Epitope of hepatitis B virus surface antigen and binding molecule specifically binding to same for neutralizing hepatitis B virus
10507240 ยท 2019-12-17
Assignee
Inventors
- Joon Sun Yoon (Incheon, KR)
- Hwa Jin Lee (Ulsan, KR)
- Kye Sook Yi (Incheon, KR)
- Cheol Min Kim (Bucheon-si, KR)
- Byung Pil Lim (Seoul, KR)
- Shin Jae Chang (Incheon, KR)
- Seung Suh Hong (Seoul, KR)
Cpc classification
A61K39/395
HUMAN NECESSITIES
A61K39/292
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
International classification
A61K39/395
HUMAN NECESSITIES
Abstract
The present invention relates to an epitope specific to hepatitis B virus surface antigen and a binding molecule binding to the same for neutralizing hepatitis B virus. Since the epitope provided by the present invention is produced by forming a three-dimensional structure and does not comprise a determinant, by which escape mutation is induced against an administration of existing vaccines or HBIg, a composition comprising an antibody biding to the epitope or a vaccine composition comprising the epitope has a very low possibility of causing a decrease in efficacy due to escape mutation. Therefore, such an antibody or vaccine composition can be very effectively used in prevention and/or treatment of HBV.
Claims
1. A binding molecule for neutralizing hepatitis B virus (HBV), which specifically binds to an epitope that includes the amino acids at positions 110, 118 and 120 of a hepatitis B virus surface antigen (HBsAg), the amino acid sequence of which antigen is set forth in SEQ ID NO:1, wherein the binding molecule is a human monoclonal antibody or a fragment of such an antibody which comprises a polypeptide sequence comprising the CDR regions of SEQ ID NOS: 5 to 10 or the CDR regions of SEQ ID NOS: 11 to 16.
2. The binding molecule of claim 1, wherein the epitope further includes an amino acid at position 147.
3. The binding molecule of claim 1, wherein the binding molecule has a binding affinity of less than 1?10.sup.?9 M.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
MODE FOR INVENTION
Examples
(12) A better understanding of the present invention may be obtained via the following examples, which are set forth to illustrate, but are not to be construed as limiting the scope of the present invention. The documents cited herein are incorporated by reference into this application.
Example 1: Identification of Binding Site of Inventive Antibody Using Deletion Mutant Antigen
(13) In order to verify the binding site of an inventive antibody to HBsAg, wild-type HBsAg and various deletion mutants of HBsAg were prepared and the binding ability thereof was measured through enzyme-linked immunosorbent assay (ELISA) using phages.
(14) Here, testing was performed in two steps. Particularly, HBsAg (226 a.a) was divided into three regions, namely amino acid sequences 1?100, 101?160, and 161?226, and expression vectors of mutants in which respective regions were deleted and of wild types were prepared (
Example 1-1. Preparation of Expression Vectors of Wild-Type HBsAg and Three Kinds of Mutant HBsAg
(15) In order to express, on the phage surface, wild-type HBsAg and its three divided portions, namely deletion mutant proteins, cloning was performed using a phage expression vector. The detailed testing method was as follows. To clone wild-type HBsAg and mutants having deleted sites, gene amplification was performed therefor through polymerase chain reaction (PCR) using, as a template, an HBV vector including an HBsAg gene base sequence of HBV genotype C (Department of Pharmacology, Konkuk University School of Medicine), followed by treatment with a restriction enzyme Sfi I and then insertion into the phage expression vector treated with the same restriction enzyme. The manufactured plasmid was extracted using a QIAprep Spin Miniprep Kit (QIAGEN, Germany, Cat #27106), and the base sequence of the antibody was ultimately identified through base sequence analysis using the extracted DNA. The names of the completed clones and the HBsAg sites are shown in Table 1 below.
(16) TABLE-US-00001 TABLE 1 Clone information for identifying binding site of inventive antibody HBsAg site Clone name Clone description (amino acid) HBsAg full Wild-type 1~226 Region 2 + 3 Amino acids 1~100 deleted 101~226 Region 1 + 3 Amino acids 101~160 deleted 1~100 & 161~226 Region 1 + 2 Amino acids 161~226 deleted 1~160
(17) In the present Example, the HBsAg wild-type full amino acid sequence of HBV genotype C (subtype adr) is represented by SEQ ID NO:1, and sequence information may be verified in Genbank No. GQ872210.1.
Example 1-2. Evaluation of Binding Intensity of Inventive Antibody to Wild-Type HBsAg and Three Kinds of Mutant HBsAg
(18) To perform the binding test to all or some of the cloned HBsAg, each vector was inserted into expression E. coli (ER2738, Lucigen, USA, Cat #60522-2) through electroporation, and antibiotic (ampicillin)-resistant E. coli selectively began to grow from the next day. After growth for about 10 hr, E. coli was infected with the bacteriophage and another kind of antibiotic (kanamycin) was used to selectively grow the infected E. coli. To extract the bacteriophage on the next day, E. coli was separated using a centrifuge, and the supernatant was treated with polyethylene glycol (PEG) and allowed to stand in an ice bath for 30 min, after which the bacteriophage was separated again using a centrifuge. The separated bacteriophage was lysed, and the supernatant was filtered, thereby extracting a pure bacteriophage having all or some of HBsAg on the surface thereof.
(19) In order to quantitatively evaluate the binding intensity of the inventive antibody to the wild-type and mutant HBsAg exposed to the bacteriophage surface, ELISA was performed. Particularly, an anti-human Fc antibody (Jackson Immunoresearch, USA, Cat #109-006-098) was mixed with a coating buffer (Sigma, USA, Cat # c3041) and a 96-well plate was coated therewith at 4? C. for one day, followed by binding the inventive antibody thereto. Thereafter, the extracted bacteriophage was attached to the inventive antibody and, using an HRP enzyme-conjugated bacteriophage M13 protein antibody (GE healthcare, USA, 27-9421-01) and then 2,2-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, KPL, USA, Cat #50-62-00), the amounts of the bacteriophages having the wild-type and mutant HBsAg bound to the inventive antibody were measured. Here, in order to measure the amounts of all the bacteriophages of individual test groups on which HBsAg was expressed on the surface thereof, an anti-HA antibody (Genescript, USA, Cat # A00168-100) was applied on a 96-well plate at 4? C. for one day, the extracted bacteriophage was attached to the antibody, and measurement was performed in the same manner as above.
(20) As results thereof, only in the Region 1+3 bacteriophage sample in which HBsAg where amino acid positions 101 to 160 were deleted was expressed on the surface thereof was specifically low binding intensity to the inventive antibody observed (
Example 2: Identification of Epitope of Inventive Antibody Using Serial-Deletion Mutant Antigen
(21) In order to identify the epitope based on the major binding site of the inventive antibody as confirmed in Example 1, serial-deletion mutants, in which 15 amino acids were sequentially deleted from the starting amino acid position 101 of Region 2, were prepared and then exposed to the bacteriophage surface, followed by measuring the binding intensity thereof to the inventive antibody through ELISA.
Example 2-1. Preparation of Expression Vectors of Four Kinds of Mutant HBsAg
(22) Mutants in which 15 amino acids each were deleted based on Region 2+3 clones were prepared. The names of the completed clones and the HBsAg sites are shown in Table 2 below (
(23) TABLE-US-00002 TABLE 2 Clone information for identification of epitope of inventive antibody HBsAg site Clone name Clone description (amino acid) Region 2 + 3 Amino acid 1~100 deletion 101~226 Region 2 + 3 Del 1 Amino acid 1~115 deletion 116~226 Region 2 + 3 Del 2 Amino acid 1~130 deletion 131~226 Region 2 + 3 Del 3 Amino acid 1~145 deletion 146~226 Region 2 + 3 Del 4 Amino acid 1~160 deletion 161~226
Example 2-2. Measurement of Binding Intensity of Inventive Antibody and Four Kinds of Mutant HBsAg
(24) ELISA was performed by extracting bacteriophages in which four serial-deletion mutants were exposed to the surface in the same manner as in Example 1-2.
(25) As results thereof, the binding intensity to the inventive antibody was remarkably decreased in Region 2+3 del 1, which means that the major antigenic determinant (epitope) of the inventive antibody is present at amino acid positions 101 to 115 (
Example 3. Identification of Epitope of Inventive Antibody Using Single Amino Acid Mutant Antigen
(26) In order to more accurately identify the epitope of the inventive antibody, random mutagenesis was introduced into HBsAg (subtype adr) using shotgun mutagenesis technology of Integral Molecular, USA (J Am Chem Soc. 2009; 131(20): 6952?6954), so that the binding ability of the inventive antibody to each mutant antigen was measured. The characteristics of the library of the mutant antigen used for the testing are shown in Table 3 below. Each clone of the library manufactured was expressed in HEK-293T cells incubated on a 384-well plate.
(27) TABLE-US-00003 TABLE 3 Characteristics of HBsAg random mutagenesis library used for epitope identification test Total clone number of library 456 Mutagenized HBsAg residue number (total 226) 226 (100%) Mutagenized clone number in one residue 367 Mutagenized clone number in two residues 78 Mutagenized clone number in three or more residues 11
Example 3-1: Verification of Epitope of Antibody
(28) The binding ability of the inventive antibody to the mutant antigen was measured three times through immunofluorescence FACS, and normalization was implemented based on the reactivity to wild-type HBsAg. Also, the results of binding ability using orb43805, which is a mouse monoclonal antibody against HBsAg, as a control antibody, were employed to confirm the reliability of test results and to set the criteria for epitope selection. Specifically, the mutant residue, present in the clone in which the binding reactivity to the inventive antibody was less than 15% (<15% WT) compared to wild-type HBsAg while the binding reactivity to orb43805 as the control antibody was 55% or more (>55% WT) compared to the binding reactivity to wild-type HBsAg, was selected as the critical residue essential for the binding of the inventive antibody.
(29) Based on the test results, the critical residues for the inventive antibody were derived from a total of four mutant antigens, and thus, the epitope of the inventive antibody was confirmed to have amino acids at positions 110, 118, 120 and 147 of HBsAg. The detailed test results are shown in Table 4 below.
(30) TABLE-US-00004 TABLE 4 Critical residues of HBsAg to inventive antibody Binding reactivity (% WT) Mutant Inventive antibody orb43805 L110P 7.9 75.7 T118A 8.3 56.3 P120L 5.7 61.4 C147R 9 98.6
(31) Among them, the amino acid at position 110 is included in the binding site identified through the testing of Example 2 and thus can be concluded to be a critical epitope for the inventive antibody. The amino acids at positions 118, 120 and 147 are absent in the binding site identified through the testing of Example 2. In the case of deletion testing, however, conformational changes may occur due to the removal of many amino acids, and thus the likelihood that some epitopes may not be identified is high.
(32) Particularly, HBsAg maintains a three-dimensional structure via disulfide bonds such as C107-C138, C139-C147 and so on. When such bonding is damaged due to the deletion mutant of Example 2, the original structure is broken to thus affect the antibody bonding. In the present Example, the epitope residue, which was not found in the deletion testing of Example 2, was identified through the single mutation testing (
Example 4: Identification of Characteristics of Epitope of Inventive Antibody
(33) In order to verify whether the conformational epitope is formed from the binding site proven through Examples 1, 2 and 3, Western blot was performed. Here, using both sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel corresponding to the protein denaturation conditions and Native-PAGE gel corresponding to the non-denaturation conditions, the binding intensity difference of the inventive antibody depending on the structure of HBsAg was measured. In particular, formation of the conformational epitope was observed upon non-linearization and upon linearization by removing a disulfide bond important for forming the tertiary structure of HBsAg, in the presence or absence of the reducing agent under the protein denaturation conditions.
(34) 4-1. Western Blot Assay Using Native-PAGE
(35) In order to evaluate whether the inventive antibody was able to recognize the conformational epitope of HBsAg which was naturally formed, Western blot was performed using NativePAGE gel having no SDS. Particularly, a solution containing HBsAg was mixed with a NativePAGE? Sample Buffer (Invitrogen, USA, Cat # BN2003) and a NativePAGE? 5% G-250 Sample Additive (Invitrogen, USA, Cat # BN2004), and then loaded on a NativePAGE? Novex? 3-12% Bis-Tris Protein Gel (Invitrogen, USA, Cat # BN1003BOX). After the gel was run for about 2 hr, the protein of the gel was transferred to a PVDF membrane (Invitrogen, USA, Cat # LC2002) using a NuPAGE? Transfer Buffer (Invitrogen, USA, Cat # NP0006). The membrane was blocked with a phosphate-buffered saline (PBS)-Tween20 buffer including 5% skim milk for 1 hr, after which a primary antibody was added to a PBS-Tween20 buffer including 3% skim milk and the membrane was refrigerated overnight therewith. Here, as a positive control for the inventive antibody, the standard of World Health Organization (WHO) (WHO International Standard for anti-HBs immunoglobulin, human (code: 07/164)) was used, and as a negative control, anti-HER2 antibody, which is a humanized antibody against human epidermal growth receptor2 (HER2), was used. The membrane was sufficiently washed with a PBS-Tween20 buffer, and as a secondary antibody, Horseradish peroxidase (HRP)-conjugated anti-human Fc (Thermo Scientific, USA, Cat #31413) was mixed with a PBS-Tween20 buffer including 3% skim milk and then treated for 1 hr. The membrane was sufficiently washed with a PBS-Tween20 buffer and then treated with an enhanced chemiluminescent (ECL) substrate, after which the binding of HBsAg and each tested antibody was observed using ChemiDoc (BioRad, USA).
(36) Based on the test results, HBsAg, the natural tertiary structure of which was maintained, exhibited very high binding intensity to the inventive antibody (
(37) Meanwhile, the molecular weight of HBsAg is known to be about 23 kd and the molecular weight of HBsAg bound to the antibody in this test was very large, wherein the formation of native HBsAg in a specific form (a subviral particle having a size of 22 nm) through spontaneous assembly is well known, which can be concluded to be a natural phenomenon (Ira Berkower et al., J Virol., March 2011; 85(5): 2439-2448).
(38) 4-2. Western Blot Assay Using SDS-PAGE
(39) In order to more clearly assay the conformational characteristics of the epitope to the inventive antibody, Western blot was performed using SDS-PAGE gel and a reducing agent. The overall test procedures were the same as in Example 4-1, and are briefly described below.
(40) First, an HBsAg solution was mixed with an SDS-PAGE sample buffer, reacted at 95? C. for 5 min, and then loaded on a 4-20% Mini-PROTEAN TGX Precast gel and the gel was run. Here, two kinds of loading samples were prepared, one of which was added with a reducing agent (NuPAGE Sample Reducing Agent (10?), Life Technologies, USA) to thus induce complete protein denaturation, and the other of which did not include a reducing agent to maintain a disulfide bond of HBsAg to thus cause incomplete denaturation. After running, HBsAg was transferred to a nitrocellulose (NC) membrane, blocked, and refrigerated with a primary antibody overnight. Examples of the primary antibody include the inventive antibody, WHO standard, HBIg (Hepabig, Green Cross, Korea), and anti-HER2 antibody. The subsequent procedures were the same as above, and the description thereof is omitted.
(41) As results thereof, the inventive antibody was not attached to the completely linearized HBsAg having no disulfide bond, and was efficiently attached to HBsAg in which partial denaturation occurred. The WHO standard and HBIg serving as the positive controls are polyclonal antibodies as described in Example 4-1, and include the antibody able to recognize a linear epitope and are thus well bound to HBsAg, which is completely linearized under the reducing conditions. The anti-HER2 antibody was not bound regardless of the structure of HBsAg. In the tertiary structure of HBsAg, the importance of the disulfide bond formed in the protein or between proteins is widely known (Mangold C M et al., Arch Virol., 1997; 142(11):2257-67).
(42) Therefore, maintaining the tertiary structure of HBsAg through disulfide bonding is essential for the binding of the inventive antibody, and thus the inventive antibody can be concluded to recognize the conformational epitope of HBsAg.
Example 5: Evaluation of Binding Activity of Inventive Antibody to Various Mutant Antigens of ?-Determinant
(43) In order to evaluate the binding activity of the inventive antibody to four mutant antigens of the ?-determinant, ELISA was performed. These antigens, which were those mutated at amino acid positions 126, 129, 133, and 143, are found in escape mutants induced by vaccines or hepatitis B immune globulin (HBIg) reported in patients with chronic hepatitis B and also cause problems in which the measurement of surface antigen is difficult upon diagnosis (Horvat et al., Lab medicine, vol. 42(8): 488-496, 2011). The recombinant proteins of such antigens were purchased from ProSpec Bio.
(44)
(45) TABLE-US-00005 TABLE 5 ELISA results of binding activity of inventive antibody 1, 2 to mutant HBsAg of a-determinant HBsAg Inventive antibody 1 Inventive antibody 2 adw T126N + + adw Q129H + + adw M133H + + adw T143K + +
(46) As test results thereof, the inventive antibody 1, 2 had binding ability to various kinds of mutant HBsAg of the ?-determinant. Since the inventive antibody is able to recognize the epitope at positions 110, 118, 120 and/or 147 of HBsAg, it may not be affected by an ?-determinant having a high mutation rate (amino acids 124-147).
(47) The amino acid at position 147 is a residue important for forming the conformation, and the mutation of such a residue is known to have a severe influence on infectivity, and thus the actual mutation rate is expected to be very low.
(48) Therefore, the vaccine composition including the epitope at positions 110, 118, 120 and/or 147 or the antibody binding to the above epitope has a low likelihood of decreasing the efficacy due to the escape mutants, and is useful in the prevention or treatment of HBV.
Example 6: Verification of In-Vitro Neutralizing Activity Against HBV
(49) In order to verify the neutralizing activity of the inventive antibody against various genotypes of HBV, an in-vitro neutralization assay was performed.
(50) An in-vitro neutralization test for HBV is a method of evaluating the neutralizing activity of an antibody by measuring the amounts of intracellular and extracellular viruses at the most active stage of viral proliferation, in order to evaluate the extent of inhibiting the infection of human hepatocytes with virus depending on the treatment conditions of each antibody. The amount of intracellular virus was measured from the amount of HBV DNA that was proliferated, and the amount of virus that was proliferated and excreted extracellularly was measured from the amounts of HBsAg and HBV DNA in the medium. Here, an HBV DNA was quantified through real-time PCR using a TaqMan probe and HBsAg was quantified through chemiluminescent immunoassay (CLIA).
(51) 6-1. 1.sup.st In-Vitro Neutralization Test
(52) Human hepatocytes necessary for infection with HBV were prepared through two-step collagenase perfusion from uPA/SCID chimeric mouse with humanized liver tissue the day before viral inoculation. The separated hepatocytes were applied at a concentration of 4?10.sup.5 per well on a 24-well plate coated with Type 1 collagen. As the culture medium, 500 ?l of DMEM (Gibco, USA, 11965), including 10% FBS (Atlas Biologicals, USA, F0500A), lx penicillin/streptomycin (Gibco, USA, 15140) and 20 mM HEPES (Gibco, USA, 15630), was used per well. The prepared hepatocytes were incubated in a 5% CO.sub.2 humidified cell incubator at 37? C. for 24 hr.
(53) Viral infection was carried out in a manner in which four genotypes of HBV, referred to as A (Genbank accession number: AB246345.1), (Genbank accession number: AB246341), (Genbank accession number: AB246338.1), and D (Genbank accession number: AB246347), each of which was produced from chimeric mice having humanized liver tissue, were mixed with the inventive antibody and then applied at a viral concentration of 2?10.sup.6 per well. The detailed description thereof is as follows.
(54) A. Preparation of Viral Inoculation Mixture
(55) The virus and each antibody were mixed so that the final volume was 100 ?l using a dHCGM medium (DMEM+10% FBS, 44 mM NaHCO.sub.3, 15 ?g/ml L-proline, 0.25 ?g/ml insulin, 50 nM dexamethasone, 5 ng/mM EGF, 0.1 mM Asc-2p, 2% DMSO), and were then reacted at room temperature for 1 hr. Here, the viral concentration was 2?10.sup.6, and the inventive antibody was diluted at four concentrations of 10, 1, 0.1, and 0.01 ?g/ml.
(56) B. Viral Inoculation
(57) 125 ?l of a dHCGM medium and 25 ?l of 40% PEG (Sigma, USA, P1458) were mixed and added with the virus/antibody mixture prepared in A above, thus obtaining 250 ?l of the final inoculation mixture. The culture medium was removed from the prepared cells and the inoculation mixture was introduced, followed by incubation for 24 hr.
(58) C. Medium Exchange and Culture, and Preparation of Analytical Sample
(59) After viral inoculation, the hepatocytes were incubated for a total of 12 days, and cell washing and medium exchange were performed on the 1.sup.st day, 2.sup.nd day, and 7.sup.th day. The existing culture medium was removed, washing was performed with 500 ?l of DMEM+10% FBS, and the same amount of dHCGM medium was newly placed. As for the medium exchange on the 7.sup.th day, the existing culture medium was collected in respective amounts of 300 ?l and 30 ?l to quantify extracellular HBsAg and HBV DNA excreted from the cells, and stored at ?20? C. until analysis.
(60) After the completion of incubation for 12 days, all of the cells and the medium were used for intracellular/extracellular viral quantitative analysis. The culture medium was separately collected for measurement of HBsAg and HBV DNA in the same manner as before, and the cells were collected in a manner in which each well was washed once with 500 ?l of DMEM+10% FBS and then lysed with 500 ?l of a SMITEST (Medical & Biological Laboratories Co., Ltd.) solution. The extraction of HBV DNA was performed according to the protocol of the manufacturer (Medical & Biological Laboratories Co., Ltd.).
(61) D. Sample Analysis
(62) The quantification of HBV DNA was performed through real-time PCR using a TaqMan probe, TaqMan PCR Core Reagents (Life Technologies, USA), and an ABI Prism 7500 sequence detector system (Applied Biosystems, USA). Also, HBsAg was quantified through ARCHITECT (Abbott, USA) as a CLIA-aided automatic system.
(63) TABLE-US-00006 TABLE6 Primer/probesequenceforreal-timePCRforHBV quantification Primer/ SEQ Probe Sequence IDNO: Forward CACATCAGGATTCCTAGGACC 2 primer Reverse AGGTTGGTGAGTGATTGGAG 3 primer TaqMan CAGAGTCTAGACTCGTGGTGGACT-TC 4 probe (Dye:FAMfor5,TAMRAfor3)
(64) TABLE-US-00007 TABLE 7 Real-time PCR program Program Cycle 50? C. 2 min 1 95? C. 10 min 1 95? C. 20 sec .fwdarw. 60? C. 1 min 53 Threshold 0.1
(65) The test results for the inventive antibodies 1, 2 are shown in
(66) The amounts of intracellular HBV DNA depending on the treatment concentration of each antibody were compared and analyzed. Particularly, the inventive antibodies 1, 2, which were chosen based on the binding intensity to HBsAg subtype adr of genotype C, can be found to have strong neutralizing activity against genotype C. In the state in which the amount of HBV DNA was decreased by at least 400 times in HBIg serving as the positive control compared to the anti-HER2 antibody serving as the negative control, the same level of viral DNA reduction was also exhibited in the sample treated with 1 ?g/ml inventive antibody 2, corresponding to 1/10 of the treatment amount thereof. As for the inventive antibody 1, the amount of HBV DNA was decreased by 100 times even at a low treatment concentration of 0.1 ?g/ml, thus maintaining relatively high neutralizing activity. Furthermore, the neutralizing activity of the inventive antibodies 1, 2 against genotypes A and B was more than twice as high as the maximum neutralizing activity compared to when HBIg was used as the positive control, and the neutralizing activity against genotype D was maintained high even at a low concentration of 0.1 ?g/ml (inventive antibody 1) or 1 ?g/ml (inventive antibody 2) (
(67) The neutralizing activity of the inventive antibodies 1, 2 against four genotypes A, B, C and D was found to be very similar to the quantitative results of extracellular HBsAg measured in the culture medium (
(68) Conclusively, based on the results of measurement of in-vitro neutralizing activity against four genotypes A, B, C, and D of HBV, the inventive antibodies 1, 2 manifested high neutralizing activity against all the viruses used.
Example 7: Measurement of Binding Characteristics to Various Virus Surface Antigen Genotypes Derived from Chronic Hepatitis B Patients
(69) In order to evaluate whether the inventive antibodies 1, 2 may exhibit neutralizing activity through binding to various virus genotypes prevailing worldwide in real-world applications, sandwich ELISA was performed using a reference panel of World Health Organization (WHO) (1.sup.st WHO International Reference Panel for HBV Genotypes for HBsAg Assays, PEI code 6100/09) comprising various virus surface antigen genotypes derived from patient sera. The detailed information on the corresponding standard is shown in Table 8 below, and the testing method is as follows.
(70) Two antibodies having a concentration of 2 ?g/ml were aliquoted in amounts of 100 ?l to each well of a 96-well microtiter plate (Nunc, Denmark, 449824) coated with anti-human IgG Fc? (gamma) antibody (Jackson ImmunoResearch, U.S.A, 109-006-098) and then adsorbed thereto. After washing, the plate was treated with phosphate-buffered saline (Teknova, USA, D5120) containing 3% bovine serum albumin (BSA) and thus blocked. After washing again, 15 serum samples of the HBsAg genotype panel were aliquoted in amounts of 100 ?l each and incubated at 37? C. for 90 min. Here, each serum sample was appropriately diluted with phosphate-buffered saline (Teknova, USA, D5120) containing 1% BSA so as to have an absorbance of about 0.8 to 1.2 at 450/620 nm. To detect HBsAg attached to the antibody, peroxidase-labeled rabbit anti-HBV surface antigen antibody (Thermo Scientific, U.S.A., PA1-73087) was treated at 37? C. for 60 min. Color development, reaction termination, and absorbance measurement were performed in the same manner as in Example 5. The reactivity of two antibodies to each HBV surface antigen genotype was graphed and analyzed using Excel (Microsoft, U.S.A.) (
(71) Based on the analytical results, both of the inventive antibodies 1, 2 were efficiently bound to 15 HBsAg samples. As described above, such surface antigen samples were sera actually prepared from patient blood, and covered seven genotypes A to H excluding genotype G, among a total of eight HBV genotypes. Also, the genotypes A, B, C, D, and F having various sub-genotypes include two to three samples of sub-genotypes and subtypes (serotypes) that were predominant for each genotype, which means that the HBV genotype panel of WHO used for the testing substantially represents most HBV genotypes prevalent around the world. The panel does not include genotype G, but genotype G has no sub-genotype that has been reported to date and is characterized as subtype (serotype) adw2, and thus the binding activity of the inventive antibodies 1, 2 to genotype G is predictable based on the test results of the five adw2 samples included in the panel.
(72) Therefore, the inventive antibodies 1, 2 exhibited superior binding activity to all 15 samples, which means that these two antibodies are able to bind to all HBV genotypes worldwide to thus manifest the corresponding neutralizing activity.
(73) TABLE-US-00008 TABLE 8 Detailed information of patient-derived serum HBV surface antigen panel (1.sup.st WHO International Reference Panel for HBV genotypes for HBsAg assays, PEI code 6100/09) Sample # Origin Genotype sub-genotype Subtype 1 South Africa A A1 adw2 2 Brazil A1 adw2 3 Germany A2 adw2 4 Japan B B1 adw2 5 Japan B2 adw2 6 Japan C C2 adr 7 Japan C2 adr 8 Russia C2 adr 9 Germany D D1 ayw2 10 Russia D2 ayw3 11 South Africa D3 ayw2 12 West Africa E N/A ayw4 13 Brazil F F2 adw4 14 Brazil F2 adw4 15 Germany H N/A adw4
Example 8: Evaluation of Binding Characteristics to Various Drug-Resistant Viruses
(74) The binding characteristics between the inventive antibodies 1, 2 and mutants resistant to HBV polymerase inhibitors widely useful for chronic hepatitis B patients, for example, lamivudine (LMV), adefovir (ADV), clevudine (CLV), and entecavir (ETV), were measured using the same sandwich ELISA as in Example 7. All resistant mutant viruses including the wild-type virus used in the testing were those cloned in the Department of Pharmacology, Konkuk University School of Medicine, using HBV DNA obtained from the blood of patients having resistance to the corresponding drug treatment, and are stains, the drug resistance of which was experimentally confirmed through transduction using a Huh7 cell line or a HepG2 cell line (Ahn et al., Journal of Virology, 88(12): 6805-6818, 2014). All viruses are genotype C, and the features of individual viruses are shown in Table 9 below.
(75) Each HBV expression vector thus prepared was transduced into the Huh7 cell line grown in a T75 flask (BD BioScience, 353136) using Lipofectamine2000 (Life technologies, 11698019), and incubated for 3 days to thus produce viruses. The produced viruses were concentrated using Centricon (Millipore, U.S.A.), and the viral amount of each sample was compared with the amount of HBsAg using a Monolisa HBsAg Ultra (BioRad, 72346) ELISA kit and then appropriately diluted so as to have similar values and thus used for testing.
(76) Based on the test results, both of the inventive antibodies 1, 2 were shown to have binding activity to lamivudine (LMV)-, adefovir (ADV)-, clevudine (CLV)-, and entecavir (ETV)-resistant viruses at the same level as in the wild-type virus (
(77) This means that the inventive antibodies 1, 2 are able to have binding activity and neutralizing activity not only to one kind of drug-resistant virus used for the test but also to most viruses resistant to the corresponding drugs. This is because the mutation that causes drug resistance to HBV is associated with the specific amino acid mutation of the reverse transcriptase (RT) domain of the HBV polymerase, as shown in Table 9, and such mutation occurs very specifically for each drug. Such specific polymerase mutation includes the specific mutation of HBsAg based on the characteristics of gene-sharing HBV. For example, rtM204I mutation of polymerase results in W196L mutation of HBsAg, and rtA181V mutation results in L173F mutation of HBsAg. The inventive antibodies 1, 2 can be found to be efficiently bound regardless of the surface antigen mutation resulting from the drug resistance mutation.
(78) Furthermore, individual resistant viruses used in this test have many surface antigen mutations that non-specifically occurred, in addition to the aforementioned resistance-specific surface antigen mutations (Table 9). This result shows that the inventive antibodies 1, 2 have the binding and neutralizing activities to viruses in which the Q101R, K112R, I126S, L175S, A184V, I185M positions of HBsAg are mutated.
(79) TABLE-US-00009 TABLE 9 Drug-resistant virus information used for test Mutation position of HBV polymerase Mutation position Strain (RT domain) of HBsAg Wild type (genotype C) N/A N/A LMV-resistant virus L80I, M204I W196L ADV-resistant virus A181V I126S, L173F, L175S CLV-resistant virus M204I Q101R, I126S, A184V, W196L ETV-resistant virus L180M, M204V Q101R, K112R, I185M
Example 9: Measurement of Antigen-Antibody Binding Affinity
(80) In order to measure the antigen-antibody binding affinity of the inventive antibody, surface plasmon resonance (SPR) was performed. Particularly, the binding affinity of recombinant HBsAg (subtype adr, ProSpec Bio) and the inventive antibody was determined through SPR analysis by means of a Biacore T200 (GE Healthcare) using an analytical buffer HBS-EP (10 mM HEPES [pH 7.4], 150 mM NaCl, 3 mM EDTA and 0.005% surfactant P20) at 25? C. 50 ?g/ml HBsAg protein diluted in 10 mM sodium acetate (pH 5.0) was directly fixed by about 500 RU to a biosensor chip for CMS research using an amine coupling kit according to the protocol and procedure of the manufacturer. The portion not reacted on the surface of the biosensor was blocked with ethanolamine. For reaction analysis, Biacore T200 control software and Biacore T200 evaluation software were used. The inventive antibody was diluted in an HBS-EP buffer. During the testing, the biosensor surface having no fixed-HBsAg was used as a control in all measurements. The association and dissociation rate constants Ka (M-1s-1) and Kd (s-1) were determined at a flow rate of 30 ?l/min. The rate constant was obtained with 3-fold serial dilutions by measuring the reaction binding at an antibody concentration of 2.46 to 200 nM and using the buffer as a control. Subsequently, the equilibrium dissociation constant KD(M) for the reaction between the antibody and the target antigen was calculated from the reaction rate constant using the following Equation: KD=Kd/Ka. The binding was recorded by calculating as a function of time and the reaction rate constant.
(81) The test results are shown in Table 10 below, from which the high binding affinity of the inventive antibody to HBsAg was confirmed.
(82) TABLE-US-00010 TABLE 10 Measurement of binding affinity using recombinant HBsAg Sample ka1(1/Ms) kd1(1/s) KD AVR KD Inventive antibody 9.04E+04 6.33E?05 7.00E?10 7.45E?10 8.12E+04 6.42E?05 7.90E?10