Variant of a BPIFB4 protein
11891421 ยท 2024-02-06
Assignee
Inventors
Cpc classification
C12N2015/8518
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C07K2319/20
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C07K14/4742
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
A61K38/1751
HUMAN NECESSITIES
A61P15/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
A61P7/02
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a variant of BPIFB4 protein (Bactericidal/Permeability Increasing protein family B, member 4) and to a polynucleotide or a vector encoding said variant of BPIFB4 protein and to their use for the treatment of pathologies involving impairment of nitric oxide signalling.
Claims
1. An isolated polynucleotide encoding a BPIFB4 protein variant consisting of the amino acid sequence of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO.
2. A vector containing an isolated polynucleotide according to claim 1, operatively linked to expression control sequences.
3. The vector according to claim 2 wherein the vector is a viral vector.
4. The vector according to claim 2 wherein the vector is a viral vector selected from AAV serotypes 1-9 vectors.
5. The vector according to claim 2 wherein the vector is an adenoviral vector.
6. A pharmaceutical composition comprising an isolated polynucleotide according to claim 1 in admixture with pharmaceutically acceptable carriers and/or excipients.
7. A pharmaceutical composition according to claim 6 which is suitable for oral, nasal, endovenous, topical, subcutaneous, intraocular or retroocular administration.
8. A pharmaceutical composition comprising a vector according to claim 2 in admixture with pharmaceutically acceptable carriers and/or excipients.
9. A pharmaceutical composition according to claim 8 which is suitable for oral, nasal, endovenous, topical, subcutaneous, intraocular or retroocular administration.
10. A method for the treatment of a pathology or clinical condition, the method comprising administering to a subject in need of said treatment a therapeutic amount of an isolated polynucleotide according to claim 1, wherein the activity of eNOS or the production of NO is increased and results in the amelioration or treatment of a pathology or clinical condition, wherein the pathology or clinical condition is selected from atherosclerosis, diabetes mellitus, dyslipidemia, metabolic syndrome, stroke, myocardial infarction, neurodegenerative diseases, multiple sclerosis, cognitive disorders, coronary spastic angina, thrombosis, pre-eclampsia, vasculites, inflammatory disorders, and venus insufficiency.
11. A method for the treatment of a pathology or clinical condition, the method comprising administering to a subject in need of said treatment a therapeutic amount of a vector according to claim 2, wherein the activity of eNOS or the production of NO is increased and results in the amelioration or treatment of a pathology or clinical condition, wherein the pathology or clinical condition is selected from atherosclerosis, diabetes mellitus, dyslipidemia, metabolic syndrome, stroke, myocardial infarction, neurodegenerative diseases, multiple sclerosis, cognitive disorders, coronary spastic angina, thrombosis, pre-eclampsia, vasculites, inflammatory disorders, and venus insufficiency.
12. The isolated polynucleotide of claim 1 wherein the polynucleotide has the sequence of SEQ ID NO:2.
13. A vector containing the isolated polynucleotide according to claim 12 operatively linked to expression control sequences.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) A first object of the present invention is a BPIFB4 protein variant, having an amino acid sequence with at least 85% homology to the amino acid sequence of SEQ ID NO: 1 and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1 (hereinafter referred to as Valine 229), a Threonine at the position corresponding to position 281 SEQ ID NO: 1 (hereinafter referred to as Threonine 281), a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 (hereinafter referred to as Phenylalanine 488) and a Threonine at position corresponding to position 494 of SEQ ID NO: 1 (hereinafter referred to as Threonine 494).
(8) Said homology is preferably of at least 90%, more preferably of at least 95%, even more preferably of at least 99%.
(9) The amino acid sequence of the BPIFB4 protein variant of the invention may differ from that of SEQ ID NO: 1 for the presence of additions, deletions or further substitutions of amino acids.
(10) However, an essential feature of the variant of the invention is that it contains the above said four amino acids. In case of homologs that differ from SEQ ID NO: 1 for deletions or additions of amino acids, the above four amino acids are present at the position that correspond to its original position in SEQ ID NO:1. In case of homologs that differ from SEQ ID NO: 1 for substitution of amino acids, the above four amino acids are present in the same position as in SEQ ID NO: 1. According to a preferred embodiment, the protein of the invention has an amino acid sequence corresponding to SEQ ID NO 1, wherein one or more amino acids at positions different from positions 229, 281, 488 and 494 of SEQ ID NO 1 have been substituted by a conserved amino acid. By conserved amino acid it is meant an amino acid with functionally physicochemical properties equivalent to those of the original amino acid.
(11) Particularly preferred proteins according to the invention have the amino acid sequence of known BPIFB4 proteins identified in Homo Sapiens (Acc. N. NP-59827.2; SEQ ID NO: 1 or Acc. N. NP-872325.2, corresponding to a longer isoform), Felis Catus (Acc N. XP003983665.1); Pan Troglodytes (Acc N XP525303); Samiri boliviensis boliviensis (Acc N XP-003932113.1); Macaca Mulatta (Acc N NP-001230192.1); Pan paniscus (Acc N. XP-003814776.1); Otolemur garnettii (Acc N. XP_003788148.1); Pongo abelii (Acc N XP-003780649.1.); Sarcophilus harrisii (Acc N. XP-003758987.1); Rattus norvegicus (Acc N. NP-001102679.2); Callithrix jacchus (Acc N. XP-003732841.1); Mus musculus (Acc N. NP-001030047.2); Bos Taurus (Acc N XP-003586861.1); Canis lupus familiaris (Acc N. XP-534383.3); Sus scrofa (Acc N. XP-003134448.3); Gallus gallus (Acc No XP-425718), Didelphis virginiana (L00100032880) or Xenopus (L00100485776), which has been modified so that it comprises a Valine at the position corresponding to position 229 of SEQ ID NO:1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at the position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at the position corresponding to position 494 of SEQ ID NO: 1.
(12) According to a particularly preferred embodiment the BPIFB4 protein variant of the invention has the sequence of SEQ ID NO:1. A protein having such sequence will be hereinafter called VTFT hBPIFB4.
(13) A second object of the present invention is a protein having a sequence which consist of the amino acid sequence of a BPIFB4 protein variant according to the invention linked to an additional amino acid sequence able to impart to the protein particularly advantageous properties. Preferably, said additional amino acid sequence is useful for identifying the BPIFB4 protein variant according to the invention or to target the BPIFB4 protein variant of the invention to a specific organ or tissue. Preferably said protein is a chimeric protein.
(14) As will be described in details in the experimental section, the present inventors have surprisingly found that the above VTFT hBPIFB4 is associated with exceptional longevity in three independent populations. The present inventors have further demonstrated that the beneficial effect of the mutant protein on life expectancy is a consequence of its ability to modulate vascular dysfunctions associated with aging. As demonstrated in the experimental section, this modulation is dependent on the presence of the specific four amino acids at positions corresponding to positions 229, 281, 488 and 494 of SEQ ID NO:1 in the VTFT hBPIFB4 of the invention.
(15) As shown in Example 3, mouse mesenteric vessels were perfused ex vivo with an empty plasmid or a plasmids encoding VTFT hBPIFB4 or proteins that differ from VTFT hBPIFB4 in that they show various substitutions at the 4 relevant amino acids: INFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 3, which differs from that of VTFT hBPIFB4 in that it contains Isoleucin and an Aspargin at positions 229 and 281, respectively, VNFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 4, which differs from that of VTFT hBPIFB4 in that it contains an Aspargin at position 281, ITFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 5, which differs from that of VTFT hBPIFB4 in that it contains Isoleucine at position 229, VTLI hBPIFB4, having the amino acid sequence of SEQ ID NO: 6, which differs from that of VTFT hBPIFB4 in that it contains an Leucin at position 488 and a Isoleucin at position 494, INLI hBPIFB4, having the amino acid sequence of SEQ ID NO: 7, which differs from that of VTFT hBPIFB4 in that it contains in that it contains Isoleucin at positions 229, Aspargin at positions 281, Leucin at position 488 and a Isoleucin at position 494. While VNFT hBPIFB4, ITFT hBPIFB4, VTLI hBPIFB4 and INLI hBPIFB4 did not show any effect on vascular function and INFT hBPIFB4 strongly inhibited any vascular function, blocking both vasoconstriction and vasodilatation, the VTFT BPIFB4 protein showed a weak effect on inhibition of vasoconstriction and a significant enhancement of vasodilatation. This effect has been demonstrated to be mediated by activation of eNOS through phosphorylation on serine 1177 and it is therefore associated to an increase in the release of NO by endothelial cells. The ability of VTFT hBPIFB4 to induce activation of eNOS has been corroborated in the cell line HEK293T (Example 5).
(16) The above data have also been further confirmed in an animal model of vascular disease linked to impaired NO production, the heterozygotic Mthfr knockout mice, wherein the transfection of VTFT hBPIFB4 protein has been shown to restore NO release and endothelium-dependent vasodilatation response (Example 4).
(17) A third object of the present invention is a fragment of the BPIFB4 protein variant of the invention having a sequence comprising the above said Valine 229, Threonine 281, Phenylalanine 488 and Threonine 494. Thanks to their biological activity, the above said BPIFB4 protein variant, protein or fragment of the invention may advantageously be used in the in the prevention, reduction of the risk of, amelioration and/or treatment of pathological conditions of the endothelium due to decreased production of NO or activity of eNOS or of pathologies or conditions where it is beneficial to increase the activity of eNOS and/or the production of NO.
(18) Thus, a fourth object of the invention is the above said BPIFB4 protein variant, protein or fragment for use in therapy.
(19) Preferably, the BPIFB4 protein variant, the protein or the fragment of the invention are for use in the prevention, reduction of the risk of, amelioration and/or treatment of an endothelial dysfunction due to release of NO from endothelial cells below the physiological levels or a decrease in the activity of eNOS or in clinical situations wherein it is beneficial to obtain an increase in the activation of eNOS and or in the production of NO. According to a preferred embodiment of the invention, said BPIFB4 protein variant, said protein or said fragment of the invention are for use in the prevention, reduction of the risk, amelioration or treatment of a pathology selected from arterial hypertension, atherosclerosis, diabetes mellitus, dyslipidemia, renal failure, metabolic syndrome, stroke, myocardial infarction, erectile dysfunction, neurodegenerative diseases, multiple sclerosis, cognitive disorders, retinal degeneration, uveoretinitis, vascular retinopathy, cataract, glaucoma, coronary spastic angina, thrombosis, pulmonary hypertension, pre-eclampsia, vasculites, cancer, inflammatory disorders, venus insufficiency, genetic diseases with reduced eNOS activity and NO production, for example MTHFR gene variations.
(20) According to an alternative preferred embodiment of the invention, said BPIFB4 protein variant is for use for the improvement of post-exercise fatigue in muscular dystrophy patients and as a co-adjuvant in the implantation of one or more stents, preferably medicated, for vascular occlusions.
(21) The BPIFB4 protein variant, the protein or the fragment according to the invention may be administered to an subject in need thereof, affected by one of the above pathologies or in the above clinical conditions, by oral, nasal, endovenous, topical-, intra- or retro-ocular administration.
(22) Accordingly, a fifth object of the invention is a pharmaceutical composition, preferably suitable for oral, nasal-, endovenous topical-, intra- or retro-ocular administration, comprising the BPIFB4 protein variant, the protein or the fragment of the invention in admixture with pharmaceutically acceptable carriers and/or excipients. Suitable formulations for the pharmaceutical composition of the invention are well known in the art and are, for example, described in Remington's Pharmaceutical Sciences Handbook, Mack Publishing Company, Easton, Pennsylvania, last or Babizhayev M A. Drug Testing and Analysis, Volume 4, Issue 6, pages 468-485, June 2012).
(23) A particularly suitable pharmaceutical formulation for the administration of the BPIFB4 protein variant, the protein or the fragment according to the invention is based on synthetic copolymers, using polyamino acidic and polysaccharidic structures, able to form reversible physical complexes with the BPIFB4 protein variant, the protein or the fragment thereof by electrostatic, hydrophobic or other physical interactions, and generate nano-aggregates from which the protein or fragment is released in intact form after administration. (Diaz-Fernandez Y A et al, Biosens Bioelectron. 2010 Sep. 15; 26(1):29-35).
(24) A sixth object of the present invention is a polynucleotide, preferably a DNA polynucleotide, coding for the amino acid sequence of the BPIFB4 protein variant, the protein or the polypeptide according to the present invention. According to a preferred embodiment, said polynucleotide has a sequence which comprises or consists in SEQ ID NO: 2 or the sequence of a fragment thereof comprising the nucleotides coding for the above said Valine 229, Threonine 281, Phenylalanine 488 and Threonine 494.
(25) The above polynucleotide may be used in order to obtain expression of the mutated protein or polypeptide in host cells either in vitro, ex vivo or in vivo by means of a suitable expression vector comprising it.
(26) Thus, a seventh object of the invention is a vector containing the above said polynucleotide of the invention operatively linked to expression control sequences.
(27) According to a preferred embodiment, the BPIFB4 protein variant, the protein or the fragment of the invention is recombinantly produced in host cells transfected with the above said vector. According to this embodiment the vector of the invention in preferably one that it is suitable for high yield production of the protein or polynucleotide. For example, the pcDNA3.3-TOPO vector can be used for high level expression of the protein of the invention in adherent mammalian tissue culture cells following transient transfection, or high level expression of secreted protein using the FreeStyle MAX CHO and FreeStyle MAX 293 systems (Invitrogen INC.)
(28) Thus, an eight object of the present invention are host cells transfected with the above said vector of the invention.
(29) An ninth object of the invention is a method of recombinantly producing the BPIFB4 protein variant, the protein or the fragment according to the invention comprising culturing the above said host cells under conditions allowing expression of the BPIFB4 protein variant, the protein or the fragment and recovering said BPIFB4 protein variant, protein or fragment.
(30) Alternatively to direct administration as such, the BPIFB4 protein variant, the protein or the fragment of the invention may be expressed in the target tissue following administration, preferably via the endovenous, subcutaneous, intraocular or retroocular route, into a subject in need thereof of a vector according to the present invention, which is suitable to induce expression in said target tissue of the mutated protein or polypeptide. The target tissue may differ depending on the pathology to be treated and may be, for example, the endothelial tissue, the tissue of the liver, heart, kidney, eye or muscle.
(31) According to this embodiment, the vector of the invention is one that is preferably suitable for transfection of the cells of the target tissue of interest following endovenous administration.
(32) According to a particularly preferred embodiment, said vector is a viral vector, preferably an Adenovirus vector, more preferably a vector selected from AAV serotypes 1-9 vectors, on the basis of specificity for the target tissue of interest (Varadi K, et al, Gene Ther. (2012); 19 (8):800-9; Zincarelli C et al, Mol Ther. (2008), 16(6): 1073-80, Diaz-Fernandez Y A et al, Oligonucleotides. 2010; 20(4): 191-8.).
(33) Thus, a tenth object of the invention is the above said polynucleotide or vector of the invention for use in therapy. Preferably, said polynucleotide or vector is for use in the prevention, reduction of the risk of, amelioration or treatment of an endothelial dysfunction due to release of NO from endothelial cells below the physiological levels or a decrease in the activity of eNOS or in conditions wherein it is beneficial to obtain an increase in the activation of eNOS and or in the production of NO. According to a preferred embodiment of the invention, said polynucleotide or vector is for use in the prevention, reduction of the risk of, amelioration or treatment of a pathology or condition selected from arterial hypertension, atherosclerosis, hypertension, diabetes mellitus, dyslipidemia, renal failure, metabolic syndrome, stroke, myocardial infarction, erectile dysfunction, neurodegenerative diseases, multiple sclerosis cognitive disorders, retinal degeneration, uveoretinitis, vascular retinopathy, cataract, glaucoma, coronary spastic angina, thrombosis, pulmonary hypertension, pre-eclampsia, vasculites, cancer, inflammatory disorders, venus insufficiency, genetic diseases with reduced eNOS activity and NO production, for example MTHFR gene variations.
(34) According to a preferred alternative preferred embodiment of the invention, said polynucleotide or vector is for use for the improvement of post-exercise fatigue in muscular dystrophy patients and as a co-adjuvant in the implantation of one or more stents, preferably medicated, for vascular occlusions.
(35) A eleventh object of the invention is a pharmaceutical composition, preferably suitable for endovenous, subcutaneous, intraocular or retroocular administration, comprising a vector according to the invention in admixture with pharmaceutically acceptable carriers and/or excipients. Suitable formulations for the pharmaceutical composition of the invention are well known in the art. As an example, polymeric-based nano-systems or polycomplex nanosystems may be used to deliver the vector of the invention (Murano E et al, Nat Prod Commun. (2011), 6(4): 555-72, Moustafine R I et al, Int J Pharm. 2012 Oct. 3).
(36) The mean daily dosage of the BPIFB4 protein variant, the protein or the fragment or vector of the invention will depend upon various factors, such as the seriousness of the disease and the conditions of the patient (age, sex and weight). The skilled man may use technical means well known in the art in order to find the correct dosage amount and regime to ensure optimal treatment in each particular pathological condition.
(37) In a further aspect of the invention, a method is provided for the treatment of an endothelial dysfunction due to release of NO from endothelial cells below physiological levels or due to a decrease in the activity of eNOS or a method for the treatment of a clinical condition wherein it is beneficial to obtain an increase in the activation of eNOS or production of NO, the method comprising administering to a subject in need of said treatment a therapeutic amount of a polynucleotide or of a viral vector containing a polynucleotide encoding a BPIFB4 protein variant having an amino acid sequence with at least 95% homology to the amino acid sequence of SEQ ID NO: 1 and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at a position corresponding to position 494 of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO, said vector operatively linked to expression control sequences, and wherein the activity of eNOS and/or the production of NO is increased and results in the amelioration or treatment of a pathology or clinical condition selected from arterial hypertension, renal failure, erectile dysfunction, retinal degeneration, uveoretinitis, vascular retinopathy, glaucoma and pulmonary hypertension.
(38) In one such aspect, the viral vector is selected from AAV serotypes 1-9 vectors.
(39) In another such aspect, the vector is an adenoviral vector.
(40) In a further particular aspect, the method comprises administering to a subject a viral vector containing a polynucleotide encoding a BPIFB4 protein variant having an amino acid sequence with at least 95% homology to the amino acid sequence of SEQ ID NO: 1 and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at a position corresponding to position 494 of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO, said vector operatively linked to expression control sequences.
(41) In another further aspect, the encoded BPIFB4 protein variant is linked to a sequence useful for targeting the BPIFB4 protein variant to a specific organ or tissue.
(42) In another further aspect, the BPIFB4 protein variant has an amino acid sequence with at least 99% homology to the amino acid sequence of SEQ ID NO: 1, the differences from the amino acid sequence of SEQ ID NO: 1 being the presence of additions, deletions or substitutions of amino acids, and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at a position corresponding to position 494 of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO.
(43) In another particular aspect, the method comprises wherein the BPIFB4 protein variant has the amino acid sequence of SEQ ID NO: 1.
(44) In another particular method aspect, the BPIFB4 protein variant has the amino acid sequence of SEQ ID NO: 1.
(45) In an aspect of the method of the invention, the BPIFB4 protein variant sequence differs from the amino acid sequence of SEQ ID NO: 1 in deletions or substitutions of amino acids.
(46) In another aspect of the method of the invention, the pathology or clinical condition is selected from vascular retinopathy, uveoretinitis and retinal degeneration.
(47) In another particular aspect of the method of the invention, the BPIFB4 protein variant sequence differs from the amino acid sequence of SEQ ID NO:1 in deletions or substitutions of amino acids.
(48) In a further aspect, a method of the invention is provided for the treatment of an endothelial dysfunction due to release of NO from endothelial cells below physiological levels or due to a decrease in the activity of eNOS or a method for the treatment of a clinical condition wherein it is beneficial to obtain an increase in the activation of eNOS or production of NO, the method comprising administering to a subject in need of said treatment a therapeutic amount of a BPIFB4 protein variant, having an amino acid sequence with at least 95% homology to the amino acid sequence of SEQ ID NO: 1, the differences from the amino acid sequence of SEQ ID NO: 1 being the presence of additions, deletions or substitutions of amino acids, and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at a position corresponding to position 494 of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO, and wherein the activity of eNOS and/or the production of NO is increased and results in the amelioration or treatment of a pathology or clinical condition selected from arterial hypertension, renal failure, erectile dysfunction, retinal degeneration, uveoretinitis, vascular retinopathy, glaucoma and pulmonary hypertension.
(49) In a particular aspect, the BPIFB4 protein variant sequence differs from the amino acid sequence of SEQ ID NO:1 in deletions or substitutions of amino acids.
(50) In another particular aspect, the BPIFB4 protein variant is linked to a sequence useful for targeting the BPIFB4 protein variant to a specific organ or tissue.
(51) In a further aspect of the method, the pathology or clinical condition is selected from vascular retinopathy, uveoretinitis and retinal degeneration.
(52) In another further aspect of the method, the BPIFB4 protein variant has an amino acid sequence with at least 99% homology to the amino acid sequence of SEQ ID NO: 1, the differences from the amino acid sequence of SEQ ID NO: 1 being the presence of additions, deletions or substitutions of amino acids, and characterised in that said sequence comprises a Valine at the position corresponding to position 229 of SEQ ID NO: 1, a Threonine at the position corresponding to position 281 SEQ ID NO: 1, a Phenylalanine at a position corresponding to position 488 of SEQ ID NO: 1 and a Threonine at a position corresponding to position 494 of SEQ ID NO: 1, said protein variant having activity in increasing the activity of eNOS and/or the production of NO.
(53) In one aspect, the BPIFB4 protein variant has the amino acid sequence of SEQ. ID No: 1.
(54) The present invention will be better illustrated by the Examples that follow, that will not be construed as being limitative of the invention.
EXAMPLES
Example 1
Identification of the VTFT hBPIFB4 Protein in Three Independent Populations
(55) A recently published Genome Wide Association Study (GWAS) conducted on a Southern Italian Centenarian (SIC) population has identified a number of genetic variants associated with long lived individuals (Malovini et al, Rejuvenation Research 2011; Vol. 14(3), pages 283-291).
(56) In order to validate the top four variations reported in that study (p<110.sup.4) a replication attempt was carried out in a first replication cohort recruited for the German Centenary Study (Keidorp et al; Aging Cell 2011; Vol 10, pages 622-8), comprising 1447 long-living individuals (LLIs) (age range of 95-110 years, mean age 98.8 years) and 1029 younger controls (age range 60-75 years and mean age 66.8 years). Thus, two non synonymous single-nucleotide polymorphisms (SNPs), rs2070325 and rs571391, and two intronic markers, rs7583529 and rs285097, which tag the functional variants rs7917 and rs1695501, have been tested by Taqman Analysis.
(57) In details, DNA was extracted from peripheral blood (QIAamp DNA blood midi kit, Qiagen) of the individuals and genotyped with TaqMan probe on ABI 7900HT Real Time PCR (Applied Biosystems). For the screening, the following probes were used: hCV25757827 for rs2070325; hCV958887 for rs571391; hCV28993331 for rs7583529; and hCV3073023 for rs285097.
(58) Data analysis was performed with Sequence Detection Systems (Applied Biosystems). The statistical methods and procedures applied to the analysis of data deriving from the genome wide scan are described in Malovini A et al., Rejuvenation Res 2011, Vol. 14, pages 283-91.
(59) Of the four variants tested, only rs2070325, which results in the amino acid change Ile229Val in BPIFB4, replicated the association observed in the SICs cohort under the recessive genetic model (OR=2.42, 95% Cl=1.56-3.77, p=5.9810-5) in this set of LLIs (OR=1.42, 95% Cl=1.12-1.80, p=5.310-3, Bonferroni adjusted p=0.021). This variant was then tested by Taqman analysis, as described above, for association in a second set, represented by a US based collection of 1461 LLIs (age range of 91-119 years, mean age 100.8) and 526 controls (age range of 0-35 years, mean age 28.2). Logistic regression confirmed the association of the above SNP also in this second replication set (OR:1.62, 95% Cl=1.15-2.27, p=3.710.sup.3).
(60) Meta-analysis of association results was performed by the meta package implemented in R (http://cran.r-project.org/web/packages/meta/index.html). Positional and functional annotation of the identified SNPs were performed by the SNPNexus on-line resource ( ).
(61) Results from meta-analysis, combining the association statistics deriving from the evaluation of this marker in the German- and US replication sets, revealed no statistically significant heterogeneity between the ORs estimated in the two populations (Q-statistic, p>0.05; heterogeneity index, I2=0%). According to these observations, association statistics were combined assuming a fixed effects model (OR=1.49; 95% Cl=1.22-1.81; p<110-4).
Example 2
Haplotype Analysis of the BPIFB4 Locus
(62) Haplotype analyses revealed patterns of strong linkage disequilibrium (LD) within the BPIFB4 genomic locus, delimiting a region that is highly enriched in non-synonymous SNPs (
(63) The three-dimensional structure of human BPIFB4 was predicted by homology modeling with the program I-TASSER, (REF: Ambrish Roy, Alper Kucukural, Yang Zhang. I-TASSER: a unified platform for automated protein structure and function prediction. Nature Protocols, vol 5, 725-738 (2010).) using as template Protein BPI from PDB (code 1 EWF) All models were considered in the visual structural analysis, performed with the program PyMOL Version 1.2r3pre, Schrdinger, LLC (Molecular Graphics System). The above analysis revealed that Ile268Val and Asn320Thr are both located in putative protein-protein interaction site. To evaluate the effects of the variations, we predicted the structure of wild-type (WT) and mutated (Ile229Val, Asn281Thr, leu488Phe, Ile494Thr) BPIFB4 proteins by homology modeling. BPIFB4 is structurally very similar to BPI and CETP, for which experimental structures are available and because of their structural similarities, we thought it reasonable to expect that BPIFB4 binds lipopolysaccharides in regions that are similar to those of the other two proteins. Our structural analysis revealed that Leu488Phe is located in a lipid-binding pocket whose size is predicted to decrease as a consequence of the mutation. The Ile494Thr mutation is located in a second lipid-binding pocket, whose hydrophobicity is decreased by the substitution. In both cases, the mutation may result in an decreased ability to bind lipids.
(64) In contrast, Ile229Val and Asn281Thr are located far from the lipid-binding sites of the structurally homologous proteins, so they probably affect functions such as interaction with other proteins, rather than lipid binding.
Example 3
Ex Vivo Vessel Reactivity to INFT hBPIFB4 and VTFT hBPIFB4
(65) To determine the role of the specific BPIFB4 variant identified on vessel function, we studied the effects of ex vivo transfection of mouse mesenteric vessels with a pRK5 vector encoding VTFT hBPIFB4 or proteins that differ from VTFT hBPIFB4 in that they show various substitutions at the 4 relevant amino acids: INFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 3, which differs from that of VTFT hBPIFB4 in that it contains Isoleucin and an Aspargin at positions 229 and 281, respectively, VNFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 4, which differs from that of VTFT hBPIFB4 in that it contains an Aspargin at position 281, ITFT hBPIFB4, having the amino acid sequence of SEQ ID NO: 5, which differs from that of VTFT hBPIFB4 in that it contains Isoleucine at position 229, VTLI hBPIFB4, having the amino acid sequence of SEQ ID NO: 6, which differs from that of VTFT hBPIFB4 in that it contains an Leucin at position 488 and a Isoleucin at position 494 and INLI hBPIFB4, having the amino acid sequence of SEQ ID NO: 7, which differs from that of VTFT hBPIFB4 in that it contains in that it contains Isoleucin at positions 229, Aspargin at positions 281, Leucin at position 488 and a Isoleucin at position 494. The sequence of the pRK5 vectors used are reported in
(66) Second-order branches of the mesenteric arterial tree of C57BL6 mice were transfected as described previously (Vecchione C et al., J Exp Med 2005; Vol. 201, pages 1217-28).
(67) Briefly, vessels (n=7) were placed in a Mulvany pressure system filled with Krebs solution to which was added 20 g of a pRK5 vector encoding either INFT or VTFT hBPIFB4. An empty plasmid was used as a negative control. Vessels were perfused at 100 mmHg for 1 hour then at 60 mmHg for 5 hours.
(68) The efficiency of transfection was evaluated by the presence of green fluorescent protein (GFP) co-expression (
(69) In details, Western blot analysis was performed on protein extracts from transfected perfused vessels (n=7 for each vector). Protein extracts were separated on 10% SDS-PAGE at 100V for 1 h or on 4-12% SDS-PAGE at 100V for 2 h and then transferred to a nitrocellulose or PVDF membrane. The membranes were incubated overnight with the following primary antibodies: anti-phospho-Ser1177 eNOS (Cell Signaling, rabbit mAb, 1:1000), anti-BPIFB4 (Abcam, rabbit polyclonal Ab, 1:200), and anti--actin (Cell Signaling, mouse mAb, 1:3000). The membranes were washed three times and then incubated for 1 or 2 h with the secondary antibody (horseradish peroxidase-linked anti-rabbit IgG or anti-mouse IgG, Amersham Life Science) at 1:3000 dilution. The membrane was then washed four times and specific protein bands were detected with ECL Prime chemiluminescent agents (Amersham Life Science). Western blot data were analyzed using ImageJ software (developed by Wayne Rasband, National Institutes of Health, USA) to determine optical density (OD) of the bands. The OD reading was normalized to -actin to account for variations in loading.
(70) As shown in
(71) In addition, vessels expressing VTFT hBPIFB4 but not INFT hBPIFB4 showed a string induction of phosphorylation of eNOS on serine 1177, an activation site of the enzyme.
(72) Vasoconstriction was assessed with KCl (80 mM) and increasing doses of phenylephrine (from 10.sup.9M to 10.sup.6M), as the percentage of lumen diameter change after drug administration. Vascular responses were tested before and after transfection. Endothelium-dependent and independent relaxations were assessed by measuring the dilatatory responses of mesenteric arteries to cumulative concentrations of acetylcholine (from 10.sup.9M to 10.sup.5M) and nitroglycerine (from 10.sup.9M to 10.sup.5M), respectively, in vessels precontracted with phenylephrine at a dose necessary to obtain a similar level of precontraction in each ring (80% of initial KCl-induced contraction). The maximal contraction evoked by phenylephrine was considered as the baseline for subsequent evoked vasorelaxations. Caution was taken to avoid endothelium damage: functional integrity was reflected by the response to acetylcholine (10.sup.6M).
(73) Overexpression of INFT hBPIFB4 almost abolished the KCl- and phenylephrine-induced vasoconstrictions that could be elicited before exposure to the plasmids (
(74) We examined the effect of L-NAME, an eNOS inhibitor, on vessels transfected with either an empty vector (
Example 4
Effect of VTFT hBPIFB4 on In Vivo Model of Vascular Disease Due to Impairment of NO Release
(75) The above described experiments were also performed on mesenteric vessels from heterozygotic mthfr mice and their control, as described in Lemarie C A et al., Am J Physiol Heart Circ Physiol 2011; Vol 300:H745-53. Mthfr+/ mice show dysfunction of eNOS which is associated with the downregulation of the longevity factor surtuin 1. Thus, we explored the effect of VTFT hBPIFB4 on the mesenteric vessels of these mice. As expected, acetylcholine-induced vasorelaxation was significantly reduced in Mthfr.sup.+/ mice compared with Mthfr.sup.+/+ littermates after exposure to EV (
Example 5
Evaluation of eNOS Modulation by BPIFB4 in Hek293T Cells
(76) Human embryonic kidney cells (HEK293T) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) fetal bovine serum and 1% non-essential amino acids at 37% in a 5% CO2 atmosphere. Cells were plated at 0.25106 per well in six-well plates, and 24 h after plating were transfected using 10 l of Lipofectamine 2000 (LifeTechnologies) and 4 g of plasmids. After 24 h, cells were serum-starved for 24 h. During serum starvation, transfected cells were treated with 400 M H.sub.2O.sub.2 for 24 h. Transcription of BPIFB4 was detected by extraction from the cells of total RNA with TRIzol (Ambion), retrotranscription (iScript BioRad). cDNA was amplified with specific primers for BPIFB4 (Fw: CTCTCCCCAAAATCCTCAACA (SEQ ID NO:8), Rev: AGCCTCTCTGGGACTGGTTC (SEQ ID NO:9)) and GAPDH (Fw: GTGAAGGTCGGAGTCAACG (SEQ ID NO:10), Rev: GGTGGAATCATATTGGAACATG (SEQ ID NO:11)).
(77) Transcription of BPIFB4 could be induced in HEK293T cells upon exposure to H.sub.2O.sub.2: this demonstrates a role of BPIFB4 in the stress response (
(78) Human embryonic kidney cells (HEK293T) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) fetal bovine serum and 1% non-essential amino acids at 37 C. in a 5% CO2 atmosphere. Cells were plated at 0.25106 per well in six-well plates, and 24 h after plating were transfected using 10 l of Lipofectamine 2000 (LifeTechnologies) and 4 g of plasmids. After 24 h, cells were serum-starved for 24 h. During serum starvation, transfected cells were treated with 400 M H2O2 for 24 h. Protein extracts were separated on 10% SDS-PAGE at 100V for 1 h or on 4-12% SDS-PAGE at 100V for 2 h and then transferred to a nitrocellulose or PVDF membrane. The membranes were incubated overnight with the following primary antibodies: anti-phospho-eNOS Ser1177 (Cell Signaling, rabbit mAb, 1:1000), and anti--actin (Cell Signaling, mouse mAb, 1:3000). The membranes were washed three times and then incubated for 1 or 2 h with the secondary antibody (Amersham Life Science horseradish peroxidase-linked anti-rabbit IgG or anti-mouse IgG, 1:3000). The membranes were then washed four times and specific protein bands were detected with ECL Prime chemiluminescent agents (Amersham Life Science). Western blot data were analyzed using ImageJ software (developed by Wayne Rasband, National Institutes of Health, USA) to determine optical density (OD) of the bands. The OD readings were normalized to -actin to account for variations in loading.
(79) As shown in