate and the plates were blocked with 2% BSA in PBS. In the meantime, serially diluted Ab was mixed with recombinant RBD-mFc (40592-V05H; Sino Biological) and incubated for 1 h at 37 C. The mixtures were then transferred to the ACE2 coated plates and incubated for 1 h followed by goat anti-mouse IgG Fc-AP (Invitrogen #A16093) at 1:2000 dilution. The reaction was developed by the addition of PNPP substrate and stopped with NaOH. The absorbance was measured at 405 nm. The ACE2/RBD binding inhibition rate was calculated by comparing to antibody-free control well. IC.sub.50 were determined using the probit program from the SPSS package.
Spike Protein Production for Structural Analysis
[0484] The stable cell line generation vector pNeoSec was used for cloning of the SARS-Cov2 spike ectodomain comprising amino acids 27-1208 with mutations of the furin cleavage site (RRAR (SEQ ID NO: 409)>GSAS (SEQ ID NO: 410) at residues 682-685) and the PP (KV>PP at residues 986-987). At the N-terminus, there is a twin StrepII tag and at the C-terminus fused with a T4 fibritin trimerisation domain, an HRV 3C cleavage site and a His-8 tag. The human embryonic kidney (HEK) Expi293F cells (Thermo Fisher Scientific) were transfected with the construct together with a phiC31 integrase expression plasmid as described earlier (Zhao et al., 2014). The polyclonal G418 resistant (1 mg/ml) cell population were used for protein production. Expi293F cells were grown in adhesion in roller bottles with the high glucose DMEM (Sigma) with 2% FBS for 6 days at 30 C. The soluble spike protein was captured from the dialysed conditional media with prepacked 5 ml Columns of HisTrap excel (GE Healthcare Life Sciences). The protein was eluted in 300 mM imidazole containing phosphate-buffered saline (PBS) after a 20 mM imidazole PBS wishing step. The protein was further purified with a 16/600 Superdex 200 size exclusion chromatography with an acidic buffer (20 mM Acetate, 150 mM NaCl, pH 4.6) for the low pH spike incubations, or a neutral buffer (2 mM Tris, 150 mM NaCl, pH 7.5).
Production of RBD for Structural Analysis
[0485] Stable HEK293 S cell line expressing His-tagged RBD was cultured in DMEM (high glucose, Sigma) supplemented with 10% FBS (Invitrogen), 1 mM glutamine and 1 non-essential amino acids at 37 C. Cells were transferred to roller bottles (Greiner) and cultured in DMEM supplemented with 2% FBS, 1 mM glutamine and 1 non-essential amino acids at 30 C. for 10 days for protein expression. For protein purification, the dialyzed media was passed through a 5 mL HisTrap Nickel column (GE Healthcare). The column was washed with buffer 20 mM Tris pH 7.4, 200 mM NaCl, 30 mM imidazole and RBD was eluted using buffer 20 mM Tris pH 7.4, 200 mM NaCl, 300 mM imidazole. A volume of 30 l endoglycosidase H1 (1 mg ml.sup.1) was added to 30 mg RBD and incubated at room temperature for 2 h. Then the sample was further purified with a Superdex 75 HiLoad 16/600 gel filtration column (GE Healthcare) using 10 mM HEPES pH 7.4, 150 mM NaCl. Purified RBD was concentrated using a 10-kDa ultra centrifugal filter (Amicon) to 10.6 mg ml.sup.1 and stored at 80 C.
Preparation of Fabs from IgGs
[0486] Fab fragments were digested from purified IgGs with papain using a Pierce Fab Preparation Kit (Thermo Fisher), following the manufacturer's protocol.
Physical Assays
[0487] Thermal stability was assessed using Thermofluor (DSF). Briefly, 3 g of the Ab preparation was used in a 5011.1 reaction containing 10 mM HEPES pH 7.5, 100 mM NaCl, 3 SYPROorange (Thermo Fisher). Samples were heated from 25-97 C. in a RT-PCR machine (Agilent MX3005p) and the fluorescence monitored at 25 C. after every 1 C. of heating. Melting temperatures (Tm) were calculated by fitting of a 5-parameter sigmoid curve using the JTSA software (P. Bond, https://paulsbond.co.uk/jtsa). Polydispersity was assessed by DLS using 10 g of the Ab preparation in an UNCLE instrument (Unchained Labs). Freeze thaw experiments on 4 of the mAbs were performed with material at 1 mg/ml by flash-freezing using LN2, thawing and centrifuging an aliquot (10 minutes at 20000 g) before measuring the absorbance at 280 nm of the soluble fraction.
Crystallization
[0488] Purified RBD was combined separately with Strep-tagged Fab150, Fab58, scFv269 and Fab316 in a 1:1 molar ratio, with final concentrations of 13.2, 9.4, 12.7 and 13.0 mg ml.sup.1, separately. RBD was combined with Fab45 and Strep-tagged Fab88, Fab75 and Fab253, and Fab 75 and Strep-tagged chimeric Fab 253H55L in a 1:1:1 molar ratio all with a final concentration of 7 mg ml.sup.1, separately. Glycosylated RBD was combined with Fab 5309 (Pinto et al., 2020) and Fab384 in a 1:1:1 molar ratio with a final concentration of 8 mg ml.sup.1. Crystals of RBD-150 complex were formed in Molecular Dimensions Morpheus condition C2, containing 0.09 M of NPS (nitrate, phosphate and sulphate), 0.1 M MES/imidazole pH 6.5, 10% (w/v) PEG 8000 and 20% (v/v) ethylene glycol and crystals also formed in Hampton Research PEGRx condition D11, containing 0.1 M imidazole pH 7.0 and 12% (w/v) PEG 20000. Crystals of RBD-158 were obtained from Index condition C01, containing 3.5 M NaCOOH pH 7.0, while some crystals were formed in Proplex condition C1, containing 0.15 M (NH4).sub.2SO.sub.4, 0.1 M Tris pH 8.0 and 15% (w/v) PEG 4000 and further optimized in 0.15 M (NH4).sub.2SO.sub.4, 0.1 M Tris pH 7.6 and 14.6% (w/v) PEG 4000. Crystals of RBD-scFv269 complexed were obtained from Index condition F01, containing 0.2 M Proline, 0.1 M HEPES pH 7.5 and 10% (w/v) PEG 3350. Good crystals for the RBD-316 complex were obtained from Index condition G10, containing 0.2 M MgCl.sub.2, 0.1 M bis-Tris pH 5.5 and 25% (w/v) PEG 3350. Crystals of RBD-45-88 complex were obtained from PEGRx condition G12, containing 10% (v/v) 2-Propanol, 0.1 M Sodium acetate trihydrate pH 4.0, 22% (w/v) PEG 6000. Crystals of RBD-75-253 complex were obtained from PEGRx condition D8, containing 0.1 M BIS-TRIS pH 6.5, 16% (w/v) PEG 10000. Crystals of RBD-75-253H55L were obtained from Index condition F5, containing 0.1 M ammonium acetate, 0.1 M bis-Tris pH 5.5 and 17% (w/v) PEG 10000. For the RBD-5309-384 ternary complex, good crystals were obtained from Morpheus condition H1, containing 0.1 M amino acids (Glu, Ala, Gly, Lys, Ser), 0.1 M MES/imidazole/pH 6.5, 10% (w/v) PEG 20000 and 20% (w/v) PEG MME 550.
X-Ray Data Collection, Structure Determination and Refinement
[0489] Diffraction data were collected at 100 K at beamline I03 of Diamond Light Source, UK. The structures were determined by molecular replacement with PHASER (Liebschner et al., 2019) using search models of the RBD, VhVl and ChCl domains of a closely related Fab in sequence for each complex. The ChCl domains of Fab 88 in the RBD-88-45 complex are disordered. Data collection and structure refinement statistics are given in Table 7.
Cryo-EM Grid Preparation
[0490] For all Fab or IgG-spike complexes, a 3 L aliquot of S 0.6 m (determined by OD) with Fab (1:6 molar ratio) was prepared, aspirated and almost immediately applied to a freshly glow-discharged Cu support Cflat 2/1-200 mesh holey carbon-coated grid (high intensity, 20 s, Plasma Cleaner PDC-002-CE, Harrick Plasma). Excess liquid was removed by blotting for 5-5.5 s with a force of 1 using vitrobot filter paper (grade 595, Ted Pella Inc.) at 4.5 C., 100% reported humidity before plunge freezing into liquid ethane using a Vitrobot Mark IV (Thermo Fisher).
Cryo-EM Data Collection and Processing
[0491] 40, 253H55L and 253H165L spike complexes:
[0492] Movies were collected in compressed tiff format on a Titan Krios G2 (Thermo Fisher) operating at 300 kV with a K3 detector (Gatan) in super resolution counting mode using a custom version of EPU 2.5 (Thermo Fisher). A defocus range of 0.8-2.6 m was applied with a nominal magnification of 105,000, corresponding to a calibrated pixel size of 0.83 /pixel and with a total dose of 43-47 e/.sup.2.
[0493] Two-times binned movies were then motion corrected and aligned on the fly using Relion (3.1) scheduler (Zivanov et al., 2018) with a 55 patch based alignment. CTF-estimation of full-frame non-weighted micrographs was performed with the GCTF (1.06) (Zhang, 2016) module in cryoSPARC (v2.14.1-live) (Punjani et al., 2017).
[0494] 88, 150, 158, 159IgG, 316 and 384 spike complexes:
[0495] Data for 88, 150, 158 were collected Titan Krios G2 (Thermo Fischer) operating at 300 kV with a K2 camera and a GIF Quantum energy filter (Gatan) with a 30 eV slit. For 159 (IgG), 384 and 316, data were collected as for 88, 150 and 158, except using a 20 keV slit. Rapid multi-shot data acquisition was set up using custom scripts with SerialEM (version 3.8.0 beta) (Mastronarde, 2005) at a nominal magnification of 165 kX, corresponding to a calibrated pixel size of 0.82 per pixel. A defocus range of 0.8 m to 2.6 m was used with a total dose of 45-57 e.sup./.sup.2 applied across 40 frames. Motion and CTF correction of raw movies was performed on the fly using cryoSPARC live patch-motion and patch-CTF correction (Punjani et al., 2017).
[0496] 40, 253H55L, 253H165L, 88, 150, 158, 159 IgG, 316 and 384 complexes:
[0497] Poor-quality images were discarded after manual inspection of CTF and motion estimations. Particles were then blob picked in cryoSPARC (Punjani et al., 2017) and initially extracted with four times binning. After inspection of 2D classes, classes of interest were selected to generate templates for complete particle picking. Binned particles were then subjected to one to three rounds of reference free 2D classification followed by 3D classification with an ab-initio derived model before further refinement and unbinning.
[0498] For both 150 and 158, two data separate data collections were set up on the same grid, and refined particle sets from each collection were separated by exposure groups before being combined. For 150, a total of 77,265 exposure-group split particles were initially combined (51,554 from 4726 movies and 25,711 from 2079 movies), re-classified into five classes, and the two best classes (42,655 particles) subjected to further non-uniform refinement, with obvious density for Fab bound to one RBD in an up conformation. Notably, discarded classes included a high proportion of undecorated S (28,463 particles, 4.4 reported resolution at GSFSC=0.143, 43 .sup.2 B-factor).
[0499] Classification using heterogeneous refinement in cryoSPARC was found to be generally poor, and, instead, 3D variability analysis was employed to try to better resolve full spike-Fab structures. Local refinements were also performed with masks focused around the Fab/RBD region (not reported here), but maps were still insufficient to clearly build a model at the RBD/Fab interface and far inferior to the crystallographic maps. 3D variability analysis was found to be essential for isolating the RBD up and RBD down conformations for 159-IgG. Results from this are presented for 159-IgG and 384. Briefly, data were separated into eight clusters using the 3D variability analysis module with a 6 resolution filter and a mask around the RBD/Fab region. Masks were generated by initially rigid body fitting a model of the spike and a Fab into a refined map in Chimera before selecting an area of the model including the RBD and fab and using the color zone module to crop out this desired part of the map. The resulting map was smoothed with a Gaussian filter (Pettersen Ef FauGoddard et al., 2004), converted into a mask format using Relion3.1 Mask Create before import into cryoSPARC. Resolution estimates were taken from Gold standard-FSC (FSC=0.143) reported in the local resolution module in cryoSPARC (Punjani et al., 2017).
Competition Assay of Antibodies
[0500] Competition assay of anti-RBD antibodies was performed on a Fortebio Octet RED96e machine with Fortebio Anti-HIS (HIS2) Biosensors. 2 g ml.sup.1 of His-tagged RBD dissolved in the running buffer (10 mM HEPES, pH 7.4 and 150 mM NaCl) was used as the ligand and was first immobilized onto the biosensors. The biosensors were then washed in the running buffer to remove unbound RBD. Each biosensor was dipped into different saturating antibodies (Ab1) to saturate the bound RBD, except one biosensor was into the running buffer in this step, acting as the reference. The concentration of saturating antibodies used was 15 g ml.sup.1. Higher concentrations were applied if 15 g ml.sup.1 was not enough to obtain saturating. Then all biosensors were washed with the running buffer again and dipped into wells containing the same competing antibody (Ab2). The concentration of competing antibodies used was 5 g ml.sup.1. The Y-axis values of signals of different saturating antibodies in this step were divided by the value of the reference channel to get ratio results of different Ab1-Ab2 pairs. Ratio result close to 0 indicated total competition while 1 indicated no competition. In total, 50 IgGs and 4 Fabs (Fabs 40, EY6A (Zhou et al., 2020), FD5D (unpublished) and S309 (Pinto et al., 2020)) were used as the saturating antibodies and 80 IgGs as the competing antibodies.
Competition Mapping of Antibodies
[0501] Gross binning of antibodies: Competition values were prepared for cluster analysis and binning by capping all competition values between 0 and 1. Competition values between antibodies i and j were averaged with the competition value for j and i when both were available. Cluster4 (Ginn, 2020) was used to cluster antibodies into three distinct groups using single value decomposition on the matrix of competition values.
[0502] Preparation of RBD surface and mesh: A surface of the receptor-binding domain was generated in PyMOL (The PyMOL Molecular Graphics System, Version 1.2r3pre, Schrdinger, LLC) from chain E of PDB code 6YLA. A mesh was generated and iteratively contracted and restrained to the surface of the RBD to provide a smoother surface on which to direct antibody refinement, reducing intricate surface features which could lead to unrealistic exploration of local minima.
[0503] Fixing positions of antibodies with known structure: In order to provide an objective position for those antibodies of known structure (FD5D (unpublished), EY6A (Zhou et al., 2020), S309 (Pinto et al., 2020) and mAb 40), to reflect the occluded region, all non-hydrogen antibody atoms were found within 20 of any RBD atom, and likewise all RBD atoms within 20 of an antibody atom. From each group, the atoms with the lowest sum-of-square-lengths from all other members were identified and the midpoint of these two atoms was locked to the nearest vertex on the mesh. Solvent molecules were ignored, but in the case of S309, the glyco-oligomer cofactor was included in the set of antibody atoms.
[0504] The target function: On an evaluation of the target function, either all unique pairs of antibodies were considered (all-pairs), or only unique pairs where one of the antibodies
was fixed (fixed-pairs), depending on the stage of the minimisation protocol. Competition levels were estimated for each pair of antibodies as described by f(x) in Eq. 1 where r is the working radius of the antibody, set to 22 , accounting for the approximate antibody radius. The distance between the pair of antibodies at a given evaluation of the function is given by din Angstroms. The target function was the sum of squared differences between the competition estimation and the competition value from SPR data.
[0505] Obtaining a self-consistent set of refined antibody positions: Minimisation was carried out globally by 1000 macrocycles of Monte Carlo-esque sampling using LBFGS refinement. A random starting position for each antibody was generated by randomly assigning a starting vertex on the RBD mesh and the target function minimised for 20 cycles considering data points for pairs with at least one fixed antibody, followed by 40 cycles for all data points. Between each cycle, antibody positions were locked onto the nearest mesh vertex. Depending on the starting positions of antibodies, results were a mixture of well-refined and poorly refined solutions. Results were ordered in ascending target function scores. Positions of antibodies for each result was passed into cluster4 as dummy C-alpha positions (Ginn, 2020). A clear self-consistent solution was enriched in lower target function scores and separated using cluster4 for further analysis. From these, an average position for each antibody was locked to the nearest vertex on the mesh, and the RMSD calculated from all contributing antibody positions.
Cells and Viruses (Mouse Experiments)
[0506] Vero CCL81 (American Type Culture Collection (ATCC)) and Vero-furin cells (Mukherjee et al., 2016) were cultured at 37 C. in Dulbecco's Modified Eagle medium (DMEM) supplemented with 10% foetal bovine serum (FBS), 10 mM HEPES, and 100 U/ml of penicillinstreptomycin. The 2019n-CoV/USA_WA1/2019 isolate of SARS-CoV-2 was obtained from the US Centers for Disease Control (CDC). Virus stocks were propagated by inoculating Vero CCL81 cells and collecting supernatant upon observation of cytopathic effect; debris was removed by centrifugation at 500g for 5 min. Supernatant was aliquoted and stored at 80 C. All work with infectious SARS-CoV-2 was performed in Institutional Biosafety Committee approved BSL3 and A-BSL3 facilities at Washington University School of Medicine using appropriate positive pressure air respirators and protective equipment.
Mouse Experiments
[0507] Animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381-01). Virus inoculations were performed under anaesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.
[0508] Heterozygous K18-hACE C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2).sub.2Prlmn/J) were obtained from The Jackson Laboratory. Seven to eight-week-old male and female animals were inoculated with 10.sup.3 PFU of SARS-CoV-2 via intranasal administration.
Measurement of Viral Burden
[0509] Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1000 L of DMEM supplemented to contain 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at 80 C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Scientific) on a Kingfisher Flex extraction robot (Thermo Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher). Reverse transcription was carried out at 48 C. for 15 min followed by 2 min at 95 C. Amplification was accomplished over 50 cycles as follows: 95 C. for 15 s and 60 C. for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay (PubMed ID 32553273). Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA (SEQ ID NO: 417)); Reverse primer: GACTGCCGCCTCTGCTC (SEQ ID NO: 418); Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/(SEQ ID NO: 419)). This region was included in an RNA standard to allow for copy number determination. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.
[0510] Plaque assay. Vero-furin cells (Mukherjee et al., 2016) were seeded at a density of 2.510.sup.5 cells per well in flat-bottom 12-well tissue culture plates. The following day, medium was removed and replaced with 200 L of 10-fold serial dilutions of the material to be titrated, diluted in DMEM+2% FBS. After incubation for 1 h at 37 C., 1 mL of methylcellulose overlay was added. Plates were incubated for 72 h, then fixed with 4% paraformaldehyde (final concentration) in phosphate-buffered saline for 20 min. Plates were stained with 0.05% (w/v) crystal violet in 20% methanol and washed twice with distilled, deionized water prior to plaque enumeration.
Affinity Determination Using Biolayer Interferometry
[0511] Octet RED 96e (ForteBio) was used to determine the binding affinities of antibodies with RBD or spike. Anti-RBD IgGs were immobilized onto AR2G biosensors (ForteBio) while RBD was used as the analyte with serial dilutions. For IgG159, spike was immobilised onto AR2G biosensors with IgG159 acting as the analyte with serial dilutions. Kd values were calculated using Data Analysis HT 11.1 (ForteBio) with a 1:1 global fitting model.
Example 14. Characterising the N501Y Mutation in the RBD
[0512] The RBD may be likened to a classical torso, in this analogy the shoulders and neck are involved in interactions with the ACE2 receptor (
Effect on ACE2 Affinity
[0513] It has been reported that mutations at 501 can increase spike affinity for ACE2 (Starr et al., 2020; Gu et al., 2020), although these data are not for the mutation to Y. In contrast Zahradnik et al., (Zahradnik et al., 2021) report direct selection of N501Y when evolving the RBD to enhance affinity. The effect of this mutation on ACE2 binding by RBD was therefore investigated using biolayer interferometry (BLI) (
Effect on Monoclonal Antibody Affinity
[0514] To investigate the effect of the N501Y mutation on antibody binding, the set of 377 monoclonal antibodies (80 of which mapped to the RBD) generated from SARS-CoV-2 cases infected during the first wave of the pandemic in the UK using samples collected before June 2020 were used. The potent neutralizers tended to have rather few somatic mutations (on average 5.33 and 4.33 amino acids in the heavy and light chains (HC, LC) respectively) and a number of public antibody responses (i.e. those using common V-region genes) including IGHV3-53 (5 potent mAbs), IGHV1-58 (4 potent mAbs) and IGHV3-66 (2 potent mAbs) were present in the collection of RBD specific mAbs.
[0515] Analysis of the position of the N501Y change with respect to the binding of all structurally characterised potent monoclonal antibodies suggests that the binding of over half of the antibodies would be unaffected by the change (
[0516] To examine the effects on antibody binding, BLI experiments were performed comparing the binding of potently neutralizing mAbs to RBDs containing 501Y and 501N (Example 17,
Example 15. Effect of B.1.1.7 Mutations on Neutralisation by Potent mAbs
[0517] Next, neutralization assays were performed with the potent mAb targeting the ACE2 interacting surface of RBD. Neutralizations were performed using focus reduction neutralization tests (FRNT) using viral strains Victoria and B.1.1.7 obtained from Public Health England (
Example 16. Neutralization Activity of Convalescent Plasma and Vaccine Sera
[0518] During the first wave of infection, before the emergence of B.1.1.7 strain, a number of samples from cases at convalescence (4-9 weeks following infection) for the generation of monoclonal antibodies were collected. Stored plasma from these cases was used in neutralization assays comparing Victoria and B.1.1.7 (
[0519] Neutralization of the B.1.1.7 and Victoria strains were also assayed using serum obtained from recipients of the Oxford-AstraZeneca and Pfizer vaccines. For the AstraZeneca AZD1222 vaccine, serum was obtained at baseline and at 14 and 28 days following the second dose. For the Pfizer vaccine, serum was obtained 7-17 days following the second dose of vaccine which was administered 3 weeks after the first dose (participants were seronegative at entry). Neutralization assays against B.1.1.7 and Victoria strains showed a 1.7-fold (n=10 p=0.002) and 2.6-fold (n=15 p<0.0001) reduction in the neutralization titres between B.1.1.7 and Victoria strains for the AstraZeneca vaccine after 14 and 28 days following the second dose respectively (
[0520] Finally, plasma from 13 patients infected with B.1.1.7 was obtained (all had spike gene dropout in viral PCR testing and 11 were verified by sequencing) at various time points following infection and compared neutralization between B.1.1.7 and Victorian strains (
[0521] In conclusion, the neutralization assays on convalescent and vaccine serum revealed that the B.1.1.7 virus required higher concentration of serum to achieve neutralization, although there was no evidence that the B.1.1.7 virus could evade neutralization by serum raised to early SARS-CoV-2 strains or vaccines.
[0522] Neutralising responses against the Victoria virus are less effective against B.1.1.7 and that part of this effect is due to the N501Y mutation as demonstrated by the weaker binding of a number of antibodies to the RBD, where N501Y is the only difference. The reduced binding and neutralization was particularly marked for some, but not all, members of the public VH3-53 class of mAb where the light chain comes in close proximity to Y501. However, B.1.1.7 contains other mutations which may have a bearing on neutralization, in particular the deletions at 69-70 and 144 in the NTD. NTD binding antibodies, which do not block interaction with ACE2, have been described by a number of groups to be able to neutralize SARS-CoV-2 (Chi et al., 2020; Liu et al., 2020; Cerutti et al., 2021), with some antibodies showing IC50 values sub 10 ng/ml. In this study B.1.1.7 showed only a 5.7-fold reduction in the FRNT.sub.50 for mAb 159 (FRNT.sub.50 Victoria 11 ng/ml B.1.1.7 61 ng/ml) suggesting that despite the residue 144 deletion being on the edge of the footprint for this antibody the binding site has not been completely disrupted.
[0523] The level of expression of ACE2 has been shown to correlate with likelihood of infection by SARS-CoV-1 (Jia et al., 2005) and the higher affinity for ACE2 of SARS-CoV-2 has been imputed to underlie its greater transmission. It is reasonable to assume that a further increase in affinity will increase the likelihood of the stochastic events of virus attachment resulting in localisation for sufficient time to trigger, perhaps by the recruitment of additional receptors, internalisation of the virus. As noted by Zahradnik, J. et al. (Zahradnik et al., 2021) in a situation where public health measures reduce RO to below 1 there will be selective pressure to increase receptor affinity.
[0524] This increase in transmission is compounded by the reduction in neutralization potency of antibodies generated by prior infection. Modification of the ACE2 binding surface of the RBD would be predicted to directly disrupt the binding of antibodies that lose affinity to the mutated residues. However, antibodies that neutralize by ACE2 competition, even if not directly affected by the mutation will have to compete with ACE2 for binding to the RBD, and mutations of RBD that increase the affinity of ACE2 will tip the equilibrium away from mAb/RBD interaction toward RBD/ACE2 making the virus more difficult to neutralize.
[0525] Mutation at position 484 of the Spike likely has a similar dual effect and Zahradnik, J. et al. report that further affinity increase in ACE2 binding is possible. Although most effort has been directed at generating antibodies that neutralize by blocking ACE2 binding, other mechanisms are possible (Huo et al., 2020; Zhou et al., 2020) and indeed partial or non-neutralising antibodies may confer protection (Dunand et al., 2016). Such antibodies would likely be unaffected by mutations in the ACE2 binding site and they deserve more thorough investigation since they would form excellent components in therapeutic cocktails. In addition, natural exposure and vaccination may confer protective immunity against symptomatic and severe COVID-19 via memory T cell responses (Sariol and Perlman, 2020; Altmann and Boyton, 2020).
[0526] The recent description of a number of virus variants which appear to have developed independently is a cause for concern as it may signal the emergence of strains able to evade vaccine induced antibody responses. There is now an imperative to closely survey the emergence of novel SARS-CoV2 strains on a global basis and to quickly understand the consequences for immune escape. There is a need to define correlates of protection from SARS-CoV-2 and also to understand how T cells contribute to protection in addition to the antibody response. It is also imperative to understand whether the newly emerging strains including B.1.1.7, 501Y.V2 and P.1 are leading to more severe disease and whether they can evade natural or vaccine induced immune responses (Zhu et al., 2021).
Example 17. Materials and Methods
[0527] For examples 14 to 16.
COG-UK Sequence Analysis
[0528] All COG-UK sequences were downloaded on 24.sup.th Jan. 2020, and the translated protein sequences were roughly to the wild-type reference from start and stop codons between nucleotides 21000-25000, and filtered on the mutation 501Y. Sequence alignment was carried out, and identified mutations were plotted as red balls (single point mutations) or black balls (deletions) on the modelled C-alpha positions of the Spike structure, size proportional to the logarithm of the number of mutations. Residues which mutated at an incidence greater than 0.3% compared to the wild-type were labelled explicitly.
Cloning of Native RBD, RBD N501Y and ACE2
[0529] The constructs of native RBD and ACE2 are the same as in Zhou et al., (Zhou et al., 2020). To clone RBD N501Y, a construct of native RBD was used as the template and two primers of RBD (Forward primer 5-CTACGGCTTTCAGCCCACATACGGTGTGGGCTACCAGCCTT-3 (SEQ ID NO: 420) and reverse primer 5-AAGGCTGGTAGCCCACACCGTATGTGGGCTGAAAGCCGTAG-3 (SEQ ID NO: 421)) and two primers of pNEO vector (Forward primer 5-CAGCTCCTGGGCAACGTGCT-3 (SEQ ID NO: 422) and reverse primer 5-CGTAAAAGGAGCAACATAG-3 (SEQ ID NO: 423)) were used to do PCR. Amplified DNA fragments were digested with restriction enzymes AgeI and KpnI and then ligated with digested pNEO vector. This construct encodes exactly the same protein as native RBD except the N501Y mutation.
Protein Production
[0530] Protein expression and purification were performed as described in Zhou et al. (Zhou et al., 2020).
Preparation of 269 Fab
[0531] Fab fragments of 269 antibody was digested and purified using Pierce Fab Preparation Kit, following the manufacturer's protocol.
Crystallization
[0532] 269 Fab was mixed with RBD N501Y in a 1:1 molar ratio with a final concentration of 9.9 mg ml.sup.1. After incubated at room temperature for 30 min, the sample was used for initial screening of crystals in Crystalquick 96-well X plates (Greiner Bio-One) with a Cartesian Robot using the nanoliter sitting-drop vapor-diffusion method as previously described (Walter et al., 2003). Crystals for the complex were obtained from a Molecular Dimensions Proplex screen, condition B10 containing 0.15 M ammonium sulfate, 0.1 M MES pH 6.0 and 15% PEG 4000.
Biolayer Interferometry
[0533] BLI experiments were run on an Octet Red 96e machine (Fortebio). To measure the binding affinities of monoclonal antibodies with native RBD and RBD N501Y, RBD and RBD N501Y were immobilized onto AR2G biosensors (Fortebio) separately. monoclonal antibodies were used as analytes. To measure the binding affinities of native RBD and RBD N501Y with ACE2, native RBD and RBD N501Y were immobilized onto AR2G biosensors separately. ACE2 with serial dilutions was used as analytes. Data were recorded using software Data Acquisition 11.1 (Fortebio) and analysed using software Data Analysis HT 11.1 (Fortebio) with a 1:1 fitting model.
X-Ray Data Collection, Structure Determination and Refinement
[0534] Crystals were mounted in loops and dipped in solution containing 25% glycerol and 75% mother liquor for a second before being frozen in liquid nitrogen prior to data collection. Diffraction data were collected at 100 K at beamline I03 of Diamond Light Source, UK. Diffraction images of 0.1 rotation were recorded on an Eiger2 XE 16M detector (exposure time of either 0.007 s per image, beam size 8020 m, 100% beam transmission and wavelength of 0.9763 ). Data were indexed, integrated and scaled with the automated data processing program Xia2-dials (Winter, 2010; Winter et al., 2018). The data set of 720 was collected from 2 frozen crystal to 2.19 resolution.
[0535] The crystal belongs to space group C2 with unit cell dimensions a=195.1, b=85.0 , c=57.9 and 0=100.6. The structure was determined by molecular replacement with PHASER (McCoy et al., 2007) using search models of SARS-CoV-2 RBD/COVOX-scFv269 complex (PDB ID, 7BEM) and the ChCl domains of SARS-CoV-2 RBD/COVOX-158 complex (PDB ID, 7BEK). There is one N501Y RBD/COVOX-269 Fab complex in the crystal asymmetric unit and a solvent content of 51%. Cyclic model rebuilding with COOT (Emsley and Cowtan, 2004) and refinement with PHENIX (Liebschner et al., 2019) resulted in the current structure with R.sub.work=0.197 and R.sub.free=0.222 for all data to 2.19 resolution.
[0536] Electron density for the side chain of Y501 is weak. However, when the structure was refined with an asparagine at 501, there is strong, but dispersed positive density around the side chain, suggesting the presence of a flexible tyrosine residue (
[0537] Data collection and structure refinement statistics are given in Table 10. Structural comparisons used SHP (Stuart et al., 1979), residues forming the RBD/Fab interface were identified with PISA (Krissinel and Henrick, 2007), figures were prepared with PyMOL (The PyMOL Molecular Graphics System, Version 1.2r3pre, Schrdinger, LLC).
Viral Stocks
[0538] SARS-CoV-2/human/AUS/VIC01/2020 (Caly et al., 2020) and SAR-CoV-2/B.1.1.7, provided by Public Health England, were grown in Vero (ATCC CCL-81) cells. Cells were infected with the SARS-CoV-2 virus at multiplicity of infection of 0.0001. Virus containing supernatant was harvested when 80% CPE was observed and spun at 2000 rpm at 4 C. before being stored at 80 C. Viral titres were determined by a focus-forming assay on Vero cells. Both Victoria passage 5 and B.1.1.7 stocks passage 2, were sequence verified to contain the expected spike protein sequence and no changes to the furin cleavage sites.
Focus Reduction Neutralization Assay (FRNT)
[0539] The neutralization potential of Ab was measured using a Focus Reduction Neutralization Test (FRNT), where the reduction in the number of the infected foci is compared to a no antibody negative control well. Briefly, serially diluted Ab or plasma was mixed with SARS-CoV-2 strain Victoria or B.1.1.7 and incubated for 1 hr at 37 C. The mixtures were then transferred to 96-well, cell culture-treated, flat-bottom microplate containing confluent Vero cell monolayers in duplicate and incubated for further 2 hrs followed by the addition of 1.5% semi-solid carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion. A focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) approximately 100 per well in the absence of antibodies, were visualized by adding TrueBlue Peroxidase Substrate. Virus-infected cell foci were counted on the classic AID EliSpot reader using AID ELISpot software. The percentage of focus reduction was calculated and IC.sub.50 was determined using the probit program from the SPSS package.
Pfizer Vaccine
[0540] Pfizer vaccine serum was obtained 7-17 days following the second dose of vaccine which was administered 3 weeks after the first dose (participants were to the best of their knowledge seronegative at entry).
[0541] The study was approved by the Oxford Translational Gastrointestinal Unit GI Biobank Study 16/YH/0247 [research ethics committee (REC) at Yorkshire & The Humber-Sheffield]. The study was conducted according to the principles of the Declaration of Helsinki (2008) and the International Conference on Harmonization (ICH) Good Clinical Practice (GCP) guidelines. Written informed consent was obtained for all patients enrolled in the study. Vaccines were Health Care Workers, based at Oxford University Hospitals NHS Foundation Trust, not known to have prior infection with SARS-COV-2. Each received two doses of COVID-19 mRNA Vaccine BNT162b2, 30 micrograms, administered intramuscularly after dilution as a series of two doses (0.3 mL each) 18-28 days apart. The mean age of vaccines was 43 years (range 25-63), 11 male and 14 female.
Astrazeneca-Oxford Vaccine Study Procedures and Sample Processing
[0542] Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298). These studies were registered at ISRCTN (U.S. Pat. Nos. 15,281,137 and 89,951,424) and ClinicalTrials.gov (NCT04324606 and NCT04400838). Written informed consent was obtained from all participants, and the trial is being done in accordance with the principles of the Declaration of Helsinki and Good Clinical Practice. The studies were sponsored by the University of Oxford (Oxford, UK) and approval obtained from a national ethics committee (South Central Berkshire Research Ethics Committee, reference 20/SC/0145 and 20/SC/0179) and a regulatory agency in the United Kingdom (the Medicines and Healthcare Products Regulatory Agency). An independent DSMB reviewed all interim safety reports. A copy of the protocols was included in previous publications (PMID: 33220855/PMID: 32702298).
[0543] Data from vaccinated volunteers who received two vaccinations are included in this paper. Vaccine doses were either 510.sup.10 viral particles (standard dose; SD/SD cohort n=21) or half dose as their first dose (low dose) and a standard dose as their second dose (LD/SD cohort n=4). The interval between first and second dose was in the range of 8-14 weeks. Blood samples were collected and serum separated on the day of vaccination and on pre-specified days after vaccination e.g. 14 and 28 days after boost.
Example 18. Mutational Changes in B.1.351
[0544] A number of isolates of B.1.351 have been described, all of which have the key mutations K417N, E484K and N501Y in the RBD. Tegally et al. (Tegally et al., 2021) reported an isolate containing 10 changes relative to the Wuhan sequence, L18F, D80A, D215G, L242-244 deleted, R246I, K417N, E484K, N501Y, D614G, A701V. Sequencing of the strain used in this report, from a case in the UK, shows only 8 changes and lacks L18F and R246I compared to the Tegaly et al. isolate. Coronavirus genome sequences were analysed in both the UK, acquired from the COG-UK database (Tatusov et al., 2000), and South Africa, acquired from GISAID (https://www.gisaid.org). It appears that B.1.1.7 and B.1.351 quickly become overwhelmingly dominant in the UK and South Africa respectively. In the evolution of both the B.1.1.7 variant in the UK, and the B.1.351 variant in South Africa, a substantial population of NTD-deletion-only mutants (469-70 in B.1.1.7 and 4242-244 in B.1.153) and 501Y-only mutants were observed in both countries preceding the rising dominance of strains harbouring both deletions and 501Y (
Example 19. Neutralization of B.1.351 by Convalescent Plasma
[0545] Plasma was collected from a cohort of infected patients during the first wave of SARS-CoV-2 infection in the UK. Samples were collected from convalescent cases 4-9 weeks following infection in June 2020, before the emergence of B.1.1.7. Also included is a recent collection of plasma from patients infected with B.1.1.7.
[0546] Neutralization titres against Victoria, an early Wuhan related strain of SARS-CoV-2 (Seemann et al., 2020), were compared to B.1.351 using a focus reduction neutralization test (FRNT). For the early convalescent samples (n=34), neutralization titres against B.1.351 were on average 13.3-fold reduced compared to Victoria (p=<0.0001) (
[0547] Neutralization was also performed using plasma recently collected, at different time points, from patients suffering from B.1.1.7 (n=13), all of these cases had S-gene knock out on diagnostic PCR (Thermo Fisher TaqPath, characteristic of B.1.1.7) and 11 had viral sequencing confirming B.1.1.7 (
Example 20. Neutralization of B.1.351 by Vaccine Serum
[0548] Neutralization was measured of Victoria and B.1.351 was using vaccine serum obtained from individuals vaccinated with the Pfizer-BioNTech vaccine BNT162b2 and Oxford-AstraZeneca AZD1222 vaccine. For Pfizer-BioNTech, vaccinated serum was obtained from healthcare workers (n=25), 4-17 days following the second dose of vaccine, administered 3 weeks after the first dose (
[0549] The Pfizer-BioNTech vaccine serum induced 3.6-fold higher neutralization titres against the Victoria strain than the Oxford-AstraZeneca vaccine (p=<0.0001). Although the overall reduction of titres was quite similar, 7.6-fold vs 9-fold respectively, because the AstraZeneca titres started from a lower base more of the samples failed to reach 50% FRNT titres against B.1.351 (9/25) than for the Pfizer vaccine (2/25).
Example 21. Neutralization of B.1.351 by Monoclonal Antibodies
[0550] The pool of 377 human monoclonal antibodies directed to the spike protein was raised from convalescent samples obtained from patients infected during the first wave of SARS-CoV-2 in the UK. The 20 most potent mAb (FRNT.sub.50 titres <50 g/ml), (19 anti-RBD and 1 anti-NTD) and performed neutralization assays against the UK B.1.1.7 strain, the Victoria strain and B.1.351 strains (
[0551] The effects on mAb neutralization were severe, 14/20 antibodies had >10-fold fall in neutralization titres, with most of these showing a complete knock out of activity. This is in line with the key role of K417, E484 and N501, in particular E484, in antibody recognition of the ACE2 interacting surface of the RBD described below and
[0552] Interestingly, the single potent NTD binding antibody included in these analyses mAb 159, also showed a complete knock out of activity against B.1.351 which contains deletion of amino acids 242-244 in the NTD part of the epitope for mAb 159. As can be seen from
Example 22. Neutralization of B.1.351 by Monoclonal Antibodies in Late Stage Clinical Trials
[0553] A number of monoclonal antibodies are in late stage clinical trials as therapy or prophylaxis against SARS-CoV2. Regeneron and AstraZeneca use cocktails of 2 monoclonal antibodies to give resistance to mutational escape of viruses. Neutralization assays were performed with the Regeneron pair REGN10933 and REGN10987 and the AstraZeneca pair of mAb AZD106 and AZD8895 and (
[0554] Table 12 shows that many of the most-potent mAbs against the Victoria strain retained high potency against the B.1.1.7 strain. In particular, mAbs 40, 55, 58, 222, 281, 316, 384, 394 and 398 maintained strong potency against B.1.1.7. A number of the most-potent mAbs also retained high potency against the South African strain (B.1.351). In particular, mAbs 55, 58, 150, 165, 222, 253, 278 and 318 retained strong potency against B.1.351.
Example 23. Understanding the Abrogation of Neutralisation: ACE2 Binding to B.1.351 RBD
[0555] The triple mutation K417N, E484R and N501Y is characteristic of the B.1.351 RBD. These residues are situated within the ACE2 footprint (
Example 24. Dissection of Impact of RBD Mutations on RBD Binding
[0556] To understand the order of magnitude of the abrogation in neutralisation of more than two thirds of the 19 potent mAbs that bind the RBD, the K.sub.D for binding to recombinant RBD was measured by BLI, (
[0557] The basis of these effects may be understood in the context of an anatomical description of the RBD, in terms of a human torso we have defined four almost contiguous structural epitopes, left shoulder, neck, right shoulder and right flank, with a separate left flank epitope (
[0558] Many of the reported Fab/SARS-CoV-2 RBD complexes are for antibodies which use the public HC V-region IGHV3-53 (Yuan et al., 2020) and these are well represented in the set by five antibodies that are potent against the Victoria virus. Four of these, 150, 158, 175 and 269, have their neutralization and binding abilities severely compromised or abolished, while 222 is an exception, since its binding is unaffected by the B.1.351 variant (
[0559] Fab 88 binds RBD at the back of the left shoulder, residues G104 and K108 of the HC CDR3 contact E484 meanwhile the LC CDR2 makes extensive hydrophobic interactions and a main chain hydrogen bond from Y51 and a salt bridge from D53 to K417 (
[0560] MAb 222 was not the only antibody to show resilience to B.1.351. The FRNT.sub.50 titres for mAbs 55, 165, 253 and 318 were also relatively equal between Victoria and B.1.351 indicating that their epitopes are not perturbed by the K417N, E484K and N501Y mutations. Antibodies 55, 165 and 253 are related to each other and it is shown that combining the light chains of 55 or 165 with the heavy chain of 253 leads to a >1 log increase in neutralization titres. The Chimeras 253H/55L and 253H/165L can both neutralize B.1.351 with FRNT.sub.50 titres of 9 and 13 ng/ml respectively. Structures of 253 and these chimera Fabs with either RBD or Spike show that they bind almost identically to the same epitope and don't contact any of the three mutation site residues, correlating well with the neutralization and BLI binding data (
Example 25. Methods for Examples 18 to 24
Viral Stocks
[0561] SARS-CoV-2/human/AUS/VIC01/2020 (Caly et al., 2020) and SARS-CoV-2/B.1.1.7, provided by Public Health England, were both grown in Vero (ATCC CCL-81) cells. Cells were infected with the SARS-CoV-2 virus using an MOI of 0.0001. Virus containing supernatant was harvested at 80% CPE and spun at 2000 rpm at 4 C. before storage at 80 C. Viral titres were determined by a focus-forming assay on Vero cells. Both Victoria passage 5 and B.1.157 passage 5 stocks were sequenced to verify that they contained the expected spike protein sequence and no changes to the furin cleavage sites. The B1.351 virus used in these studies contained the following mutations: D80A, D215G, L242-244 deleted, K417N, E484K, N501Y, D614G, A701V.
Bacterial Strains and Cell Culture
[0562] Vero (ATCC CCL-81) cells were cultured at 37 C. in Dulbecco's Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100 U/ml of penicillin-streptomycin. Human mAbs were expressed in HEK293T cells cultured in UltraDOMA PF Protein-free Medium (Cat #12-727F, LONZA) at 37 C. with 5% CO2.
[0563] E. coli DH5 bacteria were used for transformation of plasmid pNEO-RBD K417N, E484K, N501Y. A single colony was picked and cultured in LB broth with 50 g mL.sup. Kanamycin at 37 C. at 200 rpm in a shaker overnight. HEK293T (ATCC CRL-11268) cells were cultured in DMEM high glucose (Sigma-Aldrich) supplemented with 10% FBS, 1% 100 Mem Neaa (Gibco) and 1% 100 L-Glutamine (Gibco) at 37 C. with 5% CO.sub.2. To express RBD, RBD K417N, E484K, N501Y and ACE2, HEK293T cells were cultured in DMEM high glucose (Sigma) supplemented with 2% FBS, 1% 100 Mem Neaa and 1% 100 L-Glutamine at 37 C. for transfection.
Participants
[0564] Participants were recruited through three studies: Sepsis Immunomics [Oxford REC C, reference:19/SC/0296]), ISARIC/WHO Clinical Characterisation Protocol for Severe Emerging Infections [Oxford REC C, reference 13/SC/0149] and the Gastrointestinal illness in Oxford: COVID substudy [Sheffield REC, reference: 16/YH/0247]. Diagnosis was confirmed through reporting of symptoms consistent with COVID-19 and a test positive for SARS-CoV-2 using reverse transcriptase polymerase chain reaction (RT-PCR) from an upper respiratory tract (nose/throat) swab tested in accredited laboratories. A blood sample was taken following consent at least 14 days after symptom onset. Clinical information including severity of disease (mild, severe or critical infection according to recommendations from the World Health Organisation) and times between symptom onset and sampling and age of participant was captured for all individuals at the time of sampling.
Sera from Pfizer Vaccinees
[0565] Pfizer vaccine serum was obtained 7-17 days following the second dose of vaccine which was administered 3 weeks after the first dose (participants were to the best of their knowledge seronegative at entry).
[0566] The study was approved by the Oxford Translational Gastrointestinal Unit GI Biobank Study 16/YH/0247 [research ethics committee (REC) at Yorkshire & The Humber-Sheffield]. The study was conducted according to the principles of the Declaration of Helsinki (2008) and the International Conference on Harmonization (ICH) Good Clinical Practice (GCP) guidelines. Written informed consent was obtained for all patients enrolled in the study. Vaccinees were Health Care Workers, based at Oxford University Hospitals NHS Foundation Trust, not known to have prior infection with SARS-COV-2. Each received two doses of COVID-19 mRNA Vaccine BNT162b2, 30 micrograms, administered intramuscularly after dilution as a series of two doses (0.3 mL each) 18-28 days apart. The mean age of vaccines was 43 years (range 25-63), 11 male and 14 female.
AstraZeneca-Oxford Vaccine Study Procedures and Sample Processing
[0567] Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298). These studies were registered at ISRCTN (U.S. Pat. Nos. 15,281,137 and 89,951,424) and ClinicalTrials.gov (NCT04324606 and NCT04400838). A copy of the protocols was included in previous publications (PMID: 33220855/PMID: 32702298).
[0568] Data from vaccinated volunteers who received two vaccinations are included in this paper. Vaccine doses were either 510.sup.10 viral particles (standard dose; SD/SD cohort n=21) or half dose as their first dose (low dose) and a standard dose as their second dose (LD/SD cohort n=4). The interval between first and second dose was in the range of 8-14 weeks. Blood samples were collected and serum separated on the day of vaccination and on pre-specified days after vaccination e.g. 14 and 28 days after boost.
COG-UK Sequence Analysis
[0569] COG-UK sequences from the 2nd Feb. 2021 (Tatusov et al., 2000), and GISAID sequences (https://www.gisaid.org/) from South Africa from 30th Jan. 2021 were downloaded and the protein sequence for the Spike protein was obtained after nucleotide 21000, followed by sequence alignment and recognition of mutations. The B.1.351 variant was filtered using selection criteria 501Y and 4242. The B.1.1.7 variant was filtered using selection criteria 501Y and 469. The structural locations of mutations were modelled as red (single point mutations), black (deletions) or blue (additions) on the Spike structure with the size proportional to the logarithm of the incidence, and those mutations over 5% incidence in the population were explicitly labelled.
Focus Reduction Neutralization Assay (FRNT)
[0570] The neutralization potential of Ab was measured using a Focus Reduction Neutralization Test (FRNT), where the reduction in the number of the infected foci is compared to a no antibody negative control well. Briefly, serially diluted Ab or plasma was mixed with SARS-CoV-2 strain Victoria or B.1.351 and incubated for 1 hr at 37 C. The mixtures were then transferred to 96-well, cell culture-treated, flat-bottom microplates containing confluent Vero cell monolayers in duplicate and incubated for a further 2 hrs followed by the addition of 1.5% semi-solid carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion. A focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) approximately 100 per well in the absence of antibodies, were visualized by adding TrueBlue Peroxidase Substrate. Virus-infected cell foci were counted on the classic AID EliSpot reader using AID ELISpot software. The percentage of focus reduction was calculated and IC.sub.50 was determined using the probit program from the SPSS package.
Cloning of Native RBD, ACE2 and RBD K417N, E484K, N501Y
[0571] The constructs of native RBD and ACE2 are the same as in Zhou et al., (Zhou et al., 2020). A further construct comprising K417N, E484K, N501Y was generated using PCR, which is exactly the same protein as native RBD except the K417N, E484K and N501Y mutations, as confirmed by sequencing.
Protein Production
[0572] Protein production was as described in Zhou et al. (Zhou et al., 2020).
Bio-Layer Interferometry
[0573] BLI experiments were run on an Octet Red 96e machine (Fortebio). To measure the binding affinities of monoclonal antibodies and ACE2 with native RBD and RBD K417N, E484K, N501Y, each RBD was immobilized onto an AR2G biosensor (Fortebio). Monoclonal antibodies were used as analytes or serial dilutions of ACE2 were used as analytes. All experiments were run at 30 C. Data were recorded using software Data Acquisition 11.1 (Fortebio) and Data Analysis HT 11.1 (Fortebio) with a 1:1 fitting model used for analysis.
Example 26. Mutational Changes in P.1
[0574] P.1 was first reported in December 2020 from Manaus in Amazonas province of Northern Brazil (Faria et al., 2021). A large first wave of infection was seen in Manaus in March-June 2020 and by October around 75% of individuals from the region are estimated to have been infected, representing a very high attack rate. A second large wave of infection began in December 2020 leading to further hospitalizations. This second wave corresponded with the rapid emergence of P.1, not seen before December when it was found in 52% of cases, rising to 85% by January 2021 (
[0575] P.1 contains multiple changes compared to B.1.1.28 and P.2 which had been previously circulating in Brazil (Faria et al., 2021). Compared to the Wuhan sequence P.1 contains the following mutations: L18F, T20N, P26S, D138Y, R190S in the NTD, K417T, E484K, N501Y in the RBD, D614G and H655Y at the C-terminus of S1 and T1027I, V1176F in S2. The position of the changes seen in P.1 compared with those found in B.1.1.7 and B.1.351 together with a representation on where they occur on the full spike protein and RBD are shown in
[0576] It is noteworthy that P.1, B.1.1.7 and B.1.351 have accrued multiple mutations in the NTD, in B.1.1.7 there are two deletions 69-70 and 144, in B.1.351 four amino acid changes and the 242-244 deletion, while in P.1 there are 6 amino acid changes in the NTD but no deletions. Of note, two of the NTD changes in P.1 introduce N-linked glycosylation sequons T20N (TRT to NRT) and R190S (NLR to NLS,
Example 27. The Effects of RBD Mutations on ACE2 Affinity
[0577] The affinity of RBD/ACE2 interaction for Wuhan, B.1.1.7 (N501Y) and B.1.351 (K417N, E484K, N501Y) RBDs is measured in earlier examples. N501Y increased affinity 7-fold and the combination of 417, 484 and 501 mutations further increased affinity (19-fold compared to Wuhan). Here, the P.1 RBD (K417T, E484K, N501Y) was expressed. The K.sub.D for the P.1/ACE2 interaction is 4.8 nM with Kon=1.08E5/Ms, Koff=5.18E-4/s (
[0578] To better understand RBD-ACE2 interactions, the crystal structure of the RBD-ACE2 complex was determined at 3.1 resolution (Example 35, Table 17). The mode of RBD-ACE2 engagement is essentially identical for P.1 and the original Wuhan RBD sequence (
[0579] Residue 417 lies at the back of the RBD neck and in the original SARS-CoV-2 is a lysine residue which forms a salt-bridge with D30 of ACE2 (
[0580] Residue 484 lies atop the left shoulder of the RBD and neither the original Glu nor the Lys of P1 make significant contact with ACE2, nevertheless the marked change in charge substantially improves the electrostatic complementarity (
[0581] Residue 501 lies on the right shoulder of the RBD and the change from a relatively short Asn sidechain to the large aromatic Tyr allows for favourable ring stacking interactions consistent with increased affinity (
Example 28. Binding and Neutralisation of P.1 RBD by Potent Human Monoclonal Antibodies
[0582] From the panel of 20 potent antibodies which have focus reduction neutralization 50% (FRNT.sub.50) values <100 ng/ml, 19 of these mAbs have an epitope on the RBD and all of these block ACE2/RBD interaction, whilst mAb 159 binds the NTD. Biolayer interferometry (BLI) was used to measure the affinity of the RBD-binding antibodies and found that compared to Victoria (SARS-CoV-2/human/AUS/VIC01/2020), an early isolate of SARS-CoV-2, which has a single change S247R in S compared to the Wuhan strain (Seemann et al., 2020; Caly et al., 2020). Monoclonal antibody binding was significantly impacted with a number showing complete knock-out of activity (
Example 29. Neutralization of P.1 by Potent Human Monoclonal Antibodies
[0583] Using the same set of 20 potent antibodies, neutralization was measured by a focus reduction neutralization test (FRNT) and compared with neutralization of Victoria and variants B.1.1.7 and B.1.351. Compared to Victoria neutralization by the monoclonal antibodies was significantly impacted by P.1, with 12/20 showing >10-fold reduction in FRNT.sub.50 titre and a number showing complete knock out of activity (
Example 30. Reduced Neutralization of P.1 by Monoclonal Antibodies being Developed for Clinical Use
[0584] A number of potent neutralizing antibodies are being developed for clinical use either therapeutically of prophylactically (Ku et al., 2021; Baum et al., 2020; Kemp et al., 2021). Neutralization assays were performed against P.1 using antibodies 5309 Vir (Pinto et al., 2020), AZD8895 and AZD1061 AstraZeneca, REGN10987 and REGN10933 Regeneron, LY-CoV555 and LY-CoV16 Lilly and ADG10, ADG20 and ADG30 from Adagio (
Example 31. Reduced Neutralization by an NTD-Binding Antibody
[0585] The neutralization titre of NTD-binding mAb159, was 133-fold reduced on P.1 compared to Victoria with only 64% neutralization at 10 g/ml (
Example 32. Reduced Neutralization by VH3-53 Public Antibodies
[0586] Five of the potent monoclonal antibodies used herein (150, 158, 175, 222 and 269), belong to the VH3-53 family and a further 2 (out of 5 of this family) belong to the almost identical VH3-66, and the following discussion applies also to these antibodies. The binding sites for these have been described in the earlier examples. The large majority of these antibodies attach to the RBD in a very similar fashion. These motifs recur widely, VH3-53 are the most prevalent deposited sequences and structures for SARS-CoV-2 neutralizing antibodies. Their engagement with the RBD is dictated by CDR-H1 (SEQ ID NOs: 449, 452, 455, 458 and 461) and CDR-H2 (SEQ ID NOs: 450, 453, 456, 459 and 462) whilst the CDR-H3 (SEQ ID NOs: 451,454,457,460 and 463) is characteristically short and makes rather few interactions (Yuan et al., 2020; Barnes et al., 2020). The structures of mAbs 150, 158 and 269 have been solved (
[0587] Neutralization of P.1 by 175 and 158 is severely impacted and neutralization of P.1 by 269 is almost completely lost. However, for 150 P.1 neutralization is less compromised than for B.1.351 (Zhou et al., 2021), whilst for 222 neutralization is completely unaffected by the changes in P.1 and indeed all variants (
[0588] The affinity of 222 was measured for both P.1 (KD=1.920.01 nM) and Wuhan RBD (KD=1.360.08 nM) showing no reduction in the strength of interaction despite the changes occurring in the putative binding site for P.1 (Table 18).
[0589] To understand how 222 is able to still neutralize P.1, the crystal structures of six ternary complexes of 222 in complex with the RBDs was solved for (i) the original virus, and bearing mutations (ii) K417N; (iii) K417T; (iv) N501Y; the 417, 484 and 501 changes characteristic of B.1.351 (v) and P.1 (vi). All crystals also contained a further Fab, EY6A as a crystallization chaperone (Zhou et al., 2020), were isomorphous and the resolution of the structures ranged from 1.95 to 2.67 ,
[0590] In the original virus residue 417 makes a weak salt bridge interaction with heavy chain CDR3 residue E99. Mutation to either Asn or Thr abolishes this and there is little direct interaction, although there are weak (3.5 ) contacts to heavy chain Y52 and light chain Y92 (
[0591] Residue 501 makes contact with CDR-L1 of mAb 222 (SEQ ID NO: 468) (
Example 33. The 222 Light Chain can Rescue Neutralization by Other VH3-53 mAbs
[0592] Reasoning that the relative robustness of mAb 222 to common variants (P.1, B.1.1.7 and B.1.351) compared to other VH3-53 antibodies stems from the choice of light chain we modelled the 222LC with the heavy chains of other VH3-53 antibodies to see if they might be compatible (
[0593] A number of public antibody responses (antibodies derived from public v-genes) have been reported for SARS-CoV-2, principal amongst these being VH3-53/VH3-66 and VH1-58 (Yuan et al., 2020; Barnes et al., 2020). Mixing heavy and light chains from antibodies within VH1-58 can increase the neutralization titre by 20-fold from the parent antibodies (chimera of 253HC with 55LC or 165LC). Here it is shown that chimeras created amongst the VH3-53 antibodies using the 222LC are able to confer broad neutralization to antibodies which have reduced neutralization capacity against the viral variants. Furthermore, the chimera of 150HC with 222LC achieved 13 and 3-fold increases in neutralization titre compared to the parental 150 and 222 mAb respectively. Due to the similarities between VH3-53 and VH3-66, chimeras between heavy chain and light chains of such antibodies are also expected to lead to an increase in neutralisation titres in a similar fashion. Creation of such antibody chimeras amongst other anti-SARS-CoV2 antibodies may similarly lead to the discovery of more antibodies with enhanced activity.
Example 34. Neutralization of P.1 by Convalescent Plasma and Vaccine Serum
[0594] As described in earlier examples, convalescent plasma samples were collected from a cohort of volunteers who had suffered from SARS-CoV-2 infection evidenced by a positive diagnostic PCR. Samples were collected during the convalescent phase, 4-9 weeks following infection, all samples were taken during the first wave of infection in the UK, prior June 2020 and well before the emergence of the B.1.1.7 variant. Plasma was also collected from volunteers recently infected with B.1.1.7 as demonstrated by viral sequencing or S gene drop out from the diagnostic PCR.
[0595] Neutralization of P.1 was assessed by FRNT on 34 convalescent samples (
[0596] Neutralization assays were next performed using serum collected from individuals who had received either the BNT162b2 Pfizer-BioNTech or ChAdOx1 nCoV-19 Oxford-AstraZeneca vaccine
[0597] Neutralization titres against P.1 were similar to those against B.1.1.7 and only a minority of samples failed to reach 100% neutralization at 1:20 dilution of serum, considerably better than neutralization of B.1.351, where titres were reduced 7.6-fold and 9-fold for the BNT162b2 Pfizer and ChAdOx1 nCoV-19 AstraZeneca vaccines respectively.
[0598] The reason for the differences in neutralization of B.1.351 and P.1 by immune serum are not immediately clear, but may reflect the difference in the mutations introduced outside the RBD. In addition to mAb 159, a number of potent neutralizing mAbs have been reported that map to the NTD (Cerutti et al., 2021), and this domain has multiple mutations in all three major variant strains: B.1.1.7 has two deletions, B.1.351 has a deletion and four substitutions and P.1 has 6 amino acid substitutions, including the creation of two N-linked glycan sequons (
Example 35. Materials and Methods for Examples 26 to 34
Viral Stocks
[0599] SARS-CoV-2/human/AUS/VIC01/2020 (Caly et al., 2020), SARS-CoV-2/B.1.1.7 and SARS-CoV-2/B.1.351 were provided by Public Health England, P.1 from a throat swab from Brazil were grown in Vero (ATCC CCL-81) cells. Cells were infected with the SARS-CoV-2 virus using an MOI of 0.0001. Virus containing supernatant was harvested at 80% CPE and spun at 3000 rpm at 4 C. before storage at 80 C. Viral titres were determined by a focus-forming assay on Vero cells. Victoria passage 5, B.1.1.7 passage 2 and B.1.351 passage 4 stocks were sequenced to verify that they contained the expected spike protein sequence and no changes to the furin cleavage sites. The P.1 virus used in these studies contained the following mutations: L18F, T20N, P26S, D138Y, R190S, K417T, E464K, N501Y, D614G, H655Y, T1027I, V1176F. Passage 1 P.1 virus was sequence confirmed and contained no changes to the furin cleavage site.
Bacterial Strains and Cell Culture
[0600] Vero (ATCC CCL-81) cells were cultured at 37 C. in Dulbecco's Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100 U/ml of penicillin-streptomycin. Human mAbs were expressed in HEK293T cells cultured in UltraDOMA PF Protein-free Medium (Cat #12-727F, LONZA) at 37 C. with 5% CO.sub.2. E. coli DH5 bacteria were used for transformation of plasmids encoding wt and mutated RBD proteins. A single colony was picked and cultured in LB broth with 50 g mL.sup.1 Kanamycin at 37 C. at 200 rpm in a shaker overnight. HEK293T (ATCC CRL-11268) cells were cultured in DMEM high glucose (Sigma-Aldrich) supplemented with 10% FBS, 1% 100 Mem Neaa (Gibco) and 1% 100 L-Glutamine (Gibco) at 37 C. with 5% CO.sub.2. To express RBD, RBD K417T, E484K, N501Y, RBD K417N, RBD K417T, RBD E484K and ACE2, HEK293T cells were cultured in DMEM high glucose (Sigma) supplemented with 2% FBS, 1% 100 Mem Neaa and 1% 100 L-Glutamine at 37 C. for transfection.
Participants
[0601] Participants were recruited through three studies: Sepsis Immunomics [Oxford REC C, reference:19/SC/0296]), ISARIC/WHO Clinical Characterisation Protocol for Severe Emerging Infections [Oxford REC C, reference 13/SC/0149] and the Gastrointestinal illness in Oxford: COVID sub study [Sheffield REC, reference: 16/YH/0247]. Diagnosis was confirmed through reporting of symptoms consistent with COVID-19 and a test positive for SARS-CoV-2 using reverse transcriptase polymerase chain reaction (RT-PCR) from an upper respiratory tract (nose/throat) swab tested in accredited laboratories. A blood sample was taken following consent at least 14 days after symptom onset. Clinical information including severity of disease (mild, severe or critical infection according to recommendations from the World Health Organisation) and times between symptom onset and sampling and age of participant was captured for all individuals at the time of sampling.
[0602] P.1 virus from throat swabs. The International Reference Laboratory for Coronavirus at FIOCRUZ (WHO) as part of the national surveillance for coronavirus had the approval of the FIOCRUZ ethical committee (CEP 4.128.241) to continuously receive and analyze samples of COVID-19 suspected cases for virological surveillance. Clinical samples (throat swabs) containing P.1 were shared with Oxford University, UK under the MTA IOC FIOCRUZ 21-02.
Sera from Pfizer Vaccinees
[0603] Pfizer vaccine serum was obtained 7-17 days following the second dose of the BNT162b2 vaccine. Vaccinees were Health Care Workers, based at Oxford University Hospitals NHS Foundation Trust, not known to have prior infection with SARS-CoV-2 and were enrolled in the OPTIC Study as part of the Oxford Translational Gastrointestinal Unit GI Biobank Study 16/YH/0247 [research ethics committee (REC) at Yorkshire & The Humber-Sheffield]. The study was conducted according to the principles of the Declaration of Helsinki (2008) and the International Conference on Harmonization (ICH) Good Clinical Practice (GCP) guidelines. Written informed consent was obtained for all patients enrolled in the study. Each received two doses of COVID-19 mRNA Vaccine BNT162b2.30 micrograms, administered intramuscularly after dilution as a series of two doses (0.3 mL each) 18-28 days apart. The mean age of vaccines was 43 years (range 25-63), 11 male and 14 female.
AstraZeneca-Oxford Vaccine Study Procedures and Sample Processing
[0604] Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298). These studies were registered at ISRCTN (U.S. Pat. Nos. 15,281,137 and 89,951,424) and ClinicalTrials.gov (NCT04324606 and NCT04400838). Written informed consent was obtained from all participants, and the trial is being done in accordance with the principles of the Declaration of Helsinki and Good Clinical Practice. The studies were sponsored by the University of Oxford (Oxford, UK) and approval obtained from a national ethics committee (South Central Berkshire Research Ethics Committee, reference 20/SC/0145 and 20/SC/0179) and a regulatory agency in the United Kingdom (the Medicines and Healthcare Products Regulatory Agency). An independent DSMB reviewed all interim safety reports. A copy of the protocols was included in previous publications (PMID: 33220855/PMID: 32702298).
[0605] Data from vaccinated volunteers who received two vaccinations are included in this paper. Vaccine doses were either 510 10 viral particles (standard dose; SD/SD cohort n=21) or half dose as their first dose (low dose) and a standard dose as their second dose (LD/SD cohort n=4). The interval between first and second dose was in the range of 8-14 weeks. Blood samples were collected and serum separated on the day of vaccination and on pre-specified days after vaccination e.g. 14 and 28 days after boost.
Focus Reduction Neutralization Assay (FRNT)
[0606] The neutralization potential of Ab was measured using a Focus Reduction Neutralization Test (FRNT), where the reduction in the number of the infected foci is compared to a negative control well without antibody. Briefly, serially diluted Ab or plasma was mixed with SARS-CoV-2 strain Victoria or P.1 and incubated for 1 hr at 37 C. The mixtures were then transferred to 96-well, cell culture-treated, flat-bottom microplates containing confluent Vero cell monolayers in duplicate and incubated for a further 2 hrs followed by the addition of 1.5% semi-solid carboxymethyl cellulose (CMC) overlay medium to each well to limit virus diffusion. A focus forming assay was then performed by staining Vero cells with human anti-NP mAb (mAb206) followed by peroxidase-conjugated goat anti-human IgG (A0170; Sigma). Finally, the foci (infected cells) approximately 100 per well in the absence of antibodies, were visualized by adding TrueBlue Peroxidase Substrate. Virus-infected cell foci were counted on the classic AID EliSpot reader using AID ELISpot software. The percentage of focus reduction was calculated and IC50 was determined using the probit program from the SPSS package.
Cloning of ACE2 and RBD Proteins
[0607] The constructs of EY6A Fab, 222 Fab, ACE2, WT RBD, B.1.1.7 and B.1.351 mutant RBD are the same as described in earlier examples. To clone RBD K417T and RBD K417N, primers of RBD K417T (forward primer 5-GGGCAGACCGGCACGATCGCCGACTAC-3 (SEQ ID NO: 424) and reverse primer5-GTAGTCGGCGATCGTGCCGGTCTGCCC (SEQ ID NO: 425)) and primers of RBD K417N (forward primer 5-CAGGGCAGACCGGCAATATCGCCGACTACAATTAC-3 (SEQ ID: 426) and reverse primer 5-GTAATTGTAGTCGGCGATATTGCCGGTCTGCCCTG-3 (SEQ ID NO: 427)) were used separately, together with two primers of pNEO vector (Forward primer 5-CAGCTCCTGGGCAACGTGCT-3 (SEQ ID NO: 422) and reverse primer 5-CGTAAAAGGAGCAACATAG-3 (SEQ ID NO: 423)) to do PCR, with the plasmid of WT RBD as the template. To clone P.1 RBD, the construct of B.1.351 RBD was used as the template and the primers of RBD K417T and of pNEO vector mentioned above were used to do PCR. Amplified DNA fragments were digested with restriction enzymes AgeI and KpnI and then ligated with digested pNEO vector. All constructs were verified by sequencing.
Protein Production
[0608] Protein production was as described in Zhou et al. (Zhou et al., 2020). Briefly, plasmids encoding proteins were transiently expressed in HEK293T (ATCC CRL-11268) cells. The conditioned medium was dialysed and purified with a 5-ml HisTrap nickel column (GE Healthcare) and further polished using a Superdex 75 HiLoad 16/60 gel filtration column (GE Healthcare).
Bio-Layer Interferometry
[0609] BLI experiments were run on an Octet Red 96e machine (Fortebio). To measure the binding affinity of ACE2 with P.1 RBD and affinities of monoclonal antibodies and ACE2 with native RBD and, RBD K417N, RBD K417T, RBD E484K and RBD K417T E484K N501Y, each P.1 RBD, each RBD was immobilized onto an AR2Gbiosensor (Fortebio). Monoclonal antibodies were used as analytes or serial dilutions of ACE2 were used as analytes. All experiments were run at 30 C. Data were recorded using software Data Acquisition 11.1 (Fortebio) and Data Analysis HT 11.1 (Fortebio) with a 1:1 fitting model used for the analysis.
Antibody Production
[0610] AstraZeneca and Regeneron antibodies were provided by AstraZeneca, Vir, Lilly and Adagio antibodies were provided by Adagio. For the chimeric antibodies heavy and light chains of the indicated antibodies were transiently transfected into 293Y cells and antibody purified from supernatant on protein A.
Crystallisation
[0611] ACE2 was mixed with P.1 RBD in a 1:1 molar ratio to a final concentration of 12.5 mg ml.sup.1. EY6A Fab, 222 Fab and WT or mutant RBD were mixed in a 1:1:1 molar ratio to a final concentration of 7.0 mg ml 1. All samples were incubated at room temperature for 30 min. Most crystallization experiments was set up with a Cartesian Robot in Crystalquick 96-well X plates (Greiner Bio-One) using the nanoliter sitting-drop vapor-diffusion method, with 100 nl of protein plus 100 nl of reservoir in each drop, as previously described (Water et al., 2003). Crystallization of B.1.1.7 RBD/EY6A/222 complex was set up by hand pipetting, with 500 nl of protein plus 500 nl of reservoir in each drop. Good crystals of EY6A Fab and 222 Fab complexed with WT, K417T, K417N, B.1.1.7, B.1.351 or P.1 RBD were all obtained from Hampton Research PEGRx 2 screen, condition 35, containing 0.15 M Lithium sulfate, 0.1 M Citric acid pH 3.5, 18% w/v PEG 6,000. Crystals of P.1 RBD/ACE2 complex were formed in Hampton Research PEGRx 1 screen, condition 38, containing 0.1 M Imidazole pH 7.0.
X-Ray Data Collection, Structure Determination and Refinement
[0612] Crystals of ternary complexes of WT and mutant RBD/EY6A and 222 Fabs were mounted in loops and dipped in solution containing 25% glycerol and 75% mother liquor for a second before being frozen in liquid nitrogen prior to data collection. No cryo-protectant was used for the P.1. RBD/ACE2 crystals. Diffraction data were collected at 100 K at beamline I03 of Diamond Light Source, UK. All data (except some of the WT RBD-EY6A-222 Fab complex images) were collected as part of an automated queue system allowing unattended automated data collection (https://www.diamond.ac.uk/Instruments/Mx/I03403-Manual/Unattended-Data-Collections.html). Diffraction images of 0.1 rotation were recorded on an Eiger2 XE 16M detector (exposure time of either 0.004 or 0.006 s per image, beam size 8020 m, 100% beam transmission and wavelength of 0.9763 ). Data were indexed, integrated and scaled with the automated data processing program Xia2-dials (Winter, 2010; Winter et al., 2018). A data set of 1080 was collected from 3 positions of a frozen crystal for the WT RBD-EY6A-222 Fab complex. 720 of data was collected for each of the B.1.1.7, P.1 and B.1.351 mutant RBD/EY6A and 222 Fab complexes (each from 2 crystals), and 360 for each of the K417N and K417T RBD with EY6A and 222 Fabs, and ACE2 complexes was collected from a single crystal.
[0613] Structures of WT RBD-EY6A-222 and the P.1 RBD-ACE2 complexes were determined by molecular replacement with PHASER (McCoy et al., 2007) using search models of SARS-CoV-2 RBD-EY6A-H4 (PDB ID 6ZCZ) (Zhou et al., 2020) and RBD-158 (PDB ID, 7BEK) complexes, and a RBD and ACE2 complex (PDB ID, 6LZG (Wang et al., 2020)), respectively. Model rebuilding with COOT (Emsley and Cowtan, 2004) and refinement with PHENIX (Liebschner et al., 2019) were done for all the structures. The ChCl domains of EY6A are flexible and have poor electron density. Data collection and structure refinement statistics are given in Table 51. Structural comparisons used SHP (Stuart et al., 1979), residues forming the RBD/Fab interface were identified with PISA (Krissinel and Henrick, 2007) and figures were prepared with PyMOL (The PyMOL Molecular Graphics System, Version 1.2r3pre, Schrdinger, LLC).
Quantification and Statistical Analysis
[0614] Statistical analyses are reported in the results and figure legends. Neutralization was measured by FRNT. The percentage of focus reduction was calculated and IC50 was determined using the probit program from the SPSS package. The Wilcoxon matched-pairs signed rank test was used for the analysis and two-tailed P values were calculated and geometric mean values. BLI data were analysed using Data Analysis HT 11.1 (Fortebio) with a 1:1 fitting model.
Example 36. Cross-Reactivity of mAbs
[0615] Live virus neutralization assays were performed using the following viruses, containing the indicated changes in the RBD: Victoria, an early Wuhan related strain, Alpha (N501Y), Beta (K417N, E484K, N501Y), Gamma (K417T, E484K, N501Y), Delta (L452R, T478K), and Omicron (G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H)(
[0616] Mabs 58, 222, 253, 253H55L, from early pandemic samples, show neutralization of Omicron. In particular, Mabs 58 and 222 retain potent neutralisation of omicron. Mab 222 potently neutralizes all strains tested. Mab 58 potently neutralizes all strains except for Delta.
Example 37. Further Neutralisation Data of Selected Antibodies Against SARS-CoV-2 Antibodies
[0617] Further neutralisation experiments were carried out to determine the neutralisation of SARS-CoV-2 variants by selected antibodies. As discussed in the detailed description above, antibodies derived from the same heavy chain V-gene may swap light chains to result in an antibody comprising the heavy chain variable region of a first antibody and a light chain variable region of a second antibody, and such new antibodies may have improved neutralisation and/or other characteristics when compared to the parent antibodies.
[0618] Tables 21 to 25 provide examples of such antibodies that may be created by swapping the light chain between antibodies derived from the same heavy chain V-gene.
[0619] Tables 27 to 28 provide further neutralisation data for selected antibodies and antibodies created by swapping the light chain between antibodies derived from the same heavy chain V-gene. Almost all the antibodies created by swapping the light chain between antibodies derived from the same heavy chain V-gene exhibit improved neutralisation when compared to the parent antibodies. The data in
Tables
[0620]
TABLE-US-00004 TABLE 1 SEQ ID NOs of selected antibodies Heavy Heavy Light Light Chain Chain Chain Chain Antibody protein nucleotide protein nucleotide number sequence sequence sequence sequence CDRH1 CDRH2 CDRH3 CDRL1 CDRL2 CDRL3 2 2 1 4 3 5 6 7 8 9 10 22 12 11 14 13 15 16 17 18 19 20 40 22 21 24 23 25 26 27 28 29 30 44 32 31 34 33 35 36 37 38 39 5 45 42 41 44 43 45 46 47 48 49 50 54 52 51 54 53 55 56 57 58 59 60 55 62 61 64 63 65 66 67 68 69 70 58 72 71 74 73 75 76 77 00 79 80 61 82 81 84 83 85 86 87 88 89 90 75 92 91 94 93 95 96 9 98 99 100 88 102 101 104 103 105 106 107 108 109 110 111 112 111 114 113 115 116 117 118 119 120 132 122 121 124 123 125 126 127 128 129 130 140 132 131 134 133 135 136 137 138 139 140 148 142 141 144 143 145 146 147 148 149 150 150 152 151 154 153 155 156 157 158 159 160 158 162 161 164 163 165 166 167 168 169 170 159 172 171 174 173 175 176 177 178 179 180 165 182 181 184 183 185 186 187 188 189 190 170 192 191 194 193 195 196 197 198 199 200 175 202 201 204 203 205 206 207 208 209 210 177 212 211 214 213 215 216 217 218 219 220 181 222 221 224 223 225 226 227 228 229 230 182 232 231 234 233 235 236 237 238 239 240 183 242 241 244 243 245 246 247 248 249 250 222 252 251 254 253 255 256 257 258 259 260 253 262 261 264 263 265 266 267 268 269 270 253H55L 262 261 64 63 265 266 267 68 69 70 253H165L 262 261 184 183 265 266 267 188 189 190 269 272 271 274 273 275 276 277 278 279 280 278 282 281 284 283 285 286 287 288 289 290 281 292 291 294 293 295 296 297 298 299 300 282 302 301 304 303 305 306 307 308 309 310 285 312 311 314 313 315 316 317 318 319 320 316 322 321 324 323 325 326 327 328 329 330 318 332 331 334 333 335 336 337 338 339 340 334 342 341 344 343 345 346 347 348 349 350 361 352 351 354 353 355 356 357 358 359 360 382 362 361 364 363 365 366 367 368 369 370 384 372 371 374 373 375 376 377 378 379 380 394 382 381 384 383 385 386 387 388 389 390 398 392 391 394 393 395 396 397 398 399 400
TABLE-US-00005 TABLE 2 Summary of SARS-CoV-2-infected patients enrolled in the study. Participants Female 16 Male 26 Average Age (y) 55.4 (IQR 47-61) Days post-symptom onset 45.5 (IQR 40-53) Disease severity Asymptomatic 1 (2.4%) Mild 28 (66.6%) Severe 12 (28.6%) Critical 1 (2.4%)
TABLE-US-00006 TABLE 3 Neutralisation and biolayer interferometry (BLI) measurements of affinity (KD) and on (Ka) and off (Kdis) rates for selected mAbs (except for 159 BLI measurements are for Fabs) Neutralisation IC.sub.50 KD (nM) Ka (1/Ms) Kdis (1/s) IgG (ug/ml)# $ $ $ 45 2.005* 5.9 7.8E04 4.6E04 55 0.037 0.008 3.6 1.1E05 3.9E04 58 0.046 0.016 3.4 1.0E05 3.6E04 132 0.054 0.014 3.1 1.1E05 3.3E04 148 6.734* 4.0 7.6E04 3.0E04 150 0.023 0.003 0.9 2.1E05 1.9E04 158 0.034 0.003 0.7 1.2E05 8.4E05 165 0.021 0.006 4.8 7.0E04 3.3E04 170 0.025* 2.7 1.7E05 4.5E04 175 0.033 0.009 2.4 2.8E05 6.5E04 222 0.016 0.003 3.0 1.2E05 3.5E04 253 0.040 0.007 4.5 1.4E05 6.1E04 253H55L 0.004 0.000 1.5 3.0E05 4.5E04 253H165L 0.003 0.000 3.1 1.2E05 3.9E04 269 0.036 0.009 2.2 1.8E05 3.9E04 278 0.009 0.002 3.0 2.6E05 7.8E04 281 0.005 0.001 1.0 2.3E05 2.3E04 282 0.073 0.009 1.5 1.6E05 2.4E04 316 0.010 0.002 2.0 3.5E05 7.1E04 318 0.015 0.002 7.6 6.7E04 5.1E04 384 0.002 0.001 2.7 1.1E05 2.9E04 159 (anti-spike) 0.005 0.001 1.1 5.7E05 6.3E04 #Neutralisation activity of selected antibodies against SARS-CoV-2 were determined by FRNT. Data are from 3 independent experiments, each with duplicate wells and the data are shown as mean s.e.m. *FRNT was performed once with duplicate well. $ Determined for Fab fragments
TABLE-US-00007 TABLE 4 Pairs of non-competing antibodies from Cluster Analysis with potency threshold of <0.1 ug/ml IC.sub.50 max 20% competition <0.1 ug/ml IC.sub.50 55 58 55 278 58 88 58 132 58 150 58 158 58 165 58 175 58 222 58 282 88 278 132 278 150 278 158 278 165 278 175 278 222 278 278 282
TABLE-US-00008 TABLE 5 Pairs of non-competing antibodies from Cluster Analysis with potency threshold of <1 ug/ml IC.sub.50 max 20% competition <1 ug/ml IC.sub.50 40 318 40 334 40 382 55 58 61 55 61 278 55 61 318 55 61 334 55 61 361 55 61 382 58 61 165 58 61 175 58 88 58 132 58 150 58 158 58 222 58 282 61 165 278 61 165 318 61 165 334 61 165 361 61 165 382 61 170 334 61 175 278 61 175 318 61 175 334 61 175 361 61 175 382 61 181 334 61 182 334 61 183 334 61 281 334 61 316 334 61 334 384 61 334 394 61 334 398 88 278 88 318 88 334 88 361 88 382 132 278 132 318 132 334 132 361 132 382 150 278 150 318 150 334 150 361 150 382 158 278 158 318 158 334
TABLE-US-00009 TABLE 6 Stability tests for selected antibodies using thermofluor and dynamic light scattering (DLS). Fraction Thermofluor (reporter dye) DLS @ 20 C soluble after Prop Prop Pk1 N freeze- Antibody n of n of est Pk1 thaw cycles id Tm 1 melt Tm 2 melt MW % mass N = 5 N = 20 2 78.4 146.25 100 22 80.7 177.55 99.98 40 73.8 215.20 100.00 0.9 0.8 44 77.6 0.9 89.1 0.1 685.57* 100.00 45 75.9 0.3 86.6 0.8 146.17 100.00 1.0 0.8 54 71.9 0.9 87.2 0.1 177.31 99.71 55 75.9 0.4 86.7 0.7 215.20 99.83 1.0 0.9 58 80.6 213.93 99.98 0.9 0.9 61 75.9 0.9 87.1 0.1 146.17 100.00 75 75.3 0.4 84.1 0.7 215.08 100.00 0.9 1.0 88 73.3 213.93 100.00 1.0 0.9 111 80.1 214.23 100.00 132 69.1 0.7 79.7 0.3 146.25 99.96 1.0 0.6 140 79.0 260.07 99.90 148 75.4 0.3 85.4 0.7 213.93 99.98 150 71.1 0.9 89.1 0.1 176.08 100.00 1.0 0.7 158 76.4 0.9 88.4 0.1 213.93 99.91 1.0 0.9 165 78.2 177.31 100.00 1.0 1.0 170 64.9 0.8 76.1 0.2 Out of 99.16 0.9 1.0 range 175 74.3 215.08 100.00 1.0 0.9 177 74.3 176.08 99.93 222 76.7 214.05 100.00 0.9 0.9 253 75.9 146.17 100.00 1.0 0.9 269 73.7 214.90 100.00 0.9 0.8 278 76.2 1.0 88.0 0.1 316.65 100.00 1.0 0.8 281 70.5 214.23 100.00 0.9 0.8 282 70.8 0.9 88.3 0.1 215.08 99.99 0.9 0.9 316 74.9 465.66 100.00 0.9 0.9 318 72.1 0.9 86.7 0.1 144.84 100.00 384 74.9 0.9 88.0 0.1 146.17 100.00 1.0 0.8 253H165L 74.5 0.6 86.4 0.4 176.08 100.00 0.9 0.7 253H55L 74.2 0.6 87.3 0.4 175.84 100.00 0.9 0.9
TABLE-US-00010 TABLE 7 X-ray data collection and refinement statistics (molecular replacement). RBD- RBD-88- RBD-158 RBD-158 RBD-253- 253H55L- RBD- RBD-384- 45 RBD-150 (form 1) (form 2) 75 75 scFV269 RBD-316 S309 Data collection Space C2 C222.sub.1 C222.sub.1 C222.sub.1 P2.sub.12.sub.12.sub.1 P2.sub.1 P6.sub.222 P2.sub.12.sub.12 P2.sub.12.sub.12.sub.1 group Cell 180.1, 81.4, 53.2, 83.0, 93.2, 93.4, 173.6, 104.0, 108.8, dimensions 140.7, 150.7, 232.3, 149.4, 149.8, 150.1, 173.6, 150.9, 113.2, ().sup.a, b, c 131.0 145.5 135.2 145.5 229.1 116.1 120.6 46.0 302.8 , , () 90, 124.6, 90, 90, 90 90, 90, 90 90, 90, 90 90, 90, 90 90, 92.0, 90, 90, 90, 90, 90 90, 90, 90 90 90 120 Resolution 59-2.53 52-2.30 53-2.42 51-2.04 59-2.50 66-3.19 57-2.52 52-2.30 63-2.61 () (2.57- (2.34- (2.46- (2.08- (2.54- (3.25- (2.56- (2.34- (2.65- 2.53).sup.b 2.30) 2.42) 2.04) 2.50) 3.19) 2.52) 2.30) 2.61) .sup.Rmerge 0.189 () 0.192 0.250 () 0.118 () 0.283 () 0.412 () 0.432 () 0.107 () 0.112 () (0.990) .sup.Rpim 0.079 0.039 0.051 0.033 0.056 0.169 0.051 0.032 0.032 (1.101) (0.362) (0.781) (1.296) (1.526) (1.189) (2.921) (1.042) (0.982) I/(I) 5.6 (0.3) 12.5 (0.5) 7.6 (0.4) 13.1 (0.5) 7.3 (0.3) 4.0 (0.5) 9.2 (0.2) 14.2 (0.6) 13.1 (0.5) CC.sub.1/2 0.995 0.997 0.993 0.999 0.999 0.977 0.999 0.998 0.998 (0.326) (0.651) (0.363) (0.345) (0.623) (0.280) (0.627) (0.223) (0.344) Completeness 97.8 84.4 98.5 99.9 100 100 99.9 85.7 100 (%) (75.6) (42.8) (85.2) (97.2) (99.5) (99.5) (96.3) (40.2) (99.1) Redundancy 6.6 (5.0) 22.0 (8.2) 23.7 (13.5) 13.4 (9.9) 26.6 (24.8) 6.9 (7.1) 73.4 (54.1) 11.0 (4.9) 13.3 (12.3) Refinement Resolution 49-2.53 43-2.30 53-2.42 43-2.04 58-2.50 58-3.19 47-2.52 45-2.30 63-2.61 () No. 81142/ 30799/ 30107/ 54733/ 105179/ 50411/ 33910/ 26846/ 108562/ reflections 4196 1567 1610 2897 5570 2657 1753 1392 5577 R.sub.work/R.sub.free 0.250/ 0.197/ 0.195/ 0.194/ 0.242/ 0.232/ 0.217/ 0.218/ 0.206/ 0.285 0.236 0.229 0.216 0.284 0.274 0.248 0.233 0.241 No. atoms Protein 13221 4787 4777 4816 16052 16152 3235 4768 16682 Ligand/ion 158 47 68 98 187 177 47 104 234 B factors (.sup.2) Protein 70 49 58 63 73 90 91 60 98 Ligand/ion 86 84 82 98 97 114 139 74 124 r.m.s. deviations Bond 0.003 0.005 0.003 0.005 0.002 0.002 0.003 0.002 0.003 lengths () Bond 0.7 0.8 0.6 0.8 0.6 0.5 0.6 0.5 0.6 angles () .sup.aPresence of translational NCS. .sup.bValues in parentheses are for highest-resolution shell
TABLE-US-00011 TABLE 8 Cryo-EM data collection, refinement and validation statistics for spike/COVOX- Fab(IgG) complexes. Numbers in brackets refer to the 30 tilted dataset that was merged with the 0 data. Square brackets provide values for C1 symmetry. *, Rigid body refinement only. 158* 150 (EMD- 316 384 40 (EMD- 88 (EMD- ID, (EMD-ID, (EMD-ID, ID, PDB (EMD-ID, ID, PDB PDB PDB PDB XXX) PDB XXX) XXX) XXX) XXX) XXX) Data collection & processing Voltage (kV) 300 Electron exposure (e.sup./.sup.2) 43.1 57.6 48.8 45.3 46.0 47.7 Defocus range (m) 0.8 to 2.6 Pixel size [super res] () 0.83 [0.415] 0.82 0.82 0.8 0.82 0.8 Symmetry imposed C1 C3 C1 C1 C3 C1 Particles in final 39186 56686 93555 18768 162,905 73,158 reconstruction (no.) Map resolution () 3.7 3.6 3.4 7.3 3.6 3.5 FSC threshold 0.143 0.143 0.143 0.143 0.143 0.143 Refinement Initial model (PDB ID) 6Z97 6ZDH 6Z97 6Z97 6VXX 6VXX RBD conformation One-up All-up One-up One-up All-down All-down Model res. (Masked) () 3.8 3.3 3.8 7.9 3.8 3.7 FSC threshold 0.5 0.5 0.5 0.5 0.5 0.5 Sharpening B (.sup.2) 83 56 45 369 90 48 Model composition Non-H atoms 23467 24303 23467 25152 29655 26133 Protein residues 2975 3006 2975 3197 3699 3237 Ligands 49 60 49 49 69 63 B factors (.sup.2) Protein 124 79 102 390 112 89 Ligand 120 110 91 414 195 121 R.m.s. deviations Bond lengths () 0.003 0.019 0.009 0.026 0.006 0.007 Bond angles () 0.5 1.0 0.8 1.6 0.9 0.9 Validation MolProbity score 1.44 1.54 1.68 2.09 1.53 1.50 Clashscore 3.81 4.84 7.07 17.0 5.17 4.21 Poor rotamers (%) 0.97 0.23 1.01 1.09 0.66 1.13 Ramachandran plot Flavored (%) 96.0 95.8 95.9 95.2 96.3 96.2 Allowed (%) 3.9 3.6 4.1 4.5 3.6 3.6 Disallowed (%) 0 0.6 0 0.3 0.2 0.2 159 159* 253H55L 253H55L 253H165L* (EMD- (EMD- (EMD-ID, (EMD-ID, (EMD-ID, ID, PDB ID, PDB PDB XXX) PDB XXX) PDB XXX) XXX) XXX) Data collection & processing Voltage (kV) Electron exposure (e.sup./.sup.2) 47.2 47.2 44.7 50.5 50.5 Defocus range (m) Pixel size [super res] () 0.83 [0.415] 0.83 [0.415] 0.83 [0.415] 0.82 0.82 Symmetry imposed C1 C1 C1 C3 C1 Particles in final 206,548 47,242 31,477 13638 27880 reconstruction (no.) Map resolution () 2.8 3.3 4.6 [5.1] 4.1 [4.3] 4.2 [4.3] FSC threshold 0.143 0.143 0.143 0.143 0.143 Refinement Initial model (PDB ID) 6Z97 6VXX 6Z97 PDB mix PDB mix RBD conformation One-up All-down One-up All-down One-up Model res. (Masked) () 3.1 3.7 5.0 5.0 6.7 FSC threshold 0.5 0.5 0.5 0.5 0.5 Sharpening B (.sup.2) 61 37 133 61 49 Model composition Non-H atoms 23790 23694 23467 31035 31035 Protein residues 3018 2916 2975 3879 3879 Ligands 47 63 49 54 54 B factors (.sup.2) Protein 106 193 231 126 137 Ligand 106 213 239 198 206 R.m.s. deviations Bond lengths () 0.009 0.009 0.011 0.005 0.010 Bond angles () 0.8 0.9 0.8 0.7 0.9 Validation MolProbity score 2.01 1.55 1.76 1.56 1.78 Clashscore 6.35 7.15 8.72 5.14 8.35 Poor rotamers (%) 2.54 0.23 0.97 0.80 0.86 Ramachandran plot Flavored (%) 94.9 97.2 95.9 95.8 95.3 Allowed (%) 4.7 2.6 4.4 4.1 4.4 Disallowed (%) 0.5 0.2 0.1 0.1 0.3
TABLE-US-00012 TABLE 9 Affinity (KD), neutralisation potency (IC.sub.50) and % occupancy against SARS-CoV-2 of full-length IgG and Fab for ten selected antibodies were determined. Data are from 2 independent experiments, each with duplicate wells and the data are shown as mean s.e.m. Binding Neutralisation Antibody KD (nM) IC.sub.50 (nM) % Occupancy 40 IgG 0.33 0.04 0.16 0.03 33.3 1.3 40 Fab 1.23 0.19 45.68 7.15 97.4 0.0 88 IgG 0.25 0.01 0.07 0.04 21.9 9.5 88 Fab 1.21 0.14 6.95 0.07 85.2 1.6 150 IgG 0.24 0.01 0.08 0.02 25.1 5.7 150 Fab 0.75 0.10 0.61 0.23 43.2 6.6 158 IgG 0.50 0.02 0.13 0.02 20.5 2.6 158 Fab 3.73 0.56 4.12 0.04 52.7 3.5 159 IgG 0.19 0.02 0.08 0.01 30.0 5.2 159 Fab 0.29 0,02 N/A N/A 253 IgG 0.17 0.01 0.36 0.02 67.9 2.3 253 Fab 23.38 3.84 N/A N/A 253H55L IgG 0.09 0.01 0.02 0.00 19.6 2.1 253H55L Fab 10.19 0.56 5.08 0.47 33.2 0.8 253H165L IgG 0.09 0.01 0.03 0.00 24.5 0.6 253H165L Fab 5.02 1.40 5.22 1.18 51.3 1.4 316 IgG 0.13 0.00 0.08 0.02 35.4 6.0 316 Fab 8.76 0.64 27.64 9.47 74.0 8.1 384 IgG 0.10 0.03 0.01 0.00 12.1 2.3 384 Fab 7.86 0.96 4.86 0.16 38.4 3.7
TABLE-US-00013 TABLE 10 X-ray data collection and refinement statistics Data collection Data set RBDN501Y/COVOX-269 Space group C2 Cell dimensions () a, b, c () 195.1, 85.0, 57.9 a, b, g () 90, 100.6, 90 Resolution () 96-2.19 (2.23-2.19) Unique reflections 48007 (2371) Rmerge 0.177 () Rpim 0.050 (0.988) CC 0.997 (0.468) <I>/<I> 8.4 (0.2) Completeness (%) 99.9 (98.5) Redundancy 13.0 (9.1) Refinement Resolution () 56.9-2.19 No. reflections 41325/2137 Rwork /Rfree 0.197/0.222 No. atoms 4948 Average B-factors (2) 68 R.m.s. deviations Bond lengths () 0.003 Bond angles () 0.6 Numbers in brackets refer to the highest resolution shell of data.
TABLE-US-00014 TABLE 11 Neutralization of selected antibodies against SARS-CoV-2 strains Victoria and B.1.1.7 IC50 (ug/ml) .sup.# B.1.1.7/Victoria mAb B.1.1.7 Victoria Ratio .sup.$ 40 0.035 0.008 0.026 0.007 1.36 55 0.348 0.044 0.095 0.015 3.68 58 0.116 0.029 0.041 0.003 2.81 88 0.058 0.008 0.033 0.001 1.78 132 0.337 0.048 0.048 0.000 7.03 150 0.139 0.019 0.012 0.000 11.96 158 0.254 0.109 0.031 0.004 8.33 159 0.061 0.020 0.011 0.000 5.71 165 0.212 0.004 0.034 0.004 6.31 170 0.105 0.050 0.025 0.004 4.22 175 0.575 0.280 0.026 0.000 22.51 222 0.014 0.002 0.019 0.000 0.74 253 0.126 0.018 0.055 0.008 2.28 269 >10 0.030 0.000 N/A 278 0.307 0.149 0.014 0.007 22.46 281 0.012 0.000 0.005 0.001 2.50 316 0.024 0.005 0.018 0.007 1.37 318 0.185 0.037 0.029 0.008 6.30 384 0.005 0.002 0.004 0.001 1.13 398 0.180 0.001 0.091 0.004 1.98 REGN10933 0.014 0.002 0.004 0.002 3.31 REGN10987 0.028 0.003 0.032 0.007 0.86 AZD1061 0.012 0.002 0.013 0.003 0.93 AZD8895 0.011 0.002 0.005 0.001 2.17 AZD7442 0.007 0.001 0.009 0.000 0.77 .sup.# Neutralization activity of selected antibodies against SARS-CoV-2 strain Victoria and B.1.1.7 were determined by FRNT. Data are from 2 independent experiments, each with duplicate wells and the data are shown as mean s.e.m. .sup.$ IC50 ratio between strains B.1.1.7 and Victoria
TABLE-US-00015 TABLE 12 Neutralization and RBD binding of selected antibodies against SARS-CoV-2 strains Victoria and B.1.1.7 IC50 (ug/ml).sup.# B.1.1.7/ Victoria KD (nM).sup. Immunoglobulin gene usage mAb B.1.1.7 Victoria ratio.sup.$ RBD-N501Y Native RBD IGHV K/ IGLV 40 0.035 0.008 0.026 0.007 1.36 0.97 0.006 0.55 0.003 3-66 K 1-33 or 1D-33 55 0.348 0.044 0.095 0.015 3.68 4.55 0.19 3.61 0.15 1-58 K 3-20 58 0.116 0.029 0.041 0.003 2.81 0.55 0.004 0.30 0.003 3-9 3-21 88 0.058 0.008 0.033 0.001 1.78 0.65 0.005 0.64 0.004 4-61 1-36 132 0.337 0.048 0.048 0.000 7.03 43.7 0.43 16.0 0.09 4-34 7-46 150 0.139 0.019 0.012 0.000 11.96 0.72 0.004 0.19 0.002 3-53 K 1-9 158 0.254 0.109 0.031 0.004 8.33 1.57 0.01 0.53 0.0003 3-53 K 1-9 159 0.061 0.020 0.011 0.000 5.71 N/A N/A 3-30 K 3-20 165 0.212 0.004 0.034 0.004 6.31 3.64 0.14 3.49 0.15 1-58 K 3-20 170 0.105 0.050 0.025 0.004 4.22 8.71 0.13 5.75 0.07 5-51 K 2D-29 175 0.575 0.280 0.026 0.000 22.51 2.54 0.02 0.97 0.005 3-53 K 1-33 or 1D-33 222 0.014 0.002 0.019 0.000 0.74 0.39 0.005 0.29 0.003 3-53 K 3-20 253 0.126 0.018 0.055 0.008 2.28 19.5 0.20 13.9 0.48 1-58 K 3-20 269 >10 0.030 0.000 N/A 45.4 1.42 1.59 0.009 3-53 K 1-9 278 0.307 0.149 0.014 0.007 22.46 8.45 0.06 5.11 0.03 1-18 K 1-39 or 1D-39 281 0.012 0.000 0.005 0.001 2.50 4.05 0.02 3.20 0.01 3-7 K 2-24 316 0.024 0.005 0.018 0.007 1.37 2.81 0.03 1.50 0.01 1-2 2-8 318 0.185 0.037 0.029 0.008 6.30 1.99 0.02 2.23 0.02 1-58 K 3-20 384 0.005 0.002 0.004 0.001 1.13 0.71 0.006 0.51 0.004 3-31 K 1-27 398 0.180 0.001 0.091 0.004 1.98 1.18 0.009 1.02 0.007 3-66 2-8 REGN10933 0.014 0.002 0.004 0.002 3.31 2.75 0.04 1.82 0.03 REGN10987 0.028 0.003 0.032 0.007 0.86 3.09 0.06 3.85 0.08 AZD1061 0.012 0.002 0.013 0.003 0.93 1.41 0.02 1.04 0.01 AZD8895 0.011 0.002 0.005 0.001 2.17 2.44 0.04 1.49 0.02 .sup.#Neutralization activity of selected antibodies against SARS-CoV-2 strain Victoria and B.1.1.7 were determined by FRNT. Data are from 2 independent experiments, each with duplicate wells and the data are shown as mean s.e.m. .sup.$IC50 ratio between strains B.1.1.7 and Victoria. .sup.KD values for Fab association with N501-RBD and Y501-RBD measured by BLI are shown mAb159 binds to the NTD and was not tested. VH and VL gene usage for monoclonal antibodies is indicated on the right.
TABLE-US-00016 TABLE 13 RBD/Fab complexes analysed for N501 contact Fabs contact N501 (4 ) Fabs that do not contact N501 (4 ) Name PDB ID Name PDB ID B38 7BZ5 CV07-270 6XKP CC12.1 6XC3 P2B-2F6 7BWJ CC12.3 6XC4 P2C-1A3 7CDJ BD604 7CH4 BD368 7CHE BD629 7CH5 P17 7CWO BD236 7CHB COVA2 7JMP COVA2-04 7JMO COVA1 7JMW C102 7K8M 52 7KZ9 C1A-B12 7KFV 298 7KZ9 C1A-B3 7KFW CR3022 6YLA C1A-C2 7KFX REGN10933 6XDG C1A-F10 7KFY REGN10987 6XDG STE90-C11 7B3O CV30 6XE1 Fab-7CJF 7CJF CB6 7C01 40 7ND3 P2C-1F11 7CDI 150 7ND5 EY6A 6ZCZ 158 7ND6 S309 7BEP 269 7NEH 88 7BEL 253 7BEN 384 7BEP
TABLE-US-00017 TABLE 14 FRNT50 titres against Victoria and B.1.351 strains (A) 34 convalescent plasma (B) Plasma from 13 patients infected with B.1.1.7. Table 14 A. Neutralization of SARS-CoV-2 convalescent plasma against SARS-CoV-2 strains Victoria and B.1.351 Victoria/ Convalescent FRNT50 (Reciprocal plasma dilution)# B.1.351 plasma Victoria B.1.351 ratio$ Convalescent 1 61 <20 N/A Convalescent 2 689 <20 N/A Convalescent 3 526 88 5.99 Convalescent 4 409 339 1.20 Convalescent 5 369 <20 N/A Convalescent 6 1270 522 2.43 Convalescent 7 274 <20 N/A Convalescent 8 633 111 5.73 Convalescent 9 667 <20 N/A Convalescent 10 124 <20 N/A Convalescent 11 102 <20 N/A Convalescent 12 339 <20 N/A Convalescent 13 331 <20 N/A Convalescent 14 438 <20 N/A Convalescent 15 6397 1147 5.58 Convalescent 16 44 <20 N/A Convalescent 17 1115 <20 N/A Convalescent 18 242 <20 N/A Convalescent 19 29 <20 N/A Convalescent 20 154 21 7.44 Convalescent 21 487 58 8.46 Convalescent 22 438 53 8.24 Convalescent 23 381 <20 N/A Convalescent 24 1647 72 22.89 Convalescent 25 913 202 4.51 Convalescent 26 1880 348 5.41 Convalescent 27 1464 67 21.90 Convalescent 28 361 <20 N/A Convalescent 29 2859 748 3.82 Convalescent 30 1109 184 6.01 Convalescent 31 811 210 3.87 Convalescent 32 395 <20 N/A Convalescent 33 1144 48 23.74 Convalescent 34 676 <20 N/A
TABLE-US-00018 TABLE 14 B. Neutralization of SARS-CoV-2 convalescent plasma against SARS-CoV-2 strains Victoria and B.1.351 FRNT50 Victoria/ Kent Day after (Reciprocal plasma dilution) B.1.351 plasma admission Victoria B.1.351 ratio B.1.1.7 P1 5 <20 <20 N/A B.1.1.7 P2 3 <20 <20 N/A B.1.1.7 P3 1 440 <20 N/A B.1.1.7 P4 1 136884 81493 1.7 B.1.1.7 P5 29 1506 278 5.4 B.1.1.7 P6 24 370 80 4.6 B.1.1.7 P7 25 2250 159 14.2 B.1.1.7 P8 18 2999 867 3.5 B.1.1.7 P9 20 970 336 2.9 B.1.1.7 P10 14 3735 1150 3.2 B.1.1.7 P11 18 2193 705 3.1 B.1.1.7 P12 29 <20 <20 N/A B.1.1.7 P13 34 <20 <20 N/A
TABLE-US-00019 TABLE 15 FRNT50 titres against Victoria and B.1.351 strains (A) Serum from 25 recipients of Pfizer-BioNTech vaccine. (B) Oxford-AstraZeneca vaccine. FRNT50 (Reciprocal plasma Victoria/ Vaccine Day Post- dilution) B.1.351 samples boost Victoria B.1.351 ratio Pfizer1 7 1149 73 15.7 Pfizer2 7 <20 <20 N/A Pfizer3 7 1727 230 7.5 Pfizer4 8 2234 420 5.3 Pfizer5 7 3016 577 5.2 Pfizer6 7 1521 152 10.0 Pfizer7 7 609 109 5.6 Pfizer8 7 4340 1255 3.5 Pfizer9 7 1467 102 14.4 Pfizer10 7 1757 124 14.2 Pfizer11 7 860 121 7.1 Pfizer12 7 1749 66 26.6 Pfizer13 7 1851 385 4.8 Pfizer14 7 407 122 3.3 Pfizer15 8 1285 202 6.4 Pfizer16 8 1286 91 14.1 Pfizer17 8 1810 143 12.7 Pfizer18 8 1198 93 12.9 Pfizer19 8 466 61 7.6 Pfizer20 8 1539 178 8.7 Pfizer21 9 184 <20 N/A Pfizer22 11 1061 212 5.0 Pfizer23 12 1658 100 16.6 Pfizer24 12 1155 192 6.0 Pfizer25 15 8092 3006 2.7 AstraZeneca 1 28 495 155 3.2 AstraZeneca 2 28 580 217 2.7 AstraZeneca 3 28 253 <20 N/A AstraZeneca 4 28 183 62 3.0 AstraZeneca 5 28 432 62 7.0 AstraZeneca 6 28 764 54 14.3 AstraZeneca 7 28 133 <20 N/A AstraZeneca 8 28 257 41 6.3 AstraZeneca 9 28 501 128 3.9 AstraZeneca 10 28 357 116 3.1 AstraZeneca 11 14 334 45 7.5 AstraZeneca 12 14 250 51 4.9 AstraZeneca 13 14 122 <20 N/A AstraZeneca 14 14 212 <20 N/A AstraZeneca 15 14 789 94 8.4 AstraZeneca 16 14 538 57 9.5 AstraZeneca 17 14 1159 36 32.5 AstraZeneca 18 14 353 44 8.1 AstraZeneca 19 14 975 69 14.0 AstraZeneca 20 14 169 <20 N/A AstraZeneca 21 14 155 <20 N/A AstraZeneca 22 14 152 <20 N/A AstraZeneca 23 14 126 <20 N/A AstraZeneca 24 14 293 30 9.7 AstraZeneca 25 14 94 <20 N/A
TABLE-US-00020 TABLE 16 FRNT50 titres against Victoria and B.1.351 strains (A) 22 human monoclonal antibodies. (B) Two Regeneron and 2 AstraZeneca monoclonal antibodies. The Mann- Whitney U test was used for the analysis and two-tailed P values were calculated, data are shown as mean s.e.m. B.1.351/ IC50 (ug/ml) Victoria KD (nM) Immunoglobulin gene usage mAb Victoria B.1.351 ratio Native RBD RBD B.1.351 IGHV K/ IGLV 40 0.026 0.007 0.738 28.6 0.55 0.003 33.2 0.88 3-66 K 1-33 or 0.311 1D-33 55 0.095 0.015 0.127 1.3 3.61 0.15 17.6 0.57 1-58 K 3-20 0.014 58 0.041 0.003 0.136 3.3 0.30 0.003 5.96 0.12 3-9 3-21 0.010 88 0.033 0.001 >10 N/A 0.64 0.004 277.3 7.17 4-61 1-36 132 0.048 0.000 >10 N/A 16.0 0.09 No signal 4-34 7-46 150 0.012 0.000 0.350 30.0 0.19 0.002 227.7 8.58 3-53 K 1-9 0.010 158 0.031 0.004 >10 N/A 0.53 0.0003 976.5 30.7 3-35 K 1-9 159 0.011 0.000 >10 N/A N/A N/A 3-30 K 3-20 165 0.034 0.004 0.054 1.6 3.49 0.15 8.57 0.20 1-58 K 3-20 0.013 170 0.025 0.004 >10 N/A 5.75 0.07 1207 74.94 5-51 K 2D-29 175 0.026 0.000 >10 N/A 0.97 0.005 1350 45.9 3-53 K 1-33 or 1D-33 222 0.019 0.000 0.017 0.9 0.29 0.003 0.47 0.09 3-53 K 3-20 0.005 253 0.055 0.008 0.109 2.0 13.9 0.48 12.1 0.25 1-58 K 3-20 0.055 269 0.030 0.000 >10 N/A 1.59 0.009 >1000 3-53 K 1-9 278 0.014 0.007 0.160 11.7 5.11 0.03 8.84 0.16 1-18 K 1-39 or 0.018 1D-39 281 0.005 0.001 >10 N/A 3.20 0.01 79540 170 3-7 K 2-24 316 0.018 0.007 >10 N/A 1.50 0.01 No signal 1-2 2-8 318 0.029 0.008 0.019 0.7 2.23 0.02 3.26 0.04 1-58 K 3-20 0.008 384 0.004 0.001 >10 N/A 0.51 0.004 No signal 3-11 K 1-27 398 0.091 0.004 >10 N/A 1.02 0.007 21.4 0.20 3-66 2-8 253- 0.003 0.000 0.009 2.7 0.88 0.02 3.43 0.06 1-58 3-20 3-20 55 0.002 253- 0.003 0.000 0.013 3.6 0.73 0.01 3.10 0.05 1-58 3-20 3-20 165 0.003
TABLE-US-00021 TABLE 16 B KD (nM) IC50 (ug/ml) B.1.351/Victoria Native RBD mAb Victoria B.1.351 ratio RBD B.1.351 REGN 0.032 0.007 0.007 0.001 0.2 3.85 0.08 0.72 0.02 R10987 REGN 0.004 0.002 3.284 2.014 773.7 1.82 0.03 No signal R10933 AZD1061 0.013 0.003 0.014 0.002 1.1 1.04 0.01 1.52 0.02 AZD8895 0.005 0.001 0.046 0.031 8.9 1.49 0.02 3.63 0.06
TABLE-US-00022 TABLE 17 Data Collection and refinement statistics of RBD complexes K417N-RBD- K417T-RBD- B.1.1.7-RBD- Structure RBD-EYGA-222 EY6A-222 EYA-222 EY6A-222 Data collection Space group P2.sub.12.sub.12.sub.1 P2.sub.12.sub.12.sub.1 P2.sub.12.sub.12.sub.1 P2.sub.12.sub.12.sub.1 Cell dimensions a, b, c () 54.4, 120.1, 211.7 54.8, 122.5, 214.2 54.8, 122.7, 213.9 54.3, 120.9, 210.2 a, b, g () 90, 90, 90 90, 90, 90 90, 90, 90 90, 90, 90 Resolution () 120-2.25 (2.29-2.25).sup.a 62-2.24 (2.28-2.24) 81-1.95 (1.98-1.95) 79-2.40 (2.44-2.40) R.sub.merge 0.438 () 0.185 () 0.120 (0.990) 0.257 () R.sub.pim 0.073 (0.767) 0.053 (0.805) 0.034 (0.972) 0.051 (0.547) I/s(I) 4.3 (0.3) 5.7 (0.3) 12.0 (0.4) 7.7 (0.6) CC.sub.1/2 0.991 (0.32) 0.992 (0.328) 0.996 (0.354) 0.995 (0.584) Completeness (%) 99.8 (95.8) 100 (99.1) 100 (99.6) 100 (98.5) Redundancy 34.8 (17.3) 13.3 (13.3) 13.4 (13.2) 26.6 (25.8) Refinement Resolution () 106-2.25 62-2.24 81-1.95 79-2.40 No. reflections 61666/3310 65884/3438 100792/5255 52327/2727 R.sub.work/R.sub.free 0.207/0.247 0.221/0.251 0.223/0.246 0.225/0.247 No. atoms Protein 8014 8013 8017 8018 386 423 389 298 Ligand/ion/water B factors (.sup.2) Protein 67 84 78 76 60 67 50 67 Ligand/ion/water r.m.s. deviations Bond lengths () 0.002 0.002 0.002 0.003 Bond angles () 0.5 0.5 0.5 0.6 P.1-RBD-EY6A- B.1.351-RBD- Structure 222 EY6A-222 P.1-RBD-ACE2 Data collection Space group P2.sub.12.sub.12.sub.1 P2.sub.12.sub.12.sub.1 P4.sub.12.sub.12 Cell dimensions a, b, c () 54.7, 122.8, 212.3 54.2, 120.4, 211.6 103.5, 103.5, 225.9 a, b, g () 90, 90, 90 90, 90, 90 90, 90, 90 Resolution () 80-2.67 (2.72-2.67) 61-2.50 (2.54-2.50) 70-3.14 (3.27-3.14) R.sub.merge 0.365 () 0.401 () 0.500 () R.sub.pim 0.072 (1.176) 0.080 (1.086) 0.100 (1.087) I/s(I) 7.0 (0.4) 4.6 (0.3) 5.3 (0.5) CC.sub.1/2 0.997 (0.344) 0.992 (0.360) 0.992 (0.306) Completeness (%) 100 (97.7) 99.9 (94.2) 100 (98.1) Redundancy 26.3 (27.5) 26.3 (27.1) 25.7 (27.1) Refinement Resolution () 80-2.67 61-2.50 70-3.14 No. reflections 39534/2103 45980/2393 20278/1904 R.sub.work/R.sub.free 0.224/0.255 0.211/0.255 0.229/0.276 No. atoms Protein 8034 8017 6407 182 145 71 Ligand/ion/water B factors (.sup.2) Protein 93 78 91 84 87 107 Ligand/ion/water r.m.s. deviations Bond lengths () 0.002 0.002 0.003 Bond angles () 0.5 0.5 0.5 Values in parentheses are for highest-resolution shell.
TABLE-US-00023 TABLE 18 Neutralization and RBD binding of selected antibodies against SARS-CoV-2 strains Victoria, B.1.1.7, B.1.351 and P.1. IC50 (ug/ml) mAb Victoria B.1.1.7 B.1.351 P.1 40 0.026 0.007 0.035 0.008 0.738 0.311 0.153 0.037 55 0.095 0.015 0.348 0.044 0.127 0.014 0.306 0.046 58 0.041 0.003 0.116 0.029 0.136 0.010 0.236 0.075 88 0.033 0.001 0.058 0.008 >10 >10 132 0.048 0.000 0.337 0.048 >10 >10 150 0.012 0.000 0.139 0.019 0.350 0.010 0.040 0.003 158 0.031 0.004 0.254 0.109 >10 >10 159 0.011 0.000 0.061 0.020 >10 1.434 0.804 165 0.034 0.004 0.212 0.004 0.054 0.013 0.241 0.030 170 0.025 0.004 0.105 0.050 >10 >10 175 0.026 0.000 0.575 0.280 >10 3.881 0.738 222 0.019 0.000 0.014 0.002 0.017 0.005 0.008 0.003 253 0.055 0.008 0.126 0.018 0.109 0.055 0.137 0.005 269 0.030 0.000 >10 >10 >10 278 0.014 0.007 0.307 0.149 0.160 0.018 0.245 0.042 281 0.005 0.001 0.012 0.000 >10 >10 316 0.018 0.007 0.024 0.005 >10 >10 318 0.029 0.008 0.185 0.037 0.019 0.008 0.083 0.032 384 0.004 0.001 0.005 0.002 >10 >10 398 0.091 0.004 0.180 0.001 >10 >10 253-55 0.003 0.000 0.008 0.002 0.009 0.002 0.026 0.006 253-165 0.003 0.000 0.006 0.000 0.013 0.003 0.019 0.000 AZD1061 0.013 0.003 0.013 0.003 0.012 0.002 0.014 0.002 AZD8895 0.005 0.001 0.005 0.001 0.011 0.002 0.046 0.031 REGN10987 0.032 0.007 0.032 0.007 0.028 0.003 0.007 0.001 REGN10933 0.004 0.002 0.004 0.002 0.014 0.002 3.284 2.014 ADG10 0.006 0.000 0.006 0.000 0.010 0.001 0.011 0.001 ADG20 0.004 0.001 0.004 0.001 0.006 0.000 0.01 0.001 ADG30 0.007 0.002 0.007 0.002 0.016 0.001 0.029 0.003 LY-CoV555 0.006 0.002 0.006 0.002 0.009 0.000 >10 LY-CoV16 0.034 0.007 0.034 0.007 3.225 1.030 >10 S309 0.040 0.005 0.040 0.005 0.078 0.069 0.082 0.002 222H + 222L 0.017 0.001 0.011 0.002 0.016 0.001 0.009 0.000 150H + 222L 0.016 0.003 0.010 0.001 0.007 0.001 0.003 0.000 158H + 222L 0.033 0.003 0.014 0.001 0.056 0.015 0.019 0.000 175H + 222L >10 0.399 0.012 >10 >10 269H + 222L 0.552 0.085 0.024 0.001 >10 >10 FRNT.sub.50 ratio Immunoglobulin gene usage mAb B.1.1.7/Victoria B.1.351/VictoriaP.1/Victoria IGHV K/ IGLV 40 1.4 28.6 5.9 3-66 K 1-33 or 1D-33 55 3.7 1.3 3.2 1-58 K 3-20 58 2.8 3.3 5.7 3-9 3-21 88 1.8 >307.6 >307.6 4-61 1-36 132 7.0 >208.4 >208.4 4-34 7-46 150 12.0 30.0 3.4 3-53 K 1-9 158 8.3 >327.5 >327.5 3-53 K 1-9 159 5.7 >928.4 133.2 3-30 K 3-20 165 6.3 1.6 7.2 1-58 K 3-20 170 4.2 >402.2 >402.2 5-51 K 2D-29.sup. 175 22.5 >391.5 151.9 3-53 K 1-33 or 1D-33 222 0.7 0.9 0.4 3-53 K 3-20 253 2.3 2.0 2.5 1-58 K 3-20 269 >337.5 >337.5 >337.5 3-53 K 1-9 278 22.5 11.7 17.9 1-18 K 1-39 or 1D-39 281 2.5 >2026.3 >2026.3 3-7 K 2-24 316 1.4 >563.6 >563.6 1-2 2-8 318 6.3 0.7 2.8 1-58 K 3-20 384 1.1 >2398.4 >2398.4 3-11 K 1-27 398 2.0 >110.2 >110.2 3-66 2-8 253-55 2.3 2.7 8.1 1-58 K 3-20 253-165 1.8 3.6 5.6 1-58 K 3-20 AZD1061 0.9 1.1 0.5 AZD8895 2.2 8.9 8.8 REGN10987 0.9 0.2 0.4 REGN10933 3.3 773.7 1455.2 ADG10 1.8 1.9 0.5 ADG20 1.4 2.5 2.2 ADG30 2.5 4.4 0.3 LY-CoV555 1.5 >1545.3 >1545.3 LY-CoV16 1.5 >291.2 >291.2 S309 1.5 2.0 1.9 222H + 222L 0.6 1.0 0.5 3-53 K 3-20 150H + 222L 0.6 0.4 0.2 3-53 K 3-20 158H + 222L 0.4 1.7 0.6 3-53 K 3-20 175H + 222L <0.04 N/A N/A 3-53 K 3-20 269H + 222L 0.04 >18.1 >18.1 3-53 K 3-20 KD (nM) mAb Native RBD K417T K417N E484K RBD P.1 40 1.33 0.03 38.9 0.89 56.7 1.18 7.31 0.03 38.2 0.95 55 2.66 0.05 4.60 0.12 4.21 0.09 3.82 0.02 11.1 0.37 58 1.46 0.04 1.83 0.02 2.75 0.03 0.97 0.04 2.84 0.03 88 2.90 0.03 Knocked out Knocked out 5.37 0.06 Knocked out 132 2.93 0.10 1846 364 2495 1095 29.8 0.36 1338 452 150 0.40 0.01 1.64 0.02 3.35 0.03 1.83 0.03 8.90 0.13 158 1.89 0.03 4.83 0.06 9.35 0.11 3.03 0.10 18.2 0.31 159 165 2.15 0.03 2.62 0.06 3.29 0.05 3.49 0.03 7.10 0.15 170 5.23 0.02 6.24 0.04 6.95 0.05 Knocked out 463.4 25.4 175 1.36 0.01 3.17 0.02 8.60 0.04 10.8 0.07 68.3 0.50 222 1.36 0.08 3.96 0.11 5.16 0.12 2.25 0.04 1.92 0.01 253 1.15 0.03 5.99 0.11 6.11 0.11 2.66 0.03 4.25 0.11 269 0.76 0.02 6.69 0.04 8.88 0.04 1.29 0.03 Knocked out 278 4.16 0.03 5.21 0.03 6.37 0.03 6.95 0.27 16.2 0.17 281 0.97 0.03 0.68 0.02 4.42 0.03 3.54 0.08 Knocked out 316 4.81 0.05 4.96 0.06 5.17 0.08 Knocked out Knocked out 318 4.43 0.04 4.96 0.04 5.35 0.04 6.05 0.02 9.30 0.03 384 1.19 0.02 1.30 0.03 1.80 0.03 1.75 0.04 Knocked out 398 4.63 0.04 10.4 0.10 13.6 0.24 Knocked out Knocked out 253-55 2.18 0.03 2.30 0.03 4.65 0.02 6.33 0.04 11.0 0.22 253-165 3.38 0.02 1.99 0.02 2.44 0.02 1.41 0.03 6.02 0.08 AZD1061 5.13 0.07 8.00 0.12 6.14 0.08 7.66 0.05 2.27 0.03 AZD8895 2.18 0.04 2.96 0.05 3.56 0.06 8.50 0.05 7.35 0.15 REGN10987 1.35 0.03 1.61 0.03 1.84 0.04 1.39 0.05 1.38 0.02 REGN10933 0.97 0.02 1.99 0.02 1.70 0.01 1.92 0.02 308.7 10.0 ADG10 ADG20 ADG30 LY-CoV555 LY-CoV16 S309 222H + 222L 150H + 222L 158H + 222L 175H + 222L 269H + 222L Where the table is blank, no data has been obtained for these points.
TABLE-US-00024 TABLE 19A TABLE 19. FRNT50 titres against Victoria and P.1 strains (A) 34 convalescent plasma (B) Plasma from 13 patients infected with B.1.1.7. Convalescent FRNT50 (Reciprocal plasma dilution) Victoria/P.1 plasma Victoria P.1 ratio Convalescent 1 61 25 2.5 Convalescent 2 689 49 14.2 Convalescent 3 526 173 3.0 Convalescent 4 409 356 1.1 Convalescent 5 369 105 3.5 Convalescent 6 1270 556 2.3 Convalescent 7 274 80 3.4 Convalescent 8 633 223 2.8 Convalescent 9 667 126 5.3 Convalescent 10 124 34 3.7 Convalescent 11 102 30 3.4 Convalescent 12 339 74 4.6 Convalescent 13 331 240 1.4 Convalescent 14 438 95 4.6 Convalescent 15 6397 3261 2.0 Convalescent 16 44 39 1.1 Convalescent 17 1115 87 12.8 Convalescent 18 242 64 3.8 Convalescent 19 29 20 1.4 Convalescent 20 154 136 1.1 Convalescent 21 487 165 3.0 Convalescent 22 438 241 1.8 Convalescent 23 381 83 4.6 Convalescent 24 1647 390 4.2 Convalescent 25 913 322 2.8 Convalescent 26 1880 825 2.3 Convalescent 27 1464 206 7.1 Convalescent 28 361 81 4.4 Convalescent 29 2859 1010 2.8 Convalescent 30 1109 477 2.3 Convalescent 31 811 274 3.0 Convalescent 32 395 130 3.0 Convalescent 33 1144 207 5.5 Convalescent 34 676 201 3.4
TABLE-US-00025 TABLE 19B Day post FRNT50 Victoria/ B.1.1.7 symptom (Reciprocal plasma dilution) P.1 plasma onset Victoria P.1 ratio B.1.1.7 P3 11 440 116 3.8 B.1.1.7 P4 18 136884 48440 2.8 B.1.1.7 P5 45 1506 787 1.9 B.1.1.7 P6 31 370 259 1.4 B.1.1.7 P7 33 2250 267 8.4 B.1.1.7 P8 25 2999 2261 1.3 B.1.1.7 P9 26 970 861 1.1 B.1.1.7 P10 18 3735 861 4.3 B.1.1.7 P11 24 2193 1116 2.0 B.1.1.7 P13 29 <20 67 <0.3 B.1.1.7 P14 21 1700 168 10.1 B.1.1.7 P15 16 168 414 0.4
TABLE-US-00026 TABLE 20 FRNT50 titres against Victoria and P.1 strains (A) Serum from 25 recipients of Pfizer-BioNTech vaccine. (B) Serum from 26 recipients of Oxford-AstraZeneca vaccine. Day FRNT50 Victoria/ Vaccine Post- (Reciprocal serum dilution) P.1 samples boost Victoria P.1 ratio Pfizer1 7 1149 396 2.9 Pfizer2 7 <20 36 <0.6 Pfizer3 7 1727 698 2.5 Pfizer4 8 2234 712 3.1 Pfizer5 7 3016 1033 2.9 Pfizer6 7 1521 302 5.0 Pfizer7 7 609 294 2.1 Pfizer8 7 4340 2119 2.0 Pfizer9 7 1467 361 4.1 Pfizer10 7 1757 343 5.1 Pfizer11 7 860 424 2.0 Pfizer12 7 1749 452 3.9 Pfizer13 7 1851 669 2.8 Pfizer14 7 407 294 1.4 Pfizer15 8 1285 571 2.3 Pfizer16 8 1286 311 4.1 Pfizer17 8 1810 304 6.0 Pfizer18 8 1198 282 4.3 Pfizer19 8 466 229 2.0 Pfizer20 8 1539 693 2.2 Pfizer21 9 184 52 3.5 Pfizer22 11 1061 491 2.2 Pfizer23 12 1658 355 4.7 Pfizer24 12 1155 569 2.0 Pfizer25 15 8092 5029 1.6 AstraZeneca 1 28 495 265 1.9 AstraZeneca 2 28 580 429 1.4 AstraZeneca 3 28 253 <20 >12.6 AstraZeneca 4 28 183 102 1.8 AstraZeneca 5 28 432 215 2.0 AstraZeneca 6 28 764 111 6.9 AstraZeneca 7 28 133 29 4.5 AstraZeneca 8 28 257 116 2.2 AstraZeneca 9 28 501 97 5.2 AstraZeneca 10 28 357 133 2.7 AstraZeneca 11 14 334 115 2.9 AstraZeneca 12 14 250 94 2.7 AstraZeneca 13 14 122 40 3.1 AstraZeneca 14 14 212 110 1.9 AstraZeneca 15 14 789 281 2.8 AstraZeneca 16 14 538 181 3.0 AstraZeneca 17 14 1159 359 3.2 AstraZeneca 18 14 353 85 4.1 AstraZeneca 19 14 975 382 2.6 AstraZeneca 20 14 169 74 2.3 AstraZeneca 21 14 155 87 1.8 AstraZeneca 22 14 152 98 1.5 AstraZeneca 23 14 126 67 1.9 AstraZeneca 24 14 293 151 1.9 AstraZeneca 25 14 94 25 3.8
TABLE-US-00027 TABLE 21 Examples of mixed chain antibodies generated from antibodies derived from the same germline heavy chain IGHV3-53. light chain (L) of Heavy chain (H) antibody 150H 158H 175H 222H 269H 150L 158H 150L 175H 150L 222H 150L 269H 150L 158L 150H 158L 175H 158L 222H 158L 269H 158L 175L 150H 175L 158H 175L 222H 175L 269H 175L 222L 150H 222L 158H 222L 175H 222L 269H 222L 269L 150H 269L 158H 269L 175H 269L 222H 269L
TABLE-US-00028 TABLE 22 Examples of mixed chain antibodies generated from antibodies derived from the germline heavy chain IGHV3-53 or IGHV3-66. Heavy chain (H)/light chain (L) of antibody 150H 158H 175H 222H 269H 40H 398H 150L 158H 175H 222H 269H 40H 398H 150L 150L 150L 150L 150L 150L 158L 150H 175H 222H 269H 40H 398H 158L 158L 158L 158L 158L 158L 175L 150H 158H 222H 269H 40H 398H 175L 175L 175L 175L 175L 175L 222L 150H 158H 175H 269H 40H 398H 222L 222L 222L 222L 222L 222L 269L 150H 158H 175H 222H 40H 398H 269L 269L 269L 269L 269L 269L 40L 150H 158H 175H 222H 269H 398H 40L 40L 40L 40L 40L 40L 398L 150H 158H 175H 222H 269H 40H 398L 398L 398L 398L 398L 398L
TABLE-US-00029 TABLE 23 Examples of mixed chain antibodies generated from antibodies derived from the same germline light chain IGKV3-20. Heavy chain (H)/light chain (L) 55H 159H 165H 222H 253H 318H 55L 159H 165H 222H 253H 318H 55L 55L 55L 55L 55L 159L 55H 165H 222H 253H 318H 159L 159L 159L 159L 159L 165L 55H 159H 222H 253H 318H 165L 165L 165L 165L 165L 222L 55H 159H 165H 253H 318H 222L 222L 222L 222L 222L 253L 55H 159H 165H 222H 318H 253L 253L 253L 253L 253L 318L 55H 159H 165H 222H 253H 318L 318L 318L 318L 318L
TABLE-US-00030 TABLE 24 Examples of mixed chain antibodies generated from antibodies derived from the same germline light chain IGV1-9. light chain (L) of Heavy chain (H) antibody 150H 158H 269H 150L 158H 150L 269H 150L 158L 150H 158L 269H 158L 269L 150H 269L 158H 269L
TABLE-US-00031 TABLE 25 Examples of the mixed chain antibodies generated from antibodies derived from the same germline heavy chain IGHV1-58. light chain (L) of Heavy chain (H) antibody 55H 165H 253H 318H 55L 165H 55L 253H 55L 318H 55L 165L 55H 165L 253H 165L 318H 165L 253L 55H 253L 165H 253L 318H 253L 318L 55H 318L 165H 318L 253H 318L
TABLE-US-00032 TABLE 26 IC50 titres of selected antibodies against SARS-CoV-2 variants IC50 (ug/ml) mAb Victoria Alpha Beta Gamma Delta Omicron 40 0.026 0.035 0.738 0.153 0.029 7.989 0.007 0.008 0.311 0.037 0.010 2.011 55 0.095 0.348 0.127 0.306 0.016 7.12 0.015 0.044 0.014 0.046 0.005 2.880 58 0.041 0.116 0.136 0.236 6.434 0.141 0.003 0.029 0.010 0.075 2.623 0.063 88 0.033 0.058 >10 >10 0.039 >10 0.001 0.008 0.007 132 0.048 0.337 >10 >10 0.051 >10 0.000 0.048 0.013 150 0.012 0.139 0.350 0.040 0.020 >10 0.000 0.019 0.010 0.003 0.001 158 0.031 0.254 >10 >10 0.026 >10 0.004 0.109 0.002 159 0.011 0.061 >10 1.434 >10 >10 0.000 0.020 0.804 165 0.034 0.212 0.054 0.241 0.027 >10 0.004 0.004 0.013 0.030 0.006 170 0.025 0.105 >10 >10 0.841 >10 0.004 0.050 0.103 175 0.026 0.575 >10 3.881 0.017 >10 0.000 0.280 0.738 0.003 222 0.019 0.014 0.017 0.008 0.018 0.240 0.000 0.002 0.005 0.003 0.001 0.122 253 0.055 0.126 0.109 0.137 0.005 1.063 0.008 0.018 0.055 0.005 0.001 0.367 269 0.030 >10 >10 >10 0.021 >10 0.000 0.004 278 0.014 0.307 0.160 0.245 7.374 >10 0.007 0.149 0.018 0.042 1.397 281 0.005 0.012 >10 >10 1.494 >10 0.001 0.000 0.302 316 0.018 0.024 >10 >10 0.008 >10 0.007 0.005 0.001 318 0.029 0.185 0.019 0.083 0.018 >10 0.008 0.037 0.008 0.032 0.003 384 0.004 0.005 >10 >10 0.108 >10 0.001 0.002 0.035 398 0.091 0.180 >10 >10 0.237 >10 0.004 0.001 0.038 253- 0.003 0.008 0.009 0.026 0.003 2.945 55 0.000 0.002 0.002 0.006 0.000 1.283 253- 0.003 0.006 0.013 0.019 0.007 >10 165 0.000 0.000 0.003 0.000 0.002
TABLE-US-00033 TABLE 27 IC50 titres of selected antibodies against SARS-CoV-2 variants The following table shows 50% Focus Reduction Neutralization Titres (FRNT50) for the indicated monoclonal antibodies against the indicated viruses. Supp stands for a tissue culture supernatant as opposed to other antibodies where purified antibody was used in the assay. The chimeric antibodies where the heavy chain (HC) from one antibody is combined with the light chain (LC) of another antibody are indicated as follows 150HC/222LC represents the heavy chain from antibody 150 combined with the light chain of antibody 222. IC50 (ug/ml) B.1.1.7 B.1.351 P.1 B.1.617.2 B.1.1.7 mAbs Victoria (Alpha) (Beta) (Gamma) (Delta) E484Q B.1.525 150H/222L 0.013 0.003 0.01 150 0.012 0.139 0.350 0.040 0.020 0.075 0.007 0.000 0.019 0.010 0.003 0.001 158 0.031 0.254 >10 >10 0.026 0.094 0.022 0.004 0.109 0.002 175 0.026 0.575 >10 3.881 0.017 5.082 0.027 0.000 0.280 0.738 0.003 222 0.019 0.014 0.017 0.008 0.018 0.018 0.022 0.000 0.002 0.005 0.003 0.001 269 0.030 >10 >10 >10 0.021 >10 0.040 0.000 0.004 253H/55L 0.003 0.008 0.009 0.026 0.003 0.389 0.000 0.002 0.002 0.006 0.000 253H/165L 0.003 0.006 0.013 0.019 0.007 0.135 0.000 0.000 0.003 0.000 0.002 55 0.095 0.348 0.127 0.306 0.016 0.692 0.090 0.015 0.044 0.014 0.046 0.005 165 0.034 0.212 0.054 0.241 0.027 1.288 0.122 0.004 0.004 0.013 0.030 0.006 253 0.055 0.126 0.109 0.137 0.005 0.675 0.164 0.008 0.018 0.055 0.005 0.001 318 0.029 0.185 0.019 0.083 0.018 0.176 0.015 0.008 0.037 0.008 0.032 0.003 *no data yet available for the blank boxes
TABLE-US-00034 TABLE 28 IC50% values for neutralization of a panel of pseudoviral constructs containing the indicated mutations in the spike protein when compared with the Wuhan SARS-CoV-2 spike protein sequence IC50 values are shown for the indicated antibodies. The mixed chain antibodies where the heavy chain (HC) from one antibody is combined with the light chain (LC) of another antibody are indicated as follows: 150HC/222LC represents the heavy chain from antibody 150 combined with the light chain of antibody 222. IC50 (ng/ml) B.1.351 A.23.1 + K417N, B.1.617.1 C.37 C.36.3 E484K E484K, L452R, L452Q, B.1.616 B.1.258 R346S, B.1.526.2 V367F, N501Y E484Q F490S V483A N439K L452R S477N E484K 150HC/ 3 4.13 2.77 2.96 2.39 5.95 4.43 3.87 222LC 253HC/ 1 1 0.62 0.58 1 0.72 1 1 55LC 253HC/ 1.2 1 1 0.51 0.54 0.94 0.73 2.88 165LC