PERMANENT GENE CORRECTION BY MEANS OF NUCLEOTIDE-MODIFIED MESSENGER RNA
20190376051 · 2019-12-12
Assignee
- EBERHARD KARLS UNIVERSITÄT TÜBINGEN MEDIZINISCHE FAKULTÄT (Tübingen, DE)
- Helmholtz-Zentrum für Infektionsforschung GmbH für das Helmholtz-Institut für Pharmazeutische (Saarbrücken, DE)
Inventors
- Michael Kormann (Weil im Schönbuch, DE)
- Lauren Mays Weddle (Newport, KY, US)
- Claus-Michael LEHR (Saarbrücken-Dudweiler, DE)
- Brigitta LORETZ (Saarbrücken, DE)
- Emad Malaeksefat (Heidelberg, DE)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a nucleotide-modified messenger RNA for the permanent correction of a genetic alteration on a DNA. The invention further relates to a nucleotide-modified messenger RNA in combination with a repair template. It also relates to a pharmaceutical composition. It finally relates to methods for the correction of a genetic alteration on a DNA.
Claims
1. A nuclease-encoding nucleotide-modified messenger RNA (nec-mRNA) configured for preconditioning the correction of a genetic alteration on a DNA, wherein in the nec-mRNA up to including approx. 50% of the uridine nucleotides and up to including approx. 50% of the cytidine nucleotides are modified by exchanging uridine for 2-thiouridine (s2U) or pseudouridine (), and by exchanging cytidine for 5-methylcytidine (m5C).
2. (canceled)
3. The nec-mRNA of claim 1, wherein the genetic alteration exists in a lung protein.
4. The nec-mRNA of claim 3, wherein the genetic alteration exists in a surfactant protein.
5. The nec-mRNA of claim 4, wherein the genetic alteration exists in a lung protein selected from the group consisting of surfactant protein B (SP-B), cystic fibrosis transmembrane and conductance regulator (CFTR), and Foxp3.
6. The nec-mRNA of claim 1, wherein the nuclease is configured in such a way that it can bind upstream or downstream of the genetic alteration on the DNA.
7. The nec-mRNA of claim 1, wherein the nuclease is selected from the group consisting of: zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEN), CRISPR/Cas9, and dimeric CRISPR RNA guided Fokl nucleases.
8. The nec-mRNA of claim 1, wherein the nec-mRNA is coupled to an aptamer.
9. The nec-mRNA of claim 1, wherein the nec-mRNA is packed into a nanoparticle.
10. The nec-mRNA of claim 9, wherein the nanoparticle is coated with chitosan.
11. The nec-mRNA of claim 1 associated with a repair template.
12. The nec-mRNA of claim 11, wherein the repair template comprises a nucleotide section which is exchangeable by homologous recombination (HR) against a section on the DNA comprising the genetic alteration.
13. The nec-mRNA of claim 12, wherein the repair template is one of the following: packed into an adeno-associated viral vector (AAV), encoded by a plasmid DNA, packed into a lentiviral vector, and packed into a protein-capped adenoviral vector (AdV).
14. A pharmaceutical composition comprising the nuclease-encoding nucleotide-modified messenger RNA (nec-mRNA) of claim 1.
15. The pharmaceutical composition of claim 14, which further comprises a repair template.
16. The pharmaceutical composition of claim 15 that is configured for the treatment of a lung disease selected from the group consisting of: surfactant protein B deficiency, cystic fibrosis (CF), asthma, and chronic obstructive pulmonary disease (COPD).
17-18. (canceled)
19. A method for the correction of a genetic alteration on a DNA comprising the following steps: (1) introducing a repair template into a DNA-containing cell, which comprises the genetic alteration to be corrected, and (2) introducing the nec-mRNA of claim 1 into the cell.
20. The method of claim 19, wherein the cell is a lung cell and the introduction is realized by means of high pressure application of the repair template and the nec-mRNA into the lung.
21. The method of claim 20, wherein the nec-mRNA is the nec-mRNA of claim 11.
22. A method for the correction of a genetic alteration on a DNA comprising the following steps: (1) introducing a repair template into a living being having a genetically altered DNA to be corrected, and (2) introducing the nec-mRNA of claim 1 into the living being.
23. The method of claim 22, wherein the introduction is realized by means of high pressure application of the repair template and the nec-mRNA into the lung of the living being.
24. The method of claim 23, wherein the nec-mRNA is the nec-mRNA of claim 11.
25. The pharmaceutical composition of claim 14, which comprises the nec-mRNA of claim 1, wherein the nec-mRNA encodes a nuclease which is configured in such a way that it can bind upstream or downstream of the genetic alteration on the DNA.
26. The pharmaceutical composition of claim 25, wherein the nec-mRNA is packed into a nanoparticle.
27. The pharmaceutical composition of claim 26, wherein the nanoparticle is coated with chitosan.
28. The pharmaceutical composition of claim 27, which further comprises a repair template.
29. The pharmaceutical composition of claim 14, which comprises the nec-mRNA of claim 1, wherein the nuclease is selected from the group consisting of: zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALEN), CRISPR/Cas9, and dimeric CRISPR RNA guided Fokl nucleases.
30. The pharmaceutical composition of claim 29, wherein the nec-mRNA is packed into a nanoparticle.
31. The pharmaceutical composition of claim 30, wherein the nanoparticle is coated with chitosan.
32. The pharmaceutical composition of claim 31, which further comprises a repair template.
33. The pharmaceutical composition of claim 14, which comprises the nec-mRNA of claim 1, wherein the nec-mRNA is coupled to an aptamer.
34. The pharmaceutical composition of claim 33, wherein the nec-mRNA is packed into a nanoparticle.
35. The pharmaceutical composition of claim 34, wherein the nanoparticle is coated with chitosan.
36. The pharmaceutical composition of claim 35, which further comprises a repair template.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
DESCRIPTION OF PREFERRED EMBODIMENTS
[0075] 1. Optimizing the nec-mRNA
[0076] In Kormann et al. (2011; cit. loc.) it is described that the replacement of 25% of each uridine and cytidine in the mRNA by 2-thiouridine and 5-methylcytidine in the SP-B deficient mouse results in a significantly stable and low immunogenic SP-B mRNA. The inventors have tested in an experiment whether the portion of modified nucleotides can be further reduced. The result of such an experiment is shown in
[0077] In a first approach the inventors have manufactured an mRNA encoding the red fluorescent protein (RFP), where different levels of uridine and cytidine were replaced by 2-thiouridine (s2U) and 5-methylcytidine (m5C), namely 25% of each, 10% of each, and 100% of m5C and 10% of s2U. With these RNA molecules A-549 cells were transfected and after 24 hours the median of the fluorescence intensity (MIT) as the size of the transfection efficiency and a positive expression were measured. The result is shown in
[0078] In a further approach the immunogenicity of the modified mRNA molecules was examined. For this purpose, in addition to the s2U and m5C modified mRNAs also pseudouridine (Psi) modified mRNA molecules were manufactured which all encode zinc-finger nucleases (ZFN-5; both directions). With the chemically-modified mRNAs PBMCs were transfected via liposome fusion (Lipofectamin-2000). In the following, in an ELISA the expression of IFN-alpha was measured as a rate for the immunogenicity. The result is shown in
[0079] The low replacement of modified nucleotides has the advantage that the nec-mRNA is producible in a significantly cheaper manner than the nucleotide-modified mRNAs of the prior art where considerably higher portions of the nucleotides are replaced. It has further the advantage that the efficiency of the translation is optimized. [0080] 2. Principle of the Permanent Gene Correction by the Use of nec-mRNA
[0081] The inventors have developed a system to achieve a permanent correction of the gene loci which are present in mutated form in several diseases such as severe congenital lung diseases, in order to allow a stable lifelong expression of the corrected protein. This system is shown in
[0083] Next, it was examined whether a modified mRNA encoding a nuclease can catalyze an effective gene correction in the lung cell of the mouse in vivo. For this purpose, experiments were performed with a mouse having SP-B deficiency. The employed mouse model is described in detail in Kormann et al. (2011; cit. loc.).
[0084] To this end, the inventors designed an mRNA encoding a TALEN pair which is specific for the SP-B locus. Furthermore, a repair template was designed which is encoded by an adeno-associated viral vector (AAV). It comprises a constitutive promoter upstream of the SP-B cDNA to make the gene expression independent from doxycycline. The repair template is schematically shown in
[0085] The nucleotide-modified mRNA (25% s2U/m5C) and the vector-encoded repair template were administered into the lung of the mice via a singular high pressure application. In the following, the delivery of doxycycline was stopped which causes acute respiratory failure in the mice and, as a consequence, determines the life span of the mice. The result is shown in
[0087] In a further experiment it should be examined whether and to which extent a replacement or a correction of the genetic alteration on the DNA can be obtained. For this purpose, the DNA of SP-B fibroblasts was cleaved by TALEN, encoded by modified mRNA, and a repair template with a Nhel restriction site was introduced. In the following, the extent of the homologous recombination was measured. The result is shown in
[0089] TALEN and ZFN reagents. TALENs and ZFNs targeting the transgenic SP-B cassette were screened by Dual Luciferase Single Strand Annealing Assay (DLSSA) and assembled using an archive of zinc-finger proteins, as previously described; Urnov, F.D. et al. Nature 435, 646-651 (2005). The full amino acid sequences of the Z3 pair are shown in
[0090] Dual Luciferase Single Strand Assay (DLSSA). ZFNs were screened using a luciferase-based reporter system. This reporter-based assay system is composed of four mammalian expression vectors each under the control of the cytomegalovirus (CMV) immediate early promoter. The vectors are (1) ZFN1, (2) ZFN2, (3) pDLSSA-Firefly, and (4) pDLSSA-Renilla. pDLSSA-Firefly vector contains a Firefly luciferase gene derived from the pGL3-Promoter vector (www.promega.com) with an internal 600 bp duplication of the middle part of the Firefly luciferase gene. DNA fragments that contain individual ZFN pair binding sites are inserted between these duplicated regions. pDLSSA-Renilla is derived from pRL-TK (www.promega.com) and expresses the Renilla luciferase gene. One day before transfection, 20,000 mouse Neruo2A cells (www.atcc.org) are seeded in a 96-well plate with Dulbecco's Modified Eagle Medium (DMEM; www.cellgro.com) plus 5 mM L-glutamine and 10% FBS. The four expression vectors described above (6.25 ng each) are co-transfected using Lipofectamine 2000 (Life Technologies). ZFN cleavage of the target plasmid followed by 5 to 3 end resection generates single-stranded DNA from the duplicated portion of the Firefly luciferase gene. Annealing of this complementary DNA and subsequent DNA repair creates an intact Firefly luciferase gene that reports the activity of the test ZFNs. Detection of Renilla luciferase serves as an internal control and allows for normalization of intra-transfection variability. Cells are harvested 24-hours post-transfection and the activities of both Firefly and Renilla luciferase are measured using the Dual-Glo Luciferase System (www.promega.com). ZFN activity is scored as the ratio of Firefly luciferase activity to Renilla luciferase activity.
[0091] Targeting vectors. The targeting vector carrying the CAG promoter was assembled from synthetic oligonucleotides (www.lifetechnologies.com) and PCR products, and was verified by sequencing. The Nhel RFLP donor plasmid was constructed by removing the CAG promoter from the targeting vector by Nhel digestion, leaving a single Nhel restriction site, which was used in the RFLP assays.
[0092] Cell culture and transfection. For the T7 and HDR assays 110.sup.6 fibroblasts in 6-well plates were transfected as indicated in the respective figure legends using the Neon electroporation system (www.lifetechnologies.com) with 100 l tips. The electroporation settings were 1,650 Volts, 20 ms, 1 pulse. A549 cells (human ATII cells, the cell type responsible for SP-B expression in the lungs) were maintained at 37 C. under 5% CO.sub.2 and grown in minimal essential medium (www.lifetechnologies.com), supplemented with 10% FCS, 1% penicillin-streptomycin. One day before transfection, 50,000 or 80,000 cells/well/500 l were plated in 24-well plates. The cells (70-90% confluent) were transfected with 5 g (T7 assays, fragment analyses and RFLP) or 1 g Z3 pair nec-mRNA (time-course experiment) using Neon electroporation (www.lifetechnologies.com) with a transfection mix volume of 100 l according to manufacturer's instructions or transduced with MOI of 110.sup.5 v.g. of each Z3 AAV6. For transfection experiments demonstrated in
[0093] Generation of (nec-)mRNA. To generate templates for in vitro transcription the 3xFLAG-tagged T1 and Z3 were cut out of their original vectors and subcloned into a PolyA-120 containing pVAX1 (www.lifetechnologies.com). The plasmids were linearized with Xbal and transcribed in vitro using the MEGAscript T7 Transcription kit (www.lifetechnologies.com), incorporating 25% 2-thio-UTP and 25% 5-methyl-CTP or 100% PseudoUTP and 100% 5-methyl-CTP (all from www.trilink.com). The anti reverse CAP analog (ARCA) capped synthesized nec-mRNAs were purified using the MEGAclear kit (www.lifetechnologies.com) and analyzed for size on agarose gels and for purity and concentration on a NanoPhotometer (www.implen.com).
[0094] T7 nuclease assay. Genomic DNA was extracted from fibroblasts using the DNeasy Blood & Tissue Kit (www.qiagen.com). A 50 l PCR reaction was set up using 100 ng of gDNA derived from fibroblasts previously transfected with 5 g T1 or Z3 pair, 0.5 M primers (for T1: fwd, GTAGGCGTGTACGGTGGGAG [SEQ ID No. 1]; rev, CAGCAGAGGGTAGGAAGCAGC [SEQ ID No. 2]; for Z3: fwd, TGTACGGTGGGAGGCCTAT [SEQ ID No. 3]; rev, CCTGGCAGGTGATGTGG [SEQ ID No. 4]), and AmpliTaq Gold 360 Mastermix (www.lifetechnologies.com). Another PCR reaction was performed using the same primer sets, but with gDNA from untransfected cells. The PCR products were run on agarose gels to verify size and sufficient amplification, pooled, purified by ethanol precipitation, dissolved in 20 l water and the DNA concentration was measured on a NanoPhotometer. 2 l NEBuffer 2 (www.neb.com), 2 g purified PCR product and water were brought to a total volume of 19 l. The DNA was hybridized in a thermocycler according to the following protocol: 95 C. for 5 min, 95-85 C. at 2 C./sec, 85-25 C. at 0.1 C./sec, hold at 4 C. 1 l (10 U) of T7E1 (www.neb.com, M0302L) was added and incubated at 37 C. for 15 min. The reaction was stopped by adding 2 l of 0.25 M EDTA. The reaction was again purified by ethanol precipitation and dissolved in 15 l water. The nuclease specific cleavage products were determined on agarose gels. The band intensities were quantified using ImageJ (http://rsb.info.nih.gov/ij/).
[0095] For measuring off-target effects, A549 cells were transfected 5 g mRNA or transduced with 110.sup.5v.g. AAV6-Z3. PCR and T7 was performed as described above (primers: off-target 1: fwd, GCAAGTTTGGCGTCGCTCCA [SEQ ID No. 5]; rev, AGAGGAAGGCGCGGCAGG [SEQ ID No. 6]; off-target 2: fwd, TTCTTGCTCCAGTGACTCTCTTA [SEQ ID No. 7]; rev, AGCCTAGTAAAGACAACACTAGTG [SEQ ID No. 8]; off-target 3: fwd, CAACGTGACCTGCGAGCG [SEQ ID No. 9]; rev, GTGCACGCTCCACTTCTCG [SEQ ID No. 10]; off-target 4: fwd, CTGGAGATGCATCCTTGTCTGT [SEQ ID No. 11]; rev, GAGGGTGAAGACTTTTGGAGCT [SEQ ID No. 12]; off-target 5: fwd, CAGCACCAGATGTTCCCTGTTA [SEQ ID No. 13]; rev, TGGAAAGCAATAGTTCTAGGATGA [SEQ ID No. 14]).
[0096] HDR/RFLP assay. Genomic DNA was extracted from fibroblasts or lung tissue using the DNeasy Blood & Tissue Kit (www.qiagen.com). T1 or Z3 target loci were amplified by PCR (40 cycles, 58 C. annealing and 30s elongation at 72 C.; 5 min at 72 C. to assure completion of amplicons) using 0.5 M of primers P1 (CCTGGCAGGTGATGTGG [SEQ ID No. 15]) and P3 (TGTACGGTGGGAGGCCTAT [SEQ ID No. 16]) with AmpliTaq Gold 360 Mastermix. In addition, in-out PCR reactions were performed using primers P1 and P2 (AGGCACTGGGCAGGTAAGTA [SEQ ID No. 17]).
[0097] Flow Cytometry. Harvested lungs were digested at 37 C. for 1 hour on a rotating shaker in 1 mg/ml collagenase type I (www.lifetechnologies.com), 1% (500 U) DNase (www.epibio.com) solution. Digested lung was passed through a 40-m nylon cell strainer and erythrocytes were lysed using ACK Lysing Buffer (www.lifetechnologies). PE anti-CD45 clone 30-F11, PE anti-CD31 clone C13.3, APC anti-mouse Ly-6A (Sca-1) clone D7 (www.biolegend.com), FITC anti-FLAG M2 and anti-clara cell secretory protein (www.sigmaaldrich.com) were used to stain lung cells. After staining for extracellular markers, cells were fixed and permeabilized using BD Cytofix/Cytoperm plus (www.bd.com), then stained with intracellular antibodies. Flow cytometer analyses were performed on a LSR-I flow cytometer (www.bd.com) and data were analysed with BD FACSDiva software (www.bd.com). ATII and Clara cells sorting were performed with a FACSAria (www.bd.com).
[0098] Nanoparticles. Chitosan (83% deacetylated (Protasan UP CL 113, www.novamatrix.biz)) coated PLGA (Poly-d,l-lactide-co-glycolide 75:25 (Resomer RG 752H, www.evonik.de) nanoparticles (short: NPs) were prepared by using emulsion-diffusion-evaporation15 with minor changes. In brief, 100 mg PLGA was dissolve in ethyl acetate and added dropwise to an aqueous 2.5% PVA solution (Polyvinyl alcohol, Mowiol 4-88, www.kuraray.eu) containing 15 mg Chitosan. This emulsion was stirred (1.5 h at RT) and followed by homogenization at 17,000 rpm for 10 min using a Polytron PT 2500E (www.kinematica.ch). These positive charged NPs were sterile filtered and characterized by Malvern ZetasizerNano ZSP (hydrodynamic diameter: 157.30.87 nm, PDI 0.11, zeta potential +30.80.115 mV). After particle formation they were loaded with mRNA by mixing (weight ratio: 25:1).
[0099] Transgenic SP-B cassette, mRNA templates and AAVs. AAV serotype 6 vectors from the Z3 pair and the donor sequence were produced and purchased from Virovek (www.virovek.com). The sequence information can be retrieved from the Sequence Listing at SEQ ID nos. 24-34 and from
[0100] Transgenic SP-B cassette (before gene manipulation): the sequence at nucleotide positions 427-450 of SEQ ID no. 24 is deleted when transgene integration occurs.
[0101] AAV6_CAG_SP-B_donor: 5 AAV ITR: 3933-4051 (119 bp); ZFN3-repair-template: 4087-6074 (1988 bp); 3 AAV ITR: 6112-6241 (130 bp)
[0102] AAV6-ZFN 3-LEFT: 5 AAV ITR: 3933-4051 (119 bp); CMV Promoter: 4060-4638 (579 bp); 3Flag-NLS-38561-Fok-KKR: 4844-5992 (1149 bp); bGHpA: 5999-6223 (225 bp); 3 AAV ITR: 6240-6369 (130 bp).
[0103] AAV6-ZFN 3-RIGHT: 5 AAV ITR: 3933-4051 (119 bp); CMV Promoter: 4060-4638 (579 bp); 3Flag-NLS-38558-Fok-ELD: 4766-6031 (1266 bp); bGHpA: 6038-6262 (225 bp); 3 AAV ITR: 6279-408 (130 bp).
[0104] Animal experiments. 6-8 week old BALB/c mice (www.criver.com) and transgenic SP-B mice6 [SP-C rtTA/(teto).sub.7 SP-B/SP-B.sup./] were maintained under specific pathogen-free conditions and were kept with a 12 h/12 h light/dark cycle. All animals were provided with food and water ad libitum, and were acclimatized for at least 7 d before the start of the respective experiment. Transgenic SP-B mice were fed with doxycycline containing food until cessation (day 0 of the control and main groups). All animal procedures were approved and controlled by the local ethics committee and carried out according to the German law of protection of animal life.
[0105] Intratracheal injection. BALB/c or transgenic SP-B mice were anesthetized intraperitoneally with a mixture of medetomidine (0.5 mg/kg), midazolam (5 mg/kg) and fentanyl (50 g/kg), and suspended on a mouse intubation platform (www.penncentury.com, Model MIP) at a 45 angle by the upper teeth. A small animal laryngoscope (www.penncentury.com) was used to provide optimal illumination of the trachea. A Microsprayer AerosolizerModel IA-1C connected to a FMJ-250 High Pressure Syringe (both from www.penncentury.com) was endotracheally inserted and PBS, 20 g Z3 (nec-)mRNA naked or complexed with Nanoparticles or AAV6 (www.virovek.com) (was applied in a volume of 100 l. The Microsprayer tip was withdrawn after 10 s, antidot was injected subcutaneously (atipamezol (50 g/kg), flumazenil (10 g/kg) and naloxon (24 g/kg)), and the mouse was taken off the support after 2 min.
[0106] Airway compliance. Compliance was determined by using the ex vivo model of the isolated perfused lung as described previously (IPL, Harvard Apparatus). In short, in situ mouse lungs were placed in a thorax chamber and mice were ventilated via a tracheal cannula. Ventilation rate was set to 90 breaths per minute with negative pressure ventilation between 2.8 cm H.sub.2O and 8.5 cm H.sub.2O. To prevent atelectasis a hyperinflation was triggered every 5 minutes (25 cm H.sub.2O). Perfusion of lungs was done with a 4% hydroxyethyl starch containing perfusion buffer via the pulmonary artery (flow 1 ml/min). Lung function parameters were recorded automatically and compliance calculated by HSE-HA Pulmodyn W Software (Harvard Apparatus). For graphical and statistical analysis, the mean compliance values were calculated from the last 10 timestamps (40 sec) of each 5-minute period (between two hyperinflations).
[0107] Airway resistance. Airway resistance in response to methacholine (MCh, acetyl--methylcholine chloride; Sigma-Aldrich) was again determined using the ex vivo model of the isolated perfused lung (IPL, Harvard Apparatus). In brief, after a 20-minutes baseline measurement, lungs were perfused with increasing concentrations of MCh (0.1 pM, 1 M, 10 M, and 100 M) for 10 minutes each, separated by a 10-minute washout period with perfusion buffer. Lung function parameters were recorded automatically and airway resistance was recorded by HSE-HA Pulmodyn W Software (Harvard Apparatus). For graphical and statistical analysis, the mean resistance values were calculated from the last 10 timestamps (40 sec) of each 10-minute MCh exposure.
[0108] Histopathology. Mouse lungs were fixed in 4.5% Histofix (www.carlroth.com) at 4 C. overnight. Fixed lungs were embedded in paraffin, and slices were stained with either H&E or Surfactant Protein-B DAB (mouse monoclonal anti-SP-B antibody (www.abcam.com, ab3282), Zytochem Plus HRP One-Step Polymer anti-mouse/rabbit/rat (www.zytomed.com, ZUC53-006) and DAB substrate kit for peroxidase (www.vectorlabs.com, SK-4100). 3xFLAG FITC fluorescence staining (monoclonal anti-FLAG M2-FITC antibody (www.sigma-aldrich.com, F4049) and DAPI counterstaining (www.applichem.com, A1001) was examined using a Zeiss Axio Imager. For 3xFLAG Cy3 fluorescence staining, rabbit polyclonal to DDDDK tag antibody (www.abcam.com, ab21536) was used as primary antibody and goat anti rabbit Cy3 antibody (www.jacksonimmuno.com, 111-165-144) was used as secondary antibody together with DAPI (www.applichem.com, A1001).
[0109] Western Blot. Protein from BALF was separated on NuPAGE 10% Bis-Tris Plus gels and a NuPAGE Mini Gel Tank (all from www.lifetechnologies.com), and immunoblotting was performed by standard procedures according to manufacturer's instructions using the XCell II Mini-Cell and blot modules (www.lifetechnologies.com). After blocking for 2 hours at room temperature, primary antibody against SP-B (kindly provided by Prof. Griese, Munich) or ANTI-FLAG M2 (www.sigmaaldrich.com) was incubated overnight, HRP-conjugated secondary antibodies (anti rabbit from www.dianova.com) were incubated for 1 hour. Blots were processed by using ECL Prime Western Blot Detection Reagents (www.gelifesciences.com). Semiquantitative analysis was performed with the Quantity One software (www.bio-rad.de).
[0110] Target-site sequencing. Genomic DNA from primary fibroblasts (in vitro transfected/transduced) or sorted ATII cells (after in vivo transfection/transduction) was isolated using the NucleoSpin Tissue Kit (www.mn-net.com) according to the manufacturer's protocol. Amplicons were derived from PCR with Primers P1 and P2 (sequences see above) using the following conditions: AmpliTaq Gold 360 master mix (www.lifetechnologies.com) at 95 C. for 10 min, 95 C. for 30 sec, 60 C. for 30 sec., 72 C. for 60 sec, with in total 35 cycles and a final extension step at 72 C. for 7 min. The amplicons were cloned into the pCR-TOPO vector (www.lifetechnologies.com) and sequenced using the primers M13forward (GTAAAACGACGGCCAGTG [SEQ ID No. 18]) and M13reverse (CAGGAAACAGCTATGACCATG [SEQ ID No. 19]). The alignments have been performed with Geneious R6 (www.biomatters.com) using the multiple align function, choosing a cost matrix of 65% similarity (5.0/4.0), a gap open penalty of 12 and a gap extension penalty of 3.
[0111] RealTime RT PCR. The lung cell separations were washed vigorously three times with PBS to avoid carrying over RNA not taken up by lung cells (the third supernatant was later tested for RNA contamination using the qPCR procedure described below). RNA was then isolated with the RNeasy purification kit (www.qiagen.com). Reverse transcription of 50 ng RNA was carried out using iScript cDNA synthesis kit (www.bio-rad.com). Detection of Z3 cDNA was performed by SYBR-Green based quantitative Real-Time PCR in 20 l reactions on a ViiA7 (www.lifetechnologies.com). Reactions were incubated for 10 min at 95 C., followed by 40 cycles of 15 sec at 95 C. and 2 min at 50 C. (annealing and extension), followed by standard melting curve analysis. The following primer pairs were used: Z3 left fwd: TGTACGGCTACAGGGGAA [SEQ ID No. 20], Z3 left rev GCCGATAGGCAGATTGTA [SEQ ID No. 21]; optimal determined house-keeping gene beta-actin: fwd TAGGCACCAGGGTGATG [SEQ ID No. 22], rev GCCATGTTCAATGGGGTACT [SEQ ID No. 23].
[0112] Statistics. Differences in mRNA expression between groups were analyzed by pair-wise fixed reallocation randomization tests with REST 2009 software17. All other analyses were performed using the Wilcoxon-Mann-Whitney test with SPSS 21 (www.ibm.com). Data are presented as means.e.m. or as the medianIQR (interquartile ranges) and P<0.05 (two-tailed) was considered statistically significant. For survival studies Log-rank tests were performed. Statistics for lung compliance was performed using 2way ANOVA with Bonferroni-post tests with GraphPad Prism 5.0 software. Lung function data are presented as means.d. and P<0.05 (two-tailed) was considered statistically significant. No randomization was used for animal experiments. In all cases but at administration of AAV6/mRNA i.t., the investigators were blinded when assessing outcomes. [0113] 6. Results
[0114] Nuclease-mediated genome editing holds enormous potential to knockout unwanted genes or repair disease-causing mutations. An ideal nuclease delivery vehicle is (i) short-lived, (ii) non-integrating, and (iii) able to enter target cells efficiently. A variety of vectors have been utilized to deliver nuclease pairs, however, to date, none have achieved direct in vivo gene correction while simultaneously being transient and non-integrating.
[0115] The inventors have used modified mRNA as an alternative to traditional viral vectors, one which naturally avoids genomic integration and provides a transient pulse of protein expression. By using nucleotide-modified mRNA, the inventors reached therapeutic protein expression levels in vivo in mouse models of surfactant protein B (SP-B) deficiency and experimental asthma. Here, the inventors utilize modified mRNA to deliver site-specific nucleases to the lung to demonstrate the value of nec-mRNA as a tool for in vivo genome editing.
[0116] To illustrate the effectiveness of nec-mRNA as a nuclease-delivery vehicle, the inventors chose a well-established transgenic mouse model of SP-B deficiency, where SP-B cDNA is under the control of a Tetracycline-inducible promoter. Administration of doxycycline drives SP-B expression levels comparable to those observed in wild-type mice (
[0117] First, a panel of ZFNs and TALENs was customized to target the transgenic SP-B cassette (
[0118] To optimize Z3 expression in the lung, the inventors administered a panel of 3xFLAG-tagged Z3 mRNAs with various modification schemes, with or without mRNA-complexation to nanoparticles (NPs); cf. Nafee, N., Taetz, S., Schneider, M., Schaefer, U. F. & Lehr, C. M. Nanomedicine 3, 173-183 (2007). Following intratracheal (i.t.) delivery, NP-complexing significantly increased mRNA expression levels (
[0119] Next, a complementary donor template was designed to insert a constitutive CAG promoter at the Z3 nec-mRNA-NP cut site, upstream of the transgenic SP-B cDNA (
[0120] Moving in vivo, AAV6-donor and Z3 nec-mRNA-NP (or a Z3 AAV positive control) were then delivered to the lung of transgenic SP-B mice, followed by cessation of doxycycline (
[0121] Phenotypically, combining gene correction with AAV6-donor and Z3 nec-mRNA-NP (or Z3 AAV) prevented the significant drop in lung function (
[0122] Inherent key limitations of our approach are (i) the co-transfection of an AAV-DNA donor template in conjunction with nec-mRNA, (ii) the temporal delimitation of our curative in vivo treatment, probably owing to the natural turnover of the transfected lung cell populations, and (iii) the engineering of an artificial, transgenic cassette compared to humanized models. However, the use of nec-mRNA will have immediate implications for all nuclease platforms, including CRISPR/Cas9 systems, targeted gene knockout, as well as therapeutic gene correction strategies for the treatment of SP-B deficiency and other diseases, such as cancer. The inventors will test this technology in humanized models when available and are confident to move nec-mRNA and nec-mRNA-NP (for efficient lung transfection) finally to the clinic.
[0123] Overall, the inventors conclude that co-delivery of Z3 nec-mRNA-NP and AAV6-donor results in successful site-specific genome editing in vivo, documenting the first report of life-prolonging gene correction in the lung. [0124] 7. Discussion
[0125] This proof-of-principle in a transgenic model of SP-B deficiency demonstrates that nec-mRNA can achieve therapeutic levels of gene correction in vivo, while possessing the three main criteria of an optimal genome editing reagent: (i) transience, (ii) an inability to integrate, and (iii) sufficient transfection of target cells. As lung cell turnover likely prevented survival beyond 30-35 days in this model, animals in future studies will undergo repeated nec-mRNA administration to target additional differentiated cells of the lung.
[0126] The inventors made sure that the truncated SP-B gene fragment in the right homology arm does not express functional SP-B protein by testing the administration of AAV6 donor w/o functional nucleases (
[0127] The ability to target and correct lung progenitor cells will also be the subject of ongoing investigation. The inventors also want to emphasize that the main safety gain by our nec-mRNA technology concerns the reduction of nuclease-derived off-target effects; it does not eliminate the integration of donor template. Since SP-B acts extracellularly in the alveolar space, modification of a small number of cells could functionally correct a larger area of lung tissue. The inventors found in vivo HDRs of about 9%: in humans 5-10% of SP-B levels in the lung are sufficient and show only a mild disease (in humans there are SNPs in the SP-B gene causing about 10% of normal SP-B levels, and many of those people were completely healthy. Also, there is no linear correlation between achieved HDR in lung cells (see
[0128] Though AAV vectors have not been associated with genotoxicity, further development of nec-mRNA-mediated gene correction approaches may also benefit from pairing with a non-viral or integration-deficient lentiviral donor template. The inventors chose to not look for AAV donor integration for several reasons: a) the inventors wanted the vector to be as coherent as possible and AAV donor integration measurements are at best mere estimations; b) any experiment that uses a transgene donor will require the use of a DNA-based donor and therefore has some risk of insertional mutagenesis. Consequently, it is not possible to achieve HDR in vivo, while avoiding background vector integration. A multitude of papers describing use of AAV and lentivirus have been published in NBT, all of which have necessarily had some background level of donor integration; however no pathological effects of AAV utilization could be demonstrated in extensive murine studies; and c) the big advantage of the inventors' work is that mRNA delivery prevents the persistent expression of the nucleases. This is a far larger worry than background AAV integration.
[0129] Off-target cleavage in vitro on the top five in silico predicted sites was a minor issue with an average of only 0.78% indels at day 14 of transfected or transduced A549 cells (data not shown).
[0130] We found it also important to perform in/out PCRs (and T7 endonuclease reactions) on lung samples of mice that received only AAV6-donor (group C). This is important because, given the large overlap between the donor and the chromosome in our case, recombination can occur in the PCR itself. Therefore, we did control PCRs (P1/P3, P1/P2) and T7 reactions on all mice (P1/P3, group C) or pooled samples (P1/P2, groups A, B and C) and could strengthen the positive results found in groups A and B, as no HDR event could have been detected in DNA samples from group C (
[0131] With respect to human SP-B deficiency, it is important to note that the site-specific nucleases designed to target the transgenic locus in this mouse model will not be directly applicable to the human condition. Also, the CAG promoter is very strong, so manipulated cells likely produce significantly higher amounts of SP-B than normal, endogenous cells. Further, the PCR assay used for quantification likely underestimates the true amount of CAG promoter integration. Despite this, the inventors feel that transgenic SP-B deficient mice serve as an excellent proof-of-principle model for several reasons: first, cessation of doxycycline results in phenotypic changes closely modeling those observed in the human condition. Second, administration of doxycycline drives SP-B expression levels comparable to wild-type mice; and finally, the outcome of survival in this model is a definitive measure of efficacy. Together with Chitosan-coated NP's, nec-mRNA presents a strong tool to approach lung diseases still currently uncorrectable in the human system. Combining nec-mRNA with other structured NPs (cf. Young C. et al. Nat Prot 9, 1900-1915 (2014); incorporated herein by reference) may expand the capabilities of gene manipulation to other large disease fields such a cancer therapeutics. [0132] 8. Conclusion
[0133] The inventors were able to demonstrate in an impressive manner by means of a mouse model that by using a nuclease-encoding nucleotide-modified messenger RNA (nec-mRNA) a genetic alteration on a DNA can be permanently corrected. The nec-mRNA is administered together with a repair template which comprises the genetic information to be inserted or to be replaced, respectively.