<i>Francisella </i>glycoconjugate vaccines

Abstract

The disclosure relates to a glycoconjugate vaccine conferring protection against Francisella tularensis infections and a method to manufacture a glycoconjugate antigen.

Claims

1. A vaccine or immunogenic composition, comprising: a carrier polypeptide comprising at least 95% identity over the full length of the amino acid sequence of SEQ ID NO: 3 and an O-antigen antigenic polysaccharide isolated from Francisella crosslinked to the carrier polypeptide, wherein the O-antigen antigenic polysaccharide comprises 4)--D-GalNAcAN-(1-4)--D-GalNAcAN-(1-3)--D-GlcNAc-(1-2)--D-Qui4NFm-(1-), and wherein GalNacAN is 2-acetomido-2-deoxy-O-D-galacturonamide, Qui4NFm is 4,6-dideoxy-4-formamido-D-glucose, and the reducing end group GlcNAc is N-acetyl glucosamine.

2. The vaccine or immunogenic composition according to claim 1, wherein the carrier polypeptide comprises at least 96% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

3. The vaccine or immunogenic composition according to claim 1, wherein the carrier polypeptide comprises at least 97% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

4. The vaccine or immunogenic composition according to claim 1, wherein said composition further includes an adjuvant.

5. The vaccine or immunogenic composition according to claim 4, wherein said adjuvant is an aluminium based adjuvant suitable for use in a human subject.

6. A method of preventing a Francisella infection, comprising: administering the vaccine or immunogenic composition of claim 1 to a subject, thereby preventing the Francisella infection in the subject.

7. An antigenic polypeptide, comprising: a carrier polypeptide comprising at least 95% identity over the full length amino acid sequence of SEQ ID NO: 3, and an O-antigen antigenic polysaccharide isolated from Francisella crosslinked to the carrier polypeptide; wherein the O-antigen comprises 4)--D-GalNAcAN-(1-4)--D-GalNAcAN-(1-3)--D-GlcNAc-(1-2)--D-Qui4NFm-(1-), and wherein GalNacAN is 2-acetomido-2-deoxy-O-D-galacturonamide, Qui4NFm is 4,6-dideoxy-4-formamido-D-glucose, and the reducing end group GlcNAc is N-acetyl glucosamine.

8. The antigenic polypeptide according to claim 7, wherein the carrier polypeptide comprises at least 96% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

9. A vaccine or immunogenic composition, comprising: a carrier polypeptide comprising the amino acid sequence of SEQ ID NO: 3, and an O-antigen antigenic polysaccharide isolated from Francisella and crosslinked to said carrier polypeptide, wherein the O-antigen is 4)--D-GalNAcAN-(1-4)--D-GalNAcAN-(1-3)--D-GlcNAc-(1-2)--D-Qui4NFm-(1-), wherein GalNacAN is 2-acetomido-2-deoxy-O-D-galacturonamide, Qui4NFm is 4,6-dideoxy-4-formamido-D-glucose, and the reducing end group GlcNAc is N-acetyl glucosamine.

10. The vaccine or immunogenic composition according to claim 9, wherein the composition further includes an adjuvant.

11. The vaccine or immunogenic composition according to claim 10, wherein the adjuvant is an aluminium based adjuvant suitable for use in a human subject.

12. A method of preventing a Francisella infection, comprising: administering the vaccine or immunogenic composition of claim 9 to a subject, thereby preventing the Francisella infection in the subject.

13. An antigenic polypeptide, comprising: a carrier polypeptide comprising the amino acid sequence of SEQ ID NO: 3, and an O-antigen antigenic polysaccharide isolated from Francisella and crosslinked to the carrier polypeptide, wherein the O-antigen is 4)--D-GalNAcAN-(1-4)--D-GalNAcAN-(1-3)--D-GlcNAc-(1-2)--D-Qui4NFm-(1-), wherein GalNacAN is 2-acetomido-2-deoxy-O-D-galacturonamide, Qui4NFm is 4,6-dideoxy-4-formamido-D-glucose, and the reducing end group GlcNAc is N-acetyl glucosamine.

14. The vaccine or immunogenic composition according to claim 1, wherein the carrier polypeptide comprises at least 98% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

15. The vaccine or immunogenic composition according to claim 1, wherein the carrier polypeptide comprises at least 99% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

16. The antigenic polypeptide according to claim 7, wherein the carrier polypeptide comprises at least 97% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

17. The antigenic polypeptide according to claim 7, wherein the carrier polypeptide comprises at least 98% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

18. The antigenic polypeptide according to claim 7, wherein the carrier polypeptide comprises at least 99% identity over the full length of the amino acid sequence of SEQ ID NO: 3.

Description

BRIEF SUMMARY OF THE DRAWINGS

(1) An embodiment of the invention will now be described by example only and with reference to the following figures:

(2) FIG. 1: Principles of Protein Glycan Coupling Technology in E. coli. An E. coli cell is transformed with three plasmids to generate the cloned glycoconjugate protein (GP). The plasmids encode the oligosaccharyltransferase PglB, the biosynthetic polysaccharide locus and the carrier protein. The polysaccharide is synthesised on an undecaprenol pyrophosphate lipid anchor () within the cytoplasm, this is transferred to the periplasmic compartment where PglB recognises the lipid link reducing end sugar and transfers the polysaccharide en bloc onto an acceptor sequon (D/E-X-N-X-S/T) on the carrier protein to produce the glycoconjugate protein (GP). IM, inner membrane; OM, outer membrane;

(3) FIG. 2: Western blot of glycoconjugates DnaK-FT and IglC indicate these F. tularensis proteins are glycosylated by C. jejuni PglB with the F. tularensis O-antigen. These are produced in large quantity indicating the suitability of DnaK and IglC as protective vaccine candidates. M: protein marker, DnaK and IglC glycoconjugates were prepared in large scale 2 L batch culture and purified. Western blot indicates protein (green) and F. tularensis O-antigen glycan (red) both present in samples;

(4) FIG. 3: amino acid sequence of carrier protein DnaK (Francisella tularensis) (SEQ ID NO 2);

(5) FIG. 4: amino acid sequence of carrier protein IglC (Francisella tularensis) (SEQ ID NO 1);

(6) FIGS. 5A-5H: nucleotide sequence encoding the Francisella O-antigen biosynthetic polysaccharide (SEQ ID NO 8);

(7) FIG. 6: nucleotide sequence encoding the oligosaccharyltransferase PglB (C. jejuni) (SEQ ID NO 9);

(8) FIG. 7: Pgl B amino acid sequence (C. jejuni) (SEQ ID NO 22);

(9) FIG. 8: nucleotide sequence of carrier protein DnaK (Francisella tularensis) (SEQ ID NO 11);

(10) FIG. 9: nucleotide acid sequence of carrier protein IglC (Francisella tularensis) (SEQ ID NO 10);

(11) FIG. 10: amino acid sequence of carrier protein ExoA (Pseudomonas aeruginosa) (SEQ ID NO 3);

(12) FIG. 11: amino acid sequence of carrier protein TUL4 (Francisella tularensis) (SEQ ID NO 4);

(13) FIG. 12: amino acid sequence of carrier protein FTT1713c (Francisella tularensis) (SEQ ID NO 5);

(14) FIG. 13: amino acid sequence of carrier protein FTT1695 (Francisella tularensis) (SEQ ID NO 6);

(15) FIG. 14: amino acid sequence of carrier protein FTT1696 (Francisella tularensis) (SEQ ID NO 7);

(16) FIG. 15: PglB amino acid sequence (C. jejuni) (SEQ ID NO 22);

(17) FIG. 16: nucleotide sequence encoding the oligosaccharyltransferase PglB (Campylobacter sputorum) (SEQ ID NO 23);

(18) FIG. 17: amino acid sequence (full length) of PglB (Campylobacter sputorum) (SEQ ID NO 24).

(19) FIGS. 18A-18C: P. aeruginosa ExoA with additional glycosylation sequons is heavily glycosylated by F. tularensis O-antigen by C. jejuni PglB in E. coli CLM24. Two-colour Western blots were used to simultaneously detect the degree of glycosylation of ExoA using monoclonal mouse mAb FB011 FIG. 18(A) (red) and rabbit anti-6His FIG. 18(B) (green). The two IR secondary antibody channels when overlaid (IR 800/680) result in images with overall yellow colour indicating conjugation FIG. 18(C). Marker, PageRuler Plus Prestained protein ladder (Life technologies); Lane 1, pGVXN150 only; Lane 2, pGVXN150 ExoA glycosylated with the F. tularensis O-antigen (same construct from Cuccui et al., 2013); Lane 3, ExoA heavily glycosylated with the F. tularensis O-antigen due to additional terminal glycosylation sequons;

(20) FIGS. 19A-19C: Survival (FIG. 19A) and disease of rats following aerosol challenge with a range of doses of F. tularensis Schu S4. Groups of 5 Fischer 344 rats were challenged via the aerosol route and monitored daily for mortality. Indicated challenge doses represent calculated dose from sampling of aerosol during challenge. Signs of disease in these animals were monitored twice daily Average cumulative signs for each group is presented for animals which had not succumbed to disease (FIG. 19B). Weight was monitored daily. Average weight change for each group is presented for animals which had not succumbed to disease (FIG. 19C);

(21) FIGS. 20A-20C: Effect of rat white blood cell counts during vaccination with Ft LVS Imaging flow cytometry was used to assess the effect of LVS vaccination on the rat immune response. Whole rat blood was labelled with CD45, CD3 and counter stained with DAPI for nuclear visualisation. Quantification of lymphocytes, monocytes/macrophages and neutrophils was achieved using CD45 vs side scatter (SSC) (FIG. 20A). Cell we gated as follows SSC high CD45 low for neutrophils, SSC low CD45 high for lymphocytes and SSC medium CD45 high for monocytes/macrophages (FIG. 20B). Data (FIG. 20C) shows the % gated of each cell type and each rat over the 21 day time course. Data shows a decrease in lymphocytes at day with returning to control levels at day 7 and 21. It also shows increased in neutrophils at day 3 returning to normal level at days 7 and 21. A significant increase in monocytes/macrophages is only observed in the LVS 10.sup.7 group at day 3 again this returns to normal levels by day 7 and 21.

(22) BF=Brightfield

(23) SSC=Side Scatter

(24) Composite=CD45, CD3 and nucleus

(25) *=p<0.01 by two-way ANOVA and Dunnett's post tests

(26) Images are representative of populations gated and fluorescence markers are optimised for visual impact with IDEAS;

(27) FIG. 21: Antigen stimulated IFN response in LVS infected rats. Splenocytes isolated from rats 21 days following infection with 10.sup.5 CFU LVS (grey bars), 10.sup.7 CFU LVS (black bars) or the PBS controls (hashed bars) were cultured in the presence of LVS sonicate, F. tularensis sonicate, Con-A or medium and then expression of IFN in 72 hour culture supernatants measured by ELISA. IFN responses (g/ml) are presented as mean response for each group (n=5)SEM;

(28) FIGS. 22A-22F: Measurement of antigen stimulated intracellular expression of IFN and IL17. Splenocytes isolated from LVS infected or PBS control rats 21 days-post infection were cultured in the presence of LVS sonicate, F. tularensis sonicate, Con-A or medium and then intracellular co-expression of IFN and/or IL17 was determined by flow cytometry. The percentage of antigen stimulated CD4.sup.+ (FIGS. 22A-22C) and CD8.sup.+ (FIGS. 22D-22F) T-cells expressing either IFN and/or IL17 is presented for each of the 3 treatment groups and for each of the antigens (medium control response subtracted). These data are presented by stacked bar graphs representing mean response for each group (n=5)SEM;

(29) FIG. 23: Antigen stimulated IFN response in glyco-conjugate vaccinated rats. Splenocytes isolated from rats immunised with glyco-conjugate vaccine administered i.p. (light grey bars) or s.c. (dark grey bars), and from rats infected with LVS (black bars) or the PBS controls (hashed bars) were cultured in the presence of LVS sonicate, F. tularensis sonicate, Con-A or medium. The expression of IFN in 72 hour culture supernatants was measured by ELISA. Responses were measured 6 weeks post vaccination for glyco-conjugate and PBS groups and 3 weeks post infection for the LVS group. IFN responses (g/ml) are presented as mean response for each group (n=5 except for LVS group where n=4)SEM;

(30) FIGS. 24A-24E: Protection of Fischer 344 rats against aerosol delivered Schu S4 with LVS and glyco-conjugate Groups of five Fischer 344 rats were vaccinated three times, two weeks apart with 10 g glyco conjugate in MF59 or MF59 alone via the s.c. or i.p. route, or 5.3810.sup.7 LVS. 5 weeks after final vaccination, rats were challenged with 5.4810.sup.2 Schu S4 via the aerosol route and monitored twice daily for mortality (FIG. 24A). Signs of disease were recorded twice daily and average cumulative signs for surviving rats in each group of 5 presented (FIG. 24B). Rats were weighed once daily. Presented data is average weight change of surviving rats in groups of 5 (FIGS. 24C-24E). Each group is presented with its apposite control: LVS s.c. and PBS s.c. (FIG. 24C), G-tExoA+MF59 s.c. and MF59 s.c. (FIG. 24D), Gt-ExoA+MF59 i.p and MF59 i.p. (FIG. 24E). Significance in divergence of weight change between groups is denoted as * p<0.05, ** p<0.005 and *** p<0.0005 for each day; and

(31) FIGS. 25A-25I: Example gating strategy used to measure intracellular expression of IFN and IL17. Splenocytes were stimulated with either antigen (LVS and F. tularensis sonicates), mitogen (Con-A) or medium control prior to surface staining with rat CD3, CD4 and CD8 antibodies and then intracellular staining for IFN and IL17. Histograms were initially gated in accordance with the following hierarchy, singlet cells (FIG. 25A), live cells (FIG. 25B) and lymphocytes (FIG. 25C) prior to gating for co-expression for CD3.sup.+CD4.sup.+ and CD3.sup.+CD8.sup.+ (FIG. 25D and FIG. 25E, respectively). The example expression of IFN and IL17 from the CD4.sup.+ and CD8.sup.+ T-cell populations derived from splenocytes isolated from a rat infected with 10.sup.7 CFU LVS and then stimulated with F. tularensis sonicate antigen is presented in FIG. 25F and FIG. 25G. The equivalent response to the medium control stimulated splenocytes is shown in the corresponding inset FIG. 25H and FIG. 25I to demonstrate the antigen-specific nature of the IFN.sup.+ and IL17.sup.+ response presented.

(32) TABLE-US-00001 TABLE 1 Summary of Sequence Information SEQ ID NO Gene/protein 1 IgIC protein 2 DNAk protein 3 Exo A protein 4 Tul4 protein 5 FTT1713c protein 6 FTT1695 protein 7 FTT1696 protein 8 Francisella O antigen locus DNA 9 Campylobacter jejuni PgI B DNA 10 IgIC DNA 11 DNAk DNA 12 KnR 13 Tul4 DNA 14 FTT1713c DNA 15 FTT1695 DNA 16 FTT1696 DNA 17 Wec A 18 DXNXS 19 DXNXT 20 EXNXS 21 EXNXT 22 PgIB C. jejuni 23 PgIB1 C. sputorum 24 PgIB1 C. sputorum 25 PlgB2 C. sputorum 26 PlgB2 C. sputorum optimised 27 PgIB2 C. sputorum 28 KnF 29 ExoA DNA

(33) TABLE-US-00002 TABLE 2 Strains and plasmids used Strain/plasmid Description Source E. coli Top10 F-mcrA (mrr-hsdRMS- Invitrogen mcrBC) 80lacZM15 lacX74 nupG recA1 araD139 (ara-leu)7697 gaIE15 galK16 rpsL(Str.sup.R) endA1 .sup. E. coli DH5 F-80lacZM15 (lacZYA-argF) Invitrogen U169 deoRrecA1 endA1 hsdR17 (rk, mk+), gal-phoAsupE44-thi-1 gyrA96 relA1 E. coli XL-1 endA1 gyrA96(nalr)thi-1 Stratagene relA1 lac gln V44 F[::Tn10 proAB+ laclq (lacZ)M15] hsdR17 (r.sub.k.sup.m.sub.k.sup.+) E. coli CLM24 rph-I IN(rrnD-rrnE) 1, 5 waaL F. tularensis subs. tularensis strain Type A strain DSTL, Porton SchuS4 Down laboratories F. tularensis subs. holarctica strain Type B strain, isolated in Green, M., et al., HN63 Norway from an infected Efficacy of the live Hare attenuated Francisella turlarenis vaccine (LVS) in a murine model of disease. Vaccine, 2005. 23(20): p. 2680-6 pGEM-T Easy TA cloning vector, amp.sup.r Promega pGH Vector construct GT-ExoA Celtek Bioscience, was synthesized in prior to LLC subcloning into pGVXN150 pLAFR1 Low copy expression Vanbleu E, Marchal vector, tet.sup.r K, Vanderleyden J. Genetic and physical map of the pLAFR1 vector. DNA Seq. 2004 June; 15(3): 225-7. pGAB1 F. tularensis O antigen This study coding region inserted into MCS of pGEM-T easy pGAB2 F. tularensis subs. This study tularensis strain SchuS4 O antigen coding region inserted into Ecorl site of pLAFR. pGVXN114 Expression plasmid for GlycoVaxyn CjPgIB regulated from the Lac promoter in pEXT21. IPTG inducible, HA tag, Spec.sup.r. pGVXN115 Expression plasmid for C. GlycoVaxyn jejuninon functionalPgIB due to a mutation at .sub.457WWDYGY.sub.462 to .sub.457WAAYGY.sub.462, regulated from the Lac promoter in pEXT21. IPTG inducible, HA tag, Spec.sup.r. pGVXN150.sub.260DNQNS.sub.264 Expression plasmid for This study Pseudomonas aeruginosa PA103 (DSM111/) Exotoxin A with the signal peptide of the E. coliDsbA protein, two inserted bacterial N-glycosylation sites, AA at position 262 altered from N to Q and a hexahis tag at the C-terminus. Induction under control of an arabinose inducible promoter, Amp.sup.r pGVXN150.sub.402DQQRT.sub.406 Expression plasmid for This study Pseudomonas aeruginosa PA103 (DSM111/) Exotoxin A with the signal peptide of the E. coliDsbA protein, two inserted bacterial N- glycosylation sites, AA at position 404 altered from N to Q and a hexahis tag at the C-terminus. Induction under control of an arabinose inducible promoter, Amp.sup.r pGVXN150.sub.260DNQNS.sub.264/.sub.402DQQRT.sub.406 Expression plasmid for This study Pseudomonas aeruginosa PA103 (DSM111/) Exotoxin A with the signal peptide of the E. coliDsbA protein, two inserted bacterial N- glycosylation sites, AA at position 262 and 404 altered from N to Q and a hexahis tag at the C- terminus. Induction under control of an arabinose inducible promoter, Amp.sup.r pGVXN150:GTExoA Expression plasmid for P. This study aeruginosa PA103 Exotoxin A (ExoA) with the signal peptide of the E. coli DsbA protein, two inserted bacterial N-glycosylation sites, two extra terminal glycosylation sites on the N and C-termini, and a hexa- His tag at the C-terminus. Induction under control of an arabinose inducible promoter, Amp.sup.r pACYCpgl pACYC184 carrying the 5 CjPgIB locus, Cm.sup.r E. coli CedAPgIB E. coli strain CLM24 with a This study chromosomally inserted IPTG inducible copy of PgIB pGVXN150 Expression plasmid for P. GlycoVaxyn, aeruginosa PA103 ExoA Cuccui et al., 2013 with the signal peptide of the E. coli DsbA protein, two inserted bacterial N- glycosylation sites, and a hexa-His tag at the C- terminus. Induction under control of an arabinose inducible promoter, Amp.sup.r

(34) Materials and Methods

(35) Bacterial Strains

(36) Escherichia coli strains were grown in LB at 37 C., 180 rpm for small scale tests, or 110 rpm for large scale vaccine production. Antibiotics and or supplements were used at the following concentrations; tetracycline 20 g/ml, ampicillin 100 g/ml, spectinomycin 80 g/ml and chloramphenicol 30 g/ml. The host strain for initial cloning experiments was E. coli XL-1, subsequent strains used for glycoconjugate production were E. coli DH5 and CLM24 (Table 1). For efficacy studies, mice were challenged with F. tularensis subsp. holarctica strain HN63. The bacterium was cultured on blood cysteine glucose agar plates (supplemented with 10 ml of 10% (wt/vol) histidine per litre) at 37 C. for 18 hours.

(37) For vaccination of rats with LVS, Lot 4, bacteria were inoculated onto blood cysteine glucose agar (BCGA) and incubated at 37 C. for 48 h. Bacterial growth was recovered from the agar and re-suspended in phosphate buffered saline (PBS), and the OD.sub.600 adjusted to 0.14. The suspension was serially diluted ten-fold to the desired concentration for immunisation.

(38) For challenge studies, F. tularensis Schu S4 was inoculated onto BCGA and incubated at 37 C. for 24 h. Growth was recovered from agar, re-suspended in PBS and the OD.sub.600 adjusted to 0.1. One ml of this suspension was inoculated into 100 ml modified cysteine partial hydrolysate (MCPH) broth with 4% glucose and incubated with shaking at 180 rpm, at 37 C. for 48 h. OD.sub.600 of the culture was adjusted to 0.1 in PBS, and serially diluted to the desired concentration for aerosol challenge.

(39) To determine bacterial load in organs, organs were weighed, then homogenised through a 40 m cell sieve, serially diluted in PBS, and plated onto BCGA.

(40) Cloning, Sequencing and Expression of the F. tularensis O-Antigen Coding Region

(41) DNA was prepared from the F. tularensis subsp. tularensis strain SchuS4 by phenol extraction as described by Karlsson et al. (2000). The O-antigen coding region was amplified using the primers FTfragment2rev (5-GGATCATTAATAGCTAAATGTAGTGCTG-3; SEQ ID NO:30) and Oant1ftfwd (5-TTTTGAATTCTACAGGCTGTCAATGGAGAATG-3; SEQ ID NO:31) using the following cycling conditions: 94 C., 15 sec, 55 C., 15 sec, 68 C., 20 min; 35 cycles using Accuprime TaqHifi (Invitrogen U.K.). This was cloned into the TA cloning vector pGEM-T Easy to generate the vector pGAB1. The plasmid pGAB1 was digested with EcoRI and the insert was subcloned into the vector pLAFR to generate the construct pGAB2.

(42) Immunofluorescence Imaging of E. coli Cells Carrying F. tularensis O Antigen Coding Region

(43) Immunofluorescence was carried out as previously described [17] with the modification that the IgG2a mouse monoclonal antibody FB11 was used to detect F. tularensis O antigen (1 l/ml in 5% (v/v) FCS/PBS).

(44) Bacterial Strains and Plasmid Construction

(45) Escherichia coli CLM24 (17) was used as the host strain for protein expression and glycoconjugate production. CLM24 (a ligase negative strain) was stably transformed with the plasmid pGab2 (24), a construct created from insertion of the F. tularensis subspecies tularensis strain SchuS4 O-antigen into the low copy number expression plasmid pLAFR (25). pGab2 is tetracycline-selectable and constitutively expressed. Following confirmation of the expression of the F. tularensis O-antigen, the resulting strain was then transformed with the plasmid CLM24 contained a plasmid encoded C. jejuni PglB, pGVXN114, which expresses the C. jejuni glycotransferase pglB Finally, the resulting strain was transformed with the plasmid pGVXN150:GT-ExoA, creating a three plasmid system for production of the glycoconjugate. The GT-ExoA construct was engineered to expressed a modified version of P. aeruginosa Exotoxin A that was synthesized by Celtek Bioscience, LLC in the vector pGH and closed into a vector derived from pEC415 using the restriction enzymes NheI and EcoRI (NEB). The synthesized protein contains two internal modifications that allow glycosylation of the protein by PglB (24), as well as containing four N-glycosylation sequons at the N terminal and an additional 4 at the C terminals glycotags. In addition, a hexa-histidine tag was added to the C-terminus of the protein to facilitate putification and an and an E. coli DsbA signal peptide was added to the N-terminal sequences enabling Sec-dependent secretion to the periplasm. pGVXN150: GT-ExoA is ampicillin resistant and L-(+)-Arabinose inducible. The construct sequence was then confirmed using Sanger sequences with the primers GTExoA NF (GCGCTGGCTGGTTTAGTTT, SEQ ID NO 32), GTExoA NR (CGCATTCGTTCCAGAGGT, SEQ ID NO 33), GTExoA CF (GACAAGGAACAGGCGATCAG, Seq ID NO 34) and GTExoA CR (TGGTGATGATGGTGATGGTC, SEQ ID NO 35).

(46) Culture and Glycoprotein Expression Conditions

(47) For all experiments, E. coli CLM24 was cultured in Luria-Bertani (LB) broth (Fisher Scientific) supplemented with appropriate antibiotics in the following concentrations: ampicillin 100 g/mL, tetracycline 20 g/mL, and spectinomycin 80 g/mL. The addition of manganese chloride at the time of protein and PglB induction was at a final concentration of 4 mM, and made up as a 1 M stock fresh prior to each experiment. Cultures were incubated at 37 C. at 110 RPM for 16-20 hrs for large-scale preparation. For three plasmid system glycoconjugate production, an overnight LB culture of E. coli CLM24 harbouring p114, pGvn150:GT-ExoA and pGab2 was sub-cultured in a 1:10 dilution of LB broth (Fisher Scientific) with antibiotics, and grown to mid log phase. pGVXN150:GT-ExoA was induced by addition of 0.2% L-(+)-Arabinose (Sigma), and C. jejuni PglB induced with 1 mM IPTG, followed by incubation for an initial 4 hours. Another addition of 0.4% L-(+)-Arabinose was then added and cultures were incubated overnight.

(48) Production and Purification of Glycoconjugate Vaccine

(49) E. coli CLM24 carrying the vectors pGAB2, pGVXN114 and pGVXN150 was grown for 16 h in 200 mL LB broth at 37 C., 180 rpm. This was used to inoculate 1.8 L of LB broth and further incubated at 110 r.p.m. 37 C. to an OD.600 nm reading of 0.4 to 0.6. L-(+)-arabinose was then added to a final concentration of 0.2% w/v and IPTG to a final concentration of 1 mM to induce expression of ExoA and Cj PglB respectively; At this point in time manganese chloride at a final concentration of 4 mM was also added. Following 5 hours of incubation, 0.2% w/v L-(+)-arabinose was added again and the culture left to incubate overnight.

(50) Cells were harvested by centrifugation at 5300 g for 30 min, and pelleted cells were then resuspended in an ice cold lysis solution composed of 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0 (adjusted with 5 M NaOH) supplemented with 1 mg/ml lysozyme and 1 l/ml Benzonase nuclease (Novagen). Then, cells were subjected to five rounds of lysis using a pre-chilled Stansted High Pressure Cell Disruptor (Stansted Fluid Homogenizer) under 60,000 psi in continuous mode. Cell debris was removed by centrifugation at 10,000 r.p.m. for 60 m, the supernatant was collected The resulting supernatant was kept on ice while being loaded onto a GE Healthcare HIS trap HP 1 mL column. Then, the column was washed in buffer containing 50.0 mM NaH.sub.2PO.sub.4; 300 mM NaCl.sub.2; 20 mM imidazole lysis while attached to an AKTA purifier. Material was eluted and collected in 1 mL fractions with an imidazole gradient of 30-500 mM elution buffer that also contained 20% v/v glycerol and 5% w/v glucose. The collected fractions were then visualised by Western blot and the most glycosylated F. tularensis carrier proteins conjugated to F. tularensis O-antigen were chosen for pooling and buffer exchange (using VivaSpin 2 (VivaProducts) into PBS 20 v/v % glycerol, prior to quantification with a BCA Protein Assay Kit (Pierce Biotechnology, USA).

(51) This generated a typical yield of 2-3.5 mg/ml of glycoconjugate per 2 L of E. coli culture.

(52) The same techniques were used for the generation of the sham C. jejuni heptasaccharide ExoA glycoconjugate encoded by pACYCpgl [18].

(53) Using the E. coli Chromosomally Inserted Strain CLM 24 CedAPglB:

(54) Escherichia coli strain CLM24 with a chromosomally inserted copy of pglB were grown in Luria-Bertani (LB) broth at 37 C., with shaking. Antibiotics were used at the following concentrations: tetracycline 20 g ml.sup.1 and ampicillin 100 g ml.sup.1. Tetracycline was used to maintain the plasmid pGAB2 coding for Francisella tularensis O antigen and ampicillin was used to maintain the plasmid coding for the acceptor carrier protein.

(55) E. coli cells were grown for 16 h in 200 ml LB broth at 37 C., with shaking. This was used to inoculate 1.8 l of LB broth and further incubated with shaking at 37 C. until an OD.sub.600 reading of 0.4-0.6 was reached. At this point L-(+)-arabinose was added to a final concentration of 0.2% w/v and IPTG to a final concentration of 1 mM to induce expression of the acceptor protein and pglB, respectively; after another 5 h of incubation, 0.2% w/v L-(+)-arabinose was added again and the culture left to incubate overnight.

(56) Cells were harvested by centrifugation at 5300g for 30 min, and pelleted cells were incubated at room temperature for 30 min in a lysis solution composed of 10 BugBuster protein extraction reagent (Novagen) diluted to 1 in 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0 supplemented with 0.1 percent Tween, 1 mg ml.sup.1 lysozyme and 1 l ml.sup.1 Benzonase nuclease (Novagen). Cell debris was removed by centrifugation at 7840 g for 30 min, the supernatant was collected and 1 ml Ni-NTA agarose (QIAGEN) was added to the supernatant. The slurry-lysate was incubated for 1 h at 4 C. with shaking then loaded into 10 ml polypropylene columns (Thermo Scientific). His-tagged ExoA was purified by the addition of an elution buffer according to manufacturer's instructions (QIA expressionist, QIAGEN) containing 250 mM imidazole with the addition of 20 percent glycerol and 5 percent glucose.

(57) Alternatively cells were grown in LB agar plates containing tetracycline, ampicillin, IPTG to a final concentration of 50 M and L-(+)-arabinose to a final concentration of 0.2% for 16 h at 37 C. Cells were subsequently harvested by scraping and protein purified as indicated above.

(58) Immunoblot Analysis

(59) To verify transfer and presence of the F. tularensis O antigen, samples were analysed by western blotting. E. coli cells were grown o/n in 10 ml LB broth and diluted to an O.D.600 nm of 1.0. Cells were centrifuged at 13,000 r.p.m. for 10 min, supernatant was removed and cells were resuspended in 100 l Laemmli buffer and lysed by boiling for 10 min before analysis by western blotting or silver staining. Mouse anti F. tularensis O-antigen monoclonal antibody FB011 (AbCam U.K.) was used at a dilution of 1:1,000, rabbit anti HIS monoclonal antibody was used to detect ExoA at a dilution of 1:10,000 (AbCam U.K.). Secondary antibodies used were goat anti mouse IRDye680 and IRDye800 conjugates used at 1:5000 dilutions. Signal detection was undertaken using the Odyssey LI-COR detection system (LI_COR Biosciences GmbH).

(60) Cytokine Response Analysis

(61) Spleen supernatants were assessed using mouse inflammatory cytometric bead array kit (CBA-BD biosciences) for IL-10, IL-12p70, IFN-, IL-6, TNF-, and MCP-1. Samples were incubated with the combined capture bead cocktail, and incubated for 1 h at room temperature. Following incubation, PE detection antibodies were added and incubated for a further 1 h. Samples were then washed and resuspended in FACS buffer. Cytokine concentrations were measured via quantification of PE fluorescence of samples in reference to a standard curve.

(62) BALB/c Mouse Challenge Studies

(63) Female Balb/C mice were obtained from Charles River Laboratories (Kent, U.K.) at 6-8 weeks of age. The pilot study was done in groups of 10 mice immunised with either 0.5 g F. tularensis LPS, 0.5 g F. tularensis glycoconjugate, 0.5 g F. tularensis glycoconjugate+SAS, 0.5 g sham glycoconjugate+SAS, 0.5 g sham glycoconjugate or SAS only. One group of mice were left untreated as challenge efficacy controls. Immunisations occurred on days 0, 14 and 28 via intra-peritoneal (IP) route. Mice were challenged 35 days post-immunisation with 100 CFU of F. tularensis strain HN63 by the IP route, delivered in 0.1 ml. Subsequent experiments used the same schedule with 15 mice per group and doses of 10 g of material per immunisation. Four weeks following final vaccination 5 mice from each group were tail bled to obtain sera for antibody analysis and culled at day 3 post-infection with spleens harvested to analyse bacterial load and cytokine response. For the enumeration of bacteria, spleen samples were homogenized in 2 ml of PBS through 40 m cell sieves (BD Biosciences) and 100 l aliquots were plated onto BCGA plates. F. tularensis LPS-specific IgM and total IgG levels were determined by ELISA as previously described [19]. All work was performed under the regulations of the Home Office Scientific Procedures Act (1986).

(64) Statistical Analysis

(65) Statistical analyses were performed using the program PASW (SPSS release 18.0). Survival data was analysed by pair-wise Log Rank test stratified by experiment. Cytokine and bacterial load data were analysed using univariate general linear models, using Bonferroni's post tests to further clarify significant differences.

(66) Production and Purification of Glycoconjugate Vaccine

(67) E. coli CLM24 carrying the vectors pGAB2, pGVXN114 and pGVXN150 was grown for 16 h in 200 mL LB broth at 37 C., 180 rpm. This was used to inoculate 1.8 L of LB broth and further incubated at 110 rpm. 37 C. until an O.D600 reading of 0.4 to 0.6 was reached. At this point L-(+)-arabinose was added to a final concentration of 0.2% and IPTG to a final concentration of 1 mM to induce expression of exoA and CjpglB respectively; after another 5 hours of incubation, 0.2% w/v L-(+)-arabinose was added again and the culture left to incubate o/n.

(68) Cells were harvested by centrifugation at 6,000 rpm. for 30 m, and pelleted cells were incubated at room temperature for 30 m in a lysis solution composed of 10BugBuster protein extraction reagent (Novagen) diluted to 1 in 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0 supplemented with 0.1% Tween, 1 mg/ml lysozyme and 1 l/ml Benzonase nuclease (Novagen). Cell debris was removed by centrifugation at 10,000 r.p.m. for 30 m, the supernatant was collected and 1 ml Ni-NTA agarose (QIAgen) was added to the supernatant. The slurry-lysate was incubated for 1 h at 4 C. with shaking then loaded into 10 ml polypropylene columns (Thermo scientific). His tagged ExoA was purified by the addition of an elution buffer according to manufacturer's instructions (QIA expressionist, QIAGEN) containing 250 mM imidazole with the addition of 20% w/v glycerol and 5% w/v glucose. Protein yields were estimated using a bicinchonic acid assay kit according to manufacturer's instructions (Pierce Biotechnology BCA protein Assay Kit, U.S.A.).

(69) For large-scale protein purification, material was isolated using GE Healthcare HIS trap columns and an AKTA purifier with an imidazole gradient of 30 mM to 500 mM. The collected fraction containing ExoA glycosylated with F. tularensis O-antigen was further purified using a resource Q anionic exchange column (GE Healthcare) with a NaCl gradient from 0 to 500 mM in 20 mM TrisHCl pH 8.0. This generated a typical yield of 2-3 mg/ml of glycoconjugate per 2 L of E. coli culture.

(70) The same techniques were used for the generation of the sham C. jejuni heptasaccharide ExoA glycoconjugate. The plasmid coding for this heptasaccharide was pACYCpgl carrying the entire Cjpgl cluster from C. jejuni 81116 [1].

(71) Protein Expression

(72) Escherichia coli strain CLM24 with a chromosomally inserted copy of pglB were grown in Luria-Bertani (LB) broth at 37 C., with shaking. Antibiotics were used at the following concentrations: tetracycline 20 g ml-1 and ampicillin 100 g ml-1. Tetracycline was used to maintain the plasmid pGAB2 coding for Francisella O-antigen and ampicillin was used to maintain the plasmid coding for the acceptor carrier protein. Additionally, a final concentration of 4 mM Manganese chloride was added as an additional co-factor to the cultures.

(73) E. coli cells were grown for 16 h in 200 ml LB broth at 37 C., with shaking. This was used to inoculate 1.8 l of LB broth and further incubated with shaking at 37 C. until an OD600 reading of 0.4-0.6 was reached. At this point L-(+)-arabinose was added to a final concentration of 0.2% w/v, 4 mM final concentration of manganese chloride, and IPTG to a final concentration of 1 mM to induce expression of the acceptor protein and pglB, respectively; after another 5 h of incubation, 0.2% w/v L-(+)-arabinose was added again and the culture left to incubate overnight.

(74) Cells were harvested by centrifugation at 5300g for 30 min, and pelleted cells were incubated at room temperature for 30 min in a lysis solution composed of 10 BugBuster protein extraction reagent (Novagen) diluted to 1 in 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0 supplemented with 0.1 percent Tween, 1 mg ml-1 lysozyme and 1 l ml-1 Benzonase nuclease (Novagen). Cell debris was removed by centrifugation at 7840 g for 30 min, the supernatant was collected and 1 ml Ni-NTA agarose (QIAGEN) was added to the supernatant. The slurry-lysate was incubated for 1 h at 4 C. with shaking then loaded into 10 ml polypropylene columns (Thermo Scientific). His-tagged ExoA was purified by the addition of an elution buffer according to manufacturer's instructions (QIA expressionist, QIAGEN) containing 250 mM imidazole with the addition of 20 percent glycerol and 5 percent glucose.

(75) Creation of WecA.sup. E. coli Strain

(76) The kanamycin resistance cassette from plasmid pKD4 was amplified using the following primers KnF 5-GTGAATTTACTGACAGTGAGTACTGATCTCATCAGTATTTTTTTATTCACTGTGTAGGCT GGAGCTGCTTC-3 (SEQ ID NO 28) and KnR 5-GTAAAACGCAGACTGCGTAGAAATCGTGGTGGCAGCCCCAATTTAACCAACATATGAA TATCCTCCTTAGCTGCAG-3 (SEQ ID NO 12) using accuprime taq hifi (Invitrogen UK) and the following cycling conditions 94 C./30 s, followed by 30 cycles of 94 C./30 s, 56 C./30 s, 68 C./90 s. These primers carry 5 end tails that are homologous to the wecA gene of Escherichia coli K-12. The PCR product was digested with DpnI and purified before transforming 1 g into E. coli K 12 carrying, the lambda red helper plasmid pKD20 (Datsenko and Wanner PNAS, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Jun. 6, 2000 pp. 6640-6645). Bacteria were grown on LB agar plates containing 10 mM L-arabinose to induce rec recombinase expression for 48 hrs prior to plating on kanamycin plates. wecA gene deletions were detected by gene specific PCR and resistance to kanamycin.

(77) Animals

(78) Animals were kept in accordance with the Animals (Scientific Procedures) Act 1986. Codes of Practice for the Housing and Care of Animals used in Scientific Procedures 1989. Following challenge with F. tularensis, all animals were handled under UK Advisory Committee on Dangerous Pathogens animal containment level 3 conditions within a half-suit isolator compliant with British Standard BS5726.

(79) Female Fischer 344 rats were obtained from Harlan, UK. Rats were implanted with biotherm microchips sub-cutaneously.

(80) Rats were vaccinated with LVS in PBS via the sub-cutaneous (s.c.) route. Rats were vaccinated with 10 g glycoconjugate in 100 l PBS via the s.c. or intra-peritoneal route 3 times, 2 weeks apart. Aerosol challenge with F. tularensis Schu S4 occurred five weeks following final vaccination.

(81) Following challenge, animals were observed twice daily, and signs of disease and sub-cutaneous temperature recorded. Disease signs were assigned a score, and a cumulative score for disease observed was calculated. Animals were weighed once daily. Weight data was analysed using IBM SPSS V21.0. Weight data was taken as the differential weight from 1 day prior to challenge. Data was found to fit the normal, Gaussian distribution using Q-Q plots (not shown). The data was then analysed using a repeated measures General Linear Model. Validity of the data for this test was further established using Levene's tests for unequal variance (not shown). Individual comparisons, pairwise and dependant or independent of time points, were performed using the Bonferroni's correction. Humane end points of more than 15% weight loss, and/or sub-cutaneous temperature reading of less than 33 C. were used. Animals underwent Schedule 1 euthanasia with i.p. administered euthatal.

(82) Aerosol Challenge

(83) Rats were exposed to an aerosol of F. tularensis SchuS4 by the inhalational route in a nose-only exposure unit (DstI, in house) utilising a 6-jet Collison atomiser (DstI, in house) attached to a contained Henderson Piccolo arrangement to condition the aerosol to 50% (5%) relative humidity, and controlled by the (AeroMP) Aerosol Management Platform aerosol system (Biaera Technologies L.L.C.). The animals were exposed to the aerosolised bacteria for 10 minutes, with impingement of the aerosol cloud sampled at the midway point of challenge into PBS via an All-Glass Impinger (AGI-30; Ace Glass, Vineland, NJ).

(84) Following challenge, the impinged aerosol was enumerated by serial dilution and plating onto BCGA plates. Calculated retained dose was calculated from aerosol concentration (cfu/L of air), using Guyton's formula (27), for minute respiratory volume, and assuming 40% retention of 1-3 m droplets (26).

(85) Cell Isolation and Culture

(86) Rat spleens were homogenised through a 40 m sieve using a sterile plunger and colleved into L15 medium. The isolated splenocytes were diluted to 210.sup.6 cells/ml in medium and cultured in the presence of either medium alone, sonicated LVS whole cells (10 g/ml, DstI), sonicated Schu S4 whole cells (10 g/ml, DstI), purified ExoA (5 g/ml, LSHTM) or Concanavalin-A (Con-A, 5 g/ml, Sigma-Aldrich). For cultures of cells from LVS infected or PBS control rats, splenocytes were diluted in L-15 medium (Life Technologies) supplemented with 10% Foetal Bovine Serum (Sigma), non-essential amino acids (Life Technologies), 2-mercaptoethanol (Life Technologies), 100 U/ml penicillin and 100 mg/ml streptomycin sulphate (Life Technologies) and then cultured at 37 C. in the absence of a controlled CO.sub.2 environment. For cultures of cells from ExoA vaccinated rats, splenocytes were diluted in RPM11640 medium (Life Technologies), supplemented as described above and then cultured at 37 C. with 5% CO.sub.2.

(87) Measurement of IFN by Enzyme Linked Immunosorbent Assay (ELISA). Splenocytes (210.sup.5 per assay well) were cultured in duplicate in the presence of antigen for 72 hours and supernatants harvested and stored at 20 C. prior to use. The expression of IFN was determined in plasma supernatants using a commercial rat IFN ELISA kit (Mabtech) with responses determined by measurement of optical density at 450 nm (OD.sub.450 nm). For reporting, the OD.sub.450 nm results were normalised by transformation into units of g/ml by generating a standard curve using recombinant rat IFN, as supplied with the assay kit.

(88) Flow cytometry. Splenocytes (210.sup.6 cells per assay well) were cultured in the presence of antigen for 20 hours with Brefeldin-A (10 ug/ml, Sigma-Aldrich) added to culture medium for the final 4 hours of the culture. Cells were harvested by centrifugation (300 g/5 mins) and stained using the following anti-rat surface marker antibodies; CD3-Brilliant Violet 421, CD4-FITC (clone OX35, eBioscience) and CD8-PerCP eFluor710 (clone OX8, eBioscience). Cells were stained for 15 minutes at 4 C. in the presence of a fixable yellow (405 nm) cell viability dye (Life Technologies) and then fixed for 16 hours at 4 C. in Cytofix fixation reagent (BD Biosciences). Fixed cells were permeabilised in BD Biosciences Permeabilistation Buffer and then stained intracellularly for 30 minutes at 4 C. using anti-rat antibodies IFN-PE (clone DB-1, BD Biosciences) and IL17A-APC (clone eBio17B7, eBioscience). Stained samples were analysed using a FACSCanto II analyser equipped with 405, 488 and 633 nm lasers (BD Biosciences). An example gating strategy for measurement of intracellular expression of IFN and IL-17 is given in FIG. 25. Data analysis was performed using FlowJo v10 software (TreeStar, USA). All antibodies were titrated prior to use to ensure optimal staining. Median number of live-singlet lymphocyte cell events on which analyses were performed was 62,598 (18,724 SD)

(89) ImageStream Staining and Data Capture

(90) 500 l whole rat blood was blocked with 5 l anti-rat CD32 antibody (BD Pharmingen Cat No: 550271), incubated for 5 minutes at room temperature (.sup.23 C.). Following blocking 40 l anti-rat CD45-FITC (BD Pharmingen Cat No: 554877), 50 l anti-rat CD3-APC (BD Pharmingen, Cat No: 557030) and 120 l 0.5% BSA in PBS were added to the blood sample. Samples were then incubated at 4 C. for 45 minutes. Blood samples were subsequently centrifuges at 300g for 10 minutes and the supernatants removed. 1 ml BD lysis buffer (BD Pharmingen) was added and samples incubated for 10 minutes at room temperature (.sup.23 C.), before being centrifuged at 300g for 10 minutes. Supernatants were removed and samples were washed and centrifuged again before being re-suspended in 100 l of 4% paraformaldehyde and stored at 4 C. Samples were counterstained with 3 M 4,6-diamidino-2-phenylindole (DAPI) 3 minutes before data capture.

(91) Data was collected using an dual camera imagestream X Mk II equipt with a 405 nm laser (set to 2 mW), a 488 nm laser (set to 100 mW) and a 642 nm laser (set to 150 mW). Samples were acquired using Inspire (version 2.0) where a minimum of 20,000 in-focus (Gradient RMS<50) nucleated (Intensity Ch07<110.sup.4) were captured per rat. Single stained samples were also created and acquired for the construction of a compensation matrix. This was performed in inspire using the compensation wizard during data capture. Data are generated from a minimum of 4 mice. Statistical analysis was completed using GraphPad Prism version 6.02.

(92) Data validity was first assessed using a Brown-Forsythe test for variance after which a two-way ANOVA was completed with Dunnett's multiple comparisons test was completed.

(93) ELISA for Anti Gt-ExoA Antibody Titre

(94) Plates were coated with 5 g/ml Gt-ExoA in PBS and, 100 l per well, and incubated at 4 C. overnight. After blocking with 1% skimmed milk powder in PBS for 2 hours at 37 C., plates were washed three times with 0.05% TWEEN in PBS. Sera was applied to plates at 1:50 and serially diluted 1:2 across the plate, in 1% skimmed milk powder. Bound IgG rat antibody was detected using anti-rat antibody conjugated to HRP at 1:2000 in PBS, and developed using 10 mM 2,2-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) in citrate buffer, with 0.01% H.sub.2O.sub.2. OD was measured at 414 nm. Antibody titre was defined as the reciprocal of the highest dilution of serum that had a mean OD value at least 3 standard deviations higher than the mean OD of non-vaccinated serum.

EXAMPLE 1

(95) Fischer 344 Rats are Susceptible to <10 CFU F. tularensis Schu S4 Via the Aerosol Route

(96) Groups of 5 rats were challenged with a range of doses of Francisella tularensis Schu S4 via the aerosol route, from approximately 9 cfu to 3.1510.sup.4 cfu. To determine bacterial dissemination following challenge, groups of five rats from each dose group were sacrificed at 7 days post infection. At this time, all rats challenged with 3.1510.sup.4 cfu, and 3 of 5 rats challenged with 2.2210.sup.3 had already succumbed to infection. At 7 days post-infection, all infected animals had highly colonised lungs, containing greater than 110.sup.6 cfu/g of lung tissue. The most heavily colonised lungs, from animals challenged with 2.2210.sup.3 contained up to 110.sup.8 cfu/g. Bacteria had disseminated from lungs to liver and spleen in all infected rats. All rat spleens and livers at 7 days post infection contained greater than 110.sup.4 cfu/g tissue Schu S4 bacteria.

(97) All rats challenged with 2.9410.sup.2 to 3.1510.sup.4 cfu rats succumbed to infection within 14 days of challenge (FIG. 19A). Of rats challenged with CFU of F. tularensis, only 1 animal of 5 survived to the end of experiment at 21 days post infection. During the recovery of this animal, its disease signs resolved and some weight was recovered. The MLD is therefore estimated to be less than 9 cfu via the aerosol route. All infected rats underwent a febrile stage, with subcutaneous temperatures which were raised at least 1.5 C. above their baseline temperature (data not shown). All infected rats showed severe signs of disease. Rats first became ruffled, and developed eye problems including secretion of porphyrin and ptosis of the eyelids until their eyes were completely closed, followed by hunched posture alongside rapid breathing. Rats became more lethargic and less responsive to stimuli over the course of disease (FIG. 19B). All infected rats lost weight, in a dose dependent manner (FIG. 19C). Rats which received the highest challenge: 3.1510.sup.4 cfu, rapidly lost between 7 and 10 percent of their body weight within 5 days of challenge. Those rats which received a lower challenge all lost at least 10 percent of their starting weight, and in some cases more than 25 percent of body weight, but over a greater length of time.

EXAMPLE 2

(98) LVS Disseminates to Lungs, Liver, and Spleen Following Challenge, Inducing Expansion of Neutrophil and Macrophage Populations in the Blood.

(99) To determine dissemination and clearance of bacteria, and determine host cell responses to LVS infection, groups of five rats were vaccinated with 5.5610.sup.5 or 5.5610.sup.7 CFU of LVS sub-cutaneously. Following vaccination, rats were sacrificed at 3, 7 and 21 days post-vaccination to determine bacterial dissemination and clearance. There was no significant difference in colonisation of organs between rats vaccinated at the 2 different doses. At 3 days post-vaccination, all rats were colonised in the liver and spleen, whilst lungs had low numbers of detectable bacteria. At 7 days, no bacteria could be detected in lungs and liver of vaccinated rats, whilst spleens were still colonised. No bacteria were detected in lungs, liver or spleen at 21 days post infection.

(100) Rat immune cells in whole blood were quantified using the ImageStream X MkII. Cell types were differentiated by CD45 intensity verses side scatter intensity identifying three distinct populations namely, lymphocytes, monocytes/macrophages and neutrophils (FIGS. 20A and B). There was a significant decrease in lymphocyte counts in rats challenged with both 10.sup.5 and 10.sup.7 LVS at day 3 post vaccination (p<0.01), with a return to baseline at day 7 and day 21. This is mirrored in the neutrophil count, with a significant increase in neutrophils at day 3 in both dose groups decreasing back to baseline at day 7 and 21. Monocyte/macrophage numbers in rats challenged with 10.sup.7 LVS were significantly increased at day 3, returning to baseline levels at days 7 and 21.

EXAMPLE 3

(101) LVS Induces T Cell Memory Response Characterised by IFN and IL-17 Expression on Re-Stimulation

(102) To determine the splenocyte re-stimulation response following LVS vaccination, 5 rats were sacrificed at day 21 and day 35 post-vaccination and splenocytes were harvested from rat spleens. IFN secretion by splenocytes was measured following re-stimulation with a range of antigens. The absence of responses in the PBS control rats indicates the antigen specific nature of these memory re-call responses, whilst all cells secreted IFN in response to the mitogen ConA indicating the cells potential for responding. LVS vaccinated rat splenocytes secreted significantly more IFN in response to stimulation with all three F. tularensis whole cell antigen preparations than PBS vaccinated rats (FIG. 21).

(103) FIG. 4. Antigen stimulated IFN response in LVS infected rats. Splenocytes isolated from rats 21 days following infection with 10.sup.5 CFU LVS (grey bars), 10.sup.7 CFU LVS (black bars) or the PBS controls (hashed bars) were cultured in the presence of LVS sonicate, F. tularensis sonicate, Con-A or medium and then expression of IFN in 72 hour culture supernatants measured by ELISA. IFN responses (g/ml) are presented as mean response for each group (n=5)SEM.

(104) Further investigation of memory response to LVS was investigated by measurement of intracellular expression of IFN and IL-17 following antigen stimulation, 21 days post-infection with LVS. LVS infection resulted in the induction of both CD4 and CD8 effector memory responses, as demonstrated by antigen-specific IFN responses by these cell phenotypes (FIG. 22). Additionally, CD4+ memory cells that express IL-17 upon antigen stimulation are also generated by LVS infection in the rats (FIG. 22).

EXAMPLE 4

(105) Glycoconjugate Induces Antigen Specific Memory Response and IgG Antibody

(106) Similarly to LVS vaccinated rats, splenocytes were isolated from glycoconjugate vaccinated rats at 35 days post final vaccination. Cells were re-stimulated both with crude antigen preparations, and recombinant ExoA protein for 72 hours. IFN secretion following re-stimulation of splenocytes from LVS challenged rats with crude F. tularensis antigens, corroborates intracellular IFN expression previously described (FIG. 23). In addition, the measurement of ExoA antigen specific IFN responses only in Gt-ExoA vaccinated rats confirmed the recognition of the Gt-ExoA conjugate by the cell mediated compartment of the immune system (FIG. 23). Serum from Gt-ExoA vaccinated rats and their appropriate MF59 only controls were measured for IgG recognition of Gt ExoA. Sera from MF59 only controls showed no appreciable binding to Gt-ExoA. IgG titres from rats vaccinated with Gt-ExoA by the i.p. route were 1:204800, and by the s.c. route 1:102400, demonstrating an antigen specific IgG response to vaccine.

EXAMPLE 5

(107) LVS and F. tularensis O-Antigen+Exoprotein A Glycoconjugate Both Protect Against Pulmonary Tularemia

(108) Rats were vaccinated with 5.3910.sup.7 LVS via the s.c. route, and glyconojugate by both the s.c. and i.p. route. Five weeks later the animals were challenged with an average 5.4810.sup.2 F. tularensis Schu S4. All vaccinated rats survived 21 days post aerosol challenge (FIG. 24A). Of five rats vaccinated with MF59 alone via the i.p route, one rat survived to 21 days post infection (FIG. 24A). Three of five rats vaccinated with MF59 alone via the s.c. route survived to 21 days post infection, which is not significantly different from rats vaccinated with glycoconjugate via the s.c. route (FIG. 24A).

(109) Rats vaccinated with Gt-ExoA by either route, or with LVS did not become febrile (data not shown) and showed no signs of disease (FIG. 24B). Comparatively, rats vaccinated with PBS s.c. and adjuvant only via i.p and s.c. routes all become febrile (data not shown), and all showed severe signs of disease (FIG. 24B)

(110) Weight change in rats after challenge, compared to 1 day before challenge, was shown to be significantly different over time between all groups of vaccinated rats and their relevant controls (FIG. 24C). Weight change between rats vaccinated with Gt-ExoA by the s.c. route and the relevant control rats, vaccinated with MF59 alone by the s.c. route, significantly diverged on day 2 after challenge FIG. 24D) (p<0.05). Weight change in rats vaccinated with LVS or with Gt-ExoA via the i.p. route significantly diverged from their apposite controls on day 4 (FIG. 24C and FIG. 24E) (p<0.005, p<0.0005 respectively).

(111) The surviving control rats all resolved signs of disease and had recovered some weight by 21 days following infection. F. tularensis was not detected in lungs, liver or spleen of LVS and glycoconjugate vaccinated rats at 21 days post infection whilst all surviving MF59 only vaccinated rats were colonised with F. tularensis in lung, liver and spleen at 21 days post infection.

REFERENCES

(112) 1. Shinefield H R, Black S, Ray P, et al. Safety and immunogenicity of heptavalent pneumococcal CRM197 conjugate vaccine in infants and toddlers. The Pediatric infectious disease journal 1999; 18:757-63. 2. Grijalva C G, Nuorti J P, Arbogast P G, Martin S W, Edwards K M, Griffin M R. Decline in pneumonia admissions after routine childhood immunisation with pneumococcal conjugate vaccine in the USA: a time-series analysis. Lancet 2007; 369:1179-86. 3. Theodoratou E, Johnson S, Jhass A, et al. The effect of Haemophilus influenzae type b and pneumococcal conjugate vaccines on childhood pneumonia incidence, severe morbidity and mortality. International journal of epidemiology 2010; 39 Suppl 1:i172-85. 4. Sucher A J, Chahine E B, Nelson M, Sucher B J. Prevnar 13, the new 13-valent pneumococcal conjugate vaccine. The Annals of pharmacotherapy 2011; 45:1516-24. 5. Feldman M F, Wacker M, Hernandez M, et al. Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 2005; 102:3016-21. 6. Terra V S, Mills D C, Yates L E, Abouelhadid S, Cuccui J, Wren B W. Recent developments in bacterial protein glycan coupling technology and glycoconjugate vaccine design. Journal of medical microbiology 2012; 61:919-26. 7. Langdon R H, Cuccui J, Wren B W. N-linked glycosylation in bacteria: an unexpected application. Future microbiology 2009; 4:401-12. 8. Dennis D T, Inglesby T V, Henderson D A, et al. Tularemia as a biological weapon: medical and public health management. JAMA: the journal of the American Medical Association 2001; 285:2763-73. 9. Reintjes R, Dedushaj I, Gjini A, et al. Tularemia outbreak investigation in Kosovo: case control and environmental studies. Emerging infectious diseases 2002; 8:69-73. 10. McCrumb F R. Aerosol Infection of Man with Pasteurella tularensis. Bacteriological reviews 1961; 25:262-7. 11. Oyston P C, Sjostedt A, Titball R W. Tularaemia: bioterrorism defence renews interest in Francisella tularensis. Nature reviews Microbiology 2004; 2:967-78. 12. Fulop M, Manchee R, Titball R. Role of lipopolysaccharide and a major outer membrane protein from Francisella tularensis in the induction of immunity against tularemia. Vaccine 1995; 13:1220-5. 13. Weintraub A. Immunology of bacterial polysaccharide antigens. Carbohydrate research 2003; 338:2539-47. 14. Fulop M, Mastroeni P, Green M, Titball R W. Role of antibody to lipopolysaccharide in protection against low- and high-virulence strains of Francisella tularensis. Vaccine 2001; 19:4465-72. 15. Conlan J W, Shen H, Webb A, Perry M B. Mice vaccinated with the O-antigen of Francisella tularensis LVS lipopolysaccharide conjugated to bovine serum albumin develop varying degrees of protective immunity against systemic or aerosol challenge with virulent type A and type B strains of the pathogen. Vaccine 2002; 20:3465-71. 16. Prior J L, Prior R G, Hitchen P G, et al. Characterization of the O antigen gene cluster and structural analysis of the O antigen of Francisella tularensis subsp. tularensis. Journal of medical microbiology 2003; 52:845-51. 17. Cuccui J, Milne T S, Harmer N, et al. Characterization of the Burkholderia pseudomallei K96243 capsular polysaccharide I coding region. Infection and immunity 2012; 80:1209-21. 18. Wacker M, Linton D, Hitchen P G, et al. N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science 2002; 298:1790-3. 19. Eyles J E, Hartley M G, Laws T R, Oyston P C, Griffin K F, Titball R W. Protection afforded against aerosol challenge by systemic immunisation with inactivated Francisella tularensis live vaccine strain (LVS). Microbial pathogenesis 2008; 44:164-8. 20. Ihssen J, Kowarik M, Dilettoso S, Tanner C, Wacker M, Thony-Meyer L. Production of glycoprotein vaccines in Escherichia coli. Microbial cell factories 2010; 9:61. 21. Friedman A M, Long S R, Brown S E, Buikema W J, Ausubel F M. Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants. Gene 1982; 18:289-96. 22. Pedersen C, Petaja T, Strauss G, et al. Immunization of early adolescent females with human papillomavirus type 16 and 18 L1 virus-like particle vaccine containing AS04 adjuvant. The Journal of adolescent health: official publication of the Society for Adolescent Medicine 2007; 40:564-71. 23. Fisher A C, Haitjema C H, Guarino C, et al. Production of secretory and extracellular N-linked glycoproteins in Escherichia coli. Applied and environmental microbiology 2011; 77:871-81. 24. Cuccui J, Thomas R M, Moule M G, D'Elia R V, Laws T R, Mills D C, et al. Exploitation of bacterial N-linked glycosylation to develop a novel recombinant glycoconjugate vaccine against Francisella tularensis. Open Biology. 2013; 3. 25. Karlsson J, Prior R G, Williams K, Lindler L, Brown K A, Chatwell N, et al. Sequencing of the Francisella tularensis strain Schu 4 genome reveals the shikimate and purine metabolic pathways, targets for the construction of a rationally attenuated auxotrophic vaccine. Microbial and Comparative Genomics. 2000; 5(1):25-39. 26. Harper G J, Morton J D. The respiratory retention of bacterial aerosolsexperiments with radioactive spores. Journal of Hygiene. 1953; 51(3):372-85. 27. Guyton A C. Measurement of the respiratory volumes of laboratory animals. American

(113) Journal of Physiology. 1947; 150(1):70-7.