COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
20240043836 ยท 2024-02-08
Assignee
Inventors
- Zhen Li (San Diego, CA, US)
- Rui Zhu (San Diego, CA, US)
- Zhiqing (Joel) Zhou (San Diego, CA, US)
- Sean Studer (San Diego, CA, US)
- Kimberly Fultz (San Diego, CA, US)
- Jean DA SILVA CORREIA (San Diego, CA, US)
Cpc classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/345
CHEMISTRY; METALLURGY
A61K47/549
HUMAN NECESSITIES
International classification
Abstract
Aspects of the disclosure provide compounds, compositions, and methods for modulating the expression or activity of Complement Factor B (CFB). In certain aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of CFB mRNA in a cell or animal. In certain aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of CFB protein in a cell or animal.
Claims
1-6. (canceled)
7. A compound comprising a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 109 and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide, wherein one or more GalNAc are attached to the 2 or 3 position of the ribosyl ring of the 5 nucleoside of the first modified oligonucleotide.
8. The compound of claim 7, wherein the first modified oligonucleotide is linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 109.
9-12. (canceled)
13. The compound of claim 8, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 19 to 23 linked nucleosides in length.
14-17. (canceled)
18. The compound of claim 7, wherein at least one nucleoside linkage of the first or second modified oligonucleotide is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage.
19. The compound of claim 18, wherein the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3 terminus of the first or second modified oligonucleotide or at the 5 terminus of the first or second modified oligonucleotide.
20-25. (canceled)
26. The compound of claim 7, wherein the first or second modified oligonucleotide comprises a modification selected from the group consisting of LNA, cEt, 2-MOE, 2-F, 2-OMe, and 2-deoxy, or a combination thereof.
27. The compound of claim 7, wherein the first modified oligonucleotide comprises no more than five 2-F sugar modifications.
28-34. (canceled)
35. The compound of claim 7, wherein the 5 nucleoside of the first modified oligonucleotide is of the following formula: ##STR00078## wherein: R.sup.9 is H, adenine, guanine, thymine, cytosine, or uracil, or adenine, guanine, thymine, cytosine, or uracil, each comprising a Protecting Group (PG), a modified nucleobase, optionally substituted alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, or a nucleobase isostere; L is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl; R.sup.2 is an oligonucleotide sequence or modified oligonucleotide; Y.sub.1 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; Y.sub.2 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; Y.sub.3 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; Y.sub.4 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; n.sub.2 is 0, 1, 2, 3, 4, 5, or 6; and each n.sub.1, n.sub.3, n.sub.4 and n.sub.5 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
36-38. (canceled)
39. The compound of claim 7, wherein the second modified oligonucleotide is 14 to 22 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 100.
40. The compound of claim 7, wherein the first modified oligonucleotide consists of Ref ID NO: IS1252.
41. The compound of claim 7, wherein the second modified oligonucleotide consists of Ref ID NO: IA1016.
42-61. (canceled)
62. The compound of claim 7, wherein the compound is of the following chemical structure: ##STR00079## ##STR00080## or a pharmaceutically acceptable salt or stereoisomer thereof.
63-65. (canceled)
66. The compound of claim 62, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.
67. The compound of claim 66, which is a sodium salt according to the following chemical structure: ##STR00081## ##STR00082## or a stereoisomer thereof.
68-70. (canceled)
71. A composition comprising the compound of claim 62 and a pharmaceutically acceptable carrier.
72. A composition comprising the compound of claim 7 and a pharmaceutically acceptable carrier.
73. A method comprising administering the compound of claim 7 to a subject in need thereof.
74-75. (canceled)
76. The method of claim 73, wherein administering the compound inhibits, reduces, and/or improves a disease, disorder, condition or a symptom thereof associated with Complement Factor B (CFB).
77. A method of inhibiting expression of CFB in a cell comprising contacting the cell with the compound of claim 7, thereby inhibiting expression of CFB in the cell.
78. The method of claim 77, wherein the cell is in the liver of an individual.
79-97. (canceled)
Description
DETAILED DESCRIPTION
[0008] It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0009] All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, NCBI and other sequence reference records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety as of the date of filing this application.
[0010] It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase even if shown in context with a modified compound. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Oligomeric compounds referenced by Compound Number or Ref ID NO indicate a combination of nucleobase sequence, chemical modification, and motif.
[0011] Herein, the use of the singular includes the plural unless specifically stated otherwise. For example, the articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element, e.g., a plurality of elements. As used herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including as well as other forms, such as includes and included, is not limiting and is used interchangeably with, the phrase including but not limited to.
Definitions
[0012] Unless otherwise indicated, the following terms have the following meanings:
[0013] Complement Factor B, used interchangeably with the term CFB, refers to any nucleic acid or protein of CFB. Exemplary nucleotide and amino acid sequences of CFB can be found, for example, at GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), and nucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4). Additional examples of CFB sequences are readily available through publicly available databases, e.g., GenBank, UniProt, and OMIM. Further information on CFB can be found, for example, at https://www.ncbi.nlm.nih.gov/gene/?term=CFB. CFB, as used herein, also refers to variations of the CFB gene including variants provided in the SNP database. Numerous sequence variations within the CFB gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., https://www.ncbi.nlm.nih.gov/snp/?term=CFB). CFB mRNA means an mRNA encoding a CFB protein. CFB may be referred to in either upper or lower case.
[0014] CFB specific inhibitor refers to any agent capable of specifically inhibiting CFB RNA and/or CFB protein expression or activity at the molecular level. For example, CFB specific inhibitors include nucleic acids (including oligonucleotide compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CFB RNA and/or CFB protein.
[0015] 2-O-methoxyethyl or 2-MOE means a 2-O(CH.sub.2).sub.2OCH.sub.3 modification. A 2-O-methoxyethyl modified sugar is a modified sugar with 2-O(CH.sub.2).sub.2OCH.sub.3 in the place of the 2-OH group of a ribosyl ring.
[0016] 5 start site means the nucleotide of the target nucleic acid or region which is complementary to the 3-most nucleoside of an antisense oligonucleotide.
[0017] 3 stop site means the nucleotide of the target nucleic acid or region which is complementary to the 5-most nucleoside of an antisense oligonucleotide.
[0018] About means within 10% of a value. For example, if it is stated, a compound achieved about 70% inhibition of CFB, it is implied that CFB levels are inhibited within a range of 60% and 80%. When about is present before a series of numbers or a range, it is understood that about can modify each of the numbers in the series or range.
[0019] Administer or administering refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example, routes of administration that can be used include, but are not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
[0020] Ameliorate refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0021] Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0022] Antisense oligonucleotide or antisense strand means an oligonucleotide which includes a region that is complementary to a target nucleic acid, e.g., a CFB RNA or a region thereof.
[0023] Complementarity in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that is complementary to the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions.
[0024] Complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), and cytosine (C) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, fully complementary or 100% complementary in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
[0025] Composition or pharmaceutical composition means a mixture of substances suitable for administering to an individual. For example, a composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.
[0026] Co-administration means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Co-administration does not require both compounds to be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Co-administration includes parallel or sequential administration of the one or more compounds.
[0027] Conjugate group means a group of atoms that is attached to an oligonucleotide. A conjugate group is optionally attached to an oligonucleotide through a conjugate linker. A conjugate group may, for example, alter the distribution, targeting, or half-life of a compound into which it is incorporated. Conjugate groups include targeting moieties.
[0028] Conjugate linker means a group of atoms comprising at least one bond that connects a linked moiety to an oligonucleotide.
[0029] Identity in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Identity of an oligonucleotide to another oligonucleotide or nucleic acid need not require each nucleobase to match and may include one or more different nucleobases. By contrast, fully identical or 100% identity in reference to oligonucleotides means that such oligonucleotides have the same nucleobase at each relative position over its length as the other oligonucleotide or nucleic acid.
[0030] Individual means a human or non-human animal selected for treatment or therapy.
[0031] Inhibiting the expression or activity with reference to a target nucleic acid or protein means to reduce or block the expression or activity of such target relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.
[0032] As used herein, the term internucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage. Phosphorothioate internucleoside linkage is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0033] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations as further described below. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
[0034] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (.sup.125I), or carbon-14 (.sup.14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure.
[0035] The term isotopic variant refers to a therapeutic agent (e.g., a compound and/or modified oligonucleotide disclosed herein) that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a therapeutic agent. In certain embodiments, an isotopic variant of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (.sup.2H), tritium (3H), carbon-11 (.sup.11C), carbon-12 (.sup.12C), carbon-13 (.sup.13C), carbon-14 (.sup.14C), nitrogen-13 (.sup.13N), nitrogen-14 (.sup.14N), nitrogen-15 (.sup.5N), oxygen-14 (.sup.14O), oxygen-15 (.sup.15O), oxygen-16 (.sup.16O), oxygen-17 (.sup.17O), oxygen-18 (18O), fluorine-17 (.sup.17F), fluorine-18 (.sup.18F), phosphorus-31 (.sup.31P), phosphorus-32 (.sup.32P), phosphorus-33 (.sup.33P), sulfur-32 (.sup.32S), sulfur-33 (.sup.33S), sulfur-34 (.sup.34S), sulfur-35 (.sup.35S), sulfur-36 (.sup.36S), chlorine-35 (.sup.35Cl), chlorine-36 (.sup.36Cl), chlorine-37 (.sup.37Cl), bromine-79 (.sup.79Br), bromine-81 (.sup.81Br), iodine 123 (.sup.123I), iodine-125 (.sup.125I), iodine-127 (.sup.127I), iodine-129 (.sup.129I), and iodine-131 (.sup.131I). In certain embodiments, an isotopic variant of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (.sup.2H), tritium (3H), carbon-11 (.sup.11C), carbon-12 (.sup.12C), carbon-13 (.sup.13C), carbon-14 (.sup.14C), nitrogen-13 (.sup.13N), nitrogen-14 (.sup.14N), nitrogen-15 (.sup.15N), oxygen-14 (.sup.14O), oxygen-15 (.sup.15O), oxygen-16 (.sup.16O), oxygen-17 (.sup.17O), oxygen-18 (.sup.18O), fluorine-17 (.sup.17F), fluorine-18 (.sup.18F), phosphorus-31 (.sup.31P), phosphorus-32 (.sup.32P), phosphorus-33 (.sup.33P) sulfur-32 (.sup.32S), sulfur-33 (.sup.33S), sulfur-34 (.sup.34S), sulfur-35 (.sup.35S), sulfur-36 (.sup.36S), chlorine-35 (.sup.35Cl), chlorine-36 (.sup.36Cl), chlorine-37 (.sup.37Cl), bromine-79 (.sup.79Br), bromine-81 (.sup.81Br), iodine-123 (.sup.123I), iodine-125 (.sup.125I), iodine-127 (.sup.127I), iodine-129 (.sup.129I), and iodine-131 (.sup.131I).
[0036] It will be understood that, in a therapeutic agent (e.g., a compound and/or modified oligonucleotide disclosed herein), any hydrogen can be .sup.2H, for example, or any carbon can be .sup.13C, for example, or any nitrogen can be .sup.15N, for example, or any oxygen can be .sup.18O, for example, where feasible according to the judgment of one of skill. In certain embodiments, an isotopic variant of a therapeutic agent contains unnatural proportions of deuterium (D).
[0037] Mismatch or non-complementary means a nucleobase of a first oligonucleotide or nucleic acid that is not complementary to the corresponding nucleobase of a second oligonucleotide or nucleic acid when the first oligonucleotide/nucleic acid and second oligonucleotide/nucleic acid are aligned in an antiparallel orientation. For example, nucleobases including, but not limited to, a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to the nucleobase to which they are hybridized. As another example, a nucleobase of a first oligonucleotide/nucleic acid that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide/nucleic acid when the first and second oligonucleotides are aligned in an antiparallel orientation is a mismatch or non-complementary nucleobase.
[0038] Modified oligonucleotide means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. In certain embodiments, the compounds described herein comprise at least one modified oligonucleotide.
[0039] Modulating refers to changing or adjusting a feature in a cell, tissue, organ, or organism. For example, modulating CFB RNA can mean to increase or decrease the level of CFB RNA and/or CFB protein in a cell, tissue, organ, or organism. A modulator effects the change in the cell, tissue, organ, or organism. For example, a CFB compound can be a modulator that decreases the amount of CFB RNA and/or CFB protein in a cell, tissue, organ, or organism.
[0040] Motif means the pattern of unmodified and modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
[0041] Nucleic acid refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
[0042] Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a naturally occurring nucleobase is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A modified nucleobase is a naturally occurring nucleobase that is chemically modified. A universal base or universal nucleobase is a nucleobase other than a naturally occurring nucleobase and modified nucleobase and is capable of pairing with any nucleobase.
[0043] Nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.
[0044] Nucleoside means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. Modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
[0045] Oligomeric Compound means a compound comprising one or more oligonucleotides and optionally one or more additional features, such as a conjugate group or terminal group. Examples of oligomeric compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, antisense oligonucleotides, interfering RNA compounds (RNAi compounds), microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds). RNAi compounds include double-stranded compounds (e.g., short-interfering RNA (siRNA) and double-stranded RNA (dsRNA)) and single-stranded compounds (e.g., single-stranded siRNA (ssRNA), single-stranded RNAi (ssRNAi), short hairpin RNA (shRNA) and microRNA mimics) which work at least in part through the RNA-induced silencing complex (RISC) pathway resulting in sequence specific degradation and/or sequestration of a target nucleic acid through a process known as RNA interference (RNAi). The term RNAi compound is meant to be equivalent to other terms used to describe nucleic acid compounds that are capable of mediating sequence-specific RNA interference, for example, interfering RNA (iRNA), iRNA agent, RNAi agent, short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, and others. Additionally, the term RNAi is meant to be equivalent to other terms used to describe sequence-specific RNA interference.
[0046] Oligonucleotide means a polymer of linked nucleosides, each of which can be modified or unmodified, independent from one another.
[0047] The term oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a duplexed oligomeric compound. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides. In some embodiments, the terms duplexed oligomeric compound and modified oligonucleotide are used interchangeably. In other embodiments, the terms oligomeric duplex and compound are used interchangeably.
[0048] Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.
[0049] Pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an individual. In certain embodiments, a pharmaceutically acceptable carrier or diluent aids the administration of a compound to and absorption by an individual and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, and the like. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.
[0050] Pharmaceutically acceptable salts means or refers to physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein, a pharmaceutically acceptable salt is any salt of a compound provided herein which retains its biological properties and which is not toxic or otherwise undesirable for pharmaceutical use. The pharmaceutically acceptable salts of the therapeutic agents disclosed herein include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds or modified oligonucleotides described herein.
[0051] When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent.
[0052] When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.
[0053] Thus, the compounds of the present disclosure may exist as salts, such as with pharmaceutically acceptable acids. Such salts may be derived from a variety of organic and inorganic counter-ions well known in the art. Such salts include, but are not limited to: (1) acid addition salts formed with organic or inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, sulfamic, acetic, trifluoroacetic, trichloroacetic, propionic, hexanoic, cyclopentylpropionic, glycolic, glutaric, pyruvic, lactic, malonic, succinic, sorbic, ascorbic, malic, maleic, fumaric, tartaric, citric, benzoic, 3-(4-hydroxybenzoyl)benzoic, picric, cinnamic, mandelic, phthalic, lauric, methanesulfonic, ethanesulfonic, 1,2-ethane-disulfonic, 2-hydroxyethanesulfonic, benzenesulfonic, 4-chlorobenzenesulfonic, 2-naphthalenesulfonic, 4-toluenesulfonic, camphoric, camphorsulfonic, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylic, glucoheptonic, 3-phenylpropionic, trimethylacetic, tert-butylacetic, lauryl sulfuric, gluconic, benzoic, glutamic, hydroxynaphthoic, salicylic, stearic, cyclohexylsulfamic, quinic, muconic acid and the like acids; or (2) salts formed when an acidic proton present in the parent compound either (a) is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion or an aluminum ion, or alkali metal or alkaline earth metal hydroxides, such as sodium, potassium, calcium, magnesium, aluminum, lithium, zinc, and barium hydroxide, ammonia, or (b) coordinates with an organic base, such as aliphatic, alicyclic, or aromatic organic amines, such as ammonia, methylamine, dimethylamine, diethylamine, picoline, ethanolamine, diethanolamine, triethanolamine, ethylenediamine, lysine, arginine, ornithine, choline, N,N-dibenzylethylene-diamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, N-methylglucamine piperazine, tris(hydroxymethyl)-aminomethane, tetramethylammonium hydroxide, and the like (see, for example, Berge et al., Pharmaceutical Salts, Journal of Pharmaceutical Science, 1977, 66, 1-19).
[0054] Pharmaceutically acceptable salts further include, by way of example only and without limitation, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like, and when the compound contains a basic functionality, salts of non-toxic organic or inorganic acids, such as hydrohalides, e.g. hydrochloride and hydrobromide, sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate, lactate, malonate, succinate, sorbate, ascorbate, malate, maleate, fumarate, tartarate, citrate, benzoate, 3-(4-hydroxybenzoyl)benzoate, picrate, cinnamate, mandelate, phthalate, laurate, methanesulfonate (mesylate), ethanesulfonate, 1,2-ethane-disulfonate, 2-hydroxyethanesulfonate, benzenesulfonate (besylate), 4-chlorobenzenesulfonate, 2-naphthalenesulfonate, 4-toluenesulfonate, camphorate, camphorsulfonate, 4-methylbicyclo[2.2.2]-oct-2-ene-1-carboxylate, glucoheptonate, 3-phenylpropionate, trimethylacetate, tert-butylacetate, lauryl sulfate, gluconate, benzoate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfamate, quinate, muconate, and the like. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium or a potassium salt. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium salt.
[0055] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents. In embodiments, compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in a conventional manner. The parent form of the compounds differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but, unless specifically indicated, the salts disclosed herein are equivalent to the parent form of the compound for the purposes of the present disclosure.
[0056] Pharmaceutical agent means a compound that provides a therapeutic benefit when administered to an individual.
[0057] Phosphorothioate linkage means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom.
[0058] Portion means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligonucleotide.
[0059] Prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time.
[0060] RNA interference compound or RNAi compound means a compound that acts, at least in part, through an RNA-induced silencing complex (RISC) pathway or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded siRNA, and microRNA, including microRNA mimics.
[0061] Sense oligonucleotide or sense strand means the strand of a double-stranded compound that includes a region that is substantially complementary to a region of the antisense strand of the compound.
[0062] Specifically inhibit with reference to a target nucleic acid or protein means to reduce or block expression or activity of the target nucleic acid or protein while minimizing or eliminating effects on non-target nucleic acids or proteins.
[0063] Subunit with reference to an oligonucleotide means a nucleotide, nucleoside, nucleobase or sugar or a modified nucleotide, nucleoside, nucleobase, or sugar as provided herein.
[0064] Target nucleic acid, target RNA, and nucleic acid target all mean a nucleic acid capable of being targeted by compounds described herein.
[0065] Target region means a portion of a target nucleic acid to which one or more compounds is targeted.
[0066] Targeting moiety means a conjugate group that provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a compound absent such a moiety.
[0067] Terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
[0068] Therapeutically effective amount or effective amount means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual. A therapeutically effective amount or effective amount is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g., achieve the effect for which it is administered, treat, prevent, or ameliorate a disease or reduce one or more symptoms of a disease or condition). An example of a therapeutically effective amount or effective amount is an amount sufficient to contribute to the treatment, prevention, amelioration, or reduction of a symptom or symptoms of a disease. A reduction of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A prophylactically effective amount of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology, or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The term therapeutically effective amount, as used herein, refers to that amount of the therapeutic agent sufficient to provide a therapeutic benefit to an individual, such as treating, preventing, or ameliorating the disease or disorder or symptom thereof, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as -fold increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
[0069] The terms treating or treatment refer to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical examination. The term treating and conjugations thereof, may include prevention of an injury, pathology, condition, or disease. In embodiments, treating is preventing. In embodiments, treating does not include preventing.
[0070] Treating or treatment as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject's condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease's transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, treatment as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease's spread; relieve the disease's symptoms, fully or partially remove the disease's underlying cause, shorten a disease's duration, or do a combination of these things.
[0071] Treating and treatment as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of a compound described herein. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of the compound, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient.
[0072] Treat refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
[0073] Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisometric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)-for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of the present disclosure do not include those that are known in art to be too unstable to synthesize and/or isolate. The present disclosure is meant to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.
[0074] As used herein, the term isomers refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.
[0075] The term tautomer, as used herein, refers to one of two or more structural isomers which exist in equilibrium, and which are readily converted from one isomeric form to another.
[0076] It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure.
[0077] Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure (i.e., the R and S configurations for each asymmetric center). Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure.
[0078] As used herein, chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
[0079] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by .sup.13C- or .sup.14C-enriched carbon are within the scope of this disclosure.
[0080] As used herein, stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
Certain Embodiments
[0081] In certain aspects, the disclosure relates to methods, compounds, and compositions for inhibiting CFB. In certain embodiments, CFB is specifically inhibited. In certain embodiments, CFB is specifically degraded. In certain embodiments, CFB expression is inhibited. In certain embodiments, CFB translation is inhibited. In certain embodiments, CFB activity is inhibited. In certain embodiments, CFB expression, translation, or activity is reduced by at least 10% relative to the expression, translation, or activity in an untreated or control sample. For example, in certain embodiments, CFB expression, translation, or activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 10-50%, 25-50%, 25-75%, 50-75%, 50-99%, or 75-99% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, CFB expression, translation, or activity is reduced as measured by any suitable assay, including but not limited to, an immunoassay, a hybridization-based assay, or a sequencing-based assay (e.g., RNA-Seq).
[0082] In certain aspects, the disclosure relates to compounds targeted to a CFB nucleic acid. In certain embodiments, the CFB nucleic acid has the sequence set forth in GENBANK Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), and nucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4).
[0083] In certain embodiments, the compound is an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
[0084] Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102.
[0085] Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102.
[0086] In certain embodiments, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleobase sequence of SEQ ID NO: 1 or 3. In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double-stranded.
[0087] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.
[0088] In certain embodiments, the compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences provided in Tables 2 and 3, and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.
[0089] Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide.
[0090] Certain embodiments provide a compound comprising a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0091] In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequences of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110.
[0092] In certain embodiments, the modified oligonucleotide or first modified oligonucleotide of any compound herein has a nucleobase sequence that has at least 80%, at least 85%, at least 90%, or at least 95% complementarity or identity to the nucleobase sequence of SEQ ID NO: 1 or 3 over its length. In certain embodiments, the modified oligonucleotide or first modified oligonucleotide has a nucleobase sequence that has at least 1, at least 2, or at least 3 mismatches to a region of a nucleobase sequence of SEQ ID NO: 1 or 3. In certain embodiments, the region of complementarity between the first strand and the second strand is 14 to 30 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 14 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 19 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide.
[0093] In certain embodiments, the first modified oligonucleotide of any preceding compound or other compound herein comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide of any preceding compound comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3 terminus of the first or second modified oligonucleotide or at the 5 terminus of the first modified oligonucleotide. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a 2-F modification. In certain embodiments, the modified sugar comprises a 2-OMe modification. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar or a combination thereof. In certain embodiments, the modified sugar comprises a modification selected from 2-MOE, 2-F, and 2-OMe or a combination thereof. In certain embodiments, the first modified oligonucleotide comprises no more than ten 2-F sugar modifications. In certain embodiments, the second modified oligonucleotide comprises no more than five 2-F sugar modifications.
[0094] In certain embodiments, the compound of any preceding embodiment comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5 end of the modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more GalNAc is attached to the 2 or 3 position of the ribosyl ring. In certain embodiments, the one or more GalNAc is attached to the 5 nucleoside of the modified oligonucleotide. In certain embodiments, the 5 nucleoside of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof, wherein R is the portion of the modified oligonucleotide other than the 5 nucleoside:
##STR00001## ##STR00002## ##STR00003## ##STR00004## ##STR00005##
[0095] In certain embodiments, the conjugate group according to Formula III is represented by the following Formula:
##STR00006##
[0096] In certain embodiments, the conjugate group according to Formula V is represented by the following Formula:
##STR00007##
[0097] In certain embodiments, the conjugate group according to Formula VIII is represented by the following Formula:
##STR00008##
[0098] In certain embodiments, R is OH. In certain embodiments, R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is SH.
[0099] In certain embodiments, R is OH. In certain embodiments, R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is SH.
[0100] In certain embodiments, R is O. In certain embodiments, R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is S.
[0101] Certain embodiments provide a compound comprising a first modified oligonucleotide selected from any one of Ref ID NOs: IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018, IS0570-587, IS0969, IS0972-977, IS1023-1027, IS1029, IS1031-1037, IS1042-1046, IS1082, IS1085, IS1086, IS1091-1095, IS1108-1111, IS1236-1239, IS1242, IS1249, and IS1251-1254 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide.
[0102] Certain embodiments provide a compound comprising a first modified oligonucleotide selected from any one of Ref ID NOs: IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018 and a second modified oligonucleotide selected from any one of Ref ID NOs: IS0570-587, IS0969, IS0972-977, IS1023-1027, IS1029, IS1031-1037, IS1042-1046, IS1082, IS1085, IS1086, IS1091-1095, IS1108-1111, IS1236-1239, IS1242, IS1249, and IS1251-1254.
[0103] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0840 and a second modified oligonucleotide which is IS0972.
[0104] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0842 and a second modified oligonucleotide which is IS0974.
[0105] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0888 and a second modified oligonucleotide which is IS1109.
[0106] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0888 and a second modified oligonucleotide which is IS1236.
[0107] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1010 and a second modified oligonucleotide which is IS1109.
[0108] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1011 and a second modified oligonucleotide which is IS1239.
[0109] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1012 and a second modified oligonucleotide which is IS1242. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1016 and a second modified oligonucleotide which is IS1252.
[0110] Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1017 and a second modified oligonucleotide which is IS1253.
[0111] In certain embodiments, the compound of any foregoing embodiment is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt.
[0112] Certain embodiments provide a compound of any foregoing embodiments that is a stereoisomer.
[0113] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00009##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IA1016 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0114] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00010##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1252 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0115] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00011##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IA1017 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0116] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00012##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1253 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0117] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00013##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IA1010 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0118] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00014##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1109 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0119] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00015##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IA1011 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0120] In an aspect provided herein, is a modified oligonucleotide according to the following chemical structure:
##STR00016##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Ref ID NO: IS1239 is a modified oligonucleotide, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0121] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00017##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IA1016 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0122] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00018##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1252 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0123] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00019##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IA1017 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0124] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00020##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1253 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0125] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00021##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IA1010 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0126] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00022##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IS1109 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0127] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00023##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IA1011 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0128] In an aspect provided herein, is a sodium salt of a modified oligonucleotide according to the following chemical structure:
##STR00024##
or a stereoisomer thereof. In certain embodiments, Ref ID NO: IS 1239 is a modified oligonucleotide, or a stereoisomer thereof, according to the preceding chemical structure.
[0129] In an aspect provided herein, is a compound according to the following chemical structure:
##STR00025## ##STR00026##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Compound Number RD2830 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0130] In an aspect provided herein, is a compound according to the following chemical structure:
##STR00027## ##STR00028##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Compound Number RD2831 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0131] In an aspect provided herein, is a compound according to the following chemical structure:
##STR00029## ##STR00030##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Compound Number RD2795 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0132] In an aspect provided herein, is a compound according to the following chemical structure:
##STR00031## ##STR00032##
or a pharmaceutically acceptable salt or stereoisomer thereof. In certain embodiments, Compound Number RD2798 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0133] In an aspect provided herein, is a sodium salt of a compound according to the following chemical structure:
##STR00033## ##STR00034##
or a stereoisomer thereof. In certain embodiments, Compound Number RD2830 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0134] In an aspect provided herein, is a sodium salt of a compound according to the following chemical structure:
##STR00035## ##STR00036##
or a stereoisomer thereof. In certain embodiments, Compound Number RD2831 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0135] In an aspect provided herein, is a sodium salt of a compound according to the following chemical structure:
##STR00037## ##STR00038##
or a stereoisomer thereof. In certain embodiments, Compound Number RD2795 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0136] In an aspect provided herein, is a sodium salt of a compound according to the following chemical structure:
##STR00039## ##STR00040##
or a stereoisomer thereof. In certain embodiments, Compound Number RD2798 is a compound, or a pharmaceutically acceptable salt or stereoisomer thereof, according to the preceding chemical structure.
[0137] In certain embodiments, provided herein is a population of modified oligonucleotides, wherein all the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. In certain embodiments, provided herein is a population of compounds, wherein all the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
[0138] Certain embodiments provide a composition comprising the compound of any preceding embodiment and a pharmaceutically acceptable carrier.
[0139] Certain embodiments provide a composition comprising a compound of any preceding embodiment, for use in therapy.
[0140] Certain embodiments provide a method of treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual comprising administering to the individual a compound targeted to CFB, thereby treating, preventing, or ameliorating the disease.
[0141] In certain embodiments, the compound or composition of any foregoing embodiment is administered to an individual. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, administering the compound inhibits or reduces or improves atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom thereof.
[0142] In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount.
[0143] In certain embodiments, a composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg/kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.
[0144] In certain embodiments, a composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly, or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year.
[0145] Certain embodiments provide a method of inhibiting expression of CFB in a cell comprising contacting the cell with a compound targeted to CFB, thereby inhibiting expression of CFB in the cell. In certain embodiments, the cell is in the liver of an individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).
[0146] Certain embodiments provide a method of reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an individual, comprising administering a compound targeted to CFB to the individual, thereby reducing or inhibiting atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in the individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds. In certain embodiments, the compound or composition is administered parenterally.
[0147] Certain embodiments provide use of a compound targeted to CFB for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds.
[0148] Certain embodiments provide use of a compound targeted to CFB in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound is a compound targeted to CFB. In certain embodiments, the compound is any of the foregoing compounds.
Certain Indications
[0149] In certain aspects, the disclosure relates to methods of inhibiting CFB expression, which can be useful for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual, by administration of a compound that targets CFB. In certain embodiments, the compound can be a CFB specific inhibitor. In certain embodiments, the compound can be an antisense oligonucleotide, an oligomeric compound, or an oligonucleotide targeted to CFB.
[0150] In certain aspects, the disclosure relates to treating, preventing, or ameliorating a disease, disorder or condition associated with CFB. In certain embodiments, diseases, disorders or conditions associated with CFB treatable, preventable, and/or ameliorable with the methods provided herein include atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). Certain compounds provided herein are directed to compounds and compositions that reduce atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal.
[0151] In certain embodiments, a method of treating, preventing, or ameliorating a disease, disorder or condition associated with CFB in an individual comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby treating, preventing, or ameliorating the disease, disorder, or condition. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is a liver, kidney, or ocular disease. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides) in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a single-stranded compound can be 14 to 30, 14 to 23, 14 to 20, 16 to 20, or 14 to 16, linked nucleosides in length. In certain embodiments, a single-stranded compound can be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, linked nucleosides in length. In certain embodiments, a double-stranded compound can comprise two oligonucleotides of the same or different lengths, as described elsewhere herein. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal.
[0152] In certain embodiments, a method of treating, preventing, or ameliorating atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby treating, preventing, or ameliorating atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof in an animal. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB.
[0153] In certain embodiments, a method of inhibiting expression of CFB in an individual having, or at risk of having, a disease, disorder or condition associated with CFB comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby inhibiting expression of CFB in the individual. In certain embodiments, administering the compound inhibits expression of CFB in the liver. In certain embodiments, the disease, disorder or condition is a complement pathway related disease, disorder or condition or is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound improves, preserves, or prevents atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, a method of inhibiting expression of CFB in a cell comprises contacting the cell with a compound comprising a CFB specific inhibitor, thereby inhibiting expression of CFB in the cell. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of an individual who has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0154] In certain embodiments, a method of reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in an individual having, or at risk of having, a disease associated with CFB comprises administering to the individual a compound comprising a CFB specific inhibitor, thereby reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) in the individual. In certain embodiments, the individual has, or is at risk of having, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having, or at risk of having, a disease, disorder or condition associated with CFB.
[0155] Certain embodiments are drawn to a compound comprising a CFB specific inhibitor for use in treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally.
[0156] Certain embodiments are drawn to a compound comprising a CFB specific inhibitor for use in reducing or inhibiting a complement pathway related disease, disorder or condition or atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA) or a symptom of any thereof. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0157] Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the manufacture or preparation of a medicament for treating a disease, disorder or condition associated with CFB. Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is a complement pathway related disease, disorder, or condition. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0158] Certain embodiments are drawn to the use of a compound comprising a CFB specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting a complement pathway related disease, disorder or condition or a symptom thereof in an individual having, or at risk of having, a complement pathway related disease. In certain embodiments, the complement pathway related disease is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). Certain embodiments are drawn to use of a compound comprising a CFB specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with CFB. In certain embodiments, the disease, disorder, or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), e.g., lupus nephritis, diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA). In certain embodiments, the compound comprises an antisense oligonucleotide targeted to CFB. In certain embodiments, the compound comprises an oligonucleotide targeted to CFB. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 24, 25, 42, 96, 97, 98, and 100. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 100 and SEQ ID NO: 101. In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of SEQ ID NO: 93, SEQ ID NO: 106, SEQ ID NO: 109 and SEQ ID NO: 110. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 96 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 93. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 97 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 106. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 100 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 109. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 101 and a second modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 110. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0159] In any of the foregoing methods or uses, the compound can be an oligomeric compound. In any of the foregoing methods or uses, the compound can be single-stranded or double-stranded. In any of the foregoing methods or uses, the compound can be targeted to CFB. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain embodiments, the compound comprises one or more modified oligonucleotides. In certain embodiments, the compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, a modified oligonucleotide is 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 14 to 30 linked nucleosides in length, 14 to 23 linked nucleosides in length, or 19 to 23 linked nucleosides in length. In certain embodiments, a modified oligonucleotide having a nucleobase sequence is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequences recited in SEQ ID NO: 1 or 3 over its length. In certain embodiments, a modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, the modified sugar is a bicyclic sugar, 2-MOE, 2-F, or 2-OMe. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In any of the foregoing embodiments, each modified oligonucleotide is independently 12 to 30, 14 to 30, 14 to 25, 14 to 24, 14 to 23, 16 to 23, 17 to 23, 18 to 23, 19 to 23, 19 to 22, or 19 to 20 linked nucleosides in length. In certain embodiments, a modified oligonucleotide having a nucleobase sequence has at least 1, at least 2, or at least 3 mismatches to a region of the nucleobases of SEQ ID NO: 1 or 3.
[0160] In any of the forgoing methods or uses, the compound comprises a first and second modified oligonucleotide, wherein there is a region of complementarity between a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the region of complementarity between the first oligonucleotide and the second oligonucleotide is 14 to 23, 19 to 23, or 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the modified internucleoside linkage is at the 3 terminus of the first or second modified oligonucleotide or at the 5 terminus of the first or second modified oligonucleotide. In certain embodiments, the first or second modified oligonucleotide comprises one or more modified sugars. In certain embodiments, each nucleoside of the first or second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a modification selected from 2-MOE, 2-F, and 2-OMe or a combination thereof. In certain embodiments, the first or second modified oligonucleotide comprises no more than ten 2-F sugar modifications. In certain embodiments, the first or second modified oligonucleotide comprises no more than five 2-F sugar modifications.
[0161] In any of the forgoing methods or uses, a compound comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5 end of a modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the one or more GalNAc is attached to the 2 or 3 position of the ribosyl ring. In certain embodiments, the one or more GalNAc is attached to the 5 nucleoside of the modified oligonucleotide. In certain embodiments, the 5 nucleoside of a modified oligonucleotide is selected from Formulae I-VIII and XII, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5 nucleoside. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is S. In certain embodiments, the 5 nucleoside of a modified oligonucleotide is Formula XII, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5 nucleoside. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is S.
[0162] In any of the foregoing methods or uses, the compound comprises a first modified oligonucleotide selected from any one of IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide. In certain embodiments, the compound comprises a first modified oligonucleotide selected from IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018 and a second modified oligonucleotide selected from IS0570-587, IS0969, IS0972-977, IS1023-1027, IS1029, IS1031-1037, IS1042-1046, IS1082, IS1085, IS1086, IS1091-1095, IS1108-1111, IS1236-1239, IS1242, IS1249, and IS1251-1254. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0840 and a second modified oligonucleotide which is IS0972. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0842 and a second modified oligonucleotide which is IS0974. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0888 and a second modified oligonucleotide which is IS1109. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA0888 and a second modified oligonucleotide which is IS1236. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1010 and a second modified oligonucleotide which is IS1109. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1011 and a second modified oligonucleotide which is IS1239. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1012 and a second modified oligonucleotide which is IS1242. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1016 and a second modified oligonucleotide which is IS1252. Certain embodiments provide a compound comprising a first modified oligonucleotide which is IA1017 and a second modified oligonucleotide which is IS1253.
[0163] In certain embodiments, the compound is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt. In certain embodiments, a composition comprises the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier.
[0164] In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg/kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the composition is administered to the individual one or more times in a day up to the dosage level or fixed dose.
[0165] In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly, or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year.
Certain Compounds
[0166] In certain aspects, the disclosure relates to a compound that comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.
[0167] In certain aspects, the disclosure relates to a compound that comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.
[0168] In certain aspects, the disclosure relates to a compound that comprises or consists of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence or portion thereof of a target nucleic acid.
[0169] In certain aspects, the disclosure relates to a compound that is a single-stranded compound. In certain embodiments, the single-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide or modified oligonucleotide of a single-stranded compound comprises a self-complementary nucleobase sequence. In certain aspects, the disclosure relates to a compound that is a double-stranded compound. In certain embodiments, the double-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, the double-stranded compound comprises a first oligonucleotide and a second oligonucleotide. In certain embodiments, the first oligonucleotide has a region complementarity to a target nucleic acid and the second oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, the double-stranded compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a region complementarity to a target nucleic acid. In certain embodiments, the double-stranded compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a region complementarity to a target nucleic acid and the second modified oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, an oligonucleotide or modified oligonucleotide of a double-stranded compound is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase.
[0170] In certain embodiments, a compound described herein comprises a conjugate group. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double-stranded compound comprises a conjugate group. In certain embodiments, the second oligonucleotide or second modified oligonucleotide of a double-stranded compound comprises a conjugate group. In certain embodiments, a first oligonucleotide or first modified oligonucleotide and a second oligonucleotide or second modified oligonucleotide of a double-stranded compound each comprises a conjugate group.
[0171] In certain embodiments, a compound is 14-30 linked nucleosides in length. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double-stranded compound is 14-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide or second modified oligonucleotide is 14-30 linked nucleosides in length. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound are blunt ended at one or both ends of the compound. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound include non-complementary overhanging nucleosides at one or both ends of the compound.
[0172] In certain embodiments, a compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102. In certain embodiments, one of the oligonucleotides or modified oligonucleotides of a double-stranded compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-44 and 96-102.
[0173] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, antisense oligonucleotides, siRNAs, microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds), and single-stranded RNAi compounds (e.g., small hairpin RNAs (shRNAs), single stranded siRNAs (ssRNAs) and microRNA mimics).
[0174] In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5 to 3 direction, comprises the reverse complement of the target region of a target nucleic acid to which it is targeted.
[0175] In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 23 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 23 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 12 to 23 linked subunits, 14 to 30 linked subunits, 14 to 23 linked subunits, 15 to 30 linked subunits, 15 to 23 linked subunits, 16 to 30 linked subunits, 16 to 23 linked subunits, 17 to 30 linked subunits, 17 to 23 linked subunits, 18 to 30 linked subunits, 18 to 23 linked subunits, 19 to 30 linked subunits or 19 to 23 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 22 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 23 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 23, 18 to 24, 18 to 25, 18 to 50, 19 to 23, 19 to 30, 19 to 50, 20 to 23 or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values.
[0176] In certain embodiments, the compound may further comprise an additional moiety, such as a conjugate group or delivery moiety. In certain embodiments, such compounds are oligomeric compounds, and the additional moiety is attached to an oligonucleotide. In certain embodiments, a conjugate group is attached to a nucleoside of an oligonucleotide.
[0177] In certain embodiments, compounds may be shortened or truncated. For example, one or more subunits may be deleted from the 5 end (5 truncation), or alternatively from the 3 end (3 truncation) of an oligonucleotide.
[0178] In certain embodiments, compounds may be lengthened. For example, one or more subunits may be attached to the 3 end or 5 end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5 end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 3 end of an oligonucleotide. In certain embodiments, at least one subunit may be attached to the 3 end or 5 end of an oligonucleotide of a double-stranded compound creating a 3 and/or 5 end overhang. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5 end of both oligonucleotides of a double-stranded compound. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunit) is attached to the 3 end of both oligonucleotides of a double-stranded compound. In certain embodiments, subunits are attached to both oligonucleotides of a double-stranded compound at the same end (e.g., that subunits are attached to the 3 end of one of the oligonucleotides and subunits are attached to the 5 end of the other oligonucleotide). In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide may be the same or may be different. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is the same. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is different. This scenario, where subunits are attached to both oligonucleotides of a double-stranded compound at the same end, may occur at one or both ends of a double-stranded compound. In certain embodiments, the subunits attached to the 3 and/or 5 end are modified.
[0179] In certain embodiments, compounds described herein are oligonucleotides. In certain embodiments, compounds described herein are modified oligonucleotides. In certain embodiments, compounds described herein are antisense oligonucleotides. In certain embodiments, compounds described herein are oligomeric compounds. In certain embodiments, compounds described herein are RNAi compounds. In certain embodiments, compounds described herein are siRNA compounds.
[0180] In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to CFB described herein. In certain embodiments, the compound can be double-stranded.
[0181] In certain embodiments, the compound comprises an oligonucleotide having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of any one of the nucleobase sequences of SEQ ID NOs: 11-44 or 96-102. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 96, 97, 100 or 101. In certain embodiments, the compound comprises a second oligonucleotide. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 93, 106, 109 or 110. In certain embodiments, the compound comprises a first oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 96 and a second oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 93. In certain embodiments, the compound comprises a first oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 97 and a second oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 106. In certain embodiments, the compound comprises a first oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 100 and a second oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 109. In certain embodiments, the compound comprises a first oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 101 and a second oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of SEQ ID NO: 110. In certain embodiments the oligonucleotide is a modified oligonucleotide.
[0182] In certain embodiments, the compound comprises ribonucleotides in which the oligonucleotide has uracil (U) in place of thymine (T) for any of the sequences provided here. In certain embodiments, the compound comprises deoxyribonucleotides in which the oligonucleotide has thymine (T) in place of uracil (U) for any of the sequences provided here.
Certain Mechanisms
[0183] In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein comprise or consist of antisense oligonucleotides. In certain embodiments, compounds comprise or consist of oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired activity.
[0184] In certain embodiments, hybridization of a compound described herein to a target nucleic acid results in recruitment of one or more proteins that cause the cleavage of the target nucleic acid. For example, certain compounds described herein, or a portion of the compounds, are loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
[0185] In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of RNA processing. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
[0186] Activities resulting from the hybridization of a compound to a target nucleic acid may be observed directly or indirectly. In certain embodiments, observation or detection of an activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.
Certain Modifications
[0187] In certain aspects, the disclosure relates to compounds that comprise or consist of oligonucleotides. Oligonucleotides consist of linked nucleosides. In certain embodiments, oligonucleotides may be unmodified RNA or DNA or may be modified. In certain embodiments, the oligonucleotides are modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise at least one modified sugar, modified nucleobase or modified internucleoside linkage relative to an unmodified RNA or DNA. In certain embodiments, an oligonucleotide has a modified nucleoside. A modified nucleoside may comprise a modified sugar, a modified nucleobase or both a modified sugar and a modified nucleobase. Modified oligonucleotides may also include end modifications, e.g., 5-end modifications and 3-end modifications.
Sugar Modifications and Motifs
[0188] In certain embodiments, a modified sugar is a substituted furanosyl sugar or non-bicyclic modified sugar. In certain embodiments, a modified sugar is a bicyclic or tricyclic modified sugar. In certain embodiments, a modified sugar is a sugar surrogate. A sugar surrogate may comprise one or more substitutions described herein.
[0189] In certain embodiments, a modified sugar is a substituted furanosyl or non-bicyclic modified sugar. In certain embodiments, the furanosyl sugar is a ribosyl sugar. In certain embodiments, the furanosyl sugar comprises one or more substituent groups, including, but not limited to, substituent groups at the 2, 3, 4, and 5 positions.
[0190] In certain embodiments, substituents at the 2 position include, but are not limited to, F and OCH.sub.3 (OMe, O-methyl or methoxy). In certain embodiments, substituent groups at the 2 position suitable for non-bicyclic modified sugars include, but are not limited to, halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, F, Cl, Br, SCH.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, and NH.sub.2. In certain embodiments, substituent groups at the 2 position include, but are not limited to, 0-(C.sub.1-C.sub.10) alkoxy, alkoxyalkyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, O-alkyl-O-alkyl, alkynyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C2 to C.sub.10 alkenyl and alkynyl. In certain embodiments, substituent groups at the 2 position include, but are not limited to, alkaryl, aralkyl, O-alkaryl, and O-aralkyl. In certain embodiments, these 2 substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, substituent groups at the 2 position include, but are not limited to, O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2), OCH.sub.3, O(CH.sub.2), CH.sub.3, O(CH.sub.2).sub.nONH.sub.2, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nSCH.sub.3, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are independently from 1 to about 10. In certain embodiments, substituent groups at the 2 position include, but are not limited to, OCH.sub.2CH.sub.2OCH.sub.3 (MOE), O(CH.sub.2).sub.2ON(CH.sub.3).sub.2(DMAOE), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2(DMAEOE), and OCH.sub.2C(O)N(H)CH.sub.3 (NMA).
[0191] In certain embodiments, substituent groups at the 4 position suitable for non-bicyclic modified sugars include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. In certain embodiments, substituent groups at the 5 position suitable for non-bicyclic modified sugars include, but are not limited to, methyl (Me) (R or S), vinyl, and methoxy. In certain embodiments, substituents described herein for the 2, 4 and 5 position can be added to other specific positions on the sugar. In certain embodiments, such substituents may be added to the 3 position of the sugar on the 3 terminal nucleoside or the 5 position of the 5 terminal nucleoside. In certain embodiments, a non-bicyclic modified sugar may comprise more than one non-bridging sugar substituent. In certain such embodiments, non-bicyclic modified sugars substituents include, but are not limited to, 5-Me-2-F, 5-Me-2-OMe (including both R and S isomers). In certain embodiments, modified sugar substituents include those described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
[0192] In certain embodiments, a modified sugar is a bicyclic sugar. A bicyclic sugar is a modified sugar comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, a bicyclic sugar comprises a bridging substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, a bicyclic sugar does not comprise a furanosyl moiety. A bicyclic nucleoside (BNA) is a nucleoside having a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a bridge between the 4 and 2 furanose ring atoms. In certain embodiments, the bicyclic sugar comprises a bridge between the 5 and 3 furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. In certain embodiments, 4 to 2 bridging substituents include, but are not limited to, 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-CH.sub.2O-2 (LNA), 4-CH.sub.2S-2, 4-(CH.sub.2).sub.2O-2 (ENA), 4-CH(CH.sub.3)O-2 (constrained ethyl or cEt when in the S configuration), 4-CH.sub.2OCH.sub.2-2, 4-CH.sub.2N(R)-2, 4-CH(CH.sub.2OCH.sub.3)O-2 (constrained MOE or cMOE) and analogs thereof (e.g., U.S. Pat. No. 7,399,845), 4-C(CH.sub.3)(CH.sub.3)O-2 and analogs thereof (e.g., U.S. Pat. No. 8,278,283), 4-CH.sub.2N(OCH.sub.3)-2 and analogs thereof (e.g., U.S. Pat. No. 8,278,425), 4-CH.sub.2ON(CH.sub.3)-2 (e.g., U.S. Patent Publication No. 2004/0171570), 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (e.g., U.S. Pat. No. 7,427,672), 4-CH.sub.2C(H)(CH.sub.3)-2 (e.g., Chattopadhyaya el al., J. Org. Chem., 2009, 74, 118-134), and 4-CH.sub.2C(CH.sub.2)-2 and analogs thereof (e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of bicyclic nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, US 2013/0190383; and WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example -L-ribofuranose and -D-ribofuranose (see e.g., WO 99/14226). Specified bicyclic nucleosides herein are in the -D configuration, unless otherwise specified.
[0193] In certain embodiments, a modified sugar is a sugar surrogate. In certain embodiments, a sugar surrogate has the oxygen atom replaced, e.g., with a sulfur, carbon, or nitrogen atom. In certain such embodiments, the sugar surrogate may also comprise bridging and/or non-bridging substituents as described herein. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. In certain such embodiments, the sugar surrogate comprises a cyclobutyl moiety in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a six membered ring in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a tetrahydropyran (THP) in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a morpholino in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,166,315; 5,185,444; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,700,920; 7,875,733; 7,939,677, 8,088,904; 8,440,803; and 9,005,906, the entire contents of each of the foregoing are hereby incorporated herein by reference.
[0194] In some embodiments, sugar surrogates comprise acyclic moieties. In certain embodiments, the sugar surrogate is an unlocked nucleic acid (UNA). A UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar residue. In one example, UNA also encompasses a monomer where the bonds between C1-C4 have been removed (i.e., the covalent carbon-oxygen-carbon bond between the C1 and C4 carbons). In another example, the C2-C3 bond (i.e., the covalent carbon-carbon bond between the C2 and C3 carbons) of the sugar has been removed. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and U.S. Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, sugar surrogates comprise peptide nucleic acid (PNA), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378, the entire contents of which is hereby incorporated herein by reference. Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.
[0195] In certain aspects, the disclosure relates to compounds comprising at least one oligonucleotide wherein the nucleosides of such oligonucleotide comprise one or more types of modified sugars and/or unmodified sugars arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include, but are not limited to, any of the patterns of sugar modifications described herein.
[0196] In certain embodiments, an oligonucleotide comprises a gapmer sugar motif. A gapmer oligonucleotide comprises or consists of a region having two external wing regions and a central or internal gap region. The gap and wing regions form a contiguous sequence of nucleosides, wherein the majority of nucleoside sugars of each of the wings differ from the majority of nucleoside sugars of the gap. In certain embodiments, the wing regions comprise a majority of modified sugars and the gap comprises a majority of unmodified sugars. In certain embodiments, the nucleosides of the gap are deoxynucleosides. Compounds with a gapmer sugar motif are described in, for example U.S. Pat. No. 8,790,919, the entire contents of which is hereby incorporated herein by reference.
[0197] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a triplet sugar motif. An oligonucleotide with a triplet sugar motif comprises three identical sugar modifications on three consecutive nucleosides. In certain embodiments, the triplet is at or near the cleavage site of the oligonucleotide. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one triplet sugar motif. In certain embodiments, the identical sugar modification of the triplet sugar motif is a 2-F modification. Compounds with a triplet sugar motif are disclosed, for example, in U.S. Pat. No. 10,668,170, the entire contents of which is incorporated herein by reference.
[0198] In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a quadruplet sugar motif. An oligonucleotide with a quadruplet sugar motif comprises four identical sugar modifications on four consecutive nucleosides. In certain embodiments, the quadruplet is at or near the cleavage site. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one quadruplet sugar motif. In certain embodiments, the identical sugar modification of the quadruplet sugar motif is a 2-F modification. For a double-stranded compound having a duplex region of 19-23 nucleotides in length, the cleavage site of the antisense oligonucleotide is typically around the 10, 11, and 12 positions from the 5-end. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the sense oligonucleotide, counting from the first nucleoside of the 5-end of the sense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5-end of the sense oligonucleotide. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the antisense oligonucleotide, counting from the first nucleoside of the 5-end of the antisense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5- end of the antisense oligonucleotide. The cleavage site may change according to the length of the duplex region of the double-stranded compound and may change the position of the quadruplet accordingly.
[0199] In certain embodiments, an oligonucleotide comprises an alternating sugar motif. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise an alternating sugar motif. An oligonucleotide with an alternating sugar motif comprises at least two different sugar modifications wherein one or more consecutive nucleosides comprising a first sugar modification alternates with one or more consecutive nucleosides comprising a second sugar modification and one or more consecutive nucleosides comprising a third sugar modification, etc. For example, if A, B and C each represent one type of modification to the nucleoside, the alternating motif can be ABABABABABAB . . . , AABBAABBAABB . . . , AABAABAABAAB AAABAAABAAAB . . . , AAABBBAAABBB . . . , or ABCABCABCABC . . . etc. In certain embodiments, the alternating sugar motif is repeated for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases along an oligonucleotide. In certain embodiments, the alternating sugar motif is comprised of two different sugar modifications. In certain embodiments, the alternating sugar motif comprises 2-OMe and 2-F sugar modifications.
[0200] In certain embodiments, each nucleoside of an oligonucleotide is independently modified with one or more sugar modifications provided herein. In certain embodiments, each oligonucleotide of a double-stranded compound independently has one or more sugar motifs provided herein. In certain embodiments, an oligonucleotide containing a sugar motif, is fully modified in that each nucleoside other than the nucleosides comprising the sugar motif comprises a sugar modification.
Nucleobase Modifications and Motifs
[0201] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside.
[0202] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5- hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (CCCH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
[0203] Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808; Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, J. L., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, dsRNA Research and Applications, pages 289-302; Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443 (Chapters 6 and 15), each of which are hereby incorporated herein by reference.
[0204] Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, US Applications 2003/0158403 and 2003/0175906; U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,811,534; 5,750,692; 5,948,903; 5,587,470; 5,457,191; 5,763,588; 5,830,653; 5,808,027; 6,005,096. 6,015,886; 6,147,200; 6,166,197; 6,166,199; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.
[0205] In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
[0206] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3-end of the oligonucleotide. In certain embodiments, the block is at the 5-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5-end of the oligonucleotide.
Internucleoside Linkage Modifications and Motifs
[0207] A 3 to 5 phosphodiester linkage is the naturally occurring internucleoside linkage of RNA and DNA. In certain embodiments, compounds described herein have one or more modified, i.e., non-naturally occurring, internucleoside linkages. Certain non-naturally occurring internucleoside linkages may impart desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Representative phosphorus-containing modified internucleoside linkages include, but are not limited to, phosphotriesters, alkylphosphonates (e.g., methylphosphonates), phosphoramidates, and phosphorothioates (PS), and phosphorodithioates (HS-PS). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (CH.sub.2N(CH.sub.3)OCH.sub.2), thiodiester, thionocarbamate (OC(O)(NH)S); siloxane (OSiH.sub.2O); and N,N-dimethylhydrazine (CH.sub.2N((CH.sub.3)N((CH.sub.3)). Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), methoxypropyl, and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (see, for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0208] In certain embodiments, compounds provided herein comprise at least one modified internucleoside linkage. A modified internucleoside linkage may be placed at any position of an oligonucleotide. For double-stranded compounds, a modified internucleoside linkage may be placed within the sense oligonucleotide, antisense oligonucleotide, or both oligonucleotides of the double-stranded compound.
[0209] In certain embodiments, the internucleoside linkage modification may occur on every nucleoside of an oligonucleotide. In certain embodiments, internucleoside linkage modifications may occur in an alternating pattern along an oligonucleotide. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (PO). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (PS). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is the same. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is different. In certain embodiments, a double-stranded compound comprises 6-8 modified internucleoside linkages. In certain embodiments, the 6-8 modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the sense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5-end and the 3-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the antisense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5-end and the 3-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages.
[0210] In certain embodiments, a double-stranded compound comprises an overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleoside linkage modification in the overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleotide linkage linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleoside linkages between the terminal three nucleosides, in which two of the three nucleosides are overhang nucleosides, and the third is a paired nucleoside next to the overhang nucleoside. These terminal three nucleosides may be at the 3-end of the antisense oligonucleotide, the 3-end of the sense oligonucleotide, the 5-end of the antisense oligonucleotide, or the 5-end of the antisense oligonucleotide.
[0211] In certain embodiments, modified oligonucleotides comprise one or more internucleoside linkages having chiral centers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having chiral centers can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. As is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
Conjugate Groups
[0212] In certain embodiments, the compounds described herein comprise or consist of one or more oligonucleotides and, optionally, one or more conjugate groups. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, a conjugate group is attached at the 3 end of an oligonucleotide. In certain embodiments, a conjugate group is attached at the 5 end of an oligonucleotide. In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups.
[0213] In certain embodiments, conjugate groups are terminal groups attached to either or both ends of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 3 end of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 5 end of an oligonucleotide. In certain embodiments, terminal groups include, but are not limited to, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified, such as an overhang.
[0214] In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, activity, half-life, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups enhance the affinity of a compound for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a compound absent such a conjugate group. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
[0215] In certain embodiments, conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
[0216] In certain embodiments, conjugate groups include an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial, or an antibiotic.
[0217] In certain embodiments, conjugate groups are targeting moieties. In certain embodiments, a targeting moiety includes, but is not limited to, a lectin, glycoprotein, lipid, protein, peptide, peptide mimetic, receptor ligand, antibody, thyrotropin, melanotropin, surfactant protein A, carbohydrate, carbohydrate derivative, modified carbohydrate, carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine (GalNAc), N-acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0218] In certain embodiments, conjugate groups may include, but are not limited to, the conjugate groups described in the following references such as cholesterol (e.g., Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (e.g., Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioether, e.g., hexyl-S-tritylthiol (e.g., Manoharan et al., Ann. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (e.g., Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, e.g., do-decan-diol or undecyl residues (e.g., Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (e.g., Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or a polyethylene glycol chains (e.g., Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), adamantane acetic acid (e.g., Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl (e.g., Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), octadecylamine or hexylamino-carbonyloxychole sterol moiety (e.g., Crooke et al. J. Pharmacol. Exp. Ther., 1996, 277:923-937), tocopherol (e.g., Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16:734-740), GalNAc and other carbohydrates (e.g., Maier et al., Bioconjugate Chemistry, 2003, 14, 18-29; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; WO2009/073809 and U.S. Pat. Nos. 8,106,022; 8,450,467 and 8,828,957; and WO2014/179445; WO2014/179620 and U.S. Pat. Nos. 9,127,276; 9,181,549 and 10,844,379) each of which is incorporated herein by reference in its entirety.
[0219] Conjugate groups may be attached to oligonucleotides through conjugate linkers. In certain embodiments, a conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units or combination of such repeating units. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain embodiments, a conjugate linker comprises at least one phosphorus group. In certain embodiments, a conjugate linker comprises at least one phosphate group. In certain embodiments, a conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl, or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides may be modified or unmodified nucleosides. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides herein can be linked to one another and to the remainder of the compound through cleavable bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide including a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
[0220] In certain embodiments, conjugate groups and conjugate linkers as well as other modifications include, without limitation, those described in the following references: U.S. Pat. Nos. 5,994,517; 6,300,319; 6,660,720; 6,906,182; 7,262,177; 7,491,805; 8,106,022; 7,723,509; 9,127,276; US 2006/0148740; US 2011/0123520; WO2013/033230; WO2012/037254, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011,19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Lee, Carhohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycohiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromh Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., JAm Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Pat. Nos. 4,751,219; 7,582,744; 8,552,163; 8,137,695; 6,908,903; 6,383,812; 7,262,177; 6,525,031; 5,994,517; 6,660,720; 6,300,319; 7,723,509; 8,106,022; 7,491,805; 7,491,805; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427; US2003/0119724; US2011/0207799; US2012/0035115; US2012/0230938; US2005/0164235; US2006/0183886; US2012/0136042; US2012/0095075; US2013/0109817; US2006/0148740; US2008/0206869; US2012/0165393; US2012/0101148; US2013/0121954; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132; each of which is incorporated herein by reference in its entirety.
Certain Targeting Moieties
[0221] In certain embodiments, a compound provided herein comprises a conjugate group. In certain embodiments, an oligonucleotide or modified oligonucleotide provided herein comprises a conjugate group. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more GalNAc. In certain embodiments, the one or more GalNAc are attached to one or more positions on a furanose ring. In certain embodiments, the one or more GalNAc are attached to the 2 or 3 position on a furanose ring. In certain embodiments, the furanose ring is a subunit of the oligonucleotide or modified oligonucleotide. In certain embodiments, the furanose ring is the 5 nucleoside sugar of an oligonucleotide or modified oligonucleotide. In certain embodiments, the furanose ring is the 5 nucleoside sugar of a sense oligonucleotide or modified oligonucleotide. In certain embodiments, a compound, oligonucleotide, or modified oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:
##STR00041## [0222] wherein: [0223] R.sup.1 is H, adenine, guanine, thymine, cytosine, uracil, carbocyclyl, heterocyclyl, aryl, heteroaryl, or a nucleobase isostere; [0224] R.sup.2 is an oligonucleotide sequence, modified oligonucleotide, or compound; [0225] L.sup.1 is alkyl, or alkyl-C(O)NH-alkyl; [0226] L.sup.2 is alkyl, or alkyl-C(O)NH-alkyl; [0227] L.sup.3 is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, 0, S, S(O), S(O).sub.2, NH, substituted N group, alkyl, alkenyl, dienyl, alkynyl, heteroalkyl, or phosphate; [0228] R.sup.3 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; [0229] R.sup.4 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.k-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; [0230] R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; [0231] R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; [0232] W and Q are each independently O, NH, CH.sub.2, or CH.sub.2O; [0233] S.sup.1 and S.sup.2 are each independently C(R.sup.7) or N, wherein each instance of R.sup.7 is independently H, alkyl, heteroalkyl, or halogen; [0234] j is an integer 1-10, inclusive; [0235] k is an integer 1-10, inclusive; [0236] m is an integer 1-10, inclusive; and [0237] n is an integer 1-10, inclusive.
[0238] In certain embodiments, R.sup.3, R.sup.4, R.sup.5, and R.sup.6 are the same. In certain embodiments, R.sup.3, R.sup.5, and R.sup.6 are the same. In certain embodiments, R.sup.3 or R.sup.4 is H.
[0239] In certain embodiments, L.sup.1 and L.sup.2 are the same.
[0240] In certain embodiments, L.sup.1 and L.sup.2 are each independently alkyl; R.sup.3 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.4 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.k-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; and R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc.
[0241] In certain embodiments, L.sup.1 and L.sup.2 are each independently alkyl-C(O)NH-alkyl; R.sup.3 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.4 is H, C(O)NH(CH.sub.2CH.sub.2O).sub.k-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; and R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc.
[0242] In certain embodiments, R.sup.4 is H.
[0243] In certain embodiments, L.sup.1 and L.sup.2 are each independently alkyl; R.sup.3 is C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.4 is H; R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; and R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc.
[0244] In certain embodiments, L.sup.1 and L.sup.2 are each independently alkyl-C(O)NH-alkyl; R.sup.3 is C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.4 is H; R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; and R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc, or C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc.
[0245] In certain embodiments, R.sup.3 is C(O)NH(CH.sub.2CH.sub.2O).sub.j-GalNAc; R.sup.4 is H; R.sup.5 is C(O)NH(CH.sub.2CH.sub.2O).sub.m-GalNAc; and R.sup.6 is C(O)NH(CH.sub.2CH.sub.2O).sub.n-GalNAc.
[0246] In certain embodiments, R.sup.3 is C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; R.sup.4 is H; R.sup.5 is C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc; and R.sup.6 is C(O)NH-alkyl-NHC(O)-alkyl-O-GalNAc.
[0247] In certain embodiments, a compound, modified oligonucleotide, or oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:
##STR00042## [0248] wherein: [0249] R.sup.9 is H, adenine, guanine, thymine, cytosine, or uracil, or adenine, guanine, thymine, cytosine, or uracil, each comprising a Protecting Group (PG), a modified nucleobase, optionally substituted alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, or a nucleobase isostere; [0250] L is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl; [0251] R.sup.2 is an oligonucleotide sequence, modified oligonucleotide, or compound; [0252] Y.sub.1 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; [0253] Y.sub.2 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; [0254] Y.sub.3 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; [0255] Y.sub.4 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; [0256] n.sub.2 is 0, 1, 2, 3, 4, 5, or 6; and [0257] each n.sub.1, n.sub.3, n.sub.4 and n.sub.5 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0258] In certain embodiments, a compound, modified oligonucleotide, or oligonucleotide comprises one or more subunits with the following formula or a salt, solvate, or hydrate thereof:
##STR00043## [0259] wherein: [0260] each n is independently 1, 2, 3, 4, or 5; [0261] each m is independently 0, 1, 2, 3, 4, 5, or 6; [0262] each o is independently 0, 1, 2, 3, 4, 5, or 6; [0263] each of L.sub.1, L.sub.2, and L.sub.3 is independently absent, C(O), or C(O)NH; [0264] each Y.sub.1 is independently O, CH(R.sup.a), S, S(O), S(O).sub.2, NH, substituted N group, NHC(O), C(O)NH, P(O).sub.2O, P(O)(S)O, P(S).sub.2O, OP(O).sub.2O, OP(O)(S)O, OP(S).sub.2O, OP(O).sub.2, OP(O)(S), OP(S).sub.2; [0265] each Y.sub.2 is independently O, CH(R.sup.b), S, S(O), S(O).sub.2, NH, substituted N group, NHC(O), C(O)NH, P(O).sub.2O, P(O)(S)O, P(S).sub.2O, OP(O).sub.2O, OP(O)(S)O, OP(S).sub.2O, OP(O).sub.2, OP(O)(S), OP(S).sub.2; [0266] each of Het.sub.1, Het.sub.2, and Het.sub.3 is independently optionally substituted heteroaryl or optionally substituted heterocyclyl; [0267] R.sup.1 is an oligonucleotide sequence, modified oligonucleotide, or compound linked by a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl;
##STR00044## [0268] each R.sub.5, R.sub.6, and R.sub.7 is independently [0269] R.sub.9 is optionally substituted heterocyclyl; [0270] each R.sup.a is independently H, alkyl, halo, OR.sup.c, or SR.sup.c; [0271] each R.sup.b is independently H, alkyl, halo, OR.sup.c, or SR.sup.c; and [0272] each R.sup.c is independently H or alkyl.
[0273] In certain embodiments, R is OH. In certain embodiments, R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is SH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is OH. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is SH.
[0274] In certain embodiments, the subunit is selected from Formulae I-VIII and XII or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5 nucleoside. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula I and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula II and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula III and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula IV and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula V and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VI and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VII and R is S. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula VIII and R is S. In certain embodiments, the subunit is Formula XII or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide other than the 5 nucleoside. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is O. In certain embodiments, the 5 nucleoside of the modified oligonucleotide is Formula XII and R is S.
Target Nucleic Acids and Target Regions
[0275] In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is non-coding. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an exon. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
[0276] In certain embodiments, compounds disclosed herein hybridize with a CFB nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence hybridizes specifically to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein specifically hybridize with a CFB nucleic acid.
[0277] Nucleotide sequences that encode CFB include, without limitation, the following: GENBANK Accession Nos. NM_001710.6 (incorporated herein as SEQ ID NO: 1), nucleotides 31946095 to 31952084 of GenBank Accession No. NC_000006.12 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NM_001710.6 (incorporated herein as SEQ ID NO: 3), and nucleotides 3423522 to 3429511 of GenBank Accession No. NT_113891.3 (incorporated herein as SEQ ID NO: 4).
Complementarity
[0278] Oligonucleotides provided herein may have a defined percent complementarity to a particular nucleic acid, target region, oligonucleotide, or portion thereof. Non-complementary nucleobases may be tolerated provided that the oligonucleotide remains able to specifically hybridize to the nucleic acid, oligonucleotide, or portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. Percent complementarity of an oligonucleotide with a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined using routine methods. For example, an oligonucleotide in which 18 of 20 nucleobases of the oligonucleotide are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an oligonucleotide which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of an oligonucleotide with a region of a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined routinely using BLAST programs (basic local alignment search tools) known in the art. In certain embodiments, oligonucleotides described herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. For example, an oligonucleotide may be fully complementary to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. As used herein, fully complementary means each nucleobase of an oligonucleotide is complementary to the corresponding nucleobase of a target nucleic acid, a target region, an oligonucleotide, or a specified portion thereof. For example, a 20-nucleobase oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20-nucleobase portion of a 30-nucleobase oligonucleotide can be fully complementary to a 20-nucleobase region of a target sequence that is 400 nucleobases long. The 20-nucleobase portion of the 30-nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20-nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.
[0279] In certain embodiments, oligonucleotides described herein comprise one or more mismatched nucleobases relative to a target nucleic acid, a target region, an oligonucleotide or a specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5-end of the oligonucleotide. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3-end of the oligonucleotide. In certain embodiments, the mismatch forms a wobble base pair with a corresponding nucleobase on the target nucleic acid. For example, in certain embodiments, the mismatch forms a wobble base pair selected from hypoxanthine (nucleobase of inosine) and uracil (I:U base pair); guanine and uracil (G:U base pair); hypoxanthine and adenine (I:A base pair); and hypoxanthine and cytosine (I:C base pair). Accordingly, in certain embodiments, a mismatched nucleobase on an oligonucleotide comprises hypoxanthine, guanine, or uracil.
[0280] In certain embodiments, oligonucleotides described herein may be complementary to a portion of a nucleic acid. As used herein, portion refers to a defined number of contiguous nucleobases within a region of a nucleic acid. A portion can also refer to a defined number of contiguous nucleobases of an oligonucleotide. In certain embodiments, the oligonucleotides are complementary to at least an 8-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 9-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 10-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least an 11-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 12-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 13-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 14-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 15-nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 16-nucleobase portion of a nucleic acid. Also contemplated are oligonucleotides that are complementary to at least a 9, 10, 17, 18, 19, 20, 21, 22, 23 or more nucleobase portion of a nucleic acid, or a range defined by any two of these values. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion of a sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide.
Identity
[0281] The oligonucleotides provided herein may also have a defined percent identity to a particular nucleic acid, target region, oligonucleotide, or specified portion thereof. As used herein, an oligonucleotide is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, a DNA which contains thymidine in place of uracil in a disclosed RNA sequence would be considered identical to the RNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. In certain embodiments, oligonucleotides described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the nucleic acids, oligonucleotides, or a portion thereof, disclosed herein. In certain embodiments, oligonucleotides described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleic acid or oligonucleotide, or portion thereof.
[0282] In certain embodiments, an oligonucleotide may have one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3-end of the oligonucleotide. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Pharmaceutical Compositions and Formulations
[0283] Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compounds comprise or consist of one or more modified oligonucleotides. In certain such embodiments, the pharmaceutical composition comprises one or more compound and a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises one or more compound and a sterile saline solution. In certain embodiments, such pharmaceutical composition consists of one compound and a sterile saline solution. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
[0284] A compound described herein targeted to CFB can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to CFB and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide provided herein.
[0285] Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
[0286] It is understood that the examples and embodiments described herein are for illustrative purposes and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
Additional Embodiments
[0287] Certain embodiments include embodiment 1 to embodiment 97 following.
[0288] Embodiment 1. A compound comprising a modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 11-44 or 96-102.
[0289] Embodiment 2. A compound comprising a modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-44 or 96-102.
[0290] Embodiment 3. A compound comprising a modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-44 and 96-102.
[0291] Embodiment 4. The compound of any one of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 85%, at least 90%, or at least 95% complementary to the nucleobase sequence of SEQ ID NO: 1 or 3.
[0292] Embodiment 5. The compound of any one of embodiments 1-4, wherein the modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase.
[0293] Embodiment 6. The compound of any one of embodiments 1-5, wherein the compound is double-stranded.
[0294] Embodiment 7. A compound comprising a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0295] Embodiment 8. A compound comprising a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0296] Embodiment 9. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from the nucleobase sequences of any one of SEQ ID NOs: 11-110 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.
[0297] Embodiment 10. The compound of any one of embodiments 7-9, wherein the nucleobase sequence of the first modified oligonucleotide has at least 80%, at least 85%, at least 90%, or at least 95% complementarity or identity to the nucleobase sequence of SEQ ID NO: 1 or 3 over its length.
[0298] Embodiment 11. The compound of any one of embodiments 7-10, wherein the nucleobase sequence of the first modified oligonucleotide has at least 1, at least 2, or at least 3 mismatches to a region of the nucleobase sequence of SEQ ID NO: 1 or 3 that is the same length as the first modified oligonucleotide.
[0299] Embodiment 12. The compound of any one of embodiments 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 14 to 23 linked nucleosides in length.
[0300] Embodiment 13. The compound of any one of embodiments 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 19 to 23 linked nucleosides in length.
[0301] Embodiment 14. The compound of any one of embodiments 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 21 to 23 linked nucleosides in length.
[0302] Embodiment 15. The compound of any one of embodiments 7-11, wherein the first modified oligonucleotide is fully complementary to the second modified oligonucleotide.
[0303] Embodiment 16. The compound of any one of embodiments 7-15, wherein the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase.
[0304] Embodiment 17. The compound of any one of embodiments 7-16, wherein the second modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase.
[0305] Embodiment 18. The compound of any one of embodiments 5, 16 or 17, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage.
[0306] Embodiment 19. The compound of embodiment 18, wherein the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3 terminus of the first or second modified oligonucleotide or at the 5 terminus of the first modified oligonucleotide.
[0307] Embodiment 20. The compound of any one of embodiments 5, 16 or 17, wherein the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar.
[0308] Embodiment 21. The compound of embodiment 20, wherein the modified sugar comprises a 2-F modification.
[0309] Embodiment 22. The compound of embodiment 20, wherein the modified sugar comprises a 2-OMe modification.
[0310] Embodiment 23. The compound of any one of embodiments 7-15, wherein each nucleoside of the first modified oligonucleotide comprises a modified sugar.
[0311] Embodiment 24. The compound of any one of embodiments 7-15, wherein each nucleoside of the second modified oligonucleotide comprises a modified sugar.
[0312] Embodiment 25. The compound of embodiment 23 or 24, wherein the modified sugar comprises a modification selected from a halogen, an alkoxy group and a bicyclic sugar or a combination thereof.
[0313] Embodiment 26. The compound of embodiment 25, wherein the modified sugar comprises a modification selected from LNA, cEt, 2-MOE, 2-F, 2-OMe, and 2-deoxy, or a combination thereof.
[0314] Embodiment 27. The compound of embodiment 23, wherein the first modified oligonucleotide comprises no more than ten 2-F sugar modifications.
[0315] Embodiment 28. The compound of embodiment 24, wherein the second modified oligonucleotide comprises no more than five 2-F sugar modifications.
[0316] Embodiment 29. The compound of any one of the preceding embodiments, comprising a conjugate group.
[0317] Embodiment 30. The compound of embodiment 29, wherein the conjugate group is attached to the 5 end of the modified oligonucleotide.
[0318] Embodiment 31. The compound of embodiment 29 or 30, wherein the conjugate group comprises a targeting moiety.
[0319] Embodiment 32. The compound of embodiment 31, wherein the targeting moiety comprises one or more GalNAc.
[0320] Embodiment 33. The compound of embodiment 32, wherein the modified oligonucleotide is the second modified oligonucleotide.
[0321] Embodiment 34. The compound of embodiment 32 or 33, wherein the one or more GalNAc are attached to the 2 or 3 position of the ribosyl ring of the 5 nucleoside of the modified oligonucleotide.
[0322] Embodiment 35. The compound of embodiment 34, wherein the 5 nucleoside is of the following formula:
##STR00045## [0323] wherein: [0324] R.sup.9 is H, adenine, guanine, thymine, cytosine, or uracil, or adenine, guanine, thymine, cytosine, or uracil, each comprising a Protecting Group (PG), a modified nucleobase, optionally substituted alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, or a nucleobase isostere; [0325] L is a bond, a phosphodiester bond, a phosphorothioate bond, a triazole, a tetrazole, an amide, a reverse-amide, a carbamate, a carbonate, urea, alkyl, or heteroalkyl; [0326] R.sup.2 is an oligonucleotide sequence or modified oligonucleotide; [0327] Y.sub.1 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; [0328] Y.sub.2 is O, CH.sub.2, CH.sub.2O, or optionally substituted NH; [0329] Y.sub.3 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; [0330] Y.sub.4 is CO, SO.sub.2, P(O)O, CH.sub.2OC(O), CH.sub.2NHC(O), CH.sub.2NHSO.sub.2, or CH.sub.2; [0331] n.sub.2 is 0, 1, 2, 3, 4, 5, or 6; and [0332] each n.sub.1, n.sub.3, n.sub.4 and n.sub.5 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0333] Embodiment 36. The compound of embodiment 34, wherein the 5 nucleoside is selected from any one of Formulae I-VIII and XII, and wherein R is S or SH and R is the portion of the modified oligonucleotide other than the 5 nucleoside.
[0334] Embodiment 37. The compound of embodiment 34, wherein the 5 nucleoside is selected from any one of Formulae I-VIII and XII, and wherein R is O or OH and R is the portion of the modified oligonucleotide other than the 5 nucleoside.
[0335] Embodiment 38. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of SEQ ID NOs: 11-110 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide.
[0336] Embodiment 39. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of Ref ID NOs: IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide.
[0337] Embodiment 40. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of Ref ID NOs: IA0478-490, IA0840, IA0842-846, IA0852-862, IA0872-882, IA0887-890, IA1010-1012, and IA1015-1018 and a second modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of Ref ID NOs: IS0570-587, IS0969, IS0972-977, IS1023-1027, IS1029, IS1031-1037, IS1042-1046, IS1082, IS1085, IS1086, IS1091-1095, IS1108-1111, IS1236-1239, IS1242, IS1249, and IS1251-1254.
[0338] Embodiment 41. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of Ref ID NOs: IA0840, IA0842, IA0888, IA1010-1012, and IA1016 and a second modified oligonucleotide having a nucleobase sequence selected from any one of the nucleobase sequences of Ref ID NOs: IS0972, IS0974, IS1109, IS1236, IS1239, IS1242 and IS1252.
[0339] Embodiment 42. A compound of any one of embodiments 1-41, wherein the compound is in a pharmaceutically acceptable salt form.
[0340] Embodiment 43. The compound of embodiment 42, wherein the pharmaceutically acceptable salt is a sodium salt.
[0341] Embodiment 44. The compound of embodiment 42, wherein the pharmaceutically acceptable salt is a potassium salt.
[0342] Embodiment 45. A modified oligonucleotide according to the following chemical structure:
##STR00046##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0343] Embodiment 46. A modified oligonucleotide according to the following chemical structure:
##STR00047##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0344] Embodiment 47. A modified oligonucleotide according to the following chemical structure:
##STR00048##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0345] Embodiment 48. A modified oligonucleotide according to the following chemical structure:
##STR00049##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0346] Embodiment 49. A modified oligonucleotide according to the following chemical
##STR00050##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0347] Embodiment 50. A modified oligonucleotide according to the following chemical structure:
##STR00051##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0348] Embodiment 51. A modified oligonucleotide according to the following chemical structure:
##STR00052##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0349] Embodiment 52. A modified oligonucleotide according to the following chemical structure:
##STR00053##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0350] Embodiment 53. The modified oligonucleotide of any one of embodiments 45-52, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.
[0351] Embodiment 54. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00054##
or a stereoisomer thereof.
[0352] Embodiment 55. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00055##
or a stereoisomer thereof.
[0353] Embodiment 56. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00056##
or a stereoisomer thereof.
[0354] Embodiment 57. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00057##
or a stereoisomer thereof.
[0355] Embodiment 58. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00058##
or a stereoisomer thereof.
[0356] Embodiment 59. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00059##
or a stereoisomer thereof.
[0357] Embodiment 60. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00060##
or a stereoisomer thereof.
[0358] Embodiment 61. The modified oligonucleotide of embodiment 53, which is a sodium salt according to the following chemical structure:
##STR00061##
or a stereoisomer thereof.
[0359] Embodiment 62. A compound according to the following chemical structure:
##STR00062## ##STR00063##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0360] Embodiment 63. A compound according to the following chemical structure:
##STR00064## ##STR00065##
[0361] or a pharmaceutically acceptable salt or stereoisomer thereof.
[0362] Embodiment 64. A compound according to the following chemical structure:
##STR00066## ##STR00067##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0363] Embodiment 65. A compound according to the following chemical structure:
##STR00068## ##STR00069##
or a pharmaceutically acceptable salt or stereoisomer thereof.
[0364] Embodiment 66. The compound of any one of embodiments 62-65, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.
[0365] Embodiment 67. The compound of embodiment 66, which is a sodium salt according to the following chemical structure:
##STR00070## ##STR00071##
or a stereoisomer thereof.
[0366] Embodiment 68. The compound of embodiment 66, which is a sodium salt according to the following chemical structure:
##STR00072## ##STR00073##
or a stereoisomer thereof.
[0367] Embodiment 69. The compound of embodiment 66, which is a sodium salt according to the following chemical structure:
##STR00074## ##STR00075##
or a stereoisomer thereof.
[0368] Embodiment 70. The compound of embodiment 66, which is a sodium salt according to the following chemical structure:
##STR00076## ##STR00077##
or a stereoisomer thereof.
[0369] Embodiment 71. A composition comprising the compound or modified oligonucleotide of any one of embodiments 1-70 and a pharmaceutically acceptable carrier.
[0370] Embodiment 72. A composition comprising a compound or modified oligonucleotide of any one of the preceding embodiments, for use in therapy.
[0371] Embodiment 73. A method of administering the compound or modified oligonucleotide of any one of embodiments 1-70 or the composition of embodiment 71 or 72 to a subject in need thereof.
[0372] Embodiment 74. A method of treating, preventing, or ameliorating a disease, disorder, or condition associated with Complement Factor B (CFB) comprising administering to a subject in need thereof a compound or modified oligonucleotide targeted to CFB, thereby treating, preventing, or ameliorating the disease, disorder, or condition.
[0373] Embodiment 75. The method of embodiment 74, wherein the disease, disorder, or condition is a complement pathway disease.
[0374] Embodiment 76. The method of any one of embodiments 73-75, wherein administering the compound inhibits, reduces, and/or improves the disease, disorder, condition or a symptom thereof.
[0375] Embodiment 77. A method of inhibiting expression of CFB in a cell comprising contacting the cell with a compound or modified oligonucleotide targeted to CFB, thereby inhibiting expression of CFB in the cell.
[0376] Embodiment 78. The method of embodiment 77, wherein the cell is in the liver of an individual.
[0377] Embodiment 79. The method of embodiment 78, wherein the subject has, or is at risk of having, a complement pathway disease, disorder, condition or a symptom thereof.
[0378] Embodiment 80. A method of reducing or inhibiting a complement pathway disease, disorder, condition or a symptom thereof comprising administering to a subject in need thereof a compound or modified oligonucleotide targeted to CFB.
[0379] Embodiment 81. The method of embodiment 80, wherein the subject has, or is at risk of having, a complement pathway disease, disorder or condition or a symptom thereof.
[0380] Embodiment 82. The method of any one of embodiments 74-81, wherein the disease, disorder or condition is atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).
[0381] Embodiment 83. The method of any one of embodiments 74-82, wherein the disease, disorder or condition is lupus nephritis.
[0382] Embodiment 84. The method of any one of embodiments 74-83, wherein the compound is a compound targeted to CFB.
[0383] Embodiment 85. The method of any one of embodiments 74-84, wherein the compound is the compound or modified oligonucleotide of any one of embodiments 1-70 or the composition of embodiment 71 or 72.
[0384] Embodiment 86. The method of embodiment 85, wherein the compound, modified oligonucleotide, or composition is administered parenterally.
[0385] Embodiment 87. Use of a compound targeted to CFB for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB comprising administering to a subject in need thereof a compound or modified oligonucleotide targeted to CFB.
[0386] Embodiment 88. The use of embodiment 87, wherein the disease is a complement pathway disease, disorder, condition or a symptom thereof.
[0387] Embodiment 89. The use of embodiment 87 or 88, wherein the compound is a compound targeted to CFB.
[0388] Embodiment 90. The use of any one of embodiments 87-89, wherein the compound is the compound or modified oligonucleotide of any one of embodiments 1-70 or the composition of embodiment 71 or 72.
[0389] Embodiment 91. Use of a compound targeted to CFB in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with CFB.
[0390] Embodiment 92. The use of any one of embodiments 87-91, wherein the disease is a complement pathway disease, disorder or condition or a symptom thereof, atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), C3 glomerulopathy (C3G), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), diabetic nephropathy, membranous nephropathy, polycystic kidney disease, age-related macular degeneration, thrombotic microangiopathy, myasthenia gravis, ischemia, reperfusion injury, or rheumatoid arthritis (RA).
[0391] Embodiment 93. The use of any one of embodiments 87-92, wherein the disease, disorder or condition is lupus nephritis.
[0392] Embodiment 94. The use of any one of embodiments 87-93, wherein the compound is a compound targeted to CFB.
[0393] Embodiment 95. The use of any one of embodiments 87-94, wherein the compound is the compound or modified oligonucleotide of any one of embodiments 1-70 or the composition of embodiment 71 or 72.
[0394] Embodiment 96. The method or use of any one of embodiments 73-95, wherein the compound or composition is administered to the subject about once every three months to about once every year.
[0395] Embodiment 97. The method or use of any one of embodiments 73-96, wherein the compound or composition is administered to the subject about once every three months, about once every six months, or about once every year.
Examples
[0396] The following examples describe the process to identify lead compounds targeted to CFB. Certain compounds are distinguished as having high potency and tolerability.
[0397] The following examples serve only to illustrate the compounds described herein and are not intended to limit the same. The following examples and related sequence listing accompanying this filing may identify sequence as either RNA or DNA; however, as disclosed herein, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that the designation of a sequence as RNA or DNA is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2-OH for the natural 2-H of DNA) or as an RNA having a modified base (methylated uracil for natural uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to, such nucleic acids having modified nucleobases.
[0398] Each of the references recited in the present application is incorporated herein by reference in its entirety.
TABLE-US-00001 TABLE 1 Chemical Nomenclature Abbreviation Structure m 2-O-methyl sugar modification (e.g., mA, mG, mC, mU) f 2-F sugar modification (e.g., fA, fG, fC, fU) * Phosphorothioate internucleoside linkage . Phosphate internucleoside linkage dQ Inverted abasic deoxyribose H1 Formula I H2 Formula II H4 Formula III H6 Formula IV H7 Formula V H9 Formula VI Hd Formula VII HL Formula VIII Hi Formula XII
[0399] The newly designed double-stranded compounds in Tables 2 and 3 below were designed as unmodified (Table 2) and modified (Table 3) compounds. Abbreviations for chemical modifications used in Table 3 are provided in Table 1 above. IA and IS in a Ref ID NO:, identifies it as an antisense strand or sense strand of a compound, respectively. It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase even if shown in context with a modified compound. Oligomeric compounds referenced by Compound Number or Ref ID NO indicate a combination of nucleobase sequence and chemical modifications. Start site indicates the 5-most nucleotide to which the compound is targeted in the human gene sequence (opposite to the 3- most nucleoside of an antisense oligonucleotide). Stop site indicates the 3-most nucleotide to which the compound is targeted in the human gene sequence opposite to the 5-most nucleoside of an antisense oligonucleotide). Each compound listed in Tables 2 and 3 is targeted to the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_001710.6).
TABLE-US-00002 TABLE2 UnmodifiedAntisenseandSensesequencesofdouble-stranded compoundstargetingCFB Seq SEQ ID ID NO:1 NO:1 SEQ SEQ Compound Start Stop AntisenseSequence ID SenseSequence ID Number Site Site (5-3) NO: (5-3) NO: RD1705 940 960 UAUCCAUCUAGCAUCAGGUAG 11 UCUACCUGAUGCUAGAUGGAUA 45 RD1706 943 963 UCUGAUCCAUCUAICACCAGG 12 UCCUGGUGUUAGAUGGAUCAGA 46 RD1707 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAGAUGAGAAUUUGGGUUUUCU 47 RD1708 2398 2418 AGAAAACCCAAAUUCUCAUCC 14 UGGAUGAGAAUUUGGGUUUUCU 48 RD1709 2281 2301 UAGACAUCCACUAUUCCCCAG 15 UCUGGGGAAUAGUGGAUGUCUA 49 RD1710 2281 2301 UAGACAUCCACUAUUCCCCAU 16 UAUGGGGAAUAGUGGAUGUCUA 50 RD1711 2284 2304 UUGCAGACAUCCAUUACUCCC 17 UGGGAGUAAUGGAUGUCUGCAA 51 RD1712 2284 2304 UUGCAGACAUCCAUUACUCCC 17 UGGGAGUAAUGGAUGUCUACAA 52 RD1713 2284 2304 UUGCAGACAUCCAUUACUCCU 18 UAGGAGUAAUGGAUGUCUACAA 53 RD1714 241 261 UUGAUCUCUACCCUCUCCAGA 19 UUCUGGAGAGGGUAGAGAUCAA 54 RD1715 1759 1779 UCUAUCUCCAGGUUCCGCUUC 20 UGAAGCGGAACCUGGAGAUAGA 55 RD1716 2050 2070 UUGAUGUAGACCUUCUUCCGA 21 UUCGGAAGAAGGUCUACAUCAA 56 RD1725 947 967 UCUGUCUGAUCCAUCUAGCAC 22 UGUGCUAGAUGGAUCAGACAGA 57 RD1726 947 967 UCUGUCUGAUCCAUCUAGCAC 22 UGUGCUAGAUGGAUCAGAUAGA 58 RD1727 947 967 UCUGUCUGAUCCAUCUAGCAC 22 UGUGCUAGAUGGAUCAGAAAGA 59 RD1728 1988 2008 AUCCUGUGCAGGGAGCAGCUC 23 GAGCUGCUCCCUGCACAGGAU 60 RD1729 1988 2008 AUCCUGUGCAGGGAGCAGCUC 23 GAGCUGCUCCCUGCACAGAAU 61 RD1730 1988 2008 AUCCUGUGCAGGGAGCAGCUC 23 GAGCUGCUCCCUGCACAAGAU 62 RD2262 2050 2070 UUGAUGUAGACCUUCUUCCGA 21 UUCGGAAGAAGGUCUACAUCAA 56 RD2273 493 515 UGAAAGAGAUCUCAUCACUCACA 24 UGUGAGUGAUGAGAUCUCUUUCA 63 RD2275 1383 1404 UAGACAUCCAGAUAAUCCUCCC 25 UGGGAGGAUUAUCUGGAUGUCUA 64 RD2276 1452 1473 UCAUUGUCUUUCUUGGAAGCCA 26 UGGCUUCCAAGAAAGACAAUGA 65 RD2277 1759 1779 UCUAUCUCCAGGUCCCGCUUC 27 UGAAGCGGGACCUGGAGAUAGA 66 RD2278 2056 2076 UCAUUCUUGAUGUAGACCUCC 28 UGGAGGUCUACAUCAAGAAUGA 67 RD2279 923 944 UGUAGAUGUUCAUGGAGCCUGA 29 UCAGGCUCCAUGAACAUCUACA 68 RD2380 2284 2304 UUGCAGACAUCCAUUACUCCC 17 UGGGAGUAAUGGAUGUCUGCAA 51 RD2381 2282 2304 UUGCAGACAUCCAUUACUCCCCA 30 UGGGGAGUAAUGGAUGUCUGCAA 69 RD2382 2282 2304 UUGCAGACAUCCAUUACUCCCCA 30 UGGGAGUAAUGGAUGUCUGCAA 51 RD2383 2283 2304 UUGCAGACAUCCAUUACUCCCC 31 UGGGAGUAAUGGAUGUCUGCAAU 70 RD2384 2282 2304 UUGCAGACAUCCAUUACUCCCCA 30 UGGGGAGUAAUGGAUGUCUGCAAU 71 RD2385 2282 2304 UUGCAGACAUCCAUUACUCCCCA 30 UGGGAGUAAUGGAUGUCUGCAAU 70 RD2386 2281 2301 UAGACAUCCACUAUUCCCCAG 15 UCUGGGGAAUAGUGGAUGUCUA 49 RD2388 2279 2301 UAGACAUCCACUAUUCCCCAGCU 32 CUGGGGAAUAGUGGAUGUCUA 72 RD2390 2279 2301 UAGACAUCCACUAUUCCCCAGCU 32 CUGGGGAAUAGUGGAUGUCUAU 73 RD2391 2280 2301 UAGACAUCCACUAUUCCCCAGC 33 UGCUGGGGAAUAGUGGAUGUCUA 74 RD2392 2396 2418 AGAAAACCCAAAUUCUCAUCUUG 34 CAAGAUGAGAAUUUGGGUUUUCU 75 RD2393 2396 2418 AGAAAACCCAAAUUCUCAUCUGG 35 CCAGAUGAGAAUUUGGGUUUUCU 76 RD2394 2397 2418 AGAAAACCCAAAUUCUCAUCUG 36 UCAGAUGAGAAUUUGGGUUUUCU 77 RD2395 2397 2418 AGAAAACCCAAAUUCUCAUCUG 36 CAGAUGAGAAUUUGGGUUUUCU 78 RD2396 2397 2418 AGAAAACCCAAAUUCUCAUCCG 37 CGGAUGAGAAUUUGGGUUUUCU 79 RD2401 940 960 UAUCCAUCUAGCAUCAGGUAG 11 UCUACCUGAUGCUAGAUGGAUA 45 RD2402 938 960 UAUCCAUCUAGCAUCAGGUAGAU 38 UCUACCUGAUGCUAGAUGGAUA 45 RD2403 939 960 UAUCCAUCUAGCAUCAGGUAGA 39 UUCUACCUGAUGCUAGAUGGAUA 80 RD2404 939 960 UAUCCAUCUAGCAUCAGGUAGG 40 UCCUACCUGAUGCUAGAUGGAUA 81 RD2405 939 960 UAUCCAUCUAGCAUCAGGUAGA 39 UCUACCUGAUGCUAGAUGGAUA 45 RD2406 938 960 UAUCCAUCUAGCAUCAGGUAGAU 38 UCUACCUGAUGCUAGAUGGAUAU 82 RD2407 940 960 UAUCCAUCUAGCAUCAGGUAG 11 UCUACCUGAUGCUAGAUGGAUAU 82 RD2408 939 960 UAUCCAUCUAGCAUCAGGUAGA 39 UCUACCUGAUGCUAGAUGGAUAU 82 RD2409 939 960 UAUCCAUCUAGCAUCAGGUAGG 40 UCCUACCUGAUGCUAGAUGGAUAU 83 RD2501 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2502 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2503 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2504 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2505 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2506 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2507 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2508 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2509 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UAAUUUGGGUUUUCU 84 RD2512 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 UUUGGGUUUUCU 85 RD2513 2279 2301 UAGACAUCCACUAUUCCCCAGCU 32 AGCUGGGGAAUAGUGGAUGUCUAU 86 RD2518 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 AAUUUGGGUUUUCU 87 RD2519 2398 2418 AGAAAACCCAAAUUCUCAUCU 13 AUUUGGGUUUUCU 88 RD2520 2279 2301 UAGACAUCCACUAUUCCCCAGCU 32 AGCUGGGGAAUAGUGGAUGUCUA 89 RD2533 2396 2418 AGAAAACCCAAAUUCUCAUCUUG 34 AAGAUGAGAAUUUGGGUUUUCU 90 RD2534 2282 2304 UUGCAGACAUCCAUUACUCCCCA 30 UGGGAGUAAUGGAUGUUUGCAA 91 RD2557 1316 1338 UCAUCAAUGACAGUAAUUGGGUC 41 CCCAAUUACUGUCAUUGAUGA 92 RD2558 1430 1452 AAAGCAUUGAUGUUCACUUGGUU 42 CCAAGUGAACAUCAAUGCUUU 93 RD2559 1667 1689 ACAAAGUACUCAGACACCACACG 43 UGUGGUGUCUGAGUACUUUGU 94 RD2560 2249 2271 UCAACUUGAAUGAAACGACUUCU 44 AAGUCGUUUCAUUCAAGUUGA 95
TABLE-US-00003 TABLE3 ModifiedAntisenseandSensesequencesofdouble-strandedcompoundstargetingCFB SEQ Com- RefID ID pound ModifiedStrands(5-3) NO: NO: RD1705 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU*fA*mG IA0478 11 H2.mC*mU*mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS0570 45 RD1706 mU*fC*mU.fG.mA.fU.mC.fC.mA.fU.mC.fU.mA.fl.mC.fA.mC.fC.mA*fG*mG IA0479 12 H2.mC*mC*mU.mG.mG.mU.fG.mU.fU.fA.fG.fA.mU.mG.mG.mA.mU.mC.mA.mG*mA*dQ IS0571 46 RD1707 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU*fC*mU IA0480 13 H2.mA*mG*mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS0572 47 RD1708 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU*fC*mC IA0481 14 H2.mG*mG*mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS0573 48 RD1709 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC*fA*mG IA0482 15 H2.mC*mU*mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS0574 49 RD1710 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC*fA*mU IA0483 16 H2.mA*mU*mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS0575 50 RD1711 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC*fC*mC IA0484 17 H2.mG*mG*mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA*mA*dQ IS0576 51 RD1712 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC*fC*mC IA0484 17 H2.mG*mG*mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mA.mC.mA*mA*dQ IS0577 52 RD1713 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC*fC*mU IA0485 18 H2.mA*mG*mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mA.mC.mA*mA*dQ IS0578 53 RD1714 mU*fU*mG.fA.mU.fC.mU.fC.mU.fA.mC.fC.mC.fU.mC.fU.mC.fC.mA*fG*mA IA0486 19 H2.mU*mC*mU.mG.mG.mA.fG.mA.fG.fG.fG.fU.mA.mG.mA.mG.mA.mU.mC.mA*mA*dQ IS0579 54 RD1715 mU*fC*mU.fA.mU.fC.mU.fC.mC.fA.mG.fG.mU.fU.mC.fC.mG.fC.mU*fU*mC IA0487 20 H2.mG*mA*mA.mG.mC.mG.fG.mA.fA.fC.fC.fU.mG.mG.mA.mG.mA.mU.mA.mG*mA*dQ IS0580 55 RD1716 mU*fU*mG.fA.mU.fG.mU.fA.mG.fA.mC.fC.mU.fU.mC.fU.mU.fC.mC*fG*mA IA0488 21 H2.mU*mC*mG.mG.mA.mA.fG.mA.fA.fG.fG.fU.mC.mU.mA.mC.mA.mU.mC.mA*mA*dQ IS0581 56 RD1725 mU*fC*mU.fG.mU.fC.mU.fG.mA.fU.mC.fC.mA.fU.mC.fU.mA.fG.mC*fA*mC IA0489 22 H2.mG*mU*mG.mC.mU.mA.fG.mA.fU.fG.fG.fA.mU.mC.mA.mG.mA.mC.mA.mG*mA*dQ IS0582 57 RD1726 mU*fC*mU.fG.mU.fC.mU.fG.mA.fU.mC.fC.mA.fU.mC.fU.mA.fG.mC*fA*mC IA0489 22 H2.mG*mU*mG.mC.mU.mA.fG.mA.fU.fG.fG.fA.mU.mC.mA.mG.mA.mU.mA.mG*mA*dQ IS0583 58 RD1727 mU*fC*mU.fG.mU.fC.mU.fG.mA.fU.mC.fC.mA.fU.mC.fU.mA.fG.mC*fA*mC IA0489 22 H2.mG*mU*mG.mC.mU.mA.fG.mA.fU.fG.fG.fA.mU.mC.mA.mG.mA.mA.mA.mG*mA*dQ IS0584 59 RD1728 mA*fU*mC.fC.mU.fG.mU.fG.mC.fA.mG.fG.mG.fA.mG.fC.mA.fG.mC*fU*mC IA0490 23 mG*mA*mG.mC.mU.mG.fC.mU.fC.fC.fC.fU.mG.mC.mA.mC.mA.mG.mG.mA*mU*dQ IS0585 60 RD1729 mA*fU*mC.fC.mU.fG.mU.fG.mC.fA.mG.fG.mG.fA.mG.fC.mA.fG.mC*fU*mC IA0490 23 mG*mA*mG.mC.mU.mG.fC.mU.fC.fC.fC.fU.mG.mC.mA.mC.mA.mG.mA.mA*mU*dQ IS0586 61 RD1730 mA*fU*mC.fC.mU.fG.mU.fG.mC.fA.mG.fG.mG.fA.mG.fC.mA.fG.mC*fU*mC IA0490 23 mG*mA*mG.mC.mU.mG.fC.mU.fC.fC.fC.fU.mG.mC.mA.mC.mA.mA.mG.mA*mU*dQ IS0587 62 RD2262 mU*fU*mG.fA.mU.fG.mU.fA.mG.fA.mC.fC.mU.fU.mC.fU.mU.fC.mC*fG*mA IA0488 21 H4.mU*mC*mG.mG.mA.mA.fG.mA.fA.fG.fG.fU.mC.mU.mA.mC.mA.mU.mC.mA*mA*dQ IS0969 56 RD2273 mU*fG*mA.fA.mA.fG.mA.fG.mA.fU.mC.fU.mC.fA.mU.fC.mA.fC.mU.fC.mA*fC*mA IA0840 24 H4.mG*mU*mG.mA.mG.mU.mG.fA.mU.fG.fA.fG.fA.mU.mC.mU.mC.mU.mU.mU.mC*mA*dQ IS0972 63 RD2275 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fC*mC*mC IA0842 25 H4.mG*mG*mG.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS0974 64 RD2276 mU*fC*mA.fU.mU.fG.mU.fC.mU.fU.mU.fC.mU.fU.mG.fG.mA.fA.mG.fC*mC*mA IA0843 26 H4.mG*mG*mC.mU.mU.mC.fC.mA.fA.fG.fA.fA.mA.mG.mA.mC.mA.mA.mU.mG*mA*dQ IS0975 65 RD2277 mU*fC*mU.fA.mU.fC.mU.fC.mC.fA.mG.fG.mU.fC.mC.fC.mG.fC.mU*fU*mC IA0844 27 H4.mG*mA*mA.mG.mC.mG.fG.mG.fA.fC.fC.fU.mG.mG.mA.mG.mA.mU.mA.mG*mA*dQ IS0976 66 RD2278 mU*fC*mA.fU.mU.fC.mU.fU.mG.fA.mU.fG.mU.fA.mG.fA.mC.fC.mU*fC*mC IA0845 28 H4.mG*mG*mA.mG.mG.mU.fC.mU.fA.fC.fA.fU.mC.mA.mA.mG.mA.mA.mU.mG*mA*dQ IS0977 67 RD2279 mU*fG*mU.fA.mG.fA.mU.fG.mU.fU.mC.fA.mU.fG.mG.fA.mG.fC.mC.fU*mG*mA IA0846 29 H4.mC*mA*mG.mG.mC.mU.fC.mC.fA.fU.fG.fA.mA.mC.mA.mU.mC.mU.mA.mC*mA*dQ IS0973 68 RD2380 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC*fC*mC IA0484 17 H4*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA*mA*dQ IS1023 51 RD2381 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC.mC*mC*mA IA0852 30 H4*mG*mG.mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA*mA*dQ IS1024 69 RD2382 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC.mC*mC*mA IA0852 30 H4*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA*mA*dQ IS1023 51 RD2383 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC*mC*mC IA0853 31 H4*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA.mA*mU*dQ IS1025 70 RD2384 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC.mC*mC*mA IA0852 30 H4.mG*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA.mA*mU*dQ IS1026 71 RD2385 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC.mC*mC*mA IA0852 30 H4*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mC.mU.mG.mC.mA.mA*mU*dQ IS1025 70 RD2386 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC*fA*mG IA0482 15 H4*mC*mU.mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1027 49 RD2388 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC.fA.mG*mC*mU IA0854 32 H9*mU*mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1029 72 RD2390 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC.fA.mG*mC*mU IA0854 32 H9*mU*mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU.mA*mU*dQ IS1031 73 RD2391 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC.fA*mG*mC IA0855 33 H4*mG*mC.mU.mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1032 74 RD2392 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC.mU*mU*mG IA0856 34 H9*mA*mA.mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1033 75 RD2393 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC.mU*mG*mG IA0857 35 H9*mC*mA.mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1034 76 RD2394 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC*mU*mG IA0858 36 H4*mC*mA.mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1035 77 RD2395 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC*mU*mG IA0858 36 H9*mA*mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1036 78 RD2396 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC*mC*mG IA0859 37 H9*mG*mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1037 79 RD2401 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU*fA*mG IA0478 11 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS1042 45 RD2402 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA.mG*mA*mU IA0860 38 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS1042 45 RD2403 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA*mG*mA IA0861 39 H4*mU*mC.mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS1043 80 RD2404 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA*mG*mG IA0862 40 H4*mC*mC.mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS1044 81 RD2405 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA*mG*mA IA0861 39 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU*mA*dQ IS1042 45 RD2406 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA.mG*mA*mU IA0860 38 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU.mA*mU*dQ IS1045 82 RD2407 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU*fA*mG IA0478 11 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU.mA*mU*dQ IS1045 82 RD2408 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA*mG*mA IA0861 39 H4*mC*mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU.mA*mU*dQ IS1045 82 RD2409 mU*fA*mU.fC.mC.fA.mU.fC.mU.fA.mG.fC.mA.fU.mC.fA.mG.fG.mU.fA*mG*mG IA0862 40 H4*mC*mC.mU.mA.mC.mC.mU.fG.mA.fU.fG.fC.fU.mA.mG.mA.mU.mG.mG.mA.mU.mA*mU*dQ IS1046 83 RD2501 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU*fC*mU IA0480 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2502 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA*mU*fC*mU IA0872 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2503 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC*fA*mU*fC*mU IA0873 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2504 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU*mC*fA*mU*fC*mU IA0874 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2505 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC*fU*mC*fA*mU*fC*mU IA0875 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2506 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU*mC*fU*mC*fA.mU*fC*mU IA0876 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2507 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU*mC.fU*mC.fA*mU*fC*mU IA0877 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2508 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC*fU.mC*fA.mU*fC*mU IA0878 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2509 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC*fA*mUamC*mU IA0879 13 H2*mA*fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1082 84 RD2512 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA*fA*mU*fU*mC*fU*mC*fA*mU*fC*mU IA0882 13 H2*fU*fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1085 85 RD2513 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC.fA.mG*mC*mU IA0854 32 Hd*mG*mC.mU.mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU.mA*mU*dQ IS1086 86 RD2518 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU*fU*mC*fU*mC*fA*mU*fC*mU IA0880 13 Hd*A*fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1091 87 RD2519 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA*mU*fU*mC*fU*mC*fA*mU*fC*mU IA0881 13 Hd*fU*fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1092 88 RD2520 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mC.fU.mA.fU.mU.fC.mC.fC.mC.fA.mG*mC*mU IA0854 32 Hd*mG*mC.mU.mG.mG.mG.mG.fA.mA.fU.fA.fG.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1093 89 RD2533 mA*fG*mA.fA.mA.fA.mC.fC.mC.fA.mA.fA.mU.fU.mC.fU.mC.fA.mU.fC.mU*mU*mG IA0856 34 Hd*mA*mG.mA.mU.mG.mA.fG.mA.fA.fU.fU.fU.mG.mG.mG.mU.mU.mU.mU.mC*mU*dQ IS1094 90 RD2534 mU*fU*mG.fC.mA.fG.mA.fC.mA.fU.mC.fC.mA.fU.mU.fA.mC.fU.mC.fC.mC*mC*mA IA0852 30 H2*mG*mG.mG.mA.mG.mU.fA.mA.fU.fG.fG.fA.mU.mG.mU.mU.mU.mG.mC.mA*mA*dQ IS1095 91 RD2557 mU*fC*mA.fU.mC.fA.mA.fU.mG.fA.mC.fA.mG.fU.mA.fA.mU.fU.mG.fG.mG*mU*mC IA0887 41 H7*mC*mC.mA.mA.mU.fU.mA.fC.fU.fG.fU.mC.mA.mU.mU.mG.mA.mU.mG*mA*dQ IS1108 92 RD2558 mA*fA*mA.fG.mC.fA.mU.fU.mG.fA.mU.fG.mU.fU.mC.fA.mC.fU.mU.fG.mG*mU*mU IA0888 42 H7*mC*mA.mA.mG.mU.fG.mA.fA.fC.fA.fU.mC.mA.mA.mU.mG.mC.mU.mU*mU*dQ IS1109 93 RD2559 mA*fC*mA.fA.mA.fG.mU.fA.mC.fU.mC.fA.mG.fA.mC.fA.mC.fC.mA.fC.mA*mC*mG IA0889 43 H2*mG*mU.mG.mG.mU.fG.mU.fC.fU.fG.fA.mG.mU.mA.mC.mU.mU.mU.mG*mU*dQ IS1110 94 RD2560 mU*fC*mA.fA.mC.fU.mU.fG.mA.fA.mU.fG.mA.fA.mA.fC.mG.fA.mC.fU.mU*mC*mU IA0890 44 Hd*mA*mG.mU.mC.mG.fU.mU.fU.fC.fA.fU.mU.mC.mA.mA.mG.mU.mU.mG*mA*dQ IS1111 95
Example 1: Inhibition of CFB in HepG2 Cells
[0400] HepG2 cells (ATCC Cat #HB-8065) or Hepa 1-6 cells (ATCC CRL-1830) were seeded in antibiotic-free media at 10,000 cells/well in a 96-well plate. The following day, test CFB compound was diluted to 1.0 M (stock solution is 10 M). Transfection mixes were prepared according to instructions for Dharmafect 4 transfection reagent (Dharmacon Cat #T-2004-0). Prepared transfection mixtures were incubated at room temperature for 20 minutes. During this incubation, the medium was replaced in the 96-well plates with 80 l of antibiotic-free medium. 20 l of the transfection mixture was then added to each well for a final concentration between 10 nM and 1 nM (tested in triplicate). CFB siRNA SMARTpool (Dharmacon Cat #L-005792-00-0005, 042586-00-0005) or Silencer Thermo Fisher (ID1966 or s533333) were used as a positive control. The cells were then incubated at 37 C. in 5% CO.sub.2 for 24 hours.
[0401] Cell lysis was performed according to the Cells-To-CT 1 Step TaqMan Kit instructions. Following cell lysis, the 96-well plate was placed on ice while the qRT-PCR reaction was prepared. 2 l of cell lysate was added to the reaction mixture containing 5 l TaqMan 1-Step qRT-PCR Mix, 1 l CFB(FAM) TaqMan Gene Expression Assay (Hs00156060_ml or Mm00433909_ml), 1 l GAPDH(VIC) TaqMan Gene Expression Assay (Hs02786624_gl or Mm99999915_g1) and 11 l RT-PCR grade nuclease-free water in a MicroAmp Optical 96-well plate (0.2 mL). qPCR was performed using a QuantStudio3 qPCR machine with the following cycles: 50 C. for 1 minute, 95 C. for 20 seconds and 40 cycles at 95 C. for 15 seconds and 60 C. for 1 minute. Results are presented in the tables below as percent inhibition of CFB, relative to untreated control cells (Table 4).
TABLE-US-00004 TABLE 4 Inhibition of CFB mRNA by double-stranded compounds targeting SEQ ID NO: 1 Compound % Number Inhibition RD1709 77 RD1710 83 RD1711 86 RD1712 87 RD1713 85 RD1714 65 RD1715 84 RD1716 80 RD1725 74 RD1726 61 RD1727 80 RD1728 62 RD1729 61 RD1730 51
Example 2: Effect of Compounds Targeting Human CFB in Mouse
[0402] Compounds RD1706, RD1707, RD1727, RD1708, RD1705, and RD1726 as modified in Table 3 were evaluated in C57Bl/6 mice. Prior to the study the mice were kept in a vivarium under IACUC approved housing. Mice were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the mice were observed daily for signs of illness or distress. Animals were bled on day 0 and 8, 15, 22, 29, and 35.
[0403] Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of mice (C57Bl/6). Following serum collection, the serum was diluted in 1 PBS buffer and mixed with SDS-PAGE compatible loading buffer and a reducing reagent. Samples were heated to 70 C. for ten minutes and resolved by SDS-PAGE. Following the migration of the samples by PAGE, the proteins were transferred to nitrocellulose or other compatible membrane. The membranes were stained with Revert 700 and total protein for each sample was quantified using an Odyssey CLx detection system.
[0404] The membranes were blocked with Intercept blocking buffer (P/N: 927-60001) and then probed with a primary antibody specific to CFB (Invitrogen #27924). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001. After incubating the membrane with the primary antibody, the membrane was washed and then probed with a secondary antibody (IgG P/N: 926-32211). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001). The membranes were then analyzed on an Odyssey CLx detection system to determine the levels of CFB in each sample. The data for each sample was normalized to the total protein loaded into each lane and the CFB levels were quantified using Image Studio Lite. CFB inhibition data in Table 5 are expressed as percent change from the predose level.
TABLE-US-00005 TABLE 5 Average CFB Inhibition Days Compound 8 15 22 29 35 RD1706 76 67 54 25 27 RD1707 68 59 46 31 30 RD1727 50 46 32 32 46 RD1708 83 81 78 62 39 RD1705 74 68 58 44 41 RD1726 70 64 54 39 37
Example 3: Effect of Compounds Targeting Human CFB in Mouse
[0405] Compounds RD2401, RD2402, RD2403, RD2404, RD2405, RD2406, RD2407, RD2408, and RD2409 as modified in Table 3 were evaluated in C57Bl/6 mice. Prior to the study the mice were kept in a vivarium under IACUC approved housing. Mice were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the mice were observed daily for signs of illness or distress. Animals were bled on day 0, 8, 15, 22, 29 and 36. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of mice (C57Bl/6) as described in Example 2. CFB inhibition data in Table 6 are expressed as percent change from the predose level.
TABLE-US-00006 TABLE 6 Average CFB Inhibition Days Compound 8 15 22 29 36 RD2401 75 73 91 70 67 RD2402 73 70 87 59 51 RD2403 78 66 86 60 57 RD2404 70 61 69 51 52 RD2405 71 62 84 50 49 RD2406 73 64 84 56 51 RD2407 73 70 88 52 51 RD2408 73 71 86 57 55 RD2409 68 54 60 49 46
Example 4: Effect of Compounds Targeting Human CFB in Mouse
[0406] Compounds RD2392, RD2393, RD2394, RD2395, and RD2396 as modified in Table 3 were evaluated in C57Bl/6 mice. Prior to the study the mice were kept in a vivarium under IACUC approved housing. Mice were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the mice were observed daily for signs of illness or distress. Animals were bled on day 0 and 7, 14, 21, 28, and 35. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of mice (C57Bl/6) as described in Example 2. CFB inhibition data in Table 7 are expressed as percent change from the predose level.
TABLE-US-00007 TABLE 7 Average CFB Inhibition Days Compound 7 14 21 28 35 RD2392 70 81 64 52 19 RD2393 78 84 72 68 53 RD2394 77 81 53 58 37 RD2395 71 82 45 58 33 RD2396 71 75 63 60 29
Example 5: Effect of Compounds Targeting Human CFB in Mouse
[0407] Compounds RD1701, RD2501, RD2502, RD2503, RD2504, RD2505, RD2506, RD2507, RD2508, RD2509, RD2512, RD2518, and RD2519 as modified in Table 3 were evaluated in C57Bl/6 mice. Prior to the study the mice were kept in a vivarium under IACUC approved housing. Mice were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the mice were observed daily for signs of illness or distress. Animals were bled on day 0, 7, 15, 22, 28 and 35. Day 7, 15 and 22 data are shown below. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of mice (C57Bl/6) as described in Example 2. CFB inhibition data in Table 8 are expressed as percent change from the predose level.
TABLE-US-00008 TABLE 8 Average CFB Inhibition Days Compound 7 15 22 RD1701 30 37 36 RD2501 2 3 10 RD2502 23 0 16 RD2503 32 14 6 RD2504 28 6 26 RD2505 38 18 24 RD2506 28 10 17 RD2507 55 25 28 RD2508 47 20 3 RD2509 14 0 0 RD2512 3 3 0 RD2518 29 15 5 RD2519 18 17 11
Example 6: Effect of Compounds Targeting Human CFB in Rat
[0408] Compounds RD1709, RD1710, RD1711, RD1712, and RD1713 as modified in Table 3 were evaluated in Sprague-Dawley or Lewis rats. Prior to the study the rats were kept in a vivarium under IACUC approved housing. Rats were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the rats were observed daily for signs of illness or distress. Animals were bled on day 0 and 8, 15, 22, 29, and 36. Day 8, 15 and 22 data are shown below.
[0409] Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of rats (Sprague-Dawley and Lewis). Following serum collection, the serum was diluted in 1PBS buffer and mixed with SDS-PAGE compatible loading buffer and a reducing reagent. Samples were heated to 70 C. for ten minutes and resolved by SDS-PAGE. Following the migration of the samples by PAGE, the proteins were transferred to nitrocellulose or other compatible membrane. The membranes were stained with Revert 700 and total protein for each sample was quantified using an Odyssey CLx detection system.
[0410] The membranes were blocked with Intercept blocking buffer (P/N: 927-60001) and then probed with a primary antibody specific to CFB (Invitrogen #27924). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001). After incubating the membrane with the primary antibody, the membrane was washed and then probed with a secondary antibody (IgG P/N: 926-32211). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001=. The membranes were then analyzed on an Odyssey CLx detection system to determine the levels of CFB in each sample. The data for each sample was normalized to the total protein loaded into each lane and the CFB levels were quantified using Image Studio Lite. CFB inhibition data in Table 9 are expressed as percent change from the predose level.
TABLE-US-00009 TABLE 9 Average CFB Inhibition Days Compound 8 15 22 RD1709 75 71 51 RD1710 79 75 55 RD1711 64 65 58 RD1712 71 72 58 RD1713 67 62 51
Example 7: Effect of Compounds Targeting Human CFB in Rat
[0411] Compounds RD1709, RD1710, RD1711, and RD1712 as modified in Table 3 were evaluated in Sprague-Dawley or Lewis rats. Prior to the study the rats were kept in a vivarium under IACUC approved housing. Rats were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the rats were observed daily for signs of illness or distress. Animals were bled on day 0 and 12. Data for day 12 is presented below. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of rats (Sprague-Dawley and Lewis) as described in Example 6. CFB inhibition data in Table 10 are expressed as percent change from the predose level.
TABLE-US-00010 TABLE 10 Average CFB Inhibition Days Compound 12 RD1709 71 RD1710 62 RD1711 55 RD1712 60
Example 8: Effect of Compounds Targeting Human CFB in Rat
[0412] Compounds RD2380, RD2381, RD2382, RD2383, RD2384, and RD2385 as modified in Table 3 were evaluated in Sprague-Dawley or Lewis rats. Prior to the study the rats were kept in a vivarium under IACUC approved housing. Rats were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the rats were observed daily for signs of illness or distress. Animals were bled on day 0, 4, 8, 15, 22, 29 and 36 in other groups. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of rats (Sprague-Dawley and Lewis) as described in Example 6. CFB inhibition data in Table 11 are expressed as percent change from the predose level.
TABLE-US-00011 TABLE 11 Average CFB Inhibition Days Compound 4 8 15 22 29 36 RD2380 29 50 48 45 0 0 RD2381 19 37 28 15 4 1 RD2382 38 51 38 36 4 1 RD2383 28 42 36 32 0 0 RD2384 18 27 32 19 10 6 RD2385 28 41 42 32 0 0
Example 9: Effect of Compounds Targeting Human CFB in Rat
[0413] Compounds RD1709, RD1711, RD2386, RD2388, RD2390, RD2391, RD2513, and RD2520 as modified in Table 3 were evaluated in Sprague-Dawley or Lewis rats. Prior to the study the rats were kept in a vivarium under IACUC approved housing. Rats were injected with a single 5 mg/kg subcutaneous dose of oligonucleotide on Day 0 of the study. During the study period, the rats were observed daily for signs of illness or distress. Animals were bled on day 0, 4, 8, 15, 22, 29 and 36. Immunoblotting was used to evaluate the levels of Complement Factor B (CFB) in the serum of rats (Sprague-Dawley and Lewis) as described in Example 6. CFB inhibition data in Table 12 are expressed as percent change from the predose level.
TABLE-US-00012 TABLE 12 Average CFB Inhibition Days Compound 4 8 15 22 29 36 RD1709 62 74 71 41 30 24 RD1711 46 62 65 44 31 26 RD2386 61 72 75 39 22 12 RD2388 66 82 84 55 32 31 RD2390 64 75 74 45 20 15 RD2391 53 73 71 33 13 11 RD2513 54 66 64 32 17 14 RD2520 49 65 64 35 22 15
Example 10: Effect of Compounds Targeting Human CFB in Cynomolgus Monkeys
[0414] Compounds RD2273, RD2275, RD2276, RD2277, RD2278, RD2279, RD2533, and RD2534 as modified in Table 3 were evaluated in cynomolgus monkeys. Prior to the study the monkeys were kept in quarantine during which the animals were observed daily for general health. Eight groups of 2 cynomolgus monkey each were injected with a single 6 mg/kg subcutaneous dose of oligonucleotide on Day 1 of the study. During the study period, the monkeys were observed daily for signs of illness or distress. Animals are bled on day 6 and on days 1 (prior to dosing), 8, and 15, 22, 29, 36, 43, 50, 57 and 64.
[0415] CFB levels in the serum of cynomolgus monkeys was determined using the Abcam (ab137973) ELISA kit. The Abcam antibody has <5% cross reactivity with monkey CFB. The protocol used was that described by the manufacturer. All reagents, standards and samples were prepared as instructed by the manual. The standards or samples were added to the wells and incubated at room temperature. The wells were washed, and the biotin antibody was added to each well and incubated at room temperature. Following the incubation, the wells were washed, and a streptavidin-peroxidase conjugate was added to the wells and was incubated with the samples at room temperature. Chromogen substrate was added to each well and was incubated with the samples at room temperature. The stop solution was added to each well and the plate was immediately read using a Biotek plate reader. CFB inhibition data are expressed as percent change from the predose level. Data for days 8, 15, 22, 29, 36 and 43 are provided below in Table 13.
TABLE-US-00013 TABLE 13 Average CFB Inhibition (ELISA) Days Compound 8 15 22 29 36 43 RD2273 32 49 63 65 45 44 RD2275 35 48 65 66 58 57 RD2276 25 36 54 51 52 49 RD2277 15 20 27 RD2278 8 18 25 RD2279 13 7 19 RD2533 27 44 56 46 54 40 RD2534 14 21 27
[0416] Immunoblotting was also used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys. Following serum collection, the serum was diluted in 1 PBS buffer and mixed with SDS-PAGE compatible loading buffer and a reducing reagent. Samples were heated to 70 C. for ten minutes and resolved by SDS-PAGE. Following the migration of the samples by PAGE, the proteins were transferred to nitrocellulose or other compatible membrane. The membranes were stained with Revert 700 and total protein for each sample was quantified using an Odyssey CLx detection system.
[0417] The membranes were blocked with Intercept blocking buffer (P/N: 927-60001) and then probed with a primary antibody specific to CFB (ProteinTech, catalog no. 10170-1-AP). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001). After incubating the membrane with the primary antibody, the membrane was washed and then probed with a secondary antibody (IgG P/N: 926-32211). The antibody was diluted in Intercept antibody diluent (P/N: 927-75001). The membranes were then analyzed on an Odyssey CLx detection system to determine the levels of CFB in each sample. The data for each sample was normalized to the total protein loaded into each lane and the CFB levels were quantified using Image Studio Lite. CFB inhibition data are expressed as percent change from the predose level. Data for days 8, 15, 22, 29, 36, 43, 50, 57, and 64 are provided below in Table 14. In a second set of experiments, certain animals were bled on day 6 and on days 1 (prior to dosing), 8, and 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85 and 92 for serum collection and analysis and data are provided below in Table 15.
TABLE-US-00014 TABLE 14 Average CFB Inhibition (Western) Day Day Day Day Day Day Day Day Day Compound 8 15 22 29 36 43 50 57 64 RD2273 85 91 89 87 77 65 60 49 RD2275 86 91 92 91 90 86 77 71 RD2276 45 70 79 81 77 80 80 82 80 RD2533 47 72 80 75 79 75 71 73 68 RD2277 12 36 44 34 RD2278 44 47 59 53 RD2279 18 22 25 21 RD2534 46 58 60 60
TABLE-US-00015 TABLE 15 Average CFB Inhibition (Western) Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 8 15 22 29 36 43 50 57 64 71 78 85 92 RD2273 64 84 89 89 84 73 60 50 43 17 9 2 0 RD2275 60 79 87 90 91 83 80 71 64 62 52 40 13 RD2276 44 67 80 83 80 79 78 74 67 RD2533 50 75 77 72 77 74 66 61 58
Example 11: Effect of Compounds Targeting Human CFB in Cynomolgus Monkeys
[0418] Compounds RD2557, RD2558, RD2559, and RD2560 as modified in Table 3 were evaluated in cynomolgus monkeys. Prior to the study the monkeys were kept in quarantine during which the animals were observed daily for general health. Each group of 2 cynomolgus monkey each were injected with a single 6 mg/kg subcutaneous dose of oligonucleotide on Day 1 of the study. During the study period, the monkeys were observed daily for signs of illness or distress. Animals are bled on day 6 and on days 1 (prior to dosing), 4, 8, and 15, 22, 29, 36, 43, 50, 57 and 64.
[0419] ELISA was used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. CFB inhibition data are expressed as percent change from the predose level. Data for days 8, 15, 22 and 29 are provided below in Table 16.
TABLE-US-00016 TABLE 16 Average CFB Inhibition (ELISA) Days Compound 8 15 22 29 RD2557 3 27 29 48 RD2558 46 63 63 57 RD2559 11 0 18 3 RD2560 28 44 57 44
[0420] Immunoblotting was also used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. CFB inhibition data are expressed as percent change from the predose level. Data for days 8, 15, 22, 29, 36, and 43 are provided below in Table 17. In a second set of experiments, certain animals were bled on day 6 and on days 1 (prior to dosing), 4, 8, and 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85 and 92 for serum collection and analysis and data are provided below in Table 18.
TABLE-US-00017 TABLE 17 Average CFB Inhibition (Western) Day Day Day Day Day Day Compound 8 15 22 29 36 43 RD2557 51 68 72 80 80 61 RD2558 83 92 89 88 87 81 RD2559 0 5 22 18 13 0 RD2560 55 84 89 85 84 76
TABLE-US-00018 TABLE 18 Average CFB Inhibition (Western) Day Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 4 8 15 22 29 36 43 50 57 64 71 78 85 92 RD2557 22 43 61 71 82 69 57 52 54 37 8 7 1 3 RD2558 32 75 90 88 84 77 67 44 29 20 11 0 0 0 RD2559 6 2 11 29 34 32 18 RD2560 13 51 82 87 82 82 75 80 69 67 65 72 53 67
Example 12: Effect of Compounds Targeting Human CFB in Cynomolgus Monkeys
[0421] Compounds RD1714, RD1715, and RD2262 as modified in Table 3 were evaluated in cynomolgus monkeys. Prior to the study the monkeys were kept in quarantine during which the animals were observed daily for general health. Each group of 2 cynomolgus monkey each were injected with a single 3 mg/kg or 6 mg/kg subcutaneous dose of oligonucleotide on Day 1 of the study. During the study period, the monkeys were observed daily for signs of illness or distress. Animals are bled on day 6 and on days 1 (prior to dosing), 8, 15, 22, 29, 36, 43, 50, 57 and 64. ELISA was used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. CFB inhibition data are expressed as percent change from the predose level. Immunoblotting was also used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. ELISA Data for days 8, 15, 22, 29 and 36 are provided below in Table 19.
TABLE-US-00019 TABLE 19 Average CFB Inhibition (ELISA) 6 mg/kg Days Compound 8 15 22 29 36 RD2262 18 28 33 40 40
Example 13: Effect of Compounds Targeting Human CFB in Complement Pathway Assay
[0422] The level of active C5b-9 formation to assess alternative complement pathway activity and classical complement pathway activity was determined using the Wieslab Complement Alternative Pathway assay (COMPL AP330 RUO, SVAR) and Wieslab Complement Classical Pathway assay (COMPL CL310 RUO, SVAR) according to manufacturer's instructions. Serum from monkeys dosed with RD2273, RD2275, and RD2276 from Example 10 was tested and the data from the Wieslab Complement Alternative Pathway assay are presented below in Table 20. The Wieslab Complement Classical Pathway assay showed no effect as expected. Serum from monkeys dosed with RD2558 and RD2560 from Example 11 was also tested and the data from the Wieslab Complement Alternative Pathway assay are presented below in Table 21. The Wieslab Complement Classical Pathway assay showed no effect as expected. In a separate study, serum from monkeys dosed with RD2558 and RD2560 from Example 11 was tested and the data from the Wieslab Complement Alternative Pathway assay are presented below in Table 22. The Wieslab Complement Classical Pathway assay showed no effect as expected. Serum from monkeys dosed with RD2558 and RD2560 from Example 11 was also tested in hemolysis assays to determine alternative hemolytic activity and the data is presented in Table 23.
[0423] The alternative hemolytic activity was determined as follows. NHP serum (5.6%) was added to GVB.sup.(Complement Technology, Tyler, Texas) and 5 mM EGTA with 25% rabbit erythrocytes (Er, Complement Technology, Tyler, Texas). Samples were incubated at 37 C. with intermittent shaking for 1 hour. Hemolysis was stopped by adding GVBE (Complement Technology, Tyler, Texas) at a 1:1 ratio to the samples. Samples were then centrifuged, and supernatants were transferred to a new 96-well plate. Absorbance was measured at 412 nm. Alternative hemolytic activity was measured by subtracting the OD value from the negative control sample (buffer and Er only) and normalizing each sample to the positive control sample (water and Er only). Individual timepoint samples were then normalized to their average pre-dose samples.
TABLE-US-00020 TABLE 20 % Inhibition of Alternative Pathway Day Day Day Day Day Day Day Compound 22 29 36 43 50 57 64 RD2273 88 91 88 66 49 9 3 RD2275 86 89 82 84 74 48 48 RD2276 44 53 59 55 49 46
TABLE-US-00021 TABLE 21 % Inhibition of Alternative Pathway Compound Day 8 Day 15 Day 22 Day 36 Day 43 RD2558 80 96 93 88 32 RD2560 30 72 80 64 26
TABLE-US-00022 TABLE 22 % Inhibition of Alternative Pathway Compound Day 4 Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 50 Day 57 Day 64 RD2558 14 74 94 81 88 75 22 21 19 21 RD2560 14 35 54 73 63 64 53 66 61 40
TABLE-US-00023 TABLE 23 % Inhibition of Alternative Pathway Hemolysis Compound Day 4 Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 50 Day 57 Day 64 RD2558 28 75 94 85 76 65 74 62 53 51 RD2560 14 35 54 73 63 64 53 66 61 40
Example 14: Effect of Compounds Targeting Human CFB in Cynomolgus Monkeys
[0424] Parent compound RD2558 was used as a starting point to design compounds RD2794, RD2795, and RD2796 as provided in Tables 24 and 25 below. The modified compounds provided in Table 25 are being evaluated in cynomolgus monkeys. Dosing of the monkeys will be carried out in accordance with the protocol in Example 10 with a 4 mg/kg subcutaneous dose of oligonucleotide on Day 1 of the study. ELISA will be used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. Immunoblotting will also be used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. CFB inhibition data are expressed as percent change from the predose level. Data for days 4, 8, 15, 22, 29, and 36 are provided below in Table 26. In a second set of experiments, CFB inhibition data was collected for Days 4, 8, 15, 22, 29, 36, 43, 50, 57, and 64 for RD2795 and RD2796 and additionally Days 71, 78, 85 and 96 for RD2794 as provided below in Table 27. Inhibition of Alternative Complement Pathway Activity was evaluated using the WIESLAB assay (COMPL AP330) following manufacturer recommended protocol as described above. Data is provided below in Table 28. Inhibition of Alternative Hemolysis was evaluated using 5.6% serum, 25% Er (Complement Technologies, Inc.) and Buffer GVB.sup.+MgEDTA as described above. Data is provided below in Table 29. Assays for the Classical Pathway showed no effect as expected (not shown).
TABLE-US-00024 TABLE24 UnmodifiedAntisenseandSensesequencesofdouble-stranded compoundstargetingCFB Seq SEQ ID ID NO:1 NO:1 SEQ SEQ Compound Start Stop AntisenseSequence ID SenseSequence ID Number Site Site (5-3) NO: (5-3) NO: RD2794 1430 1452 AAAGCAUUGAUGUUCACUUGGUU 42 ACCAAGUGAACAUCAAUGCUUU 103 RD2795 1432 1452 AAAGCAUUGAUGUUCACUUGG 96 CCAAGUGAACAUCAAUGCUUU 93 RD2796 1432 1452 AAAGCAUUGAUGUUCACUUGG 96 UCCAAGUGAACAUCAAUGCUUU 104
TABLE-US-00025 TABLE25 ModifiedAntisenseandSensesequencesofdouble-strandedcompoundstargetingCFB SEQ Com- RefID ID pound ModifiedStrands(5-3) NO: NO: RD2794 mA*fA*mA.fG.mC.fA.mU.fU.mG.fA.mU.fG.mU.fU.mC.fA.mC.fU.mU.fG.mG*mU*mU IA0888 42 Hd*mC*mC.mA.mA.mG.mU.fG.mA.fA.fC.fA.fU.mC.mA.mA.mU.mG.mC.mU.mU*mU*dQ IS1236 103 RD2795 mA*fA*mA.fG.mC.fA.mU.fU.mG.fA.mU.fG.mU.fU.mC.fA.mC.fU.mU*mG*mG IA1010 96 H7*mC*mA.mA.mG.mU.fG.mA.fA.fC.fA.fU.mC.mA.mA.mU.mG.mC.mU.mU*mU*dQ IS1109 93 RD2796 mA*fA*mA.fG.mC.fA.mU.fU.mG.fA.mU.fG.mU.fU.mC.fA.mC.fU.mU*mG*mG IA1010 96 H2*mC*mC.mA.mA.mG.mU.fG.mA.fA.fC.fA.fU.mC.mA.mA.mU.mG.mC.mU.mU*mU*dQ IS1237 104
TABLE-US-00026 TABLE 26 Average CFB Inhibition (Western) Day Day Day Day Day Day Compound 4 8 15 22 29 36 RD2794 31 67 87 89 89 81 RD2795 36 72 89 91 93 88 RD2796 31 70 82 82 79 65
TABLE-US-00027 TABLE 27 Average CFB Inhibition (Western) Day Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 4 8 15 22 29 36 43 50 57 64 71 78 85 96 RD2794 36 69 85 87 86 76 79 76 70 61 62 62 52 47 RD2795 36 72 89 91 93 88 86 84 76 79 RD2796 31 70 82 82 79 65 81 55 42 44
TABLE-US-00028 TABLE 28 Average Alternative Pathway Inhibition (WIESLAB COMPL AP330) Day Day Day Day Day Day Day Day Day Day Day |Day Day Day Compound 4 8 15 22 29 36 43 50 57 64 71 78 85 96 RD2794 3 15 33 32 39 17 47 29 22 7 12 6 2 0 RD2795 15 19 33 37 48 44 44 15
TABLE-US-00029 TABLE 29 Average Alternative Hemolysis Inhibition Day Day Day Day Day Day Day Day Day Day 71 78 85 Day Compound 4 8 15 22 29 36 43 50 57 64 Day Day Day 96 RD2794 10 29 46 54 48 40 42 36 34 26 27 22 12 17 RD2795 4 43 60 63 63 60 59 32 30 RD2796 14 28 28 31 20 0 0
Example 15: Effect of Compounds Targeting Human CFB in Cynomolgus Monkeys
[0425] Parent compounds RD2273, RD2275, RD2558, RD2560 and RD2276 were used as a starting point to design compounds RD2797, RD2829, RD2798, RD2801, RD2830, RD2821, RD2831, and RD2832 as provided in Tables 30 and 31 below. The modified compounds provided in Table 31 are being evaluated in cynomolgus monkeys. Dosing of the monkeys will be carried out in accordance with the protocol in Example 10 with a 4 mg/kg subcutaneous dose of oligonucleotide on Day 1 of the study. ELISA will be used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. Immunoblotting will also be used to evaluate the levels of Complement Factor B (CFB) in the serum of cynomolgus monkeys as described in Example 10. CFB inhibition data are expressed as percent change from the predose level. Data for days 8, 15, 22, and 29 are provided below in Table 32 for RD2798, RD2801, RD2821, RD2830, and RD2832. In a second set of experiments, CFB inhibition data was collected for Days 8, 15, 22, 29, 36, 43, 50, 57, and 64 for RD2821 and RD2832 and additionally Days 71, 78, and 85 for RD2798 and RD2801 and additionally Day 96 for RD2830 as provided below in Table 33. In a third set of experiments, CFB inhibition data was collected for Days 8, 15, 22, 29, 36, 43, 50, 57, 64, and 71 for RD2797, RD2829 and RD2831 as provided below in Table 34. Inhibition of Alternative Complement Pathway Activity was evaluated using the WIESLAB assay (COMPL AP330) following manufacturer recommended protocol as described above. Data is provided below in Table 35. Inhibition of Alternative Hemolysis was evaluated using 5.6% serum, 25% Er (Complement Technologies, Inc.) and Buffer GVB.sup.+MgEDTA as provided above. Data is provided below in Table 36.
TABLE-US-00030 TABLE30 UnmodifiedAntisenseandSensesequencesofdouble-stranded compoundstargetingCFB Seq SEQ ID ID NO:1 NO:1 SEQ SEQ Compound Start Stop AntisenseSequence ID SenseSequence ID Number Site Site (5-3) NO: (5-3) NO: RD2797 493 515 UGAAAGAGAUCUCAUCACUCACA 24 GUGAGUGAUGAGAUCUCUUUCA 105 RD2829 1383 1404 UAGACAUCCAGAUAAUCCUCCC 25 UGGGAGGAUUAUCUGGAUGUCUA 64 RD2798 1382 1404 UAGACAUCCAGAUAAUCCUCCCU 97 GGGAGGAUUAUCUGGAUGUCUA 106 RD2801 1384 1404 UAGACAUCCAGAUAAUCCUCC 98 UGGAGGAUUAUCUGGAUGUCUA 107 RD2821 1430 1452 AAAGCAUUGAUGUUCGCUUGGUU 99 ACCAAGCGAACAUCAAUGCUUU 108 RD2830 1383 1404 UAGACAUCCAGAUAAUCCUUCC 100 UGGAAGGAUUAUCUGGAUGUCUA 109 RD2831 2249 2271 UCAACUUGAAUGAAACGGCUUCU 101 GAAGCCGUUUCAUUCAAGUUGA 110 RD2832 1451 1473 UCAUUGUCUUUCUUGGAAGCCAA 102 UGGCUUCCAAGAAAGACAAUGA 65
TABLE-US-00031 TABLE31 ModifiedAntisenseandSensesequencesofdouble-strandedcompoundstargetingCFB SEQ Com- RefID ID pound ModifiedStrands(5-3) NO: NO: RD2797 mU*fG*mA.fA.mA.fG.mA.fG.mA.fU.mC.fU.mC.fA.mU.fC.mA.fC.mU.fC.mA*fC*mA IA0840 24 HL*mU*mG.mA.mG.mU.mG.fA.mU.fG.fA.fG.fA.mU.mC.mU.mC.mU.mU.mU.mC*mA*dQ IS1238 105 RD2829 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fC*mC*mC IA0842 25 H4*mG*mG.mG.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1251 64 RD2798 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fC.mC*mC*mU IA1011 97 HL*mG*mG.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1239 106 RD2801 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU*fC*mC IA1012 98 H4*mG*mG.mA.mG*mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1242 107 RD2821 mA*fA*mA.fG.mC.fA.mU.fU.mG.fA.mU.fG.mU.fU.mC.fG.mC.fU.mU.fG.mG*mU*mU IA1015 99 Hd*mC*mC.mA.mA.mG.mC.fG.mA.fA.fC.fA.fU.mC.mA.mA.mU.mG.mC.mU.mU*mU*dQ IS1249 108 RD2830 mU*fA*mG.fA.mC.fA.mU.fC.mC.fA.mG.fA.mU.fA.mA.fU.mC.fC.mU.fU*mC*mC IA1016 100 H4*mG*mG.mA.mA.mG.mG.mA.fU.mU.fA.fU.fC.fU.mG.mG.mA.mU.mG.mU.mC.mU*mA*dQ IS1252 109 RD2831 mU*fC*mA.fA.mC.fU.mU.fG.mA.fA.mU.fG.mA.fA.mA.fC.mG.fG.mC.fU.mU*mC*mU IA1017 101 HL*mA*mA.mG.mC.mC.mG.fU.mU.fU.fC.fA.fU.mU.mC.mA.mA.mG.mU.mU.mG*mA*dQ IS1253 110 RD2832 mU*fC*mA.fU.mU.fG.mU.fC.mU.fU.mU.fC.mU.fU.mG.fG.mA.fA.mG.fC.mC*mA*mA IA1018 102 H4*mG*mG.mC.mU.mU.mC.fC.mA.fA.fG.fA.fA.mA.mG.mA.mC.mA.mA.mU.mG*mA*dQ IS1254 65
TABLE-US-00032 TABLE 32 Average CFB Inhibition (Western) Day Day Day Day Compound 8 15 22 29 RD2798 72 82 92 81 RD2801 73 82 89 86 RD2821 68 64 62 47 RD2830 64 81 89 85 RD2832 40 48 71 60
TABLE-US-00033 TABLE 33 Average CFB Inhibition (Western) Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 8 15 22 29 36 43 50 57 64 71 78 85 96 RD2798 72 82 92 81 84 83 81 82 77 75 74 59 RD2801 73 82 89 86 87 83 77 78 76 64 55 49 RD2821 68 64 62 47 39 17 1 2 0 RD2830 70 84 90 92 92 89 90 87 83 77 78 75 76 RD2832 60 66 71 60 61 56 40 31 35
TABLE-US-00034 TABLE 34 Average CFB Inhibition (Western) Compound Day 8 Day 15 Day 22 Day 29 Day 36 Day 43 Day 50 Day 57 Day 64 Day 71 RD2797 53 73 86 90 83 84 84 76 70 65 RD2829 36 63 88 90 86 82 84 76 77 59 RD2831 52 76 70 84 82 84 85 77 82 79
TABLE-US-00035 TABLE 35 Average Alternative Pathway Inhibition (WIESLAB COMPL AP330) Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 8 15 22 29 36 43 50 57 64 71 78 85 96 RD2798 55 71 85 75 59 69 RD2801 72 81 87 85 78 84 RD2830 60 87 95 95 98 97 94 93 89 83 75 75 74
TABLE-US-00036 TABLE 36 Average Alternative Hemolysis Inhibition Day Day Day Day Day Day Day Day Day Day Day Day Day Compound 8 15 22 29 36 43 50 57 64 71 78 85 96 RD2798 42 55 57 54 48 48 53 47 RD2801 37 31 45 52 61 34 39 39 RD2821 44 0 13 0 0 0 RD2830 39 55 70 68 78 67 65 70 62 44 47 37 52 RD2832 23 18 27 21 11 18 RD2797 41 33 57 64 58 46 67 RD2829 23 25 34 41 34 29 34 RD2831 2 18 30 29 28 42 40
Example 16: Effect of Compounds Targeting Human CFB in Sprague Dawley Rats
[0426] Sprague Dawley rats (3/sex/group main (Groups 1-5), 1/sex/group toxicokinetic (groups 6-9)), 8-9 weeks of age) were administered the vehicle control (Group 1) or 30, 60, 150, or 300 mg/kg/dose RD2830 (Groups 2 and 6, 3 and 7, 4 and 8, or 5 and 9, respectively) on Day 1 and Day 21 via SC injection at a dose volume of 5 mL/kg.
[0427] Observations included cage-side observations (general signs of toxicity including fecal and urine quality), physical examination (predose), body weight (Days 1, 5, 8, 12, 15, 19, 21 (toxicokinetic) and Day 26 (main) and quantitative food consumption (weekly). Blood samples were collected for clinical chemistry, hematology and coagulation on Day 26. Termination was on Day 26. Necropsy included visual examination for external abnormalities, abdominal, thoracic, and cranial cavities abnormalities. Organ weights (heart, kidney, liver, spleen and thymus) were recorded. Histology and microscopic pathology (heart, kidney, lesions, liver, lung, lymph nodes, injection sites, skin, spleen and thymus) were conducted.
[0428] RD2830, administered as single SC doses on Days 1 and 21 at 30, 60, 150 and 300 mg/kg/dose, was considered generally tolerated by male and female rats.
TABLE-US-00037 SEQIDNO:1 1 gggaagggaatgtgaccaggtctaggtctggagtttcagc ttggacactgagccaagcag 61 acaagcaaagcaagccaggacacaccatcctgccccaggc ccagcttctctcctgccttc 121 caacgccatggggagcaatctcagcccccaactctgcctg atgccctttatcttgggcct 181 cttgtctggaggtgtgaccaccactccatggtctttggcc cggccccagggatcctgctc 241 tctggagggggtagagatcaaaggcggctccttccgactt ctccaagagggccaggcact 301 ggagtacgtgtgtccttctggcttctacccgtaccctgtg cagacacgtacctgcagatc 361 tacggggtcctggagcaccctgaagactcaagaccaaaag actgtcaggaaggcagagtg 421 cagagcaatccactgtccaagaccacacgacttcgagaac ggggaatactggccccggtc 481 tccctactacaatgtgagtgatgagatctctttccactgc tatgacggttacactctccg 541 gggctctgccaatcgcacctgccaagtgaatggccgatgg agtgggcagacagcgatctg 601 tgacaacggagcggggtactgctccaacccgggcatcccc attggcacaaggaaggtggg 661 cagccagtaccgccttgaagacagcgtcacctaccactgc agccgggggcttaccctgcg 721 tggctcccagcggcgaacgtgtcaggaaggtggctcttgg agcgggacggagccttcctg 781 ccaagactccttcatgtacgacacccctcaagaggtggcc gaagctttcctgtcttccct 841 gacagagaccatagaaggagtcgatgctgaggatgggcac ggcccaggggaacaacagaa 901 gcggaagatcgtcctggacccttcaggctccatgaacatc tacctggtgctagatggatc 961 agacagcattggggccagcaacttcacaggagccaaaaag tgtctagtcaacttaattga 1021 gaaggtggcaagttatggtgtgaagccaagatatggtcta gtgacatatgccacataccc 1081 caaaatttgggtcaaagtgtctgaagcagacagcagtaat gcagactgggtcacgaagca 1141 gctcaatgaaatcaattatgaagaccacaagttgaagtca gggactaacaccaagaaggc 1201 cctccaggcagtgtacagcatgatgagctggccagatgac gtccctcctgaaggctggaa 1261 ccgcacccgccatgtcatcatcctcatgactgatggattg cacaacatgggcggggaccc 1321 aattactgtcattgatgagatccgggacttgctatacatt ggcaaggatcgcaaaaaccc 1381 aagggaggattatctggatgtctatgtgtttggggtcggg cctttggtgaaccaagtgaa 1441 catcaatgctttggcttccaagaaagacaatgagcaacat gtgttcaaagtcaaggatat 1501 ggaaaacctggaagatgttttctaccaaatgatcgatgaa agccagtctctgagtctctg 1561 tggcatggtttgggaacacaggaagggtaccgattaccac aagcaaccatggcaggccaa 1621 gatctcagtcattcgcccttcaaagggacacgagagctgt atgggggctgtggtgtctga 1681 gtactttgtgctgacagcagcacattgtttcactgtggat gacaaggaacactcaatcaa 1741 ggtcagcgtaggaggggagaagcgggacctggagatagaa gtagtcctatttcaccccaa 1801 ctacaacattaatgggaaaaaagaagcaggaattcctgaa ttttatgactatgacgttgc 1861 cctgatcaagctcaagaataagctgaaatatggccagact atcaggcccatttgtctccc 1921 ctgcaccgagggaacaactcgagctttgaggcttcctcca actaccacttgccagcaaca 1981 aaaggaagagctgctccctgcacaggatatcaaagctctg tttgtgtctgaggaggagaa 2041 aaagctgactcggaaggaggtctacatcaagaatggggat aagaaaggcagctgtgagag 2101 agatgctcaatatgccccaggctatgacaaagtcaaggac atctcagaggtggtcacccc 2161 tcggttcctttgtactggaggagtgagtccctatgctgac cccaatacttgcagaggtga 2221 ttctggcggccccttgatagttcacaagagaagtcgtttc attcaagttggtgtaatcag 2281 ctggggagtagtggatgtctgcaaaaaccagaagcggcaa aagcaggtacctgctcacgc 2341 ccgagactttcacatcaacctctttcaagtgctgccctgg ctgaaggagaaactccaaga 2401 tgaggatttgggttttctataaggggtttcctgctggaca ggggcgtgggattgaattaa 2461 aacagctgcgacaaca
[0429] Although the disclosure has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the disclosure and by the following claims.