CATALYTIC AMPLIFICATION BY TRANSITION-STATE MOLECULAR SWITCHES FOR DIRECT AND SENSITIVE DETECTION OF SARS-COV-2
20240043945 ยท 2024-02-08
Assignee
Inventors
- Huilin SHAO (Singapore, SG)
- Noah Riandiputra Sundah (Singapore, SG)
- Auginia Natalia (Singapore, SG)
- Yu LIU (Singapore, SG)
Cpc classification
B01L2200/16
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502738
PERFORMING OPERATIONS; TRANSPORTING
C12Q2563/131
CHEMISTRY; METALLURGY
B01L2200/0647
PERFORMING OPERATIONS; TRANSPORTING
C12Q2563/125
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2563/125
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to the detection of target nucleic acids using enzyme-assisted nanotechnology. More specifically, the present invention provides a molecular nanotechnology in the form of a transition-state DNA-enzyme molecular switch and methods of use that enables direct and sensitive detection of viral RNA targets in native clinical samples. In one embodiment, the detection comprising steps of providing a composition comprising at least one DNA polymerase enzyme, at least one enhancer, and at least one DNA polymerase inhibitor, wherein the DNA polymerase inhibitor is recognized and bound by the DNA polymerase enzyme via its conserved region, and is complementary to a portion of the enhance via its variable region. In another embodiment, the detection method comprising steps of providing a signalling nanostructure and detecting signal development, wherein a change in the intensity of signal. In an alternative embodiment, the target nucleic acid is a SARS-CoV-2 polynucleotide.
Claims
1. A method of detecting target polynucleotides in a sample, comprising the steps of: (a) providing a sample comprising polynucleotides; (b) providing a composition comprising at least one DNA polymerase enzyme, at least one enhancer, and at least one DNA polymerase inhibitor, wherein; i) the enhancer is a polynucleotide comprising a sequence that is complementary to a target polynucleotide sequence; ii) the DNA polymerase inhibitor is a polynucleotide comprising a conserved region and a variable region, wherein the conserved region is recognized and bound by the DNA polymerase enzyme, and the variable region is complementary to a portion of the enhancer; iii) complementary sequences of the variable region of the inhibitor and enhancer form a duplexed inhibitory DNA complex which inhibits DNA polymerase activity; iv) the composition comprises an amount of inhibitory complex that has been determined to have the fastest response and/or highest signal-to-noise ratio, for example by using first derivative of a titration curve of inhibitory complex v polymerase activity and/or by using first derivative of a titration curve of ratios of enhancer:inhibitor; (c) contacting the sample comprising nucleic acid with the composition of (b), wherein target polynucleotide binding to: (i) the enhancer sequence region of the duplex in (b) displaces the inhibitor, thereby releasing and activating the DNA polymerase; (d) providing a signalling nanostructure that is reactive to active DNA polymerase enzyme from step (c); (e) contacting the signalling nanostructure with active DNA polymerase enzyme from step (c); (f) detecting signal development, wherein a change in the intensity of signal indicates the presence of target nucleic acid in the sample when using composition (b).
2. The method of claim 1, wherein the signalling nanostructure in d) comprises: i) a self-priming portion responsive to the DNA polymerase enzyme, whereby in the presence of labelled oligonucleotides (dNTPs) and signal development reagents, the activated DNA polymerase enzyme adds labelled oligonucleotides to the signalling nanostructure and the signal development reagents bind to the labelled oligonucleotides incorporated into the self-primed portion; or ii) a self-priming exonuclease dumbbell nanostructure responsive to DNA polymerase enzyme exonuclease activity, wherein activated DNA polymerase enzyme removes labelled dNTPs from the dumbbell signalling nanostructure.
3. The method of claim 1, further comprising the step of: (g) diagnosing the patient with the disease when presence of target nucleic acid in the sample is detected.
4. The method according to claim 1, wherein the DNA polymerase inhibitor conserved sequence region comprises the nucleic acid sequence set forth in SEQ ID NO: 14; 5-CAATGTACAGTATTG-3; and/or wherein the enhancer to inhibitor ratio in the composition is less than 1:1.
5. (canceled)
6. The method according to claim 1, wherein the enhancer is at least one nucleotide longer than the inhibitor duplex region; and/or wherein the enhancer is about 35 to 45 nucleotides in length; and/or wherein about half of the length of the enhancer oligonucleotide forms the inhibitor-enhancer duplex and about half forms an overhang segment.
7. (canceled)
8. (canceled)
9. The method according to claim 2, wherein the signalling nanostructure in d) comprises: i) a self-priming portion comprising the nucleic acid sequence set forth in SEQ ID NO: 5: 5-CGGCGTACGTAGAGCGTTGAGCAGGATGCCAACAGTCGATCAGGACGAGTGCTAAC G CATTGTCGATAGCTCAGCTGTCTGAGCTATCGACAATGCGTT-3; or ii) a self-priming exonuclease dumbbell nanostructure comprising the nucleic acid sequence set forth in SEQ ID NO: 6: 5-GTGCGTACATAGATCGTTATCTGTCTAACGATCTATGTAC GCACTCACTCAGCTAACGCATTGTCGATAGCTCAGCTGTCTGAGCTATCGACAATGC GTT-3.
10. The method according to claim 1, wherein the dNTP label is biotin; and/or wherein the signal development reagents comprise a fusion protein comprising avidin or a derivative thereof and an enzyme, selected from a group comprising but not limited to HRP, beta-lactamase, amylase, beta-galactosidase, and respective substrates selected from a group comprising but not limited to DAB, TMB, ABTS, ADHP, nitrocefin, luminol, starch and iodine, wherein signals can be measured and quantified as but not limited to colour, fluorescence, luminescence or electrochemical changes.
11. (canceled)
12. The method according to claim 1, wherein the target is at least one nucleic acid associated with a non-human or human disease, genetic variants, forensic, strain identification, environmental and/or food contamination.
13. The method according to claim 1, wherein the target is at least one pathogen polynucleotide.
14. The method according to claim 1, wherein the target is a SARS-CoV-2 polynucleotide; or wherein the target is a SARS-CoV-2 polynucleotide and the inhibitor and enhancer polynucleotides are selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4
15. (canceled)
16. The method according to claim 1, performed in a multi-well format, a microfluidic device or lateral flow device.
17. The method according to claim 1, wherein the steps are performed in the range from 16 C. to 40 C., or at room temperature.
18. A device comprising: (i) composition b) comprising at least one DNA polymerase enzyme and at least one inhibitory DNA complex, of claim 1, at a first location; (ii) signalling nanostructures attached at a second location; and (iii) an intermediate stage for mixing of said detection nanostructures with sample nucleic acid to release active enzyme to said second location.
19. The device of claim 18, selected from a group comprising a multi-well plate, a microfluidic device and a lateral flow device.
20. The device of claim 18, wherein the device is a microfluidic device comprising: (i) an inlet at a first location, to introduce test sample, positive and negative controls, and reconstitute the lyophilized reagents in the device including at least one DNA polymerase enzyme, at least one enhancer, and at least one DNA polymerase inhibitor as defined in any aspect of the invention; (ii) a detection chamber comprising signalling nanostructures at a second location, in fluid connection with said first location, to receive activated DNA polymerase enzyme; (iii) valves between said first and second locations to control flow of sample and reagents; wherein, when the device is assembled and in use, there is fluidic flow from the sample inlet to an outlet.
21. A nucleic acid detection kit comprising; (a) a composition comprising at least one DNA polymerase enzyme and at least one inhibitory DNA complex, wherein the inhibitory DNA complex comprises a DNA polymerase enzyme-specific DNA inhibitor and an enhancer polynucleotide, wherein the inhibitor has a conserved sequence region and a variable sequence region, wherein the variable sequence region comprises an overhang segment which is at least 7 nucleotides complementary to, and forms a duplex with, a portion of the enhancer polynucleotide, wherein the enhancer polynucleotide is at least one nucleotide longer than the inhibitor-enhancer duplex and has more than 7 nucleotides complementary to a target polynucleotide; and/or (b) a signalling nanostructure that is reactive to active DNA polymerase enzyme; and/or (c) labelled nucleotides (dNTPs) and signal development reagents, wherein active DNA polymerase enzyme adds labelled nucleotides to the signalling nanostructure and the signal development reagents bind to the labelled nucleotides incorporated into the self-primed portion.
22. The nucleic acid detection kit of claim 21, wherein said composition and said signalling nanostructure are as defined according to any one of the previous claims.
23. The nucleic acid detection kit of claim 21, configured into a device comprising: (i) composition b) comprising at least one DNA polymerase enzyme and at least one inhibitory DNA complex at a first location; (ii) signalling nanostructures attached at a second location; and (iii) an intermediate stage for mixing of said detection nanostructures with sample nucleic acid to release active enzyme to said second location.
24. The nucleic acid detection kit of claim 21, wherein at least one of the inhibitor polynucleotides and/or enhancer polynucleotides is structurally and/or chemically modified from its natural nucleic acid.
25. The nucleic acid detection kit of claim 24, wherein said structural and/or chemical modification is selected from the group comprising the addition of tags, such as fluorescent tags, radioactive tags, biotin, a 5 tail, the addition of phosphorothioate (PS) bonds, 2-O-Methyl modifications and/or phosphoramidite C3 Spacers during synthesis.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
DETAILED DESCRIPTION OF THE INVENTION
[0076] Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference. Any discussion about prior art is not an admission that the prior art is part of the common general knowledge in the field of the invention.
Definitions
[0077] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention belongs. Certain terms employed in the specification, examples and appended claims are collected here for convenience.
[0078] It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a target sequence includes a plurality of such target sequences, and a reference to an enzyme is a reference to one or more enzymes and equivalents thereof known to those skilled in the art, and so forth.
[0079] The phrases nucleic acid or nucleic acid sequence, as used herein, refer to an oligonucleotide, nucleotide, polynucleotide, or any fragment thereof, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent the sense or the antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material.
[0080] As used herein, the term inhibitory complex refers to a duplex of inhibitor polynucleotide and enhancer polynucleotide which inactivates DNA polymerase bound to it.
[0081] As used herein, the term DNA polymerase inhibitor or inhibitor is a polynucleotide comprising a conserved region and a variable region, wherein the conserved region is recognized and bound by the DNA polymerase enzyme, and the variable region is complementary to a portion of the enhancer polynucleotide.
[0082] As used herein, the term enhancer refers to a polynucleotide comprising a sequence that is complementary to a target polynucleotide sequence, of which a portion is involved in forming a duplex with complementary sequences of the variable region of the DNA polymerase inhibitor and a portion is involved in an overhang. Preferably, the enhancer is about 40 nucleotides in length, that is complementary to a target polynucleotide sequence, and 20 of the 40 nucleotides form the duplex with the inhibitor and 20 nucleotides of the 40 nucleotides form an overhang. Thus, the inhibitor and enhancer form a duplexed inhibitory DNA complex which inhibits DNA polymerase activity until such time as the enhancer is displaced upon duplex formation with target polynucleotide sequence.
[0083] As used herein, the term transition state refers to an optimum inhibitor complex:DNA polymerase ratio which is further optimized in respect of enhancer:inhibitor ratio (see, for example
[0084] The term sample, as used herein, is used in its broadest sense. For example, a biological sample suspected of containing SARS-CoV-2 genome sequences may comprise a bodily fluid; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; a cell; genomic DNA, RNA, or cDNA (in solution or bound to a solid support); a tissue; a tissue print; and the like.
[0085] It would be understood that oligonucleotides used in the present invention may be structurally and/or chemically modified to, for example, prolong their activity in samples potentially containing nucleases, during performance of methods of the invention, or to improve shelf-life in a kit. Thus, the inhibitor and/or enhancer and/or signalling nanostructure or any oligonucleotide primers or probes used according to the invention may be chemically modified. In some embodiments, said structural and/or chemical modifications include the addition of tags, such as fluorescent tags, radioactive tags, biotin, a 5 tail, the addition of phosphorothioate (PS) bonds, 2-O-Methyl modifications and/or phosphoramidite C3 spacers during synthesis.
[0086] For example, the signalling oligonucleotide was modified for attachment chemistry with a 5 thiol group. Other attachment modifications can be made on the 5 end such as amino, acryldite, azide, etc.
[0087] The term comprising as used in the context of the invention refers to where the various components, ingredients, or steps, can be conjointly employed in practicing the present invention. Accordingly, the term comprising encompasses the more restrictive terms consisting essentially of and consisting of. With the term consisting essentially of it is understood that the phenotypic features of the present invention substantially comprise the indicated features as essential element.
EXAMPLES
Example 1
[0088] Material and Methods
Molecular Switch Design and Preparation.
[0089] All oligonucleotide sequences can be found in Table 1 and were purchased from Integrated DNA Technologies (IDT). Genome sequences of SARS-CoV-2 (NC_045512), SARS-CoV (FJ882957), MERS (NC_019843), dengue virus (NC_001477) and influenza A subtype H1N1 virus (strain A/California/07/2009(H1N1), NC_026431-NC_026438) were obtained from NCBI RefSeq. Multiple sequence alignment was performed using the UGENE suite of tools [Okonechnikov K et al., Bioinformatics. 2012, 28:1166-1167]. To prepare molecular switches, we mixed inhibitor and enhancer oligonucleotides (Table 1, IDT) in a reaction buffer made up of 50 mM NaCl, 1.5 mM MgCl.sub.2, and 50 mM Tris-HCl (pH 8.5). The mixture was incubated at 95 C. for 5 min and slowly cooled at 0.1 C./s until the reaction reached 25 C. to form the inhibitory complex. Taq DNA polymerase (Promega) was then added to form the complete molecular switch.
TABLE-US-00001 TABLE1 Oligonucleotidesequences. Molecularswitches SARS-COV-2 TTATTTGACTCCTGGTGATTCAATGTACAGTATTG Sgeneinhibitor SEQIDNO:1 SARS-COV-2 AATCACCAGGAGTCAAATAACTTCTATGTAAAGCAAGTAA Sgeneenhancer SEQIDNO:2 SARS-COV-2 AATCCATGAGCAGTGCTGACCAATGTACAGTATTG Ngeneinhibitor SEQIDNO:3 SARS-COV-2 GTCAGCACTGCTCATGGATTGTTGCAATTGTTTGGAGAAA Ngeneenhancer SEQIDNO:4 Signallingoligonucleotides Self-priminghairpin CGGCGTACGTAGAGCGTTGAGCAGGATGCCAACAGTCGATCAGG template ACGAGTGCTAACGCATTGTCGATAGCTCAGCTGTCTGAGCTATCG ACAATGCGTT SEQIDNO:5 Biotinylateddumbbell GTGCGTACATAGATCGTTATCTGTCTAACGATCTATGTACGCACT template CACTCAGCTAACGCATTGTCGATAGCTCAGCTGTCTGAGCTATCG ACAATGCGTT SEQIDNO:6 Mismatchanalysis SARS-COV-2 GTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGT Sgenesynthetic GATTCTTCTTCAGG target SEQIDNO:7 2mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGTTCTTTGACTCCTGAT SARS-COV-2 GATTCTTCTTCAGG Sgenesynthetic SEQIDNO:8 target 4mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGTTCTTGGACTCATGAT SARS-COV-2 GATTCTTCTTCAGG Sgenesynthetic SEQIDNO:9 target 6mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGCTCTTGGAATCATGAT SARS-COV-2 GATTCTTCTTCAGG Sgenesynthetic SEQIDNO:10 target 8mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGCTCTGGGAATCATGAT SARS-COV-2 GAGTCTTCTTCAGG Sgenesynthetic SEQIDNO:11 target 10mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGCTCTGGGAATCAGGAT SARS-COV-2 TAGTCTTCTTCAGG Sgenesynthetic SEQIDNO:12 target 12mismatch GTTTCAAACTTTACTTGCTTTACATAGAAGCTCTGGGTATCAGGAT SARS-COV-2 TAGGCTTCTTCAGG Sgenesynthetic SEQIDNO:13 target
Bolded nucleotides indicate possible sites of biotin incorporation/removal.
Underlined nucleotides indicate mismatches.
Transition-State Characterization.
[0090] To identify various states of the molecular switch, we varied the ratio of its constituents, first with the inhibitor and enhancer strand at 1:1 ratio, then at varying ratios of these two components. The resultant polymerase activity was measured through 5 exonuclease degradation of fluorescent signalling probe. Briefly, equimolar amounts of fluorescent probe, template and primer (IDT) were mixed with deoxynucleotide triphosphates (dNTPs, Thermo Scientific) in the reaction buffer. The mixture was incubated at 95 C. for 5 min and slowly cooled to 25 C. at 0.1 C./s. Molecular switches were then added to the probe mixture and incubated at 25 C. while fluorescence readings were taken. Based on the observed changes in polymerase activity, we defined the different states of molecular switches: the open state is where the inhibitory complex is lacking (<20 nM), the closed state is where the inhibitory complex is in excess (>60 nM) and the transition state is the most responsive state (i.e., the vertex of the first derivative of the inhibition curve, where a small change in the switch composition would result in the largest change in polymerase activity). To characterize the responsiveness of the different switch states to nucleic acid targets, we prepared switches at the following representative composition and incubated the switches with target oligonucleotides: open state, 1 nM of inhibitor strand and 1 nM of enhancer strand; closed state, 100 nM of inhibitor strand and 100 nM of enhancer strand; and the transition state, 36 nM of inhibitor strand and 24 nM of enhancer strand. All experiments were also performed with scrambled oligonucleotides to determine background off-target signal.
Immobilization of Signalling Oligonucleotides.
[0091] Signalling oligonucleotides were immobilized on an ELISA plate as illustrated in
Amplification of Polymerase Activity by Horseradish Peroxidase (HRP).
[0092] Two forms of signalling oligonucleotides were used and evaluated to amplify and transduce different types of polymerase activity, namely exonuclease- and elongation-based activity. In both approaches, control wells containing no polymerase were run concurrently to provide the baseline signal. For the exonuclease-based strategy, we immobilized dumbbell DNA signalling structures on the plate and measured the polymerase activity (5 exonuclease activity) through the catalytic removal of biotin-modified nucleotides from the immobilized dumbbells. Briefly, we mixed sample targets with transition-state molecular switches and directly incubated the reaction with immobilized oligonucleotides, in the presence of dNTPs (Thermo Scientific), for 30 min at room temperature. Following washing steps with PBST and incubation with streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific), we applied QuantaRed chemifluorescence substrate (Thermo Scientific) and measured the fluorescence intensity (Tecan) to evaluate the removal of biotin-modified nucleotides.
[0093] For the elongation-based strategy, polymerase activity was measured through the incorporation of biotin-modified nucleotides to self-priming, hairpin DNA signalling structures immobilized on the plate. Sample and molecular switches were added to the signalling structures and incubated in the presence of biotin-modified dNTPs mixture (TriLink BioTechnologies). Following incubation for 30 min at room temperature and washing with PBST, we incubated streptavidin-conjugated HRP (Thermo Scientific). After washing, we applied QuantaRed chemifluorescence substrate (Thermo Scientific) and measured the fluorescence intensity (Tecan) to evaluate the addition of biotin-modified nucleotides.
CATCH Assay (Plate Format).
[0094] Transition-state molecular switches were prepared as previously described. Sample containing target was mixed with the prepared molecular switches to a final volume of 50 l. The mixture was added to the self-priming DNA signalling structures, immobilized on the plate, in the presence of biotin-modified dNTP mixture. The reaction mixture was incubated for 30 min at room temperature. Following washing steps with PBST and incubation with streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific), we applied QuantaRed chemifluorescence substrate (Thermo Scientific) and measured the fluorescence intensity (Tecan). For each sample, sample-matched positive (containing polymerase without inhibitory complex) and negative (scrambled molecular switch) controls were run concurrently for data normalization.
Device Fabrication.
[0095] A prototype microfluidic device was fabricated through standard soft lithography as previously described [X. Wu, et al., Sci Adv 6, eaba2556 (2020)]. Briefly, 50-m-thick cast molds were patterned with SU-8 photoresist and silicon wafers using a cleanroom mask aligner (SUSS MicroTec) and developed after ultraviolet (UV) exposure. Polydimethylsiloxane (PDMS, Dow Corning) and cross-linker were mixed at a ratio of 10:1 and casted on the SU-8 mold. The polymer was first cured at 75 C. for 30 min. Then, multiple nylon screws and hex nuts (RS Components) were positioned on the PDMS film over their respective channels and embedded in the PDMS, before a final curing step.
Device Preparation.
[0096] To immobilize the signalling oligonucleotides on the device, we treated the device's glass surface with (3-aminopropyl)triethoxysilane (APTES, 2% v/v, Sigma) in 95% ethanol for 1 h at room temperature. The chambers were then flushed with ethanol to remove excess APTES and dried. Separately, thiol-modified signalling oligonucleotides were activated as previously described. The activated oligonucleotides were then flowed in and incubated for 2 h at room temperature. After flushing with PBST to remove excess oligonucleotides, the chambers were blocked with 2% BSA for 1 h at room temperature. The chambers were then washed with PBST and the reaction buffer. To prepare the device for operation, we lyophilized the assay reagents within the device. The reagent mixture, containing inhibitor strand, enhancer strand, polymerase and biotin-modified dNTP mixture, was flowed into the device and lyophilized overnight (Labconco).
CATCH Assay (Microfluidic Chip Format).
[0097] Operation steps of the microfluidic device are illustrated in
Smartphone-Based Optical Sensor.
[0098] To enable smartphone analysis of the microfluidic CATCH assay, we developed a sensor that comprised a LED source, an optical filter and a magnification lens within a 3D-printed optical cage as previously described [X. Wu, et al., Sci Adv 6, eaba2556 (2020)]. The optical cage was fabricated from a UV-curable resin (HTM 140) using a desktop 3D printer (Aureus). The central wavelengths of the LED light source (Chaoziran S&T) and optical filter (Thorlabs) were 500 and 600 nm, respectively. The magnification lens (Thorlabs) was placed before the smartphone camera to improve the image quality. The assembled system measured 45 mm (width) by 45 mm (length) by 50 mm (height) in dimension and was equipped with two sliding slots for quick attachment to smartphones (Apple). Sensor performance was evaluated against a commercial microplate reader (Tecan) for different fluorescent dyes and intensities.
Data Normalization.
[0099]
I.sub.norm=(I.sub.targetI.sub.control)/(I.sub.polI.sub.control)
where I.sub.norm is the normalized fluorescence intensity, I.sub.target is the fluorescence intensity of the sample incubated with molecular switches against the target, I.sub.control is the fluorescence intensity of the sample-matched negative control, incubated with scrambled control molecular switches, and I.sub.pol is the fluorescence intensity of the sample-matched positive control, incubated with active polymerase.
Evaluation of CATCH Performance.
[0100] To evaluate the specificity of the transition state compared to that of the closed state, molecular switches were mixed with targets with varying number of mismatches at positions that would most drastically affect the signal produced by the molecular switches [Ho N R Y et al., Nat Commun. 2018, 9: 3238] (Table 1). The resultant polymerase activity was measured using the assay on the plate as previously described. To characterize the sensitivity of the assay, we prepared serial ten-fold dilutions of the target and mixed the target samples with molecular switches in distinct states (e.g., transition vs. closed states) to evaluate changes in polymerase activity. To investigate the incubation time required to recover the functionality of lyophilized switches, we reconstituted the lyophilized reagents with the reaction buffer and incubated the mixture for less than 1 min, 5 min, 10 min, and 30 min before mixing with target and transferring to the functionalized plate for signalling. To evaluate the performance of lyophilized switches, we mixed lyophilized and non-lyophilized switches with target and the resultant polymerase activity was measured through 5 exonuclease degradation of fluorescent signalling probe as previously described.
Cell Culture and Lysis.
[0101] Human lung epithelial cell line (PC9) was obtained from American Type Culture Collection (ATCC) and grown in RPMI-1640 medium (HyClone) supplemented with 10% fetal bovine serum (FBS, HyClone) and 1% penicillin-streptomycin (Gibco) in a humidified 37 C. incubator with 5% CO.sub.2. The cell line was tested and free of mycoplasma contamination (MycoAlert Mycoplasma Detection Kit, Lonza, LT07-418). To evaluate the performance of the assay in biological samples, we prepared cell lysates through different protocols and spiked in synthetic target oligonucleotides, before testing the samples with molecular switches. RNase inhibitor was added to all lysate mixtures. Specifically, we lysed cell pellets through heating or incubating with detergent buffer. For heat treatment, cell pellets were resuspended in the reaction buffer and heated at 56 C. for 30 min, 70 C. for 5 min, or 90 C. for 5 min [Chin A W H, et al., The Lancet Microbe. 2020, 1: e10; Ladha A et al., medRxiv (2020). Doi.org/10.1101/2020.05.07.20055947]. For chemical lysis, we prepared lysis buffers, by mixing the reaction buffer with varying amounts of single or a mixture of detergents: Triton X-100, sodium dodecyl sulfate (SDS), Saponin, Tween-20, Igepal CA-630, NP-40 (Sigma). To optimize the chemical lysis composition and incubation duration, we evaluated various lysis conditions for their ability to rapidly lyse cells while maintaining good polymerase activity. To assess cell lysis efficiency, cells were incubated with the lysis buffers and the resultant cell numbers were counted using Countess II Automated Cell Counter (Thermo Scientific). Polymerase activity was measured through 5 exonuclease degradation of fluorescent signalling probe, as described above.
RNA Extraction and Detection.
[0102] RNA extraction was performed with a commercially available kit (RNeasy Mini, Qiagen) per manufacturer's protocol. Extracted RNA was quantified with Nanodrop spectrophotometer (Thermo Scientific). To detect specific RNA targets through gold-standard RT-qPCR analysis, extracted RNA was first reverse-transcribed to generate first-strand cDNA (MultiScribe Reverse Transcriptase, Thermo Scientific). For PCR analysis, to detect housekeeping genes (i.e., GAPDH and beta-actin), we used Taqman Fast Advanced Master Mix (Thermo Scientific) and primer sets (Taqman gene expression assays, Thermo Scientific) as recommended by the manufacturer. Amplification conditions consisted of 1 cycle of 95 C. for 2 min, 45 cycles of 95 C. for 1 s and 60 C. for 20 s. All thermal cycling was performed on a QuantStudio 5 real-time PCR system (Applied Biosystems).
Clinical Measurements
[0103] A total of 48 clinical samples consisting of extracted RNA and heat-inactivated swabs were evaluated in this study. To determine the diagnostic performance of the CATCH assay, extracted RNA samples (positive, n=20; negative, n=9) were used directly on the CATCH assay, while swab lysates (positive, n=9; negative, n=10) were prepared through heating at 70 C. for 30 min, before measurement by the CATCH assay. SARS-CoV-2 clinical diagnoses were generated by commercial RT-qPCR assay (Fortitude Kit, MiRXES). Amplification conditions consisted of 1 cycle of 48 C. for 15 min, 1 cycle of 95 C. for 150 s, 42 cycles of 95 C. for 10 s and 59 C. for 42 s. C.sub.t value <40 was determined as positive as per CDC's guidelines [Centers for Disease Control and Prevention, CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel. (2020), available at worldwidewebdotfda.gov/media/134922/download]. All measurements on clinical samples were performed in an anonymized and blinded fashion and finalized before comparison with clinical C.sub.t value.
Statistical Analyses
[0104] Unless otherwise stated, all measurements were performed in biological triplicate, and the data are presented as meanstandard deviation. For inter-sample comparisons, multiple pairs of samples were each tested via Student's t-test, and the resulting P values were adjusted for multiple hypothesis testing using Bonferroni correction. An adjusted P<0.05 was determined as significant. Receiver operating characteristic (ROC) curves were generated from patient profiling data and constructed by plotting sensitivity versus (1specificity), and the values of area under the curve (AUC) were computed using the trapezoidal rule. The clinical reports were used as classifiers (true positives and true negatives). Detection sensitivity, specificity and accuracy were calculated using standard formulas. Statistical analyses were performed using GraphPad Prism software (version 7.0c).
Example 2
CATCH Platform
[0105] The working principle of the CATCH assay is illustrated in
[0106] By ratiometric tuning of various switch components, we found the transition-state switches to be hyper-responsive to RNA targets, and leveraged this state to develop the CATCH assay for rapid, sensitive detection of SARS-CoV-2. To further enhance the detection signal, we measured the changes in polymerase activity through additional enzymatic amplification (
Example 3
Transition-State Molecular Switches
[0107] To develop the CATCH assay for detecting SARS-CoV-2, we designed molecular switches as specific probes against the viral RNA. We chose regions of the spike (S) gene [Yan C et al., Clin Microbiol Infect. 2020, 26: 773-779] and the nucleocapsid (N) gene [Broughton J P et al., Nat Biotechnol. 2020, 38: 870-874] of the virus as specific targets and constructed distinct molecular switches based on these sequences (
[0108] To establish the transition state, we further tuned the responsive-state molecular switches by titrating the amount of enhancer strand (i.e., through which target hybridizes and activates the switch) while keeping constant the amount of inhibitor strand (
Example 4
Signal Generation and Amplification
[0109] Next, we devised a signalling mechanism to enzymatically amplify and measure the switch-induced polymerase activity. Specifically, we designed two signalling oligonucleotide structures to leverage different types of polymerase activity (i.e., elongation vs. exonuclease activity) and recruit additional enzymatic cascades (i.e., horseradish peroxidase, HRP) for signal amplification (
[0110] Motivated by the signalling performance, we developed the CATCH assay workflow to utilize transition-state molecular switches for responsive target recognition, and elongation-based multi-enzyme cascade for signal enhancement. Specifically, we mixed RNA targets with transition-state switches and directly incubated the reaction with immobilized oligonucleotides (30 minutes at room temperature) for signal transduction and enhancement. As compared to a similar assay using closed-state molecular switches (i.e., fully inactivated molecular switches and HRP-based signal enhancement), the CATCH assay demonstrated comparable specificity against target mismatches, even when the mismatches were introduced against the most sensitive segment of the switches (
Example 5
Assessment of CATCH Assay in Cellular Lysates
[0111] To address the need for extensive sample preparation in conventional qPCR (i.e., RNA extraction), we next determined if the CATCH assay could be developed to bypass this crucial and limiting step. Using specific molecular switches designed for SARS-CoV-2 RNA targets (i.e., S-gene and N-gene switches), which demonstrated specific detection and minimal activity against sequences of other closely-related human coronaviruses (SARS-CoV and MERS-CoV) as well as other viruses causing diseases with similar symptoms (dengue virus and influenza A subtype H1N1 virus) (
[0112] Specifically, we explored two modes of direct lysis, namely thermal (
[0113] With these selected thermal and chemical lysis protocols, we first validated the ability of these methods to release and preserve endogenous RNA targets (i.e., GAPDH and beta-actin) in human lung epithelial cells. We demonstrated that for both endogenous targets tested, when assayed via RT-qPCR, all lysates generated similar cycle threshold (Ct) values as compared with the gold-standard extracted RNA samples (
Example 6
SARS-CoV-2 Detection in Clinical Swab Samples
[0114] To test the clinical utility of the CATCH platform for SARS-CoV-2 detection, we conducted a feasibility study with patient samples. We aimed at addressing the following questions: (1) if the CATCH assay can be applied directly to detect extracted RNA of nasopharyngeal swab samples (i.e., bypassing RT-qPCR), (2) if the CATCH platform can be used for direct detection of swab lysates (i.e., bypassing RNA extraction), and (3) the accuracy of CATCH in COVID-19 diagnosis.
[0115] We first tested swab-extracted RNA samples (n=49) using the CATCH assay. RNA samples were extracted through commercial columns and incubated directly with the CATCH mixture for 30 minutes at room temperature. Of the 49 extracted RNA samples, 24 were determined by gold-standard RT-qPCR assay as positive for COVID-19 infection and 25 as negative. The positive and negative diagnostic prediction of CATCH relative to the clinical RT-qPCR outcome were 100% and 92%, respectively (
[0116] To evaluate the clinical performance, across all tested clinical samples, we correlated the CATCH assay with the matched RT-qPCR C.sub.t values (
SUMMARY
[0117] Amongst current COVID-19 testing protocols, nucleic acid detection, particularly RT-qPCR, remains the gold standard. Nevertheless, the approach is almost exclusively performed in large, centralized clinical laboratories, due to its extensive processing, high complexity and need for trained personnel; reliance on RT-qPCR has thus placed much pressure on public health systems (Huang H, et al., ACS Nano. 2020, 14: 3747-3754; Weissleder R et al., Sci Transl Med. 2020, 12, eabc1931), leading to a significant global supply shortage and delayed diagnoses. For prompt detection and efficient management, rapid and accurate diagnostic assays are urgently needed [Ong C W M et al., Eur Respir J. 2020, 56: 2001727; Ong C W M et al., Int J Tubc Lung Dis. 2020, 24:547-548]. We developed the CATCH assay as an alternative nucleic acid detection method to complement the current gold standard. Specifically, the CATCH assay demonstrates distinct advantages, through its unique assay mechanism and facile clinical adaptation, to address multiple challenges of COVID-19 diagnostics.
[0118] From the assay perspective, CATCH leverages DNA-enzyme hybrid complexes as hyper-responsive molecular switches. By tuning their molecular composition, the multi-component molecular switches are prepared in a hyper-responsive statethe transition statethat can be readily activated upon the direct hybridization of even sparse RNA targets to turn on substantial enzymatic activity. CATCH thus achieves an enhanced response that that is not only bigger in magnitude, but also faster in kinetics. Yet, CATCH retains all key advantages inherent to molecular switching: 1) it is highly specific and activates only when complementary targets bind to the switches; 2) it can be readily integrated with other enzyme cascades (e.g., HRP) for further signal enhancement; and 3) it enables programmable design and rapid new assay prototyping. CATCH achieved a LOD of 8 RNA copies per l (>10,000-fold more sensitive than our previous platform), could be completed in <1 hour at room temperature and applied directly to a variety of sample types (e.g., swab lysates). Its superior performance enables CATCH to accurately detect SARS-CoV-2 even in patient samples with a low viral load.
[0119] For clinical adaptation, CATCH detects through target hybridization, instead of conventional target amplification (as in RT-qPCR). This enables the technology to bypass essentially all critical steps of RT-qPCR (i.e., RNA extraction, reverse transcription and thermal cycling amplification). Importantly, CATCH supports versatile assay implementation to accommodate the different diagnostic needs of COVID-19. In its 96-well format, the assay configuration closely resembles conventional ELISA in terms of assay workflow and readout, and can be readily adapted for high-throughput analysis, using existing infrastructure of clinical laboratories (e.g., plate reader and trained personnel). In its portable format, CATCH is implemented through a miniaturized microfluidic cartridge, where assay reagents are lyophilized within the device for user-friendly application and smartphone-based detection [Yelleswarapu V et al., Proc Nat Acad Sci USA. 2019, 116: 4489-4495; Xu H et al., Sci Adv. 2020, 6: eaaz7445; Wu X et al., Sci Adv. 2020, 6: eaba2556]. For different clinical applications, the CATCH assay threshold should be adjusted with respect to the proposed application. This threshold setting presents a trade-off between assay sensitivity vs. specificity. For example, considering the potential application of CATCH as a preliminary screening test, we prioritized assay sensitivity when setting the current detection threshold (100% sensitivity, minimal false negatives and maximal false positives); even at this assay threshold, we determined a low incidence of false positives (<8%), which is within the range reported of existing assays (0-16.7%) [Surkova E et al., Lancet Respir Med. 2020, 8: 1167-1168; Cohen A N et al., medRxiv (2020). doi.org/10.1101/2020.04.26.20080911]. The cause of false results in nucleic acid tests could be assay-associated or PCR-based misclassification, both of which have been reported [Cohen A N et al., medRxiv (2020). doi.org/10.1101/2020.04.26.20080911; Vogels C B F et al., Nat Microbiol. 2020, 5: 1299-1305].
[0120] The technology has the potential to be expanded further. For COVID-19 diagnostics, in view of the rapidly evolving pandemic, we envision the integration of multiple CATCH switches, designed to recognize different genetic loci of SARS-CoV-2, to not only enhance the detection coverage of the infection, but also enable subtype differentiation and mutation identification [Toyoshima Y et al., J Hum Genet. 2020, 65(12): 1075-1082]. With its robust performance in minimally-processed clinical lysates, CATCH could be readily expanded to investigate other more accessible sample types (e.g., saliva and sputum) [Garg N et al., Lab Chip. 2019, 19: 1524-1533; Jeong J H et al., J Med Virol. 2014, 86: 2122-2127]. To further improve user-friendliness, the microfluidic CATCH platform could be integrated with automated liquid handling systems (e.g., computer-programmed fluidics and pumps for compact liquid handling) [Shaffer S M et al., Lab Chip. 2015, 15: 3170-3182; Yeh E C et al., Sci Adv. 2017, 3: e1501645]. Such sample expansion and system automation could facilitate new clinical opportunities for repeat-testing as well as self-testing. Finally, beyond the current COVID-19 pandemic, CATCH can be further developed to discover and measure new biomarker signatures. The platform could be applied across a spectrum of diseases (e.g., infectious diseases, cancers and neurodegenerative diseases) to facilitate sensitive detection of nucleic acid targets and composite signatures [Lim C Z J et al., Nat Commun. 2019, 10: 1144]. Further technical improvements, such as multiplexed microfluidic compartmentalization [Duncombe T A et al., Nat Rev Mol Cell Biol. 2015, 16: 554-567; Tokeshi M et al., Anal Chem. 2002, 74: 1565-1571; Shao H et al., Nat Commun. 2015, 6: 6999], could enable microarray-type assay implementation for highly-parallel biomarker discovery and large-scale clinical validation.
REFERENCES
[0121] 1. Y. Bai, L. Yao, T. Wei, F. Tian, D. Y. Jin, L. Chen, M. Wang, Presumed Asymptomatic Carrier Transmission of COVID-19. JAMA 323(14), 1406-1407 (2020). [0122] 2. J. P. Broughton, X. Deng, G. Yu, C. L. Fasching, V. Servellita, J. Singh, X. Miao, J. A. Streithorst, A. Granados, A. Sotomayor-Gonzalez, K. Zorn, A. Gopez, E. Hsu, W. Gu, S. Miller, C. Y. Pan, H. Guevara, D. A. Wadford, J. S. Chen, C. Y. Chiu, CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38, 870-874 (2020). [0123] 3. E. A. Bruce, M. L. Huang, G. A. Perchetti, S. Tighe, P. Laaguiby, J. J. Hoffman, D. L. Gerrard, A. K. Nalla, Y. Wei, A. L. Greninger, S. A. Diehl, D. J. Shirley, D. G. B. Leonard, C. D. Huston, B. D. Kirkpatrick, J. A. Dragon, J. W. Crothers, K. R. Jerome, J. W. Botten, Direct RT-qPCR detection of SARS-CoV-2 RNA from patient nasopharyngeal swabs without an RNA extraction step. bioRxiv (2020). doi.org/10.1101/2020.03.20.001008. [0124] 4. L. J. Carter, L. V. Garner, J. W. Smoot, Y. Li, Q. Zhou, C. J. Saveson, J. M. Sasso, A. C. Gregg, D. J. Soares, T. R. Beskid, S. R. Jervey, C. Liu, Assay Techniques and Test Development for COVID-19 Diagnosis. ACS Cent Sci 6, 591-605 (2020). [0125] 5. Centers for Disease Control and Prevention, CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel. (2020), (available at worldwidewebdotfda.gov/media/134922/download). [0126] 6. A. W. H. Chin, J. T. S. Chu, M. R. A. Perera, K. P. Y. Hui, H. L. Yen, M. C. W. Chan, M. Peiris, L. L. M. Poon, Stability of SARS-CoV-2 in different environmental conditions. The Lancet Microbe 1, el0 (2020). [0127] 7. A. N. Cohen, B. Kessel, M. G. Milgroom, Diagnosing COVID-19 infection: the danger of over-reliance on positive test results. medRxiv (2020). doi.org/10.1101/2020.04.26.20080911. [0128] 8. C. Dang, S. D. Jayasena, Oligonucleotide inhibitors of Taq DNA polymerase facilitate detection of low copy number targets by PCR. J Mol Biol 264, 268-278 (1996). [0129] 9. T. A. Duncombe, A. M. Tentori, A. E. Herr, Microfluidics: reframing biological enquiry. Nat Rev Mol Cell Biol 16, 554-567 (2015). [0130] 10. N. Garg, D. Boyle, A. Randall, A. Teng, J. Pablo, X. Liang, D. Camerini, A. P. Lee, Rapid immunodiagnostics of multiple viral infections in an acoustic microstreaming device with serum and saliva samples. Lab Chip 19, 1524-1533 (2019). [0131] 11. A. E. Gorbalenya, S. C. Baker, R. S. Baric, R. J. de Groot, C. Drosten, A. A. Gulyaeva, B. L. Haagmans, C. Lauber, A. M. Leontovich, B. W. Neuman, D. Penzar, S. Perlman, L. L. M. Poon, D. V. Samborskiy, I. A. Sidorov, I. Sola, J. Ziebuhr, Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat Microbiol 5, 536-544 (2020). [0132] 12. H. Hasegawa, N. Savory, K. Abe, K. Ikebukuro, Methods for Improving Aptamer Binding Affinity. Molecules 21, 421 (2016). [0133] 13. H. Huang, C. Fan, M. Li, H.-L. Nie, F.-B. Wang, H. Wang, R. Wang, J. Xia, X. Zheng, X. Zuo, J. Huang, COVID-19: A Call for Physical Scientists and Engineers. ACS Nano 14, 3747-3754 (2020). [0134] 14. N. R. Y. Ho, G. S. Lim, N. R. Sundah, D. Lim, T. P. Loh, H. Shao, Visual and modular detection of pathogen nucleic acids with enzyme-DNA molecular complexes. Nat Commun 9, 3238 (2018). [0135] 15. J. H. Jeong, K. H. Kim, S. H. Jeong, J. W. Park, S. M. Lee, Y. H. Seo, Comparison of sputum and nasopharyngeal swabs for detection of respiratory viruses. J Med Virol 86, 2122-2127 (2014). [0136] 16. M. R. Jones, N. C. Seeman, C. A. Mirkin, Nanomaterials. Programmable materials and the nature of the DNA bond. Science 347, 1260901 (2015). [0137] 17. A. Ladha, J. Joung, O. Abudayyeh, J. Gootenberg, F. Zhang, A 5-min RNA preparation method for COVID-19 detection with RT-qPCR. medRxiv (2020). Doi.org/10.1101/2020.05.07.20055947. [0138] 18. J. Li, A. A. Green, H. Yan, C. Fan, Engineering nucleic acid structures for programmable molecular circuitry and intracellular biocomputation. Nat Chem 9, 1056-1067 (2017). [0139] 19. Y. Li, Y. T. Cu, D. Luo, Multiplexed detection of pathogen DNA with DNA-based fluorescence nanobarcodes. Nat Biotechnol 23, 885-889 (2005). [0140] 20. Y. Li, L. Yao, J. Li, L. Chen, Y. Song, Z. Cai, C. Yang, Stability issues of RT-PCR testing of SARS-CoV-2 for hospitalized patients clinically diagnosed with COVID-19. J Med Virol 92, 903-908 (2020). [0141] 21. C. Z. J. Lim, Y. Zhang, Y. Chen, H. Zhao, M. C. Stephenson, N. R. Y. Ho, Y. Chen, J. Chung, A. Reilhac, T. P. Loh, C. L. H. Chen, H. Shao, Subtyping of circulating exosome-bound amyloid reflects brain plaque deposition. Nat Commun 10, 1144 (2019). [0142] 22. K. Okonechnikov, O. Golosova, M. Fursov, T. UGENE, Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28, 1166-1167 (2012). [0143] 23. C. W. M. Ong, G. B. Migliori, M. Raviglione, G. MacGregor-Skinner, G. Sotgiu, J. W. Alffenaar, S. Tiberi, C. Adlhoch, T. Alonzi, S. Archuleta, S. Brusin, E. Cambau, M. R. Capobianchi, C. Castilletti, R. Centis, D. M. Cirillo, L D'Ambrosio, G. Delogu, S. M. R. Esposito, J. Figueroa, J. S. Friedland, B. H. Choon Heng, G. Ippolito, M. Jankovic, H. Y. Kim, S. R. Klintz, C. Kdmn, E. Lalle, Y. S. Leo, C. C. Leung, A. G. Martson, M. Melazzini, S. Najafi Fard, P. Penttinen, L. Petrone, E. Petruccioli, E. Pontali, L. Saderi, M. Santin, A. Spanevello, R. van Crevel, M. J. van der Werf, D. Visca, M. Viveiros, J. P. Zellweger, A. Zumla, D. Goletti, Epidemic and pandemic viral infections: impact on tuberculosis and the lung. A consensus by the World Association for Infectious Diseases and Immunological Disorders (WAidid), Global Tuberculosis Network (GTN) and members # of ESCMID Study Group for Mycobacterial Infections (ESGMYC). Eur Respir J 56, 2001727 (2020). [0144] 24. C. W. M. Ong, D. Goletti, Impact of the global COVID-19 outbreak on the management of other communicable diseases. Int J Tuberc Lung Dis 24, 547-548 (2020). [0145] 25. Y. Pan, D. Zhang, P. Yang, L. L. M. Poon, Q. Wang, Viral load of SARS-CoV-2 in clinical samples. Lancet Infect Dis 20, 411-412 (2020). [0146] 26. C. Rothe, M. Schunk, P. Sothmann, G. Bretzel, G. Froeschl, C. Wallrauch, T. Zimmer, V. Thiel, C. Janke, W. Guggemos, M. Seilmaier, C. Drosten, P. Vollmar, K. Zwirglmaier, S. Zange, R. Wlfel, M. Hoelscher, Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany. N Engl J Med 382, 970-971 (2020). [0147] 27. S. M. Shaffer, R. P. Joshi, B. S. Chambers, D. Sterken, A. G. Biaesch, D. J. Gabrieli, Y. Li, K. A. Feemster, S. E. Hensley, D. Issadore, A. Raj, Multiplexed detection of viral infections using rapid in situ RNA analysis on a chip. Lab Chip 15, 3170-3182 (2015). [0148] 28. H. Shao, J. Chung, K. Lee, L. Balaj, C. Min, B. S. Carter, F. H. Hochberg, X. O. Breakefield, H. Lee, R. Weissleder, Chip-based analysis of exosomal mRNA mediating drug resistance in glioblastoma. Nat Commun 6, 6999 (2015). [0149] 29. P. Song, J. Shen, D. Ye, B. Dong, F. Wang, H. Pei, J. Wang, J. Shi, L. Wang, W. Xue, Y. Huang, G. Huang, X. Zuo, C. Fan, Programming bulk enzyme heterojunctions for biosensor development with tetrahedral DNA framework. Nat Commun 11, 838 (2020). [0150] 30. N. R. Sundah, N. R. Y. Ho, G. S. Lim, A. Natalia, X. Ding, Y. Liu, J. E. Seet, C. W. Chan, T. P. Loh, H. Shao, Barcoded DNA nanostructures for the multiplexed profiling of subcellular protein distribution. Nat Biomed Eng 3, 684-694 (2019). [0151] 31. E. Surkova, V. Nikolayevskyy, F. Drobniewski, False-positive COVID-19 results: hidden problems and costs. Lancet Respir Med 8, 1167-1168 (2020). [0152] 32. M. Tokeshi, T. Minagawa, K. Uchiyama, A. Hibara, K. Sato, H. Hisamoto, T. Kitamori, Continuous-flow chemical processing on a microchip by combining microunit operations and a multiphase flow network. Anal Chem 74, 1565-1571 (2002). [0153] 33. Y. Toyoshima, K. Nemoto, S. Matsumoto, Y. Nakamura, K. Kiyotani, SARS-CoV-2 genomic variations associated with mortality rate of COVID-19. J Hum Genet (2020). [0154] 34. C. B. F. Vogels, A. F. Brito, A. L. Wyllie, J. R. Fauver, I. M. Ott, C. C. Kalinich, M. E. Petrone, A. Casanovas-Massana, M. Catherine Muenker, A. J. Moore, J. Klein, P. Lu, A. Lu-Culligan, X. Jiang, D. J. Kim, E. Kudo, T. Mao, M. Moriyama, J. E. Oh, A. Park, J. Silva, E. Song, T. Takahashi, M. Taura, M. Tokuyama, A. Venkataraman, O. E. Weizman, P. Wong, Y. Yang, N. R. Cheemarla, E. B. White, S. Lapidus, R. Earnest, B. Geng, P. Vijayakumar, C. Odio, J. Fournier, S. Bermejo, S. Farhadian, C. S. Dela Cruz, A. Iwasaki, A. I. Ko, M. L. Landry, E. F. Foxman, N. D. Grubaugh, Analytical sensitivity and efficiency comparisons of SARS-CoV-2 RT-qPCR primer-probe sets. Nat Microbiol 5, 1299-1305 (2020). [0155] 35. R. Weissleder, H. Lee, J. Ko, M. J. Pittet, COVID-19 diagnostics in context. Sci Transl Med 12, eabc1931 (2020). [0156] 36. O. I. Wilner, Y. Weizmann, R. Gill, O. Lioubashevski, R. Freeman, I. Willner, Enzyme cascades activated on topologically programmed DNA scaffolds. Nat Nanotechnol 4, 249-254 (2009). [0157] 37. X. Wu, H. Zhao, A. Natalia, C. Z. J. Lim, N. R. Y. Ho, C. J. Ong, M. C. C. Teo, J. B. Y. So, H. Shao, Exosome-templated nanoplasmonics for multiparametric molecular profiling. Sci Adv 6, eaba2556 (2020). [0158] 38. H. Xu, A. Xia, D. Wang, Y. Zhang, S. Deng, W. Lu, J. Luo, Q. Zhong, F. Zhang, L. Zhou, W. Zhang, Y. Wang, C. Yang, K. Chang, W. Fu, J. Cui, M. Gan, D. Luo, M. Chen, An ultraportable and versatile point-of-care DNA testing platform. Sci Adv 6, eaaz7445 (2020). [0159] 39. C. Yan, J. Cui, L. Huang, B. Du, L. Chen, G. Xue, S. Li, W. Zhang, L. Zhao, Y. Sun, H. Yao, N. Li, H. Zhao, Y. Feng, S. Liu, Q. Zhang, D. Liu, J. Yuan, Rapid and visual detection of 2019 novel coronavirus (SARS-CoV-2) by a reverse transcription loop-mediated isothermal amplification assay. Clin Microbiol Infect 26, 773-779 (2020). [0160] 40. E. C. Yeh, C. C. Fu, L. Hu, R. Thakur, J. Feng, L. P. Lee, Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip. Sci Adv 3, e1501645 (2017). [0161] 41. V. Yelleswarapu, J. R. Buser, M. Haber, J. Baron, E. Inapuri, D. Issadore, Mobile platform for rapid sub-picogram-per-milliliter, multiplexed, digital droplet detection of proteins. Proc Natl Acad Sci U SA 116, 4489-4495 (2019).