METHOD FOR CONSTRUCTING STRICTLY ANAEROBIC SALMONELLA, CONSTRUCTED STRICTLY ANAEROBIC SALMONELLA AND APPLICATION THEREOF

20240041945 ยท 2024-02-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a method for constructing an obligate anaerobic Salmonella strain, the obligate anaerobic Salmonella strain constructed by using said method, and the use thereof in tumor therapy.

Claims

1. A method for turning a facultative anaerobic bacterium into an obligate anaerobic bacterium by means of a circuit of hypoxically- or strictly anaerobically-induced expression of an essential gene, wherein said obligate anaerobic bacterium, when used for tumor therapy, is capable of inhibiting tumor growth and reducing tumor volume.

2. The method of claim 1, wherein said facultative anaerobic bacterium comprises a bacterium of the family Enterobacteriaceae (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthraces and Corynebacterium diphtheriae, preferably said facultative anaerobic bacterium is a strain of Salmonella sp., preferably a strain of facultative anaerobic Salmonella sp. derived from human, chicken, dog or cattle; and/or wherein said obligate anaerobic bacterium, when being cultured in vitro under aerobic conditions, requires further addition of 2,6-diaminoheptanedioic acid (2,6-Diaminopimelic acid) or an analogue thereof into the culture medium; and/or wherein said essential gene comprises dapA or dapE, and can further comprise one or more selected from the group consisting of dapB, dapD, argD, dapF, murE, murF or lysA; and/or wherein said strictly anaerobically regulatory gene circuit consists of an anaerobically activated promoter and the essential gene; and/or wherein said gene circuit of hypoxically- or strictly anaerobically-induced expression regulation of the essential gene is present in a chromosome or a plasmid vector.

3. The method of claim 1, wherein said anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.

4. A method for treating cancer using a bacterium regulated by an anaerobic circuit, said bacterium comprising strictly hypoxic regulation of expression of an essential gene; and/or preferably, said method further comprising: combined application with other therapy for treating cancer; and/or preferably, wherein said combined application with other therapy for treating cancer comprises: (a) bacteriotherapy of an anaerobic strain in combination with operative therapy; (b) bacteriotherapy of an anaerobic strain in combination with radiotherapy; (c) bacteriotherapy of an anaerobic strain in combination with a chemotherapeutic which comprises alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, isocyclophosphamide, glyfosfin, etc.), antimetabolites (furtulon, doxifluridine, 6-mercaptopurine, cytarabine, fluoroguanosine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, tegafur-uracil, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, epirubicin, mitomycin, pelomycin, bleomycin, pirarubicin, etc.), phytogenic anticarcinogens (irinotecan, harringtonine, hydroxycamptothecin, vinorelbine, paclitaxel, taxotere, topotecan, vincristine, vindesine, vinblastine, etc.), hormones (atamestane, anastrozole, aminoglutethimide, letrozole, formestane, megestrol, tamoxifen, etc.), immunosuppressants and other anticancer medicaments such as asparaginase, Carboplatin, Cisplatin, Dacarbazine, Oxaliplatin, Eloxatin, Oxaliplatin, mitoxantrone, procarbazine, etc.; (d) bacteriotherapy of an anaerobic strain in combination with biotherapy; (e) bacteriotherapy of an anaerobic strain in combination with traditional Chinese medical herbal treatment; and/or preferably, wherein said tumor and cancer comprise leukemia (chronic leukemia, acute leukemia), osteocarcinoma, lymphoma (non-Hodgkin's lymphoma, Hodgkin's lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, stomach cancer, pelvic cancer (cervical cancer, malignant ovarian tumor, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.

5. A vector which is a prokaryotic cell comprising (a) a hypoxically- or strictly anaerobically-activated promoter; and (b) an essential gene under the regulation of the promoter in (a); wherein the promoter in (a) has a binding site to an anaerobically activated transcription factor.

6. The vector of claim 5, wherein said anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.

7. The vector of claim 5, wherein said essential gene comprises dapA or dapE, and can further comprise one or more selected from the group consisting of dapB, dapD, argD, dapF, murE, murF or lysA.

8. The vector of claim 5, which, when being cultured in vitro under aerobic conditions, requires addition of 2,6-diaminoheptanedioic acid into the culture medium.

9. Use of an obligate anaerobic Salmonella bacterium in expressing a medicament or as a vector for carrying a medicament, said medicament being used for treating cancer.

10. The use of an obligate anaerobic Salmonella bacterium in expressing a medicament or as a vector carrying a medicament of claim 9, wherein said medicament comprises: (a) expressing a protein substance or a polypeptide substance having a therapeutic effect on cancer; (b) expressing RNA having a therapeutic effect on cancer; and (c) serving as a vector carrying a modified RNA medicament.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1 shows the construction of strain R1074.

[0035] FIGS. 2A-2G are electrophoretic images of the construction of 9 strains (SL7207 (AdapA)-promoter-BBa_B0033-dapA).

[0036] FIGS. 3A, 3B and 3C show in vitro experiments of 9 strains. FIG. 3A shows the photos of 9 strains (as shown by the strain abbreviation on the left side of each photo) incubated under aerobic conditions for 24-144 h, respectively. FIG. 3B shows the photos of 9 strains (as shown by the strain abbreviation on the left side of each photo) incubated under anaerobic conditions for 24 h, respectively. FIG. 3C shows the measured OD600 values of 9 strains (as shown by the strain abbreviations on X-axis) incubated under anaerobic conditions for 24 h.

[0037] FIGS. 4A-4E show the in vivo experimental results of the 9 strains constructed.

[0038] FIGS. 5(A)-5(E) are electrophoretic images of the construction of 5 strains (SL7207 (AdapE)-promoter (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE).

[0039] FIGS. 6A, 6B and 6C show in vitro experiments of 5 strains. FIG. 6A shows the photos of 5 strains (as shown by the strain abbreviation on the left side of each photo) incubated in aerobic conditions for 24-72 h. FIG. 6B shows the photos of 5 strains (as shown by the strain abbreviation on the left side of each photo) incubated in anaerobic conditions for 24 h, respectively. FIG. 6C shows the measured OD600 values of 5 strains (as shown by the of strain abbreviation on the left side of each photo) incubated in anaerobic conditions for 24 h.

[0040] FIG. 7 shows the in vivo experiment of strain SL7207 (AdapE)-R1074-BBa_B0033-dapE (abbreviation: R1074-1).

DETAILED DESCRIPTION OF THE INVENTION

[0041] Although various modifications can be made to the invention and there may be a variety of forms for the invention, the embodiments will be described and interpreted in detail as follows. However, it should be understood that these are not intended to limit the invention to a particular disclosure and that the invention comprises all modifications, equivalents or alternatives thereof without departing from the spirit and technical scope of the invention.

[0042] The method of constructing an obligate anaerobic Salmonella strain, the obligate anaerobic Salmonella strain constructed by using the method and the use thereof in tumor therapy according to specific embodiments of the invention will be interpreted in more detail hereinafter.

[0043] In one or more embodiments of the invention, the vector of the invention is a prokaryotic cell comprising (a) a hypoxically- or strictly anaerobically-activated promoter; and (b) an essential gene under the regulation of the promoter in (a), wherein the promoter in (a) has a binding site to an anaerobically activated transcription factor.

[0044] In one or more embodiments of the invention, the hypoxically or strictly anaerobically activated promoter in (a) may be, for example, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 or YsgAP.

[0045] In one or more embodiments of the invention, said transcription factor is Fnr or arcA.

[0046] In one or more embodiments of the invention, said essential gene in (b) under the regulation of the promoter in (a) may be, for example, dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular, dapA or dapE.

[0047] The invention provides a method for turning a facultative anaerobic bacterium into an obligate anaerobic bacterium by means of a circuit of hypoxically- or strictly anaerobically-induced expression of an essential gene.

[0048] In one or more embodiments of the invention, said strictly anaerobically regulatory gene circuit consists of an anaerobically activated promoter and the essential gene.

[0049] In one or more embodiments of the invention, the anaerobically activated promoter may be, for example, Pept, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 or YsgAP.

[0050] In one or more embodiments of the invention, said essential gene may be, for example, dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular, dapA or dapE.

[0051] When the essential gene is dapA or dapE gene, the vector of the invention, when being cultured under aerobic conditions, requires further addition of 2,6-diaminoheptanedioic acid (2,6-Diaminopimelic acid) or an analogue thereof into the culture medium.

[0052] The obligate anaerobic bacterium described in the invention, when used for in vivo tumor therapy, can inhibit tumor growth and reduce tumor volume.

[0053] Said facultative anaerobic bacterium may be any species from any one of the bacterial genera of bacteria of the family Enterobacteriaceae (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthraces and Corynebacterium diphtheriae and the like.

[0054] The source of said facultative anaerobic Salmonella strains is not limited, as long as they are facultatively anaerobic, comprising, for example, facultative anaerobic Salmonella strains from human, chicken, dog, cattle, etc.

[0055] Said facultative anaerobic bacterium is Salmonella typhimurium.

[0056] The invention also provides a bacteriotherapy for cancer treatment by using the strains of the invention that are unable to grow under either aerobic or anaerobic conditions.

[0057] Said cancers comprise leukemia (chronic leukemia, acute leukemia), osteocarcinoma, lymphoma (non-Hodgkin's lymphoma, Hodgkin's lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, stomach cancer, pelvic cancer (cervical cancer, malignant ovarian tumor, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.

[0058] In one or more embodiments of the invention, the vector of the invention as a prokaryotic cell, or the obligate anaerobic bacterium obtained by the method of the invention, can be used as a bacteriotherapy for anti-tumor or cancer treatment.

[0059] In one or more embodiments of the invention, the bacteriotherapy of the invention can be used in combination with other therapy for treating cancer.

[0060] In one or more embodiments of the invention, the combined application of bacteriotherapy with other therapy for treating cancer comprises, for example, (a) bacteriotherapy of an anaerobic strain in combination with operative therapy; (b) bacteriotherapy of an anaerobic strain in combination with radiotherapy; (c) bacteriotherapy of an anaerobic strain in combination with chemical medicaments: chemotherapeutics comprising alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, isocyclophosphamide, glyfosfin, etc.), antimetabolites (furtulon, doxifluridine, 6-mercaptopurine, cytarabine, fluoroguanosine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, tegafur-uracil, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, epirubicin, mitomycin, pelomycin, bleomycin, pirarubicin, etc.), phytogenic anticarcinogens (irinotecan, harringtonine, hydroxycamptothecin, vinorelbine, paclitaxel, taxotere, topotecan, vincristine, vindesine, vinblastine, etc.), hormones (atamestane, anastrozole, aminoglutethimide, letrozole, formestane, megestrol, tamoxifen, etc.), immunosuppressants and other anticancer medicaments such as asparaginase, Carboplatin, Cisplatin, Dacarbazine, Oxaliplatin, Eloxatin, Oxaliplatin, mitoxantrone, procarbazine, etc.; (d) bacteriotherapy of an anaerobic strain in combination with biotherapy; (e) bacteriotherapy of an anaerobic strain in combination with traditional Chinese medical herbal treatment.

[0061] The vector of the invention as a prokaryotic cell, or the obligate anaerobic bacterium obtained by the method of the invention, can also be used for inducing expression of a medicament in vitro or serving as a vector carrying a medicament, so as to carry out cancer treatment.

[0062] In an embodiment of the invention, the medicament that can be carried in said vector comprises: (a) expressing a protein substance or a polypeptide substance having a therapeutic effect on cancer; (b) expressing an RNA having a therapeutic effect on cancer; and (c) serving as a vector carrying a modified RNA medicament.

[0063] Advantages of the invention comprise that: [0064] (1) The anaerobic regulatory module of the modified strain is simple, the regulatory system is more rigorous, and there is no intrinsic leaky expression under aerobic conditions; [0065] (2) The modified strain can be completely cleared in normal tissues and organs within only a short time; [0066] (3) During the treatment of tumor-bearing mice, the modified strain has almost no effect on the body weight of the mice, and the safety is improved with relatively small toxic side effects.

[0067] The strain construction scheme, as shown in FIGS. 1 and 5, comprises that: on the basis of SL7207 (AdapA) and SL7207 (AdapE) already constructed in our laboratory, Fnr-SP, Hip1, I14018, Pept, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 or YsgAP-BBa_B0033-dapA anaerobic gene circuit is integrated to SL7207 (AdapA) genome (original dapA position); and Fnr-SP, Hip1, Pept, R1074, YsgAP-BBa_B0033-dapE anaerobic gene circuit is integrated to SL7207 (AdapE) genome (original dapA position). The dapA and dapE genes are key genes in the lysine metabolism pathway, and knockout of either of these two genes prevents a bacterium from forming a normal cell wall, resulting in imbalance of the osmotic pressures inside and outside the bacterium, and prevents the bacterium from surviving due to cell rupture. The above promoters are anaerobically activated promoters, which can initiate the transcription of dapA or dapE gene under anaerobic or hypoxic conditions, thereby allowing the downstream DAP protein to generate DAP. The bacterium can form an intact cell wall. Under aerobic conditions, the 9 promoters-BBa_B0033-dapA or the 5 promoters-BBa_B0033-dapE gene circuits are inactivated and the bacteria are unable to produce an intact cell wall. Cultivation of SL7207 (dapA)-Promoter (one of the 9 promoters as shown in Table 1)-BBa_B0033-dapA strain or SL7207 (AdapE)-Promoter (one of the 5 promoters)-BBa_B0033-dapE strain under aerobic conditions requires the addition of DAP (diaminoheptanedioic acid), which can compensate for the genetic deletion of dapA or dapE resulting in the inability of the bacteria to form an intact cell wall.

TABLE-US-00001 TABLE1 Promotersusedintheinvention Promotername Sequence Fnr-SP 5GATCCGCCGCAAAGTTT GAGCGAAGTCAATAAACTCT CTACCCATTCAGGGCAATAT CTCTCTTGCAGGTGAATGCA ACGTCAAGCGAT3 Hip1 5GATCGGATAAAAGTGAC CTGACGCAATATTTGTCTTT TCTTGCTTAATAATGTTGTC A3 I14018 5GATCTGTAAGTTTATAC ATAGGCGAGTACTCTGTTAT GG3 Pept 5GATCGCAGGGGTAAAAG TGACCTGACGCAATATTTGT CTTTTCTTGCTTCTTAATAA TGTTGTCACAAAAAGTGAGG GTGACTACATGG3 Ptet-arcA 5GATCGTTAATAAAATGT TATTGACAGTTAATAAAATG TTATACTGAGC3 Ptet-Fnr 5GATCAAAATTGATCTGA ATCAATATTTTGACAAAAAT TGATCTGAATCAATATTTAC TGAGC3 R1074 5GATCTTAAATTTCCTCT CGTCAGGCCGGAATAACTCC CTATAATGCGCCACCACACT GATAGTGCTAGTGTAGATCA C3 Ssbp1 5GATCAACCGAGGTCACA ACATAGTAAAAGCGCTATTG GTAATGGTACAATCGCGCGT TTACACTTATTCAGAACGAT TTTTTTCAGGAG3 YsgAP 5GATCTCAGAAGAAGCAA AAAGACACTTTACCGAAGGG TTTAACATTTTTTCGTGATA CTCATCACCATGACGCAAAT GCGTTGCATAAA3

TABLE-US-00002 TABLE2 Primersusedforthecloning oftheinvention Primername Sequence Vector- 5-gattacttcgcattgca Forward- atcag-3 primer1 Vector- 5-caagtaggcctgagacc Reverse- ac-3 primer2 dapA- 5-gtggtctcaggcctact Forward- tgtcacacaggacggtacca primer tgttcacgggaagtatt-3 dapA- 5-gattgcaatgcgaagta Reverse- atcttagtgatggtgatggt primer gatgcagcaggccagcattg -3 dapA-HR- 5-tgccataccaaacgtac forward- cattgagggacttgtttgca primer cagaggatggccccgaagaa aggcccacccgtg-3 dapA-HR- 5-tcgccaggcgcgacttt Reverse- tgtactgagtaagccatcaa primer atctccctaaactatttgtc ctactcaggagagcgttc- 3 dapAhomologous 5-ggaaaccataaaaaaaa recombination cctgcat-3 identification forwardprimer dapAhomologous 5-aacgtagcggcgcgaga recombination t-3 identification reverseprimer Vector- 5-gattacttcgcattgca Forward- atcag-3 primer3 Vector- 5-taccgtcctgtgtgaca Reverse agt-3 primer4 dapE- 5-acttgtcacacaggacg Forward- gatgtcgtgcccggttattg primer ag-3 dapE- 5-gattgcaatgcgaagta Reverse- atcttagtgatggtgatggt primer gatgggcgacgagctgttcc at-3 dapE-HR- 5-ttggtttcagtgaatcc Forward- cgttatcagcagttttttga primer tgaggtgtagtctatttgtc ctactcaggagagcgttc- 3 dapE-HR- 5-caatattttgccagcca Reverse- gtccatgcttatttcctctt primer accggaacgctcacgaagaa aggcccacccgtg-3

EXAMPLES

Example 1: Construction of 9 Obligate Anaerobic Strains (SL7207 (AdapA)-Promoters-BBa_B0033-dapA) (Primers Used in the Following Experiments are Shown in Table 2)

[0068] 1. Construction of pSC101-BBa_B0033-dapA plasmid [0069] a. Linearized vector fragment 1 was obtained via PCR using pSC101-FbFp-KnaR-loxp+promoter plasmid as the template, with Backbone-Forward-primer and Backbone-Reverse-primer as primers; [0070] b. Target fragment 1 was obtained via PCR using Salmonella SL7207 genome as the template, with dapA-Forward-primer and dapA-Reverse-primer as primers; and [0071] c. The pSC101-BBa_B0033-dapA plasmid was obtained via one-step cloning method.

[0072] 2. Construction of pSC101-R1074-BBa_B0033-dapA plasmid [0073] a. The pSC101-BBa_B0033-dapA plasmid was enzymatically cleaved by Bsal to obtain linearized vector fragment 2; [0074] b. Primer annealing method was carried out to obtain the R1074 promoter fragment; [0075] c. The pSC101-R1074-BBa_B0033-dapA plasmid was obtained by ligating by ligase.

[0076] 3. Construction of SL7207 (AdapA)-R1074-BBa_B0033-dapA strain [0077] a. Homologous recombinant (HR) fragment 2 was obtained via PCR using the pSC101-R1074-BBa_B0033-dapA plasmid as the template, with dapA-HR-Forward-primer and dapA-HR-Reverse primer as primers; [0078] b. The homologous recombinant fragment 2 was integrated to the original dapA gene position of SL7207 (AdapA) by 2\,-red homologous recombination method to obtain SL7207 (AdapA)-R1074-BBa_B0033-dapA target strain.

[0079] The other 8 target strains (below) were constructed in a manner essentially identical to the SL7207 (AdapA)-R1074-BBa_B0033-dapA strain, requiring the replacement of the b primer annealing fragment in step 2 with Hip1, I14018, Ptet-Fnr, PepT, Ptet-arcA, Ssbp1, Fnr-SP, and YsgAP promoter fragments. [0080] 1. SL7207 (AdapA)-Fnr-SP-BBa_B0033-dapA; [0081] 2. SL7207 (AdapA)-Hip1-BBa_B0033-dapA; [0082] 3. SL7207 (AdapA)-I14018-BBa_B0033-dapA; [0083] 4. SL7207 (AdapA)-Pept-BBa_B0033-dapA; [0084] 5. SL7207 (AdapA)-Ptet-arcA-BBa_B0033-dapA; [0085] 6. SL7207 (AdapA)-Ptet-Fnr-BBa_B0033-dapA; [0086] 7. SL7207 (AdapA)-Ssbp1-BBa_B0033-dapA; [0087] 8. SL7207 (AdapA)-YsgAP-BBa_B0033-dapA.

[0088] The 9 strains were abbreviated as (Fnr-SP; Hip1; I14018; Pept; Ptet-arcA; Ptet-Fnr; R1074; Ssbp1; YsgAP), and the electrophoresis results are shown in FIGS. 2A-2G.

Example 2: In Vitro Characterization of the 9 Strains

[0089] Characterization under aerobic conditions: 1 monoclone was picked and added into LB(DAP+) medium containing kanamycin; 3 monoclones were picked and added into LB(DAP) medium containing kanamycin, respectively. The monoclones were incubated in an air bath shaker (37 C., 220 rpm) for a period of time.

[0090] Characterization under anaerobic conditions: 3 monoclones were picked and added into LB(DAP+) medium containing kanamycin. Overnight incubation was carried out in an air bath shaker (37 C., 220 rpm). The bacterial suspension after overnight incubation was placed in an anaerobic incubator and transferred at a ratio of 1:100. 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP+) medium containing kanamycin; 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP) medium containing kanamycin, carried out in triplicate. The initial OD600 value of the samples after transferring was measured. The samples were incubated stationarily in an anaerobic incubator at 37 C. for 24 h. After incubation for 24 h, the OD600 values of the samples were measured.

[0091] Experimental results (as shown in FIGS. 3A-3C):

[0092] (1) Under aerobic condition: the 9 strains were incubated in LB(DAP+) medium for 144 h, and these strains could grow normally. The 9 strains were incubated in LB(DAP) medium for 144 h, and these strains could not grow.

[0093] (2) Under anaerobic condition: the 9 strains were cultured in LB(DAP+) medium and in LB(DAP) medium for 24 h. These strains could grow in both LB(DAP+) medium and LB(DAP) medium.

[0094] Conclusion: by means of the tests on the bacterial strains under aerobic and anaerobic conditions, it showed that the facultative anaerobic strain SL7207 was successfully modified into an obligate anaerobic strain.

Example 3: In Vivo Characterization of the 9 Strains

[0095] C57BL/6 mice were subcutaneously inoculated with 110.sup.6 mouse bladder cancer cells (MB49) per mouse to establish a subcutaneous tumor model of mouse bladder cancer. The experiment was divided into PBS group, SL7207 strain group, Fnr-SP group, Hip1 group, I14018 group, Pept group, Ptet-arcA group, Ptet-Fnr group, R1074 group, Ssbp1 group and YsgAP group. The tail vein was inoculated with 110.sup.7 of each type of bacteria of the invention per mouse. The distribution of each bacteria in normal tissues and organs and in tumors of tumor-bearing mice, the change of tumor volume, the change of mouse body weight, and the percent survival of mice were detected within 6 days. Experimental results comprise (as shown in FIGS. 4A-4E):

[0096] (1) Distribution of bacteria in the tumor-bearing mice (FIGS. 4A-4E, left column): The bacterial strain of the Fnr-SP group was cleared slowly in vivo, and the normal and tumor tissues had a large number of the bacteria; the bacterial strains of the Hip1, I14018, R1074, and Ssbp1 groups were cleared relatively quickly in vivo. The amounts of the bacteria in heart, liver, lung, kidney and blood were relatively lower, and there were 10.sup.4 (CFU/g) bacteria in spleen and tumor tissues. The bacteria of the Pept and YsgAP groups were only present in small amounts in liver and spleen, and were absent in other tissues, organs and tumor. The bacteria of the Ptet-arcA group were only present in small amounts in heart, liver and lung, and were absent in spleen, kidney, blood and tumor tissues. The bacteria of the Ptet-Fnr group were only present in liver and tumor tissues, but were absent in other organs.

[0097] (2) Changes in tumor volume (FIGS. 4A-4E, middle column): compared with the PBS group, all the 9 strain groups had inhibitory effects on tumor growth within 6 days.

[0098] (3) Changes in body weight of mice (FIGS. 4A-4E, right column): compared with SL7207 group, the mice of the 9 strain groups had less weight loss, which was slightly lower than that of PBS group.

[0099] (4) Percent survival of mice: all mice of SL7207 group died within 6 days. There were no deaths of mice in the 9 strain groups and PBS group during the experimental cycle.

[0100] Conclusion: within 6 days, the distribution of the 9 modified strains in normal tissues and organs in vivo was not identical to that in tumors. Compared with SL7207 group, the 9 strains of the invention were cleared in large amounts in vivo. The tumor volumes in 9 strain groups of the invention were all reduced. The mice of the 9 strain groups had slightly lower body weight than that of the PBS group during the experimental cycle, without any death. It indicates that the 9 strains of the invention have improved safety while having an inhibitory effect on tumors, compared with the prior art.

Example 4: Construction of 5 Obligate Anaerobic Strains (SL7207 (AdapE)-Promoter-BBa_B0033-dapE)

[0101] 1. Construction of pSC101-Promoters-BBa_B0033-dapE plasmids [0102] a. Five linearized vector fragments were obtained via PCR by using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapA plasmids as the templates, with Backbone-Forward-primer 3 and Backbone-Reverse-primer 4 as primers (results as shown in FIG. 5(A)); [0103] b. Target fragment 2 was obtained via PCR by using Salmonella SL7207 genome as the template, with dapE-Forward-primer and dapE-Reverse-primer as primers (results as shown in FIG. 5(A)); [0104] c. The pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE plasmids were obtained via one-step cloning method (results as shown in FIG. 5(B)).

[0105] 3. Construction of SL7207 (AdapE)-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE strains [0106] a. Five homologous recombinant fragments were obtained via PCR by using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE plasmids as the templates, with dapE-HR-Forward-primer and dapE-HR-Reverse-primer as primers (results are shown in FIG. 5(C)); [0107] b. The five homologous recombinant fragments were integrated into the original dapE gene position of SL7207 (AdapE) by 2\,-red homologous recombination method to obtain SL7207 (AdapE)-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE target strains (results as shown in FIGS. 5(D) and (E)).

[0108] The five strains were abbreviated as (R1074-1, YsgAP-1, Fnr-SP-1, Pept-1, Hip1-1).

Example 5: In Vitro Characterization of the 5 Obligate Anaerobic Strains (SL7207 (AdapE)-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE)

[0109] Characterization under aerobic conditions: 3 clones were picked and added into LB(DAP+) medium containing spectinomycin and incubated overnight in an air bath shaker (37 C., 220 rpm). The bacterial suspension after overnight incubation was transferred at a ratio of 1:100. 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP+) medium containing spectinomycin; 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP) medium containing spectinomycin, carried out in triplicate. The bacterial strains were incubated in an air bath shaker (37 C., 220 rpm) for 72 h and the growth of the strains was observed.

[0110] Characterization under anaerobic conditions: 3 monoclones were picked and added into LB(DAP+) medium containing spectinomycin and incubated overnight in an air bath shaker (37 C., 220 rpm). The bacterial suspension after overnight incubation was placed in an anaerobic incubator and transferred at a ratio of 1:100. 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP+) medium containing spectinomycin; 20 l of the bacterial suspension was taken and added into 2 ml of LB(DAP) medium containing spectinomycin, carried out in triplicate. The bacterial strains were incubated stationarily in an anaerobic incubator (37 C.) for 24 h. After incubation for 24 h, the OD600 values of the samples were measured.

[0111] Experimental results (as shown in FIGS. 6A-6C):

[0112] (1) Under aerobic condition: the 5 strains were incubated in LB(DAP+) medium for 72 h, and these strains could grow normally. The 5 strains were incubated in LB(DAP) medium for 72 h, and these strains could not grow.

[0113] (2) Under anaerobic condition: 5 strains were incubated in LB(DAP+) medium and in LB(DAP) medium for 24 h. These strains could grow in both LB(DAP+) medium and LB(DAP) medium.

[0114] Conclusion: by means of the tests on the 5 strains under aerobic and anaerobic conditions, it showed that the facultative anaerobic strain SL7207 was successfully modified into an obligate anaerobic strain.

Example 6: In Vivo Characterization of R1074-1 Strain

[0115] C57BL/6 mice were subcutaneously inoculated with 110.sup.6 mouse bladder cancer cells (MB49) per mouse to establish a subcutaneous tumor model of mouse bladder cancer. The experiment was divided into PBS group and R1074-1 group. The tail vein was inoculated with 110.sup.7 bacteria of the invention per mouse. The tumor volume change, mouse weight change, and percent survival of mice were detected within 14 days. Experimental results comprise (as shown in FIG. 7):

[0116] (1) Tumor volume change (FIG. 7A): compared with the PBS group, the R1074-1 strain group had an inhibitory effect on tumor growth during the experimental cycle.

[0117] (2) Changes in body weight of mice (FIG. 7B): compared with the PBS group, the R1074-1 strain group showed no significant difference in body weight of mice during the experimental cycle

[0118] (3) Percent survival of mice: during the experimental cycle, mice in both PBS and R1074-1 strain groups survived.

[0119] Conclusion: during the experimental period, R1074-1 strain can inhibit the tumor growth in mice; meanwhile, compared with the PBS group, there is no significant difference in the body weight of the mice and all mice survived, which means that said strain is safe.