METHODS FOR MANIPULATING CELL FATE
20190376046 ยท 2019-12-12
Inventors
Cpc classification
C12N15/1135
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N5/0696
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are methods of generating induced pluripotent stem cells. The method involves providing a somatic or non-embryonic cell population, contacting the somatic or non-embryonic cell population with a quantity of at least one reprogramming factor, an agent that downmodulates SIRT2, and/or an agent that upmodulates SIRT1, and culturing the somatic or non-embryonic cells for a period of time sufficient to generate at least one induced pluripotent stem cell. Methods for differentiating a cell by upmodulating SIRT2 and/or downmodulating SIRT1 are also provided herein. Also disclosed are cell lines and pharmaceutical compositions generated by use of the methods.
Claims
1) A method to generate induced human pluripotent stem cells comprising delivering to a somatic or non-embryonic cell population an effective amount of one or more reprogramming factors and also an agent that downmodulates SIRT2, and culturing the somatic or non-embryonic cell population for a period of time sufficient to generate at least one induced human pluripotent stem cell.
2) The method of claim 1, further comprising delivering to the somatic or non-embryonic cell population an effective amount of an agent that upmodulates SIRT1.
3) The method of claim 1, wherein the reprogramming factor is an agent that increases expression of c-Myc, Oct4, Sox2, Nanog, Lin-28, or Klf4 in the cells.
4) The method of claim 1, wherein the reprogramming factor is an agent that increases expression of SV40 Large T Antigen (SV40LT), or short hairpin RNAs targeting p53 (shRNA-p53).
5) The method of claim 1, wherein the agent that downmodulates SIRT2 is selected from the group consisting of a small molecule, an antibody, a peptide, an antisense oligonucleotide, and an RNAi.
6) The method of claim 5, wherein the RNAi is a microRNA, an siRNA, or a shRNA.
7) The method of claim 6, wherein the microRNA is miR-200c-5p.
8) The method of claim 2, wherein the agent that upmodulates SIRT1 is selected from the group consisting of a small molecule, a peptide, and an expression vector encoding SIRT1.
9) The method of claim 1, further comprising delivering to the cells one or more microRNAs selected from the miR-302/367.
10) The method of claim 1, wherein delivery comprises contacting the cell population with an agent or a vector that encodes the agent.
11) The method of claim 1, wherein delivery comprises transduction, nucleofection, electroporation, direct injection, and/or transfection.
12) The method of claim 10, wherein the vector is non-integrative or integrative.
13) The method of claim 12, wherein the non-integrative vector is selected from the group consisting of an episomal vector, an EBNA1 vector, a minicircle vector, a non-integrative adenovirus, a non-integrative RNA, and a Sendai virus.
14) The method of claim 10, wherein the vector is an episomal vector or a lentivirus vector.
15) (canceled)
16) The method of claim 1, wherein the culturing is for a period of from 7 to 21 days.
17) (canceled)
18) (canceled)
19) (canceled)
20) A cell line comprising induced pluripotent stem cells generated by the method of claim 1.
21) A pharmaceutical composition comprising an induced pluripotent stem cell or population thereof generated by the method of claim 1, and a pharmaceutically acceptable carrier.
22) A method to generate differentiated cells comprising delivering to a pluripotent cell population an agent that upmodulates SIRT2 and culturing the population under differentiating conditions for a period of time sufficient to generate at least one differentiated cell.
23) (canceled)
24) The method of claim 22, wherein the pluripotent cell population is selected from the group consisting of an embryonic stem population, an adult stem cell population, an induced pluripotent stem cell population, and a cancer stem cell population.
25)-39) (canceled)
40) A cell line comprising differentiated cells generated by the method of claim 22.
41)-49) (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
DETAILED DESCRIPTION
[0088] Aspects of the invention are based on the discovery that the metabolic pathway used by a cell directly influences its state of differentiation. Although correlations between cellular metabolism and differentiation state have been previously observed, a causative effect of metabolism on cell state was not appreciated. The results presented herein indicate that the metabolic pathway utilized drives a cell either towards pluripotency or differentiation. As such metabolic reprogramming (e.g., via experimental manipulation) can directly influence the differentiated state of a cell. Reprogramming cells to increase utilization of glycolysis metabolism and decrease oxidative phosphorylation (OXPHOS) metabolism drives cells to a less differentiated state (to thereby increase their stemness). Whereas, reprogramming cells toward decrease utilization of glycolysis and increase OXPHOS metabolism drives cells towards a more differentiated state.
[0089] Aspects of the invention are further based on the finding that one way in which a cell regulates which metabolic pathway is utilized is through protein acetylation, with acetylated glycolytic enzymes being highly active compared to their deacetylated counterparts. This, taken with the recognition of the role of the different metabolic pathways in cell fate, indicates that cell fate can be manipulated by the appropriate manipulation of the acetylation state of glycolytic enzymes.
[0090] As such, one aspect of the invention relates to the shifting of cell fate by manipulation of the acetylation state of the glycolytic enzymes. Deacetylation of the glycolytic enzymes in otherwise differentiated cells (e.g., somatic cells) to thereby reduce glycolysis in the cells, shifts the cells towards pluripotency. Alternatively, acetylation of the glycolytic enzymes in less differentiated cells to thereby increase glycolysis in the cells (e.g., pluripotent or multipotent) shifts the cells towards differentiation.
[0091] One such method of reducing glycolysis is through manipulation of the deacetylase SIRT2. SIRT2 deacetylates glycolytic enzymes to thereby reduce their activity and suppress glycolysis. SIRT2 is highly active in differentiated cells. Reduction in SIRT2 activity allows glycolysis to increase thereby driving the cells toward de-differentiation. Alternatively, SIRT2 activity in less differentiated cells (e.g., stem cells) is relatively low, as is glycolytic enzyme activity, with OXPHOS being primarily used for metabolism. Increasing SIRT2 activity in less differentiated cells deacetylates the glycolytic enzymes, suppressing glycolysis, and drives the cells toward a more differentiated state.
[0092] Another acetylation modulating factor, SIRT1, has activity reciprocal to that of SIRT2 with respect to cell fate. SIRT1 is active in less differentiated cells, with activity decreasing in more differentiated cells. Similar to SIRT2, SIRT1 alters acetylation of metabolic enzymes to increase utilization of glycolysis and decrease utilization of OXPHOS, thereby contributing to the undifferentiated state. SIRT1 manipulation can therefore be used in the methods described herein to affect cell fate, with an increase in SIRT1 driving a cell towards de-differentiation and a decrease in SIRT1 driving a cell towards further differentiation.
[0093] The ability to shift cell fate by manipulating the metabolic pathways utilized is useful in enhancing known methods of cell fate manipulation (e.g. to generate pluripotent cells from differentiated cells, and to generate differentiated cells from pluripotent cells). Methods for de-differentiating cells using reprogramming factors are well known in the art. Examples include the induction of the Yamanaka (reprogramming) factors: Oct-4, Sox-2, c-Myc (or 1-Myc) and Klf-4, and also the induction of the Thomson (reprogramming) factors: Oct-4, Sox-2, Nanog, and Lin-28. Unfortunately, the current methods for inducing de-differentiation of a cell (e.g., pluripotency) are fairly inefficient, generating a small percentage of the desired product. Modulation of cell metabolism, such as by SIRT1 (upmodulation) and SIRT2 (downmodulation), as described herein, to shift a cell towards a less differentiated state can be used to enhance known methods for de-differentiating cells (e.g., generating induced pluripotent cells). As such, the methods involve SIRT1 and SIRT2 modulation in combination with the full complement of reprogramming factors. It is expected however, that SIRT1 and SIRT2 modulation, as described herein, will increase the number of de-differentiated cells produced and/or enable the omission of one or more of the reprogramming factors in the de-differentiation process. The ability to omit one or more reprogramming factors is considered an enhancement of the known procedures if it facilities a reduction in total manipulation of the cells (e.g., delivery of less foreign matter to the cells).
[0094] Various methods for differentiating cells (e.g., pluripotent or multipotent stem cells) by using various differentiation factors and/or culture procedures are known. Many of these methods suffer from low efficacy of induction and/or slow rate of induction. Modulation of cell metabolism, wuch as by SIRT1 (downmodulation) and SIRT2 (upmodulation), as described herein, to shift a cell toward a more differentiated state can be used to enhance known methods for differentiating cells (e.g., generating neuronal cells). As such, the methods involve SIRT1 and SIRT2 modulation in combination with known methods of differentiation. It is expected however, that SIRT1 and SIRT2 modulation will decrease the time required to generate the differentiated cells and/or increase the number of differentiated cells produced. It is also expected that SIRT1 and SIRT2 modulation will also enable the omission of one or more steps or factors required for the differentiation process.
[0095] Moreover, the invention described herein provides methods for selecting pluripotent stem cells and differentiated cells based on the expression level and/or activity of SIRT1 and/or SIRT2.
[0096] Methods and compositions described herein require that the levels and/or activity of SIRT1 and/or SIRT2 be modulated in order to more easily and readily alter the cell fate. SIRT1 is a NAD (nicotinamide adenine dinucleotide)-dependent deacetylase enzyme that regulates proteins essential for cellular regulation, e.g., via deacetylation. SIRT2 is a NAD-dependent deacetylase enzyme that functions as an intracellular regulatory protein with mono-ADP-ribosyltransferase activity.
[0097] Downmodulate or downmodulation refers to reducing the function of the protein (e.g., SIRT1 or SIRT2). This can be accomplished by directly inhibiting the production of functional SIRT1 or SIRT2 itself in the cell (e.g., by reducing gene expression or protein synthesis), or alternatively by reducing SIRT1 or SIRT2 function/activity. SIRT1 or SIRT2 function/activity can be reduced, for example by directly inhibiting the SIRT1 or SIRT2 protein itself or otherwise targeting that protein for degradation. As such, an agent useful in the present invention for downmodulation is one that inhibits SIRT1 or SIRT2 gene expression or protein synthesis, or inhibits SIRT1 or SIRT2 function or activity. Downmodulation of SIRT1 or SIRT2 can also be accomplished by inhibition of an upstream factor that induces or positively regulates SIRT1 or SIRT2 gene expression or SIRT1 or SIRT2 function/activity. As such, another useful agent for downmodulation is an agent that inhibits or downmodulates such an upstream factor by methods that correspond to those described for SIRT1 or SIRT2.
[0098] Upmodulate or upmodulation refers to increasing the level of a functional protein, and is accomplished by methods described for downmodulation, but by instead increasing or activating gene expression or protein activity.
[0099] Induced Pluripotent Stem Cells
[0100] Stem cells are undifferentiated cells defined by their ability at the single cell level to both self-renew and differentiate to produce progeny cells, including self-renewing progenitors, non-renewing progenitors, and terminally differentiated cells. Stem cells, depending on their level of differentiation, are also characterized by their ability to differentiate in vitro into functional cells of various cell lineages from multiple germ layers (endoderm, mesoderm and ectoderm), as well as to give rise to tissues of multiple germ layers following transplantation and to contribute substantially to most, if not all, tissues following injection into blastocysts. Induced pluripotent stem cells are pluripotent stems cells that are generated directly from adult cells, e.g., somatic or non-embryonic cells.
[0101] One aspect of the invention described herein provides a method to generate induced human pluripotent stem cells comprising delivering to a somatic or non-embryonic cell population an effective amount of one or more reprogramming factors (e.g., Yamanaka factors or Thomson factors) and also an agent that downmodulates SIRT2, and culturing the somatic or non-embryonic cell population for a period of time sufficient to generate at least one induced human pluripotent stem cell. In one embodiment, the method further comprises delivering to the somatic or non-embryonic cell population an effective amount of an agent that upmodulates SIRT1.
[0102] In one embodiment, the somatic or non-embryonic cell population is cultured for a period of time sufficient to generate at least one induced human pluripotent stem cell. Culturing can occur for a period of at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, at least 21 days, or more.
[0103] In some instances, the chemical and/or atmospheric conditions are altered for reprogramming. For example, where the somatic and non-embryonic cells are not vascularized and hypoxic reprogramming under hypoxic conditions of 5% O.sub.2, instead of the atmospheric 21% O.sub.2, may further provide an opportunity to increase the reprogramming efficiency. Similarly, chemical induction techniques have been used in combination with reprogramming, particularly histone deacetylase (HDAC) inhibitor molecule, valproic acid (VPA), which has been found wide use in different reprogramming studies.
[0104] At the same time, other small molecules such as MAPK kinase (MEK)-ERK (MEK) inhibitor PD0325901, transforming growth factor beta (TGF-) type I receptor ALK4, ALK5 and ALK7 inhibitor SB431542 and the glycogen synthase kinase-3 (GSK3) inhibitor CHIR99021 have been applied for activation of differentiation-inducing pathways (e.g. BMP signaling), coupled with the modulation of other pathways (e.g. inhibition of the MAPK kinase (MEK)-ERK pathway) in order to sustain self-renewal. Other small molecules, such as Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitors, such as Y-27632 and thiazovivin (Tzv) have been applied in order to promote survival and reduce vulnerability of cell death, particularly upon single-cell dissociation. As such, the inclusion of one or more of the factors in the herein described methods is envisioned.
[0105] Efficiency of Reprogramming
[0106] Efficiency of reprogramming, e.g., changing the cell fate of a cell, is readily ascertained by one of many techniques readily understood by the skilled practitioner. For example, efficiency can be described by the ratio between the number of donor cells receiving the agent(s) and reprogramming factors and the number of reprogrammed colonies (de-differentiated colonies) generated. The number donor cells receiving the agent(s) and reprogramming factors can be measured directly, such as by use of a reporter gene such as GFP included in a vector encoding an agent or reprogramming factor. Alternatively, indirect measurement of delivery efficiency can be accomplished by transfecting a vector encoding a reporter gene as a proxy to gauge delivery efficiency in paired samples delivering agent(s) and reprogramming factor vectors. Further, the number of reprogrammed colonies generated can be measured by, for example, observing the appearance of one or more multipotency or pluripotency characteristics such as alkaline phosphatase (AP)-positive clones, colonies with endogenous expression of transcription factors Oct-4 or Nanog, or antibody staining of surface markers such as Tra-1-60. Efficiency can alternatively be described by the time required for induced pluripotent stem cell generation. A combination of percentage of induced cells and the time of induction can also be used.
[0107] In one embodiment, the methods described herein result in an enhancement of the number of induced pluripotent stem cells by at least 2-fold as compared to an appropriate control. In another embodiment, the methods described herein result in an enhancement of the number of induced pluripotent stem cells by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, or more as compared to an appropriate control. As used herein, an appropriate control refers to a comparably treated cell population in the absence of the agent (e.g., that downmodulates SIRT2 and/or that upmodulates SIRT1). The efficiency of reprogramming can be assessed as described above.
[0108] One aspect of the invention described herein provides a cell line comprising induced stem-like cells (e.g., pluripotent stem cells) generated by any of the methods described herein.
[0109] Another aspect of the invention described herein provides a pharmaceutical composition comprising an induced stem-like cell (e.g., pluripotent stem cell) or population thereof generated by any of the methods described herein and a pharmaceutically acceptable carrier.
[0110] Reprogramming Factors with Downmodulation of SIRT2 and/or Upmodulation of SIRT1
[0111] The somatic or non-embryonic cell population is further contacted with one or more reprogramming factor. In one embodiment, the one or more reprogramming factor is from one to four reprogramming factors selected from the Yamanaka (reprogramming) factors, e.g, Oct-4, Sox-2, c-Myc (or 1-Myc) and Klf-4, or selected from the Thomson (reprogramming) factors, e.g., Oct-4, Sox-2, Nanog, and Lin-28. Reprogramming factors are traditionally understood to be normally expressed early during development and are involved in the maintenance of the pluripotent potential of a subset of cells that constitute the inner cell mass of the pre-implantation embryo and post-implantation embryo proper. Their ectopic expression is believed to allow the establishment of an embryonic-like transcriptional cascade that initiates and propagates an otherwise dormant endogenous core pluripotency program within a host cell.
[0112] In one embodiment, reprogramming factors are expressed in the cell e.g., via an vector such as those described herein, comprising a nucleic acid encoding a given reprogramming factor. In another embodiment, reprogramming factors are expressed in the cell e.g., via expression of a nucleic acid encoding a given reprogramming factor as naked DNA.
[0113] Additional reprogramming factors include, but are not limited to, Tert, Klf-4, c-Myc, SV40 Large T Antigen (SV40LT) and short hairpin RNAs targeting p53 (shRNA-p53). One or more of these factors can further be delivered to the cells to enhance the reprogramming process using delivery methods described herein.
[0114] The agent and reprogramming factors described herein may necessarily be contained in and thus further include a vector. Many such vectors useful for transferring exogenous genes into target mammalian cells are available. The vectors may be episomal, e.g. plasmids, virus-derived vectors (e.g., viral vectors) such cytomegalovirus, adenovirus, etc., or may be integrated into the target cell genome, through homologous recombination or random integration, e.g. retrovirus-derived vectors such as MMLV, HIV-1, ALV, etc. For modification of stem cells, lentiviral vectors are preferred. Lentiviral vectors such as those based on HIV or FIV gag sequences can be used to transfect non-dividing cells, such as the resting phase of human stem cells (see Uchida et al. (1998) P.N.A.S. 95(20): 11939-44). In some embodiments, combinations of retroviruses and an appropriate packaging cell line may also find use, where the capsid proteins will be functional for infecting the target cells. Usually, the cells and virus will be incubated for at least about 24 hours in the culture medium. The cells are then allowed to grow in the culture medium for short intervals in some applications, e.g. 24-73 hours, or for at least two weeks, and may be allowed to grow for five weeks or more, before analysis. Commonly used retroviral vectors are defective, i.e. unable to produce viral proteins required for productive infection. Replication of the vector requires growth in the packaging cell line.
[0115] The use of various combinations of vectors in the methods is envisioned. While various vectors and reprogramming factors in the art appear to present multiple ingredients capable of establishing reprogramming in cells, a high degree of complexity occurs when taking into account the stoichiometric expression levels necessary for successful reprogramming to take hold. For example, somatic cell reprogramming efficiency is reportedly fourfold higher when Oct-4 and Sox-2 are encoded in a single transcript on a single vector in a 1:1 ratio, in contrast to delivering the two factors on separate vectors. The latter case results in a less controlled uptake ratio of the two factors, providing a negative impact on reprogramming efficiency. One approach towards addressing these obstacles is the use of polycistronic vectors, such as inclusion of an internal ribosome entry site (IRES), provided upstream of transgene(s) that is distal from the transcriptional promoter. This organization allows one or more transgenes to be provided in a single reprogramming vector, and various inducible or constitutive promoters can be combined together as an expression cassette to impart a more granular level of transcriptional control for the plurality of transgenes. These more specific levels of control can benefit the reprogramming process considerably, and separate expression cassettes on a vector can be designed accordingly as under the control of separate promoters.
[0116] Although there are advantages to providing such factors via a single, or small number of vectors, upper limitations on vector size do exist, which can stymie attempts to promote their delivery in a host target cell. For example, early reports on the use of polycistronic vectors were notable for extremely poor efficiency of reprogramming, sometimes occurring in less than 1% of cells, more typically less than 0.1%. These obstacles are due, in-part, to certain target host cells possessing poor tolerance for large constructs (e.g., fibroblasts), or inefficient processing of IRES sites by the host cells. Moreover, positioning of a factor in a vector expression cassette affects both its stoichiometric and temporal expression, providing an additional variable impacting reprogramming efficiency. Thus, some improved techniques can rely on multiple vectors each encoding one or more reprogramming factors in various expression cassettes. Under these designs, alteration of the amount of a particular vector for delivery provides a coarse, but relatively straightforward route for adjusting expression levels in a target cell.
[0117] In an alternate embodiment, the methods described herein do not require the somatic or non-embryonic cell to be contacted by a reprogramming factor.
[0118] Differentiation of an Induced Pluripotent Stem Cell
[0119] One aspect of the invention described herein provides a method to generate differentiated cells comprising delivering to a pluripotent cell population an agent that upmodulates SIRT2 and culturing the population under differentiating conditions for a period of time sufficient to generate at least one differentiated cell. In one embodiment, the method further comprises delivering an agent that downmodulates SIRT1
[0120] Pluripotent stem cells comprise the capacity to differentiate into any cell type of the organism. It should be understood that the methods and protocols for differentiating a stem cell will vary based on the cell type, e.g., differentiation into a neuron may require a different protocol compared to differentiation into a hepatocyte. Protocols for differentiating a stem cell into a given cell type are known in the art. The skilled practitioner is able to determine if a cell has differentiated into a particular cell type (e.g., a neuron) by assessing the differentiated cells for specific linage-derived markers (e.g., Class III (3-tubulin, neuron specific enolase (NSE), or calretinin). Markers for various cell types are known and can be determine by the skilled practitioner.
[0121] Specific differentiation conditions typically require cultureing in specific differentiation medium. As used herein, differentiation media refers to a medium containing factors required for differentiating a stem cell into a particular cell type. Differentiated media useful for generating a particular differentiated cell (e.g., a neuron, or other neuronal cell type) are commercially available for various cell types, e.g, at Cell Applications, Inc., San Diego, Calif. The skilled artisan can determine the appropriate differentiation media and conditions for a desired cell type.
[0122] In one embodiment, differentiating conditions are specific for neuronal differentiation (e.g., differentiation in to a neuronal progenitor cell). Methods for differentiation of a stem-like cell to a neuronal cell include culturing an adherent population of stem-like cell in a medium containing factors that promote neural differentiation, such as retinoic acid, BMP inhibitors (e.g., noggin), N2, B27, and ITS. The adherent stem-like cells can be adherent to a matrix, e.g, laminin, fibronection, or collagen, or adherent to a population of feeder cells, e.g., a monolayer of fibroblast cells. When cells in culture begin to commit to neural fates, e.g., as observed by the presence of neural rosettes, they are cultures in a permissive medium, and neuronal rosettes are passaged in permissive medium containing high levels of basic FGF2. Methods for neuronal differentiation are further are reviewed in, e.g., Dhara, S K., and Stice, S L. J Cell Biochem. 2008 Oct. 15; 105(3): 633-640, which is incorporated herein by reference in its entirety.
[0123] By way of another example, stem-like cells can be differentiated into a hepatocyte by culturing the stem-like cells in medium containing factors that promote hepatocyte differentiation, e.g., FGF-4, and HGF. After 6 days, the cells are cultured in medium containing FGF-4, HGF, and oncostatin M to allow for differentiation. Complete hepatocyte differentiation can be determined by assessing the cells for hepatocyte markers, such as GATA4, HNF4a, and albumin. Methods for hepatocyte differentiation are further are reviewed in e.g., Agarwak, S., et al. Stem Cells. 2008 Feb. 21; 26(5): 1117-1127, which is incorporated herein by reference in its entirety.
[0124] The stem cells for use with the methods and compositions described herein can be naturally occurring stem cells or induced stem cells, such as induced pluripotent stem cells generated using methods described herein. Induced pluripotent stem cells can be generated using any methods known in the art (e.g., as described herein). Stem cells can be obtained or generated from any mammalian subjects, e.g. human, primate, equine, bovine, porcine, canine, feline, rodent, e.g. mice, rats, hamster, etc. In one embodiment, the stem cell is a human stem cell. In one embodiment, the stem cell is a non-human stem cell.
[0125] In one embodiment, the pluripotent stem cell population is an embryonic stem cell population, an adult stem cell population, an induced pluripotent stem cell population, or a cancer stem cell population. In one embodiment, the stem cell is a non-embryonic stem cell.
[0126] In one embodiment, a pluripotent cell population is cultured in, e.g., differentiation media, for a period of time sufficient to generate at least one differentiated cell. Culturing can occur for a period of from 1-5 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days, at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, at least 100 days, at least 110 days, at least 120 days, at least 130 days, at least 140 days, at least 150 days, at least 160 days, at least 170 days, at least 180 days, at least 190 days, at least 200 days, at least 210 days, at least 220 days, at least 230 days, at least 240 days, at least 250 days, at least 260 days, at least 1270 days, at least 280 days, at least 290 days, at least 300 days, or more. In one embodiment, culturing occurs for a period of 7 to 100 days, 7 to 200 day, 7 to 300 days, 100 to 200 days, 200 to 300 days, 50 to 150 days, 150 to 250 days, or 150 to 300 days.
[0127] In one embodiment, the methods described herein produce an enhanced number of differentiated cells by at least 2-fold as compared to an appropriate control. In another embodiment, the methods described herein result in an enhancement of the number of differentiated cells by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, or more as compared to an appropriate control. In one embodiment, enhancement is by at least 100, 250, 500, 750, 100 or more, as compared to an appropriate control. One such appropriate control is a similar or identical cell subjected to an otherwise identical method that does not downmodulate SIRT1 and/or upmodulate SIRT2. The efficiency of de-differentiation can be assessed as described above for the efficiency of reprogramming.
[0128] In one embodiment, the differentiated cells are produced in a significantly shorter period of time than in appropriate control. In one embodiment, the period of time is at least 10% shorter as compared to an appropriate control. In one embodiment, period of time is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 99%, or more, shorter as compared to an appropriate control.
[0129] Another aspect of the invention relates to a cell line comprising differentiated cells generated by any of the methods described herein.
[0130] Agents
[0131] In various embodiment, agents are delivered to cells to modulate (e.g., upmodulate, or downmodulate) SIRT1 and SIRT2. The term agent as used herein means any compound or substance such as, but not limited to, a small molecule, nucleic acid, polypeptide, peptide, drug, ion, etc. An agent can be any chemical, entity or moiety, including without limitation synthetic and naturally-occurring proteinaceous and non-proteinaceous entities. In some embodiments, an agent is nucleic acid, nucleic acid analogues, proteins, antibodies, peptides, aptamers, oligomer of nucleic acids, amino acids, or carbohydrates including without limitation proteins, oligonucleotides, ribozymes, DNAzymes, glycoproteins, siRNAs, lipoproteins, aptamers, and modifications and combinations thereof etc. In certain embodiments, agents are small molecule having a chemical moiety. For example, chemical moieties included unsubstituted or substituted alkyl, aromatic, or heterocyclyl moieties including macrolides, leptomycins and related natural products or analogues thereof. Compounds can be known to have a desired activity and/or property, or can be selected from a library of diverse compounds.
[0132] Such an agent can take the form of any entity which is normally not present or not present at the levels being administered in the cell. Agents such as chemicals; small molecules; nucleic acid sequences; nucleic acid analogues; proteins; peptides; aptamers; antibodies; or fragments thereof, can be identified or generated for use to downmodulate or upmodulate SIRT1 or SIRT2.
[0133] Agents in the form of nucleic acid sequences designed to specifically inhibit gene expression are particularly useful. Such a nucleic acid sequence can be RNA or DNA, and can be single or double stranded, and can be selected from a group comprising; nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acid (LNA) etc. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.
[0134] The agent can be a molecule from one or more chemical classes, e.g., organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc. Agents may also be fusion proteins from one or more proteins, chimeric proteins (for example domain switching or homologous recombination of functionally significant regions of related or different molecules), synthetic proteins or other protein variations including substitutions, deletions, insertion and other variants.
[0135] In one embodiment the agent is a catalytic antisense nucleic acid constructs, such as ribozymes, which is capable of cleaving RNA transcripts and thereby preventing the production of the encoded protein. Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementary to the target flanking the ribozyme catalytic site. After binding the ribozyme cleaves the target in a site specific manner. The design and testing of ribozymes which specifically recognize and cleave sequences of the specific gene products is commonly known to persons of ordinary skill in the art.
[0136] In one embodiment, the agent inhibits gene expression (i.e. suppress and/or repress the expression of the gene). Such agents are referred to in the art as gene silencers and are commonly known in the art. Examples include, but are not limited to a nucleic acid sequence, for an RNA, DNA or nucleic acid analogue, and can be single or double stranded, and can be selected from a group comprising nucleic acid encoding a protein of interest, oligonucleotides, nucleic acids, nucleic acid analogues, for example but are not limited to peptide nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acids (LNA) and derivatives thereof etc. Nucleic acid agents also include, for example, but are not limited to nucleic acid sequences encoding proteins that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNA, siRNA, micro RNAi (miRNA), antisense oligonucleotides, etc.
[0137] The agent may function directly in the form in which it is administered. Alternatively, the agent can be modified or utilized intracellularly to produce something which modulates SIRT1 or SIRT2, such as introduction of a nucleic acid sequence into the cell and its transcription resulting in the production of the nucleic acid and/or protein inhibitor or activator of SIRT1 or SIRT2 within the cell. In some embodiments, the agent is any chemical, entity or moiety, including without limitation synthetic and naturally-occurring non-proteinaceous entities. In certain embodiments the agent is a small molecule having a chemical moiety. For example, chemical moieties included unsubstituted or substituted alkyl, aromatic, or heterocyclyl moieties including macrolides, leptomycins and related natural products or analogues thereof. Agents can be known to have a desired activity and/or property, or can be selected from a library of diverse compounds.
[0138] Agents in the form of a protein and/or peptide or fragment thereof can also be designed to downmodulate or upmodulate SIRT1 or SIRT2. Such agents encompass proteins which are normally absent or proteins that are normally endogenously expressed in the host cell. Examples of useful proteins are mutated proteins, genetically engineered proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins (any of which may take the form of a dominant negative protein for SIRT1 or SIRT2), antibodies, midibodies, minibodies, triabodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof. Agents also include antibodies (polyclonal or monoclonal), neutralizing antibodies, antibody fragments, peptides, proteins, peptide-mimetics, aptamers, oligonucleotides, hormones, small molecules, nucleic acids, nucleic acid analogues, carbohydrates or variants thereof that function to inactivate the nucleic acid and/or protein of the gene products identified herein, and those as yet unidentified.
[0139] In one embodiment, an agent that downmodulates SIRT2 is delivered to a differentiated cell to a generate at least one induced pluripotent stem cell. In such embodiment, the agent downmodulates SIRT2 by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% or more as compared to an appropriate control. In an alternate embodiment, an agent that upmodulates SIRT2 is delivered to a stem cell to generate at least one differentiated cell. In such embodiment, the agent upmodulates SIRT2 by at least 2-fold, by at least 3-fold, by at least 4-fold, by at least 5-fold, by at least 6-fold, by at least 7-fold, by at least 8-fold, by at least 9-fold, by at least 10-fold or more as compared to an appropriate control, or by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% as compared to an appropriate control. An appropriate control can be the same type of cell or population thereof similarly or identically treated to which an agent has not been delivered.
[0140] In another embodiment, an agent that downmodulates SIRT1 is delivered to a stem cell to generate at least one differentiated cell. In such embodiment, the agent downmodulates SIRT1 by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% as compared to an appropriate control. In an alternate embodiment, an agent that upmodulates SIRT1 is delivered to a differentiated cell to de-differentiate the cell (e.g., generate at least one induced pluripotent stem cell). In such embodiment, the agent upmodulates SIRT1 by at least 2-fold, by at least 3-fold, by at least 4-fold, by at least 5-fold, by at least 6-fold, by at least 7-fold, by at least 8-fold, by at least 9-fold, by at least 10-fold or more as compared to an appropriate control, or by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% or more as compared to an appropriate control. An appropriate control can be a cell or population thereof similarly or identically treated to which an agent has not been delivered.
[0141] In one embodiment, SIRT1 is upmodulated by a nucleic acid encoding SIRT1 expressed in the cell e.g., via a vector comprising a nucleic acid encoding SIRT1. In another embodiment, a nucleic acid encoding SIRT1 is expressed in the cell e.g., via expression of a nucleic acid encoding SIRT1 as naked DNA. In one embodiment, the nucleic acid encoding SIRT1 has a sequence corresponding to the sequence of SEQ ID NO: 2; or comprises the sequence of SEQ ID NO: 2; or comprises a sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the sequence of SEQ ID NO: 2, and having the same activity as the sequence of SEQ ID NO: 2 (e.g., acetylation of its substrates).
[0142] In one embodiment, SIRT2 is upmodulated by expression of a nucleic acid encoding SIRT1. The nucleic acid encoding SIRT2 can be expressed in the cell e.g., via a vector comprising a nucleic acid encoding SIRT2. In another embodiment, a nucleic acid encoding SIRT2 is expressed in the cell e.g., via expression of a nucleic acid encoding SIRT2 as naked DNA. In one embodiment, the nucleic acid encoding SIRT2 has a sequence corresponding to the sequence of SEQ ID NO: 3; or comprises the sequence of SEQ ID NO: 3; or comprises a sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the sequence of SEQ ID NO: 3, and having the same activity as the sequence of SEQ ID NO: 3 (e.g., acetylation of its substrates).
[0143] In one embodiment, the agent is a small molecule that downmodulates SIRT1 or SIRT2. Such small molecules include, but are not limited, to the small molecules listed in Table 1. Methods for screening small molecules are known in the art and can be used to identify a small molecule that is efficient at, for example, inducing pluripotent stem cells or differentiated cells, given the desired target (e.g., SIRT1 or SIRT2).
TABLE-US-00001 TABLE 1 Small molecule compounds targeting Sirtuins Molecular Full Name Weight Formula Information SRT1720 506.02 C25H23N7OSHCl SRT1720 HCl is a selective SIRT1 activator with EC50 of 0.16 M in a cell-free assay, but is >230-fold less potent for SIRT2 and SIRT3 EX527 248.71 C13H13ClN2O EX 527 is a potent and selective SIRT1 inhibitor with IC50 of 38 nM in a cell-free assay, exhibits >200-fold selectivity against SIRT2 and SIRT3. Phase 2. Sirtinol 394.47 C26H22N2O2 Sirtinol is a specific SIRT1 and SIRT2 inhibitor with IC50 of 131 M and 38 M in cell-free assays, respectively. Nicotinamide 122.12 C6H6N2O Nicotinamide (Vitamin B3), a water-soluble vitamin, is an (Vitamin B3) active component of coenzymes NAD and NADP, and also act as an inhibitor of sirtuins. SRT2183 468.57 C27H24N4O2S SRT2183 is a small-molecule activator of the sirtuin subtype SIRT1, currently being developed by Sirtris Pharmaceuticals. Tenovin-6 454.63 C25H34N4O2S Tenovin-6 acts through inhibition of the protein- deacetylating activities of SirT1 and SirT2. Tenovin-6 inhibits the protein deacetylase activities of purified human SIRT1, SIRT2, and SIRT3 in vitro with IC50 of 21 M, 10 M, and 67 M, respectively. SRT2104 516.64 C26H24N6O2S2 SRT2104 (GSK2245840) is a selective SIRT1 activator (GSK2245840) involved in the regulation of energy homeostasis. Phase 2. Thiomyristoyl 581.85 C34H51N3O3S Thiomyristoyl is a potent and specific SIRT2 inhibitor with an IC50 of 28 nM. It inhibits SIRT1 with an IC50 value of 98 M and does not inhibit SIRT3 even at 200 M. SirReal2 420.55 C22H20N4OS2 SirReal2 is a potent and selective Sirt2 inhibitor with IC50 of 140 nM. Salermide 394.47 C26H22N2O2 Salermide is a reverse amide with a strong in vitro inhibitory effect on Sirt1 and Sirt2. Compared with Sirt1, Salermide is even more efficient at inhibiting Sirt2. AGK2 434.27 C23H13Cl2N3O2 AGK2 is a potent, and selective SIRT2 inhibitor with IC50 of 3.5 M that minimally affects either SIRT1 or SIRT3 at 10-fold higher levels. SRT3025 606.2 C31H31N5O2S2HCl SRT3025 is an orally available small molecule activator of the SIRT1 enzyme. Fisetin 286.24 C15H10O6 Fisetin (Fustel) is a potent sirtuin activating compound (STAC) and an agent that modulates sirtuins. Quercetin 302.24 C15H10O7 Quercetin, a natural flavonoid present in vegetables, fruit and wine, is a stimulator of recombinant SIRT1 and also a PI3K inhibitor with IC50 of 2.4-5.4 M. Phase 4.
[0144] In one embodiment, the agent that downmodulates SIRT1 or SIRT2 is an antibody or antigen-binding fragment thereof, or an antibody reagent. As used herein, the term antibody reagent refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a given antigen. An antibody reagent can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. In some embodiments of any of the aspects, an antibody reagent can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy (H) chain variable region (abbreviated herein as VH), and a light (L) chain variable region (abbreviated herein as VL). In another example, an antibody includes two heavy (H) chain variable regions and two light (L) chain variable regions. The term antibody reagent encompasses antigen-binding fragments of antibodies (e.g., single chain antibodies, Fab and sFab fragments, F(ab)2, Fd fragments, Fv fragments, scFv, CDRs, and domain antibody (dAb) fragments (see, e.g. de Wildt et al., Eur J. Immunol. 1996; 26(3):629-39; which is incorporated by reference herein in its entirety)) as well as complete antibodies. An antibody can have the structural features of IgA, IgG, IgE, IgD, or IgM (as well as subtypes and combinations thereof). Antibodies can be from any source, including mouse, rabbit, pig, rat, and primate (human and non-human primate) and primatized antibodies. Antibodies also include midibodies, nanobodies, humanized antibodies, chimeric antibodies, and the like.
[0145] The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). The extent of the framework region and CDRs has been precisely defined (see, Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917; which are incorporated by reference herein in their entireties). Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[0146] In some embodiments, a nucleic acid for use as an agent as described herein (e.g. SIRT1, or SIRT2) is contained in a vector for delivery and/or expression of the nucleic acid.
[0147] In one embodiment, the agent that downmodulates SIRT1 or SIRT2 is an antisense oligonucleotide. As used herein, an antisense oligonucleotide refers to a synthesized nucleic acid sequence that is complementary to a DNA or mRNA sequence, such as that of a microRNA. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under cellular conditions to a gene, e.g., SIRT1 or SIRT2. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity in the context of the cellular environment, to give the desired effect.
[0148] In one embodiment the agent downmodulates SIRT1 or SIRT2 by RNA inhibition. Inhibitors of the expression of a given gene can be an inhibitory nucleic acid. In oneembodiment, the inhibitory nucleic acid is an inhibitory RNA (iRNA). The RNAi can be single stranded or double stranded.
[0149] The iRNA can be siRNA, shRNA, endogenous microRNA (miRNA), or artificial miRNA. In one embodiment, an iRNA as described herein effects inhibition of the expression and/or activity of a target, e.g. SIRT1 or SIRT2. In one embodiment, the agent is siRNA that downmodulates SIRT1 or SIRT2. In one embodiment, the agent is shRNA that downmodulates SIRT1 or SIRT2.
[0150] The skilled practitioner is able to design siRNA, shRNA, or miRNA to target SIRT1 or SIRT2, e.g., using publically available design tools. siRNA, shRNA, or miRNA is commonly commercially made by companies such as Dharmacon (Layfayette, Colo.) or Sigma Aldrich (St. Louis, Mo.). One skilled in the art will be able to readily assess whether the siRNA, shRNA, or miRNA effective target e.g., SIRT1 or SIRT2, for its downregulation, for example by transfecting the siRNA, shRNA, or miRNA into cells and detecting the expression levels of a gene within the cell via western-blotting for the encoded protein.
[0151] In one embodiment, the iRNA can be a dsRNA. A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of the target. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions
[0152] The RNA of an iRNA can be chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference.
[0153] microRNA
[0154] In one embodiment, the agent that downmodulates SIRT1 or SIRT2 is miRNA. microRNAs are small non-coding RNAs with an average length of 22 nucleotides. These molecules act by binding to complementary sequences within mRNA molecules, usually in the 3 untranslated (3UTR) region, thereby promoting target mRNA degradation or inhibited mRNA translation. The interaction between microRNA and mRNAs is mediated by what is known as the seed sequence, a 6-8-nucleotide region of the microRNA that directs sequence-specific binding to the mRNA through imperfect Watson-Crick base pairing. More than 900 microRNAs are known to be expressed in mammals. Many of these can be grouped into families on the basis of their seed sequence, thereby identifying a cluster of similar microRNAs. A miRNA can be expressed in a cell, e.g., as naked DNA. A miRNA can be encoded by a nucleic acid that is expressed in the cell, e.g., as naked DNA or can be encoded by a nucleic acid that is contained within a vector.
[0155] In one embodiment, the agent that downmodulates SIRT2 is miRNA-200c-5p. miRNA-200c-5p is the mature product of miRNA-200c. miRNA-200c-5p sequences are known for a number of species, e.g., human miRNA-200c-5p, e.g., miRBase Accession number MIMAT0004657. Human miRNA-200c-5p comprises the sequence of CGUCUUACCCAGCAGUGUUUGG (SEQ ID NO: 1). miRNA-200c-5p can refer to human miRNA-200c-5p, including naturally occurring variants, molecules, and alleles thereof.
[0156] In one embodiment, the agent, e.g., the miRNA, has a sequence corresponding to the sequence of SEQ ID NO: 1; or comprises the sequence of SEQ ID NO: 1; or comprises a sequence with at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the sequence of SEQ ID NO: 1, and having the same activity as the sequence of SEQ ID NO: 1 (e.g., downmodulates SIRT2, and induces a pluripotent state).
[0157] Various other microRNAs (e.g., as miR-302, and -367) have been shown synergize with the reprogramming factors. One or more of these can also be delivered to the cells to induce de-differentiation in the methods described herein. The miR-302/367 cluster contains eight microRNAs, miR-367, 302d, 302c-5p, 302c-3p, 302a-5p, 302a-3p, 302b-5p and 302b-3p. miR302a-d contain the same seed sequence, AAGUGCU (SEQ ID NO: 200). The miR-302/367 cluster members have been demonstrated to play an important role in diverse biological processes, such as the pluripotency of human embryonic stem cells (hESCs), self-renewal and reprogramming. The miR-200 cluster is a family of microRNAs that includes miR-200a, miR-200b, miR-200c, miR-141 and miR-429. In one embodiment, the methods described herein do not include/deliver the members of the miRNA-200 cluster other than miRNA-200c-5p.
[0158] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and/or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of ordinary skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a conservatively modified variant where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.
[0159] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. ligan-mediated receptor activity and specificity of a native or reference polypeptide is retained.
[0160] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into His; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gln; Ile into Leu or into Val; Leu into Ile or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into Ile or into Leu.
[0161] In some embodiments, a polypeptide described herein (or a nucleic acid encoding such a polypeptide) can be a functional fragment of one of the amino acid sequences described herein. As used herein, a functional fragment is a fragment or segment of a peptide which retains at least 50% of the wildtype reference polypeptide's activity according to an assay known in the art or described below herein. A functional fragment can comprise conservative substitutions of the sequences disclosed herein.
[0162] In some embodiments, a polypeptide described herein can be a variant of a polypeptide or molecule as described herein. In some embodiments, the variant is a conservatively modified variant. Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example. A variant, as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Variant polypeptide-encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains activity of the non-variant polypeptide. A wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan.
[0163] A variant amino acid or DNA sequence can be at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).
[0164] Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites permitting ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are well established and include, for example, those disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462, which are herein incorporated by reference in their entireties. Any cysteine residue not involved in maintaining the proper conformation of a polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to a polypeptide to improve its stability or facilitate oligomerization.
[0165] Delivery of an Agent
[0166] In the herein described methods and compositions, the agent is contacted to the cell such that it can exert its intended effect on the cell. In one embodiment, the agent exerts its effects on cells merely by interacting with the exterior of the cell (e.g., by binding to a receptor). Agents that act on the cell internally (e.g., RNAi or encoded protein) may be delivered in a form readily taken up by the cell when contacted to the cell (e.g., in a formulation which facilitates cellular uptake and delivery to the appropriate subcellular location). In one embodiment, the agent is in a formulation in which it is readily taken up by the cell so that it can exert it effect. In one embodiment, the agent is applied to the media, where it contacts the cell (such as the progenitor and/or feeder cells) and produces its modulatory effects.
[0167] The agent may result in gene silencing of the target gene (e.g., SIRT1 or SIRT2), such as with an RNAi molecule (e.g. siRNA or miRNA). This entails a decrease in the mRNA level in a cell for a target by at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 100% of the mRNA level found in the cell without the presence of the agent. In one preferred embodiment, the mRNA levels are decreased by at least about 70%, about 80%, about 90%, about 95%, about 99%, about 100%.
[0168] As used herein, delivery refers to an effective amount of, e.g., an agent, that enters a cell or population thereof, and properly functions, e.g., delivery of functional protein or a vector that appropriately expresses the agent. Delivery can be done using any technique known in the art. Exemplary techniques include, but are not limited to transduction, nucleofection, electroporation, direct injection, or transfection. Effective delivery of an agent (e.g., a vector encoding SIRT1 or SIRT2, or a small molecule inhibitor of SIRT1 or SIRT2) can be assessed by measuring protein or mRNA levels, e.g., via Westerblotting or qRT-PCR, respectively. Effective delivery of an agent can additionally be measured by assessing the biological function of the intended target of the agent.
[0169] In one embodiment, an agent is delivered to a cell via culturing the cell in a medium comprising the agent. Culturing a population of cells with one or more agents can be achieved in a variety of ways. For instance, a population of cells, e.g., somatic or non-embryonic cells, may be contacted with one or more agents. Somatic or non-embryonic cells can be cultured in the presence of these agents for a period of time, such as for seven or more days. When more than one agent (e.g., an agent that downmodulates SIRT2, and an agent that upmodulates SIRT1) is in contact with a population of cells, the agents can be present in the cell culture medium together, such that the cells are exposed to the agents simultaneously. Alternatively, the agents may be added to the cell culture medium sequentially. For instance, the one or more agents may be added to a population of cells in culture according to a particular regimen, e.g., such that different agents are added to the culture media at different times during a culture period.
[0170] It is understood that the optimal method for delivery can vary based on the type of agent, and can be determined by a skilled practitioner.
[0171] Identifying Cell Populations of a Particular Cell Fate
[0172] One aspect of the invention relates to a method for selecting pluripotent stem cells from an induced population comprising measuring the level and/or activity of SIRT1 and SIRT2 in a population of candidate cells, and selecting cells that exhibit an increased level and/or activity of SIRT1 and decreased level and/or activity of SIRT2. In one embodiment, the candidate cells were induced using any of the methods described herein. In another embodiment, the candidate cells were induced using any method known in the art.
[0173] In one embodiment, the level and/or activity of SIRT1 is increased by at least 2-fold, by at least 3-fold, by at least 4-fold, by at least 5-fold, by at least 6-fold, by at least 7-fold, by at least 8-fold, by at least 9-fold, by at least 10-fold or more as compared to an appropriate control, or by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% or more as compared to an appropriate control, and the level and/or activity of SIRT2 is decreased by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% as compared to an appropriate control. As used herein, an appropriate control refers to a similarly or identically treated cell or population thereof that is not an induced pluripotent cell. An appropriate control can be an identical cell population that was not induced to a pluripotent state, e.g., a cell population that was not contacted by an agent or reprogramming factor.
[0174] Another aspect of the invention described herein provides a method for selecting differentiated cells from an induced population comprising measuring the level and/or activity of SIRT1 and SIRT2 in a population of candidate cells, and selecting cells that exhibit an increased level and/or activity of SIRT2 and decreased level and/or activity of SIRT1. In one embodiment, the candidate cells are induced using any of the methods described herein. In another embodiment, the candidate cells are induced using any method known in the art.
[0175] In one embodiment, the level and/or activity of SIRT2 is increased by at least 2-fold, by at least 3-fold, by at least 4-fold, by at least 5-fold, by at least 6-fold, by at least 7-fold, by at least 8-fold, by at least 9-fold, by at least 10-fold or more as compared to an appropriate control, or by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% or more as compared to an appropriate control, and the level and/or activity of SIRT1 is decreased by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 100% as compared to an appropriate control. As used herein, an appropriate control can be a stem cell or population thereof, either naturally occurring or induced. An appropriate control can be an identical stem cell population that was not induced to be differentiated, e.g., a cell population that was not contacted by an agent or differentiation factor, but otherwise identically treated.
[0176] In one embodiment, the levels of SIRT1 and/or SIRT2 is measured via immunofluorescence using a reagent (e.g., an antibody reagent) that detects SIRT1 or SIRT2 protein in the cell. Fluorescence-activated cell sorting (FACS) can be used to select for cells with a given SIRT1 and SIRT2 expression level. Alternatively, levels of SIRT1 and/or SIRT2 can be measured, e.g., by assessing the protein level or mRNA level in the cell via, e.g., Westernblotting or PCR-based screening (e.g., qRT-PCR), respectively. Activity of SIRT1 and/orSIRT2 can be assessed e.g., via functional assays, e.g., by determining if SIRTlor SIRT2 substrates are acetylated.
[0177] In one respect, the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not (comprising). In some embodiments, other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the invention (consisting essentially of). This applies equally to steps within a described method as well as compositions and components therein. In other embodiments, the inventions, compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method (consisting of).
[0178] All patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0179] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: [0180] 1. A method to generate induced human pluripotent stem cells comprising delivering to a somatic or non-embryonic cell population an effective amount of one or more reprogramming factors and also an agent that downmodulates SIRT2, and culturing the somatic or non-embryonic cell population for a period of time sufficient to generate at least one induced human pluripotent stem cell. [0181] 2. The method of paragraph 1, further comprising delivering to the somatic or non-embryonic cell population an effective amount of an agent that upmodulates SIRT1. [0182] 3. The method of paragraph 1 or 2, wherein the reprogramming factor is an agent that increases the expression of c-Myc, Oct4, Sox2, Nanog, Lin-28, or Klf4 in the cells. [0183] 4. The method of paragraph 1-3, wherein the reprogramming factor is an agent that increases the expression of SV40 Large T Antigen (SV40LT), or short hairpin RNAs targeting p53 (shRNA-p53). [0184] 5. The method of any of paragraphs 1-3, wherein the agent that downmodulate SIRT2 is selected from the group consisting of a small molecule, an antibody, a peptide, an antisense oligonucleotide, and an RNAi. [0185] 6. The method of paragraph 5, wherein the RNAi is a microRNA, an siRNA, or a shRNA. [0186] 7. The method of paragraph 6, wherein the microRNA is miR-200c-5p. [0187] 8. The method of any one of paragraphs 2-7, wherein the agent that upmodulates SIRT1 is selected from the group consisting of a small molecule, a peptide, and an expression vector encoding SIRT1. [0188] 9. The method of any one of paragraphs 1-8, further comprising delivering to the cells one or more microRNAs selected from the miR-302/367 cluster. [0189] 10. The method of any one of paragraphs 1-9, wherein delivery comprises contacting the cell population with an agent or a vector that encodes the agent. [0190] 11. The method of any one of paragraphs 1-10, wherein delivery comprises transduction, nucleofection, electroporation, direct injection, and/or transfection. [0191] 12. The method of paragraph 10, wherein the vector is non-integrative or integrative. [0192] 13. The method of paragraph 12, wherein the non-integrative vector is selected from the group consisting of an episomal vector, an EBNA1 vector, a minicircle vector, a non-integrative adenovirus, a non-integrative RNA, and a Sendai virus. [0193] 14. The method of paragraph 10-12, wherein the vector is an episomal vector. [0194] 15. The method of paragraph 10, wherein the vector is a lentivirus vector. [0195] 16. The method of any one of paragraphs 1-15, wherein the culturing is for a period of from 7 to 21 days. [0196] 17. The method of any one of paragraphs 1-16, wherein SIRT2 is downmodulated by at least about 50%, 60%, 70%, 80% or 90% as compared to an appropriate control. [0197] 18. The method of any one of paragraphs 1-17, wherein SIRT1 is upmodulated by at least about 2, 5, 6, 7, 8, 9, or 10 as compared to an appropriate control. [0198] 19. The method of any one of paragraphs 1-18, wherein at least a 2 enhancement of the number of induced pluripotent stem cells is produced as compared to an appropriate control. [0199] 20. A cell line comprising induced pluripotent stem cells generated by the method of any one of paragraphs 1-19. [0200] 21. A pharmaceutical composition comprising an induced pluripotent stem cell or population thereof generated by the method of any one of paragraphs 1-19, and a pharmaceutically acceptable carrier. [0201] 22. A method to generate differentiated cells comprising delivering to a pluripotent cell population an agent that upmodulates SIRT2 and culturing the population under differentiating conditions for a period of time sufficient to generate at least one differentiated cell. [0202] 23. The method of paragraph 22, further comprising delivering to the pluripotent cell population an agent that downmodulates SIRT1. [0203] 24. The method of paragraph 22 or 23, wherein the pluripotent cell population is selected from the group consisting of an embryonic stem population, an adult stem cell population, an induced pluripotent stem cell population, and a cancer stem cell population. [0204] 25. The method of paragraph 23 or 24, wherein the agent that downmodulates SIRT1 is selected from the group consisting of a small molecule, an antibody, a peptide, an antisense oligonucleotide, and an RNAi. [0205] 26. The method of paragraph 25, wherein the RNAi is a microRNA, an siRNA, or a shRNA. [0206] 27. The method of any one of paragraphs 22-26, wherein the agent that upmodulates SIRT2 is selected from the group consisting of a small molecule, a peptide, and an expression vector encoding SIRT2. [0207] 28. The method of any one of paragraphs 22-27, wherein delivery comprises contacting the cell population with a vector that encodes the agent. [0208] 29. The method of paragraph 28, wherein delivery comprises transduction, nucleofection, electroporation, direct injection, and/or transfection. [0209] 30. The method of paragraph 28, wherein the vector is non-integrative or integrative. [0210] 31. The method of paragraph 30, wherein the non-integrative vector is selected from the group consisting of an episomal vector, an EBNA1 vector, a minicircle vector, a non-integrative adenovirus, a non-integrative RNA, and a Sendai virus. [0211] 32. The method of any of paragraphs 28-30, wherein the vector is an episomal vector. [0212] 33. The method of paragraph 28, wherein the vector is a lentivirus vector. [0213] 34. The method of any one of paragraphs 22-33, wherein the culturing is for a period of from 7 to 300 days. [0214] 35. The method of any one of paragraphs 22-33, wherein SIRT1 is downmodulated by at least about 50%, 60%, 70%, 80% or 90% as compared to an appropriate control. [0215] 36. The method of any one of paragraphs 23-35, wherein SIRT2 is upmodulated by at least about 2, 5, 6, 7, 8, 9, or 10 as compared to an appropriate control. [0216] 37. The method of any one of paragraphs 23-36, wherein at least a 2 enhancement of the number of differentiated cells is produced as compared to an appropriate control. [0217] 38. The method of any one of paragraphs 23-37, wherein the differentiated cells are produced in a significantly shorter period of time as compared to an appropriate control. [0218] 39. The method of any of paragraphs 22-38, wherein the differentiating conditions are specific for neuronal differentiation to thereby generate neuronal cells. [0219] 40. A cell line comprising differentiated cells generated by the method of any one of paragraphs 22-39. [0220] 41. A method for selecting pluripotent stem cells from an induced population comprising measuring the level and/or activity of SIRT1 and SIRT2 in a population of candidate cells, and selecting cells which exhibit an increased level and/or activity of SIRT1 and decreased level and/or activity of SIRT2. [0221] 42. The method of paragraph 41, wherein the level and/or activity of SIRT1 is increased by at least about 2, 5, 6, 7, 8, 9, or 10 as compared to an appropriate control. [0222] 43. The method of paragraph 41, wherein the level and/or activity of SIRT2 is decreased by at least about 50%, 60%, 70%, 80% or 90% as compared to an appropriate control. [0223] 44. The method of paragraph 41, wherein the candidate cells are induced by the method of any of paragraphs 1-21. [0224] 45. A method for selecting differentiated cells from an induced population comprising measuring the level and/or activity of SIRT1 and SIRT2 in a population of candidate cells, and selecting cells which exhibit an increased level and/or activity of SIRT2 and decreased level and/or activity of SIRT1. [0225] 46. The method of paragraph 45, wherein the level and/or activity of SIRT2 is increased by at least about 2, 5, 6, 7, 8, 9, or 10 as compared to an appropriate control. [0226] 47. The method of paragraph 45, wherein the level and/or activity of SIRT1 is decreased by at least about 50%, 60%, 70%, 80% or 90% as compared to an appropriate control. [0227] 48. The method of paragraph 45, wherein the candidate cells are differentiated by the method of any of paragraphs 50-53. [0228] 49. The method of paragraph 41 or 45, wherein measuring is by immunofluorescence.
EXAMPLES
[0229] A hallmark of cancer cells is the metabolic switch from oxidative phosphorylation (OXPHOS) to glycolysis, a phenomenon referred to as the Warburg effect, which is also observed in primed human pluripotent stem cells (hPSCs) such as human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). It is reported herein that downregulation of SIRT2 and upregulation of SIRT1 is a molecular signature of primed hPSCs and critically regulates induced pluripotency. SIRT2 downregulation leads to hyperacetylation of enzymes of the glycolytic pathway (e.g., aldolase, glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase, and enolase) and to their enhanced activities, indicating that SIRT2 critically regulates metabolic reprogramming during induced pluripotency. In support of this model, knockdown of SIRT2 in human fibroblasts resulted in significantly decreased OXPHOS and increased glycolysis, both in the absence and presence of reprogramming factors. Aldolase lysine residue 322 was identified herein as an important acetylation site whose deacetylation by SIRT2 robustly downregulates aldolase activity. In addition, it was found that miR-200c-5p specifically targets SIRT2, downregulating its expression through two miRNA-response elements that are identified to reside within the coding sequence. Furthermore, doxycycline-induced SIRT2 overexpression in hESCs significantly affected energy metabolism, altering stem cell function such as pluripotent differentiation properties. Taken together, experimental data described herein identify the miR-200c-SIRT2 axis as a key regulator of metabolic reprogramming (Warburg-like effect), at a minimum, in part via regulation of glycolytic enzymes acetylation and activities, during human induced pluripotency, as well as pluripotent stem cell function.
INTRODUCTION
[0230] Recent proteomics studies revealed that numerous proteins of the nucleus, cytoplasm, and mitochondria involved in diverse aspects of cellular metabolism are highly acetylated in human, mouse, and prokaryotic cells.sup.14-16. In particular, virtually all enzymes involved in glycolysis and the tricarboxylic acid (TCA) cycle were found to be acetylated in human liver tissues.sup.15, strongly suggesting that protein acetylation is a key mechanism regulating metabolism.sup.17, which prompted the hypothesis that protein acetylation regulates, at least in part, metabolic reprogramming. Protein acetylation can be modulated by histone acetyl transferase (HATs), as well as by class I, II, and III histone deacetylases (HDAC). Among these, class III HDACs, termed sirtuins, are NAD-dependent protein deacetylases that are highly conserved from bacteria to human.sup.18, 19. Since sirtuins are the only HDACs whose activity is dependent on NAD, a critical co-factor of cell metabolism, it was further hypothesized that certain sirtuin members play important roles in regulating metabolic reprogramming and are likely linked to induced pluripotency and stem cell fate control. Experimental data provided herein indicate that altered acetylation levels of glycolytic enzymes by SIRT2 downregulation critically regulate metabolic reprogramming during human induced pluripotency and influence stem cell function and regulation in primed hPSCs.
[0231] Results
[0232] Warburg-Like Effect in hESCs and hiPSCs.
[0233] To compare energy metabolism between human pluripotent stem cells (hPSCs) and their somatic counterpart, human iPSCs from were derived from newborn dermal fibroblasts (hDFs) by introducing four reprogramming genes (c-Myc, Oct4, Sox2, and Klf4) using inducible lenti-viruses and confirmed robust expression of the canonical pluripotency markers (Oct4, Nanog, TRA1-60, and SSEA4) in the resulting hiPSCs and in hESCs (
[0234] Glycolytic Enzymes are Highly Acetylated in hPSCs.
[0235] To address the hypothesis that regulation of acetylation affects the metabolic switch, protein acetylation in hESCs and dermal fibroblasts were compared. Acetylated proteins were pulled down by immunoprecipitation with acetyl-Lys antibody and subjected them to liquid chromatography-tandem mass spectrometry (LC-MS/MS) analyses following SDS-PAGE and in-gel trypsin digestion (
[0236] Downregulation of SIRT2 and Upregulation of SIRT1 is a Molecular Signature of Primed hPSCs.
[0237] It was next determined if any acetylation-modulating factor(s) such as HATs or HDACs show a unique expression pattern in hPSCs compared to their counterpart somatic tissues by meta-analyses of web-based microarray databases. five independent studies (GSE28633.sup.26, GSE18265.sup.27, GSE20013.sup.28, GSE39144 (found on the world wide web at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE39144), and GSE9709.sup.29) of hESCs and/or hiPSCs were analyzed against various sets of differentiated cell types (e.g., foreskin fibroblast, neuronal differentiated cells from hESCs/hiPSCs, or endothelial cells). The microarray dataset was analyzed using GEO2R (found on the world wide web at https://www.ncbi.nlm.nih.gov/geo/geo2r/) to identify acetylation-modulating factor(s) whose expression is significantly different in hPSCs compared to their differentiated counterparts .sup.11. Of 40,000-50,000 primers, corresponding to mRNA transcripts, only the top 20% mRNA transcripts were selected as a cut-off range to validate significance, based on p values. Each gene expression in a given database was further monitored across multiple groups of hPSCs to determine gene expression changes. It was first determined if the expression of any acetyl transferase is consistently altered in hPSCs, but failed to find any in all five meta-analysis studies (Table 4). All known deacetylases were next analyzed; 11 HDACs (belonging to HDAC I, II, and IV) and 7 SIRTs (belonging to HDAC III). Remarkably, SIRT2 was found to be uniquely and consistently downregulated in all five independent meta-analyses using multiple sets of hPSCs (
[0238] Functional Effects of SIRT2 Knockdown in hPSCs
[0239] Because glycolytic enzymes (e.g., aldolase (ALDOA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphoglycerate kinase (PGK1), enolase (ENO1), and pyruvate kinase) are highly acetylated and the deacetylase SIRT2 is robustly downregulated in hESCs, it was hypothesized, without wishing to be bound by theory, that SIRT2 downregulation is responsible for their hyperacetylation, directly contributing to the Warburg-like effect. To address this, stable hESC lines were first generated in which expression of SIRT2 and EGFP can be induced by doxycycline (Dox) using a lentiviral vector (
[0240] Next, the effect of SIRT2 knockdown (KD) on glycolytic enzymes in hDFs was investigated using lentiviral SIRT2 shRNAs. Each protein was pulled down using specific antibody and detected by western blotting using anti-acetyl-Lys antibody. Acetylation levels of aldolase, enolase, PGK1 and GAPDH were substantially increased in SIRT2 KD fibroblasts, compared to original fibroblasts or mock control, while the expression levels of their total proteins were similar (
[0241] The findings presented herein are surprising because acetylation is generally known to inhibit most metabolic enzymes.sup.34. Thus, it was sought to identify specific lysine residues and analyzed the functional effects of their deacetylation by SIRT2, using aldolase (AldoA) as an example. Using LTQ-Orbitrap mass spectrometry, a total of 6 and 8 Lys residues are highly acetylated in mock- and SIRT2 KD cells, respectively, were found (
[0242] SIRT2 Expression Levels Influence Metabolism, Cell Survival, and Pluripotent Differentiation Functions of hPSCs
[0243] It was next determined if altered SIRT2 levels directly influence glycolytic metabolism in hPSCs by measuring extracellular acidification rate (ECAR).sup.28. Indeed, Dox-induced SIRT2 OE in hESC cells resulted in a reduction of ECAR, basal glycolytic rate (0.770.07 versus 1.210.04 mpH/min/g protein) and glycolytic capacity (1.040.08 versus 1.840.11 mpH/min/vg protein), compared to control cells (
[0244] Next, the effect of SIRT2 OE on metabolic reprogramming during the early stage of differentiation was investigated. mRNA expression patterns for pluripotency and lineage-specific early markers were examined. In addition, production of extracellular lactate, a key metabolite of glycolysis, was measured during in vitro differentiation of H9 hESCs. As shown in
[0245] Expression Levels of SIRT2 Regulate Energy Metabolism in hDFs and Influence the Reprogramming Process
[0246] Whether proper regulation of SIRT2 expression is critical for induced pluripotency via regulating metabolic reprogramming was next assessed. To this end, it was first determined whether altered SIRT2 expression induces a metabolic switch in fibroblasts. Indeed, SIRT2 KD in fibroblasts resulted in significant metabolic changes including decreased OCR and increased ECAR compared to control cells (
[0247] The dynamics of metabolic change by altered SIRT2 expression were also examined during the reprogramming process. As shown in
[0248] Whether altered SIRT2 expression influences the generation ofiPSCs from fibroblasts was next tested. As shown in
[0249] miR-200c Suppresses SIRT2 Expression
[0250] Finally, it was sought to identify the molecular mechanism underlying SIRT2 downregulation during induced pluripotency. In particular, it was speculated that SIRT2 might be regulated by a specific miRNA(s) that are induced by at least one of the reprogramming factors. To address this, miRNA target-prediction analyses using Rna22.sup.40 was first performed and 656 potential miRNAs that can target the SIRT2 gene were identified. Among these, identified four miRNAs (i.e., miR-25, -92b, -200c, and -367) that belong to the most highly enriched miRNAs in hPSCs.sup.41 were further. Their potential target sites (miRNA-response elements; MREs) in the 5-untranslated region (UTR) and amino acid coding sequences (CDS) of the SIRT2 gene (Table 7) were also identified. Interestingly, one of these candidates (miR-200c), known to be induced by Oct4.sup.42, was found to prominently downregulate SIRT2 expression at both the mRNA and protein levels (
DISCUSSION
[0251] Here, a molecular signature consisting of SIRT2 downregulation and SIRT1 upregulation in primed hPSCs during the reprogramming process was uncovered, which is critical for induced pluripotency. It was found that SIRT2 KD in human fibroblasts significantly increases the generation of hiPSC colonies while its OE prominently inhibit it. Regulation of SIRT1 expression is also critical for induced pluripotency but in the opposite direction: SIRT1 OE significantly increases the generation of hiPSC colonies while its KD robustly interferes with it. In line with their opposite direction of expression, it appears that SIRT1 and SIRT2 regulate induced pluripotency through distinct mechanisms and targets. For instance, results presented herein highlight that acetylation levels and activities of glycolytic enzymes (e.g., aldolase, PGK1, enolase, and GAPDH) are robustly regulated by SIRT2, but not SIRT1. In agreement with results presented herein, previous studies showed upregulation of SIRT1 in hPSCs .sup.31, 32 and SIRT1's important roles for generation of mouse iPSCs .sup.32 39. In addition, the study by Si et al., .sup.33 showed that SIRT2 is upregulated during in vitro differentiation of mouse ESCs and its KD promotes mesoderm and endoderm lineages while compromising ectoderm differentiation. In contrast, results presented herein show that SIRT2 regulates more fundamental stem cell functions such as metabolism, cell survival/death, and pluripotent differentiation potential in hPSCs. The different functional role(s) of SIRT2 between these two studies possibly reflect species differences (mouse vs. human). Another possibility is that SIRT2 has distinct functional role(s) for different stem cell state. Unlike hESCs and hiPSCs, which represent a primed pluripotent state, mouse ESCs are known to be at a nave pluripotent state and are energetically bivalent, dynamically switching from glycolysis to OXPHOS on demand.sup.9.
[0252] Recent studies implicate that increased glycolysis is critical for the maintenance or induction of pluripotency.sup.6, 7, 11-13. Especially, Moussaieff et al. found that inhibition of glycolysis by BrPA or 2DG causes a rapid loss of pluripotency.sup.12. In contrast, results presented herein showed that SIRT2 OE hPSCs still can be maintained in the undifferentiated state using ESC culture conditions, while they exhibit decreased acetylation levels of glycolytic enzymes and reduced glycolytic metabolism. When hPSCs were exposed to differentiation condition, SIRT2 OE in hPSCs caused further decreased glycolysis, leading to reduced production of lactate, a key metabolite of glycolysis, during early differentiation. It is to be noted that culture conditions (in both ESC maintenance and differentiation) are significantly different between Moussaieff et al. .sup.12 and findings presented herein. For instance, the chemically defined culture medium (E8TM) containing TGFI3 was used herein, which is known to support undifferentiated proliferation of hPSCs. Indeed, SIRT2 over expression in TGFO-free hPSCs culture condition result in efficient loss of pluripotency and spontaneous differentiation (data not shown). Furthermore, during in vitro differentiation, Moussaieff et al. detected a significant decrease of lactate after 2 days of differentiation while it was only evident after 4 days of differentiation in the experiments presented herein.
[0253] Importantly, work presented herein found multiple lines of evidence indicating that SIRT2 is a key regulator of metabolic reprogramming (Warburg-like effect) during human induced pluripotency and critically regulates stem cell fates and functions. Firstly, Dox-induced SIRT2 OE in hESCs robustly altered the acetylation levels and enzymatic activities of glycolytic enzymes, significantly compromising glycolytic metabolism. Secondly, SIRT2 OE in hPSCs caused enhanced OXPHOS and reduced glycolysis, leading to reduction of lactate production. As a result, SIRT2 OE hPSCs exhibit significantly reduced cell proliferation, which may be caused, at least in part, by increased apoptotic cell death via enhanced production of ROS. In addition, SIRT2 OE in hPSCs leads to enhanced pluripotent differentiation potential. Thirdly, SIRT2 KD in human fibroblasts robustly increased acetylation levels and activities of glycolytic enzymes, leading to prominent metabolic switch from OXPHOS to glycolytic metabolism. Fourthly, SIRT2 KD together with the introduction of reprogramming factors into human fibroblasts more rapidly and effectively induced metabolic switch compared to reprogramming factors alone, resulting in more efficient generation of hiPSC colonies. In contrast, altered expression of SIRT1 did not directly influence the metabolic status, further supporting that SIRT1 and SIRT2 regulate the reprogramming process via distinct mechanisms. Taken together, data presented herein indicate that altered levels of SIRT2 during induced pluripotency and differentiation regulate OXPHOS and glycolysis in opposite directions, thus facilitating the metabolic switches. Notably, SIRT2 is the only sirtuin residing primarily in the cytoplasm.sup.18, 19, and this may provide a unique advantage to directly control metabolic reprogramming by regulating glycolytic enzymes activities.
[0254] The finding that there is a direct correlation between acetylation levels and enzymatic activities is surprising because it was suggested that acetylation is inhibitory to the activities of most enzymes.sup.34. For instance, two groups showed that deacetylation of a glycolytic enzyme (phosphoglycerate mutase) by SIRT1 or SIRT2 downregulates its activity.sup.44, 45. However, another study reported that the same enzyme could be stimulated through deacetylation by SIRT2.sup.46 and a recent study showed that GAPDH is activated by acetylation of its K254 residue.sup.47. Furthermore, increasing GapA acetylation in Salmonella by Pat acetylase treatment increased its glycolysis activity.sup.16. Thus, the functional effect of acetylation appears to be enzyme- and perhaps lysine-specific. To further validate the findings presented herein, LC-MS/MS analyses of Myc-tagged aldolase A (AldoA-Myc) was performed. K111 and K322 were identified as specific SIRT2 target sites and found that K322 critically regulates enzyme activity. K322 resides on an outside surface of AldoA with unknown functional domain, and the new functional data presented herein will provide useful insight into this important enzyme and its regulation in diseases such as cancer.
[0255] Interestingly, it was found that SIRT2 is suppressed by miR-200c, a miRNA induced in pluripotent stem cells by Oct4.sup.42, via binding sites in the sirtuin gene coding sequence. This miRNA enhances metabolic reprogramming via SIRT2 suppression and this appears to be a critical step of induced pluripotency (
[0256] Materials and Methods
[0257] Cell Culture.
[0258] Human dermal fibroblasts (hDFs) were cultured in Dulbecco's modified Minimal Essential Medium (DMEM; Invitrogen, Carlsbad, Calif.) supplemented with 2 mM L-glutamine (Invitrogen), 10% fetal bovine serum (FBS; Invitrogen), 100 U/ml penicillin and 100 g/ml streptomycin (Invitrogen). For iPSC induction, DMEM/F-12 medium supplemented with 2 mM L-glutamine (Invitrogen), 1 mM p-mercaptoethanol (Invitrogen), 1 non-essential amino acids (NEAA; Invitrogen), 20% knock-out serum replacement (KSR; Invitrogen), 100 U/ml penicillin, 100 g/ml streptomycin (Invitrogen) and 10 ng/ml basic fibroblast growth factor (bFGF; Invitrogen) was used as the reprogramming medium. Human ESC lines and hiPSC lines were maintained in Essential 8 medium (Invitrogen) using Matrigel Matrix (Corning Life Sciences, Tewksbury, Mass.) and passaged using 0.5 mM EDTA (Invitrogen) for gentle dissociation.
[0259] Plasmid Construction and Lentivirus Production.
[0260] Human SIRT1 or SIRT2 was PCR-amplified from hESCs (H9) or hDFs, respectively, then cloned into the pGEM-T Easy vector (Promega, Madison, Wis.). The 2A sequence of the Thoseaasigna virus (T2A)-linked EGFP was amplified from pCXLE-EGFP plasmid (#27082; Addgene, Cambridge, Mass.) by RT-PCR, cloned into the pGar-T Easy vector. The SIRT1 and SIRT2 fragments were then cut off from the corresponding vectors and inserted into the pGEM-T-T2A-EGFP to generate pGEM-T-SIRT1-T2A-EGFP and pGEM-T-SIRT2-T2A-EGFP, respectively. The SIRT1-T2A-EGFP and SIRT2-T2A-EGFP constructs were confirmed by sequencing and then introduced into the EcoRI site of FUW-tetO vector (Addgene), respectively. Human AldoA-Myc constructs, the AldoA fragment was PCR-amplified from hESCs (H9), and then cloned into the pcDNA3.1-Myc/His vector (Invitrogen). For the psicheck2 constructs, the CDS fragments were cloned in downstream of a Renilla luciferase open reading frame. Point mutations of AldoA were generated by site-directed mutagenesis using a QuickChange II XL Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, Calif.). The primers are listed in Table 6. FUW-tetO-based lentiviral vectors containing the other individual reprogramming factors for Oct4 (#20726), Sox2 (#20724), Klf4 (#20725) or c-Myc (#20723) were purchased from Addgene. The polycistronic human STEMCCA lentiviral vector.sup.48 was kindly provided by Dr. Gustavo Mostoslaysky (Boston University). Genetic knockdown of SIRT1 or SIRT2 was carried out using lentiviral shRNA plasmids targeting human SIRT1 (RHS3979-201750186, RHS3979-201750188, RHS3979-201750189, and RHS3979-201750190) or human SIRT2 (RHS3979-201797165, RHS3979-201768981, RHS3979-201768982, RHS3979-201768983, RHS3979-201768984, and RHS3979-201768985) that were obtained from GE Healthcare Dharmacon (Lafayette, Colo.).
[0261] For lentivirus production, lentiviral vectors were co-transfected by packaging plasmids into 293T cells which were maintained in DMEM supplemented with 10% FBS using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instruction. The viral supernatant was harvested at 48 hours (h) after transfection and filtered using 0.45 pm Millex-HV (Millipore) filters to remove cell debris.
[0262] Human iPSC Induction.
[0263] Human iPSCs were generated using lentiviral particles by inducible lentiviral vectors or STEMCCA vectors to introduce the OSKM factors (Oct4, Sox2, Klf4, and c-Myc) into fibroblasts.sup.49. ES-like colonies formed after 3 weeks of viral infection and the observed ES-like colonies were handpicked and transferred onto mouse feeder cells (MEF)-plated or Matrigel-coated tissue culture plates to generate iPSC lines. iPSC colonies were mechanically picked until iPSC lines were established.
[0264] Live Cell Metabolic Analysis.
[0265] Oxygen consumption rate (OCR) and extracellular acidification rates (ECAR) were measured using the XFp8 or XF24 analyzer (Seahorse Bioscience, MA) according to the manufacturer's instruction. Briefly, cells were plated into wells of an XF cell culture microplate and incubated at 37 C. in a CO.sub.2 incubator for 24 h to ensure attachment. The assay was started after cells were equilibrated for 1 h in XF assay medium supplemented with 10 mM glucose, 5 mM sodium pyruvate and 2 mM glutamine in a non-CO.sub.2 incubator. Mitochondrial activity between hDFs and hESCs/parental hDFs and iPSCs were monitored through sequential injections of 1 M oligomycin, 0.3 pLM FCCP and 1 M rotenone/antimycin A to calculate basal respiration rates (baseline OCRrotenone/antimycin A OCR), ATP dependent (basal respiration rateoligomycin OCR), maximum respiration (FCCP OCR rotenone/antimycin A OCR), and oxidative reserve (maximum respiration ratebasal respiration rate). Glycolytic processes were measured by serial injections of 10 mM glucose, 1 M oligomycin, and 100 mM 2-deoxyglucose to calculate basal glycolytic rate, glycolytic capacity (in response to oligomycin), and glycolytic reserve (glycolytic capacitybasal rate). Each plotted value was normalized to total protein quantified using a Bradford protein assay (Bio-Rad).
[0266] Immunoprecipitation.
[0267] For immunoprecipitation assays, hESCs and hDFs lysates were incubated with specific antibodies against acetyl-Lys, aldolase, enolase, PGK1 or GAPDH at 4 C. overnight. After addition of protein A/G UltraLink resin, samples were incubated at 4 C. for 2 h. Beads were washed three times with PBS and proteins were released from the beads by boiling in SDS-sample loading buffer and analyzed by SDS-PAGE.
[0268] Liquid Chromatography Mass Spectrometry (LC-MS/MS).
[0269] For identification of acetylated proteins, hESCs or hDFs (control) were plated in 100 mm dishes, grown in STEMPRO hESC SFM up to 60-70% confluence. Cells were collected, washed with PBS and lysed (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.5% NP-40, 1% SDS, and protease inhibitor cocktail). Whole cell lysate from hESCs and hDFs were incubated for 10 min on ice followed by centrifugation at 14,000g for 15 min at 4 C. Supernatants were collected and pellets were discarded. Protein concentrations were determined using the BCA assay (Pierce, Rockford, Ill.) using bovine serum albumin (BSA) as standard. For immunoprecipitation assays, 500 g of hESC and hDFs lysates were incubated with anti-acetyl-Lys antibody at 4 C. for overnight. After addition of Protein A/G UltraLink resin samples were incubated at 4 C. for 2 h. Beads were washed three times with PBS and proteins were released from the beads by addition of SDS-sample loading buffer. The eluted proteins were analyzed by SDS-PAGE and the gel stained with Coomassie Blue. For LC-MS/MS analyses, the gel was de-stained and bands cut and processed as follows. Briefly, acetylated proteins bands were divided into 10 mm sections and subjected to in-gel digestion with trypsin. The tryptic digests were separated by on-line reversed-phase chromatography using a Thermo Scientific Eazy nano LC II UHPLC equipped with an autosampler using a reversed-phase peptide trap EASY-Column (100 m inner diameter, 2 cm length) and a reversed-phase analytical EASY-Column (75 gm inner diameter, 10 cm length, 3 pm particle size), both from Thermo Scientific, followed by electrospray ionization using a 30 gm (i.d.) nanobore stainless steel online emitter (Thermo Scientific) and a voltage set at 2.6 V., at a flow rate of 300 nl/min. The chromatography system was coupled on-line with an LTQ mass spectrometer. Spectra were searched against the Human IPI v3.7 DB using the Sorcerer 2 IDA Sequest-based search algorithm, and comparative analysis of proteins identified in this study was performed using Scaffold 4. LC-MS/MS analysis was performed at the Biopolymers & Proteomics Core Facility of the David H. Koch Institute at MIT and at the Medicinal Bioconvergence Research Center at Seoul National University. To compare protein acetylation between hESCs and hDFs, the acetylated proteins in both samples were quantified based on spectral counts. The spectral counts were first normalized to ensure that average spectral counts per protein was the same in the two data sets.sup.50. A G test was used to judge statistical significance of protein abundance differences .sup.51. Briefly, the G value of each protein was calculated as follows:
G=2(Siln[Si/((Si+S2)/2)]+S2/ln[S2/(S1S2)21));
wherein S.sub.1 and S.sub.2 are the detected spectral counts of a given protein in any of two samples for comparison. Although the theoretical distribution of the G values is complex, these values approximately fit to the .sub.72 distribution (1 degree of freedom), allowing the calculation of related p values.sup.51. For identification of acetylation sites on AldoA, Myc-conjugated AldoA proteins were pulled down by immunoprecipitation via Myc antibody from 293T cells infected with AldoA-Myc-overexpressing plasmid together with empty or SIRT2 KD plasmid. The AldoA-Myc band was excised, digested with chymotrypsin, and analyzed by LTQ-Orbitrap ion-trap mass spectrometer from Thermo Scientific (Taplin Mass Spectrometry Facility, Harvard University, Boston, Mass.; found on the world wide web at https://taplin.med.harvard.edu/home).
[0270] Western Blot Analysis.
[0271] Samples (50 g) were loaded onto a 12% SDS-PAGE and separated by electrophoresis followed by transfer onto a piece of Immun-Blot PVDF membrane (Bio-Rad, Hercules, Calif.). After transfer, the membrane was blocked at room temperature with Tris-buffered saline (TBS) containing 0.1% Tween-20 and 5% (w/v) skim milk for 3-5 h and then incubated overnight at 4 C. with primary antibody. The membrane was washed three times with TBS containing 0.05% Tween-20 (TBST) and then incubated for 2 h with the appropriate secondary antibody (Pierce, Rockford, Ill.). After washing twice with TBST and once with TBS, bound antibodies were detected by chemiluminescence using the SuperSignal West Pico kit (Pierce). Antibodies against acetyl-Lys (#9441; 1:1000) and Enolase (#3810; 1:1000) were purchased from Cell Signaling Technology (Danvers, Mass.), actin (ab8227; 1:1000), tubulin (ab4074; 1:1000), acetylated-tubulin (ab24610; 1:1000), total OXPHOS cocktail (ab110413; 1:250), SIRT1 (ab32441; 1:1000), and SIRT2 (ab51023; 1:1000) from Abcam (Cambridge, Mass.), Aldolase A (sc-12059; 1:1000), PGK1 (sc-130335; 1:1000), GAPDH (sc-32233; 1:1000) from Santa Cruz Biotechnologies (Santa Cruz, Calif.). horseradish peroxidase-conjugated Veriblot for 1P secondary antibody (ab131366; Abcam) were used to facilitate detection of immunoprecipitated proteins without co-detecting the IgG heavy and light chains. The PVDF membrane was stripped by washing three times with TBST followed by incubation at 50 C. for 30 min with shaking in stripping buffer (62.5 mM Tris-HC 1, pH 6.7, 100 mM13-mercaptoethanol, and 2% SDS). After incubation, the membrane was washed several times with TBST. Stripped membranes were blocked and probed with primary and secondary antibodies as previously described.
[0272] Immunofluorescence.
[0273] For immunofluorescence assay, cells were immediately fixed (2% formaldehyde, 100 mM KCl, 200 mM sucrose, 1 mM EGTA, 1 mM MgCl2, 10 mM PIPES, pH 6.8) for 10 min, washed with PBS and then treated with permeabilization buffer (0.2% Triton X-100, 100 mM KCl, 200 mM sucrose, 1 mM EGTA, 1 mM MgCl.sub.2, 10 mM PIPES, pH 6.8) for 10 min. Cells were washed with PBS three times and incubated with blocking solution containing 3% BSA in PBS for 15 min. Cells were washed with PBS three times and incubated with primary antibodies in blocking solution at 4 C. overnight. Oct4 (sc-5279; 1:500) and Nanog (sc-33759; 1:500) antibodies were obtained from Santa Cruz Biotechnologies, SSEA4 (MAB4304; 1:500) and TRA-1-60 (MAB4360; 1:500) antibodies from EMD Millipore (Billerica, Mass.), Otx2 (AF1979; 1:500), Sox17 (AF1924; 1:500) and Brachyury (AF2085; 1:500) antibodies from R&D Systems, Inc. (Minneapolis, Minn.). Cells were washed with PBS three times and incubated with Alexa Fluor conjugated secondary antibodies (Alexa Fluor 488 goat anti-mouse (A11001; Invitrogen) and Alexa Fluor 568 donkey anti-rabbit (A10042; Invitrogen)) in blocking solution. After washing with PBS, nuclei were stained with Hoechst33342 (H3570; Invitrogen). Each image was examined using a confocal laser-scanning microscope (Olympus America Inc., Melville, N.Y.).
[0274] Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR).
[0275] Total RNA was extracted from cells by using the Direct-zol RNA purification Kit (Zymo research, Irvine, Calif.) and cDNA was synthesized using the ThermoScript RT-PCR system (Invitrogen). For quantitative analysis, qRT-PCR (Bio-Rad) was performed using SsoAdvanced SYBR Green supermix (Bio-Rad) with target genes specific primers. The expression level of each gene was shown as relative value following normalization against that of the 13-actin gene. Primers used in this study are listed in Table 8.
[0276] ATP Determination Assay.
[0277] Cellular ATP concentration was measured by using an ATP determination kit (Molecular Probe, Carlsbad, Calif.). Cells (iPSCs and parental hDFs/hESCs and hDFs) were washed three times with PBS and lysed by addition of water and boiled for 5 min. Cell lysates were collected by centrifugation for 15 min at 4 C. ATP chemiluminescent detection was performed using firefly luciferase and luciferin and measured by a SpectraMax L (Molecular Devices, Sunnyvale, Calif.). Cell lysates protein concentrations were determined using the BCA assay (Bio-Rad) and RLU (relative luminescent unit) were normalized according to protein concentrations.
[0278] Neuronal and Spontaneous Differentiation.
[0279] Neuronal differentiation was performed as described previously with slight modifications.sup.52. Briefly, hESCs were dissociated and embryoid bodies (EB) were allowed to form for 1 week after plating on bacterial dishes in hESC medium without bFGF. EBs were allowed to attach to tissue culture dish and neuronal precursors were selected by incubation in serum-free ITSFn (Insulin-Transferrin-Selenium-Fibronectin) medium for 30 days. hESCs and hiPSCs in vitro spontaneous differentiation was performed by culturing in serum-free ITSFn medium for different periods up to 12 days without EB formation.
[0280] Fluorescence-Based Competition Assay.
[0281] Fluorescence-based competition assay was performed as described previously with slight modifications.sup.37, 38. Briefly, GFP expressing hESCs (GFP) or SIRT2 (and GFP)-inducible hESCs (SIRT2) were mixed with wild type hESCs (GFP.sup.) and cultured in matrigel-coated 6 well plates. Every 5 days (one passage) cells were dissociated using accutase (A6964; Sigma-Aldrich, St. Louis, Mo.) and replated. At each passage, the proportion of GFP.sup.+/GFP.sup. cells was measured by flow cytometry on a BD Accuri flow cytometer using the Accuri C6 data analysis software (Ann Arbor, Mich.). Analyses were carried out for six consecutive passages.
[0282] Enzyme Activity Assay.
[0283] Enzyme activity of aldolase (#K665-100), enolase (#K691-100), and GAPDH (#K640-100) was measured using an enzymatic colorimetric assay kit (Biovision, Milpitas, Calif.) according to the manufacturer's instruction. All samples were assayed in triplicate wells, and data are presented as meanSEM.
[0284] Proliferation Assay.
[0285] Cells were detached using accutase for 10 min and suspended in ESC medium and counted using a hemocytometer. An equal number of cells (110.sup.4 cells/well) were seeded on matrigel-coated 12 well plates. The total number of cells per well was determined at 2, 4, 6 days post-seeding using a hemocytometer.
[0286] Annexin Stainin.
[0287] For apoptosis analysis, cells were washed twice with cold PBS, and then stained with annexin V-PE and 7-AAD (559763; BD Biosciences), and analyzed by flow cytometer.
[0288] Luciferase Reporter Assay.
[0289] The Promega dual luciferase assay kit was used to perform the luciferase assay according to the manufacturer's instruction. In brief, cell lysates were analyzed for luciferase activity using the dual luciferase system in which two luciferase enzymes, one (from Renilla reniformis) containing the experimental target sequence and another (from firefly) containing the control. The Renilla/firefly luciferase ratios were normalized against the empty psicheck-2 vector and averaged over 6 replicates.
[0290] Cellular ROS Measurements.
[0291] Intracellular ROS levels were determined using a CeliROX Deep Red Oxidative Stress Reagent (C10422; Life technologies) according to the manufacturer's instruction.
[0292] Lactate Assay.
[0293] Extracellular lactate production was measured using L-Lactate assay kit (700510; Cayman Chemical, Ann Arbor, Mich.) according to the manufacturer's instruction.
[0294] Statistical Analysis.
[0295] The graphical data are presented as meanSEM. For multiple group comparisons one-way analysis of variance (ANOVA) was used followed by Bonferroni post-test analysis. For two groups comparisons Student's t test was used. Statistically significant differences are indicated as follows: *p<0.05; p<0.01; ***p<0.005; ****p<0.001.
TABLE-US-00002 NucleicacidsequenceencodingSIRT1(SEQIDNO:2) (SEQIDNO:2) atgtttgatattgaatatttcagaaaagatccaagaccattcttcaag tttgcaaaggaaatatatcctggacaattccagccatctctctgtcacaaattcatagcc ttgtcagataaggaaggaaaactacttcgcaactatacccagaacatagacacgctggaa caggttgcgggaatccaaaggataattcagtgtcatggttcctttgcaacagcatcttgc ctgatttgtaaatacaaagttgactgtgaagctgtacgaggagatatttttaatcaggta gttcctcgatgtcctaggtgcccagctgatgaaccgcttgctatcatgaaaccagagatt gtgttttttggtgaaaatttaccagaacagtttcatagagccatgaagtatgacaaagat gaagttgacctcctcattgttattgggtcttccctcaaagtaagaccagtagcactaatt ccaagttccataccccatgaagtgcctcagatattaattaatagagaacctttgcctcat ctgcattttgatgtagagcttcttggagactgtgatgtcataattaatgaattgtgtcat aggttaggtggtgaatatgccaaactttgctgtaaccctgtaaagctttcagaaattact gaaaaacctccacgaacacaaaaagaattggcttatttgtcagagttgccacccacacct cttcatgtttcagaagactcaagttcaccagaaagaacttcaccaccagat NucleicacidsequenceencodingSIRT2(SEQIDNO:3) (SEQIDNO:3) gcagacatggacttcctgcg gaacttattctcccagacgctcagcctgggcagccagaaggagcgtctgctggacgagct gaccttggaaggggtggcccggtacatgcagagcgaacgctgtcgcagagtcatctgttt ggtgggagctggaatctccacatccgcaggcatccccgactttcgctctccatccaccgg cctctatgacaacctagagaagtaccatcttccctacccagaggccatctttgagatcag ctatttcaagaaacatccggaacccttcttcgccctcgccaaggaactctatcctgggca gttcaagccaaccatctgtcactacttcatgcgcctgctgaaggacaaggggctactcct gcgctgctacacgcagaacatagataccctggagcgaatagccgggctggaacaggagga cttggtggaggcgcacggcaccttctacacatcacactgcgtcagcgccagctgccggca cgaatacccgctaagctggatgaaagagaagatcttctctgaggtgacgcccaagtgtga agactgtcagagcctggtgaagcctgatatcgtcttttttggtgagagcctcccagcgcg tttcttctcctgtatgcagtcagacttcctgaaggtggacctcctcctggtcatgggtac ctccttgcaggtgcagccctttgcctccctcatcagcaaggcacccctctccacccctcg cctgctcatcaacaaggagaaagctggccagtcggaccctttcctggggatgattatggg cctcggaggaggcatggactttgactccaagaaggcctacagggacgtggcctggctggg tgaatgcgaccagggctgcctggcccttgctgagctccttggatggaagaaggagctgga ggaccttgtccggagggagcacgccagcatagatgcccagtcgggggcgggggtccccaa ccccagcacttcagcttcccccaagaagtccccgccacctgccaaggacgaggccaggac aacagagagggagaaaccccagtgacagct NucleicacidsequenceencodigpCXLE-miR-302s/200c(SEQIDNO:199) (SEQIDNO:199) tcgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatat atggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcc cattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatg ggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccc cctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggact ttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgtt ctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaatta ttttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgagg ggcggggcgggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttcct tttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctg cgcgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgac cgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtt taatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggccctttgt gcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgc gctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgag gggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgc ggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgca cccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcg gggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcggg ccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgag ccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgt gcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcg ccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctct ccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggc ttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctac agctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattc
tctagaagg gctcaccaggaagtgtccccagggactcgggtggtggggggatgggagccagggatctgcagctttt ccgcagggatcctgggcctgaagctgcctgacccaaggtgggcgggctgggcgggggccctcgtctt acccagcagtgtttgggtgcggttgggagtctctaatactgccgggtaatgatggaggcccctgtcc ctgtgtcagcaacatccatcgcctcaggtccccagcccttagctggctgcagccccctccccacttc ccacgcaccccggaagcccctcgtcttgagctgagagcgttgcacaaggggtggttcttgttggctg gctgccactaagggacacaatgggccccagcccctcctcccacccagtgcgatttgtcacctggtgg atccagaacccacagtcgaccttgagcttggggttggctcgccccctctcaagagacctcacctggc ctgtggccagggtcccctgtagcaactggtgagcgcgcaccgtagttctctgtcggccggccctggg tccatcttccagtacagtgttggatggtctaattgtgaagctcctaacactgtctggtaaagatggc tcccgggtgggttctctcggcagtaaccttcagggagccctgaagaccatggaggactactgaccaa caacctctgaccttcacccctctggatgggggacgaatcactaggcaaaggggaacaatgggaagga gacagaattcaagcttcggggactagtcatatgataatcaacctctggattacaaaatttgtgaaag attgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttg tatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctc tttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaac ccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccct attgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggca ctgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccac ctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcc cgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatct ccctttgggccgcctccccgcatcggtaaattcactcctcaggtgcaggctgcctatcagaaggtgg tggctggtgtggccaatgccctggctcacaaataccactgagatctttttccctctgccaaaaatta tggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgca atagtgtgttggaattttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaac atcagaatgagtatttggtttagagtttggcaacatatgcccatatgctggctgccatgaacaaagg ttggctataaagaggtcatcagtatatgaaacagccccctgctgtccattccttattccatagaaaa gccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaa aattttccttacatgttttactagccagatttttcctcctctcctgactactcccagtcatagctgt ccctcttctcttatggagatccctcgacctgcagcccaagcttggcgtaatcatggtcatagctgtt tcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaa gcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagt cgggaaacctgtcgtgccagcggatctcaattccgatcatattcaataacccttaatataacttcgt ataatgtatgctatacgaagttattaggtctgaagaggagtttacgtccagccaagcttaggatcaa ttctcatgtttgacagcttatcatcgataagctgatcctcacaggccgcacccagcttttcttccgt tgccccagtagcatctctgtctggtgaccttgaagaggaagaggaggggtcccgagaatccccatcc ctaccgtccagcaaaaagggggacgaggaatttgaggcctggcttgaggctcaggacgcaaatcttg aggatgttcagcgggagttttccgggctgcgagtaattggtgatgaggacgaggatggttcggagga tggggaattttcagacctggatctgtctgacagcgaccatgaaggggatgagggtgggggggctgtt ggagggggcaggagtctgcactccctgtattcactgagcgtcgtctaataaagatgtctattgatct cttttagtgtgaatcatgtctgacgaggggccaggtacaggacctggaaatggcctaggagagaagg gagacacatctggaccagaaggctccggcggcagtggacctcaaagaagagggggtgataaccatgg acgaggacggggaagaggacgaggacgaggaggcggaagaccaggagccccgggcggctcaggatca gggccaagacatagagatggtgtccggagaccccaaaaacgtccaagttgcattggctgcaaaggga cccacggtggaacaggagcaggagcaggagcgggaggggcaggagcaggaggggcaggagcaggagg aggggcaggagcaggaggaggggcaggaggggcaggaggggcaggaggggcaggagcaggaggaggg gcaggagcaggaggaggggcaggaggggcaggaggggcaggagcaggaggaggggcaggagcaggag gaggggcaggaggggcaggagcaggaggaggggcaggaggggcaggaggggcaggagcaggaggagg ggcaggagcaggaggaggggcaggaggggcaggagcaggaggaggggcaggaggggcaggaggggca ggagcaggaggaggggcaggagcaggaggggcaggaggggcaggaggggcaggagcaggaggggcag gagcaggaggaggggcaggaggggcaggaggggcaggagcaggaggggcaggagcaggaggggcagg agcaggaggggcaggagcaggaggggcaggaggggcaggagcaggaggggcaggaggggcaggagca ggaggggcaggaggggcaggagcaggaggaggggcaggaggggcaggagcaggaggaggggcaggag gggcaggagcaggaggggcaggaggggcaggagcaggaggggcaggaggggcaggagcaggaggggc aggaggggcaggagcaggaggaggggcaggagcaggaggggcaggagcaggaggtggaggccggggt cgaggaggcagtggaggccggggtcgaggaggtagtggaggccggggtcgaggaggtagtggaggcc gccggggtagaggacgtgaaagagccagggggggaagtcgtgaaagagccagggggagaggtcgtgg acgtggagaaaagaggcccaggagtcccagtagtcagtcatcatcatccgggtctccaccgcgcagg ccccctccaggtagaaggccatttttccaccctgtaggggaagccgattattttgaataccaccaag aaggtggcccagatggtgagcctgacgtgcccccgggagcgatagagcagggccccgcagatgaccc aggagaaggcccaagcactggaccccggggtcagggtgatggaggcaggcgcaaaaaaggagggtgg tttggaaagcatcgtggtcaaggaggttccaacccgaaatttgagaacattgcagaaggtttaagag ctctcctggctaggagtcacgtagaaaggactaccgacgaaggaacttgggtcgccggtgtgttcgt atatggaggtagtaagacctccctttacaacctaaggcgaggaactgcccttgctattccacaatgt cgtcttacaccattgagtcgtctcccctttggaatggcccctggacccggcccacaacctggcccgc taagggagtccattgtctgttatttcatggtctttttacaaactcatatatttgctgaggttttgaa ggatgcgattaaggaccttgttatgacaaagcccgctcctacctgcaatatcagggtgactgtgtgc agctttgacgatggagtagatttgcctccctggtttccacctatggtggaaggggctgccgcggagg gtgatgacggagatgacggagatgaaggaggtgatggagatgagggtgaggaagggcaggagtgatg taacttgttaggagacgccctcaatcgtattaaaagccgtgtattcccccgcactaaagaataaatc cccagtagacatcatgcgtgctgttggtgtatttctggccatctgtcttgtcaccattttcgtcctc ccaacatggggcaattgccggaacccttaatataacttcgtataatgtatgctatacgaagttatta ggtccctcgaagaggttcactagcggatctcaattgggcatacccatgttgtcacgtcactcagctc cgcgctcaacaccttctcgcgttggaaaacattagcgacatttacctggtgagcaatcagacatgcg acggctttagcctggcctccttaaattcacctaagaatgggagcaaccagcaggaaaaggacaagca gcgaaaattcacgcccccttgggaggtggcggcatatgcaaaggatagcactcccactctactactg ggtatcatatgctgactgtatatgcatgaggatagcatatgctacccggatacagattaggatagca tatactacccagatatagattaggatagcatatgctacccagatatagattaggatagcctatgcta cccagatataaattaggatagcatatactacccagatatagattaggatagcatatgctacccagat atagattaggatagcctatgctacccagatatagattaggatagcatatgctacccagatatagatt aggatagcatatgctatccagatatttgggtagtatatgctacccagatataaattaggatagcata tactaccctaatctctattaggatagcatatgctacccggatacagattaggatagcatatactacc cagatatagattaggatagcatatgctacccagatatagattaggatagcctatgctacccagatat aaattaggatagcatatactacccagatatagattaggatagcatatgctacccagatatagattag gatagcctatgctacccagatatagattaggatagcatatgctatccagatatttgggtagtatatg ctacccatggcaacattagcccaccgtgctctcagcgacctcgtgaatatgaggaccaacaaccctg tgcttggcgctcaggcgcaagtgtgtgtaatttgtcctccagatcgcagcaatcgcgcccctatctt ggcccgcccacctacttatgcaggtattccccggggtgccattagtggttttgtgggcaagtggttt gaccgcagtggttagcggggttacaatcagccaagttattacacccttattttacagtccaaaaccg cagggcggcgtgtgggggctgacgcgtgcccccactccacaatttcaaaaaaaagagtggccacttg tctttgtttatgggccccattggcgtggagccccgtttaattttcgggggtgttagagacaaccagt ggagtccgctgctgtcggcgtccactctctttccccttgttacaaatagagtgtaacaacatggttc acctgtcttggtccctgcctgggacacatcttaataaccccagtatcatattgcactaggattatgt gttgcccatagccataaattcgtgtgagatggacatccagtctttacggcttgtccccaccccatgg atttctattgttaaagatattcagaatgtttcattcctacactagtatttattgcccaaggggtttg tgagggttatattggtgtcatagcacaatgccaccactgaaccccccgtccaaattttattctgggg gcgtcacctgaaaccttgttttcgagcacctcacatacaccttactgttcacaactcagcagttatt ctattagctaaacgaaggagaatgaagaagcaggcgaagattcaggagagttcactgcccgctcctt gatcttcagccactgcccttgtgactaaaatggttcactaccctcgtggaatcctgaccccatgtaa ataaaaccgtgacagctcatggggtgggagatatcgctgttccttaggacccttttactaaccctaa ttcgatagcatatgcttcccgttgggtaacatatgctattgaattagggttagtctggatagtatat actactacccgggaagcatatgctacccgtttagggttaacaagggggccttataaacactattgct aatgccctcttgagggtccgcttatcggtagctacacaggcccctctgattgacgttggtgtagcct cccgtagtcttcctgggcccctgggaggtacatgtcccccagcattggtgtaagagcttcagccaag agttacacataaaggcaatgttgtgttgcagtccacagactgcaaagtctgctccaggatgaaagcc actcagtgttggcaaatgtgcacatccatttataaggatgtcaactacagtcagagaacccctttgt gtttggtccccccccgtgtcacatgtggaacagggcccagttggcaagttgtaccaaccaactgaag ggattacatgcactgccccgcgaagaaggggcagagatgtcgtagtcaggtttagttcgtccggggc ggggcatcgatcctctagagtcgacgctagcggatccgctgcattaatgaatcggccaacgcgcggg gagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgtt cggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggata acgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgct ggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtgg cgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctg ttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctca tagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagac acgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgc tacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgct ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctg gtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcc tttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatg agattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaa gtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggc ttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcag caataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcca gtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgtt gccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttccc aacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctcc gatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattct cttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgag aatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatag cagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccg ctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttca ccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacg gaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctc atgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttcccc gaaaagtgccacctggg
[0296] In SEQ ID NO: 199, the bolded. double underlined text represents the sequence of miR-302s, and the bolded, underlined text represents the sequence of miRNA-200c.
REFERENCES
[0297] 1. Warburg, 0., Wind, F. & Negelein, E. The Metabolism of Tumors in the Body. J Gen Physiol 8, 519-530 (1927). [0298] 2. Warburg, 0. On the origin of cancer cells. Science 123, 309-314 (1956). [0299] 3. Rafalski, V. A., Mancini, E. & Brunet, A. Energy metabolism and energy-sensing pathways in mammalian embryonic and adult stem cell fate. Journal of cell science 125, 5597-5608 (2012). [0300] 4. Ito, K. & Suda, T. Metabolic requirements for the maintenance of self-renewing stem cells. Nature reviews. Molecular cell biology 15, 243-256 (2014). [0301] 5. Burgess, R. J., Agathocleous, M. & Morrison, S. J. Metabolic regulation of stem cell function. J Intern Med 276, 12-24 (2014). [0302] 6. Zhang, J., Nuebel, E., Daley, G. Q., Koehler, C. M. & Teitell, M. A. Metabolic regulation in pluripotent stem cells during reprogramming and self-renewal. Cell stem cell 11, 589-595 (2012). [0303] 7. Folmes, C. D., Dzeja, P. P., Nelson, T. J. & Terzic, A. Metabolic plasticity in stem cell homeostasis and differentiation. Cell stem cell 11, 596-606 (2012). [0304] 8. Zhang, J et al. UCP2 regulates energy metabolism and differentiation potential of human pluripotent stem cells. The EMBO journal 30, 4860-4873 (2011). [0305] 9. Zhou, W. et al. HIF 1 alpha induced switch from bivalent to exclusively glycolytic metabolism during ESC-to-EpiSC/hESC transition. EMBO J 31, 2103-2116 (2012). [0306] 10. Varum, S. et al. Energy metabolism in human pluripotent stem cells and their differentiated counterparts. PLoS One 6, e20914 (2011). [0307] 11. Folmes, C. D. et al. Somatic oxidative bioenergetics transitions into pluripotency-dependent glycolysis to facilitate nuclear reprogramming. Cell metabolism 14, 264-271 (2011). [0308] 12. Moussaieff, A. et al. Glycolysis-Mediated Changes in Acetyl-CoA and Histone Acetylation Control the Early Differentiation of Embryonic Stem Cells. Cell metabolism 21, 392-402 (2015). [0309] 13. Panopoulos, A. D. et al. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell research 22, 168-177 (2012). [0310] 14. Kim, S. C. et al. Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Mol Cell 23, 607-618 (2006). [0311] 15. Zhao, S. et al. Regulation of cellular metabolism by protein lysine acetylation. Science 327, 1000-1004 (2010). [0312] 16. Wang, Q. et al. Acetylation of metabolic enzymes coordinates carbon source utilization and metabolic flux. Science 327, 1004-1007 (2010). [0313] 17. Guarente, L. The logic linking protein acetylation and metabolism. Cell metabolism 14, 151-153 (2011). [0314] 18. Guarente, L. Franklin H. Epstein Lecture: Sirtuins, aging, and medicine. The New England journal of medicine 364, 2235-2244 (2011). [0315] 19. Finkel, T., Deng, C. X. & Mostoslaysky, R. Recent progress in the biology and physiology of sirtuins. Nature 460, 587-591 (2009). [0316] 20. Zhang, J. et al. Measuring energy metabolism in cultured cells, including human pluripotent stem cells and differentiated cells. Nature protocols 7, 1068-1085 (2012). [0317] 21. Gatenby, R. A. & Gillies, R. J. Why do cancers have high aerobic glycolysis? Nat Rev Cancer 4, 891-899 (2004). [0318] 22. Mathieu, J. et al. Hypoxia-Inducible Factors Have Distinct and Stage-Specific Roles during Reprogramming of Human Cells to Pluripotency. Cell stem cell 14, 592-605 (2014). [0319] 23. Prigione, A. et al. HIF 1 alpha modulates cell fate reprogramming through early glycolytic shift and upregulation of PDK1-3 and PKM2. Stem Cells 32, 364-376 (2014). [0320] 24. North, B. J., Marshall, B. L., Borra, M. T., Denu, J. M. & Verdin, E. The human Sir2 ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 11, 437-444 (2003). [0321] 25. Lynn, E. G., McLeod, C. J., Gordon, J. P., Bao, J. & Sack, M. N. SIRT2 is a negative regulator of anoxia-reoxygenation tolerance via regulation of 14-3-3 zeta and BAD in H9c2 cells. FEBS Lett 582, 2857-2862 (2008). [0322] 26. Fathi, A. et al. Comprehensive gene expression analysis of human embryonic stem cells during differentiation into neural cells. PLoS One 6, e22856 (2011). [0323] 27. Assou, S. et al. A meta-analysis of human embryonic stem cells transcriptome integrated into a web-based expression atlas. Stem Cells 25, 961-973 (2007). [0324] 28. Li, Z. et al. Functional and transcriptional characterization of human embryonic stem cell-derived endothelial cells for treatment of myocardial infarction. PLoS One 4, e8443 (2009). [0325] 29. Masaki, H. et al. Heterogeneity of pluripotent marker gene expression in colonies generated in human iPS cell induction culture. Stem Cell Res 1, 105-115 (2007). [0326] 30. Barrett, T. et al. NCBI GEO: archive for functional genomics data setsupdate. Nucleic Acids Res 41, D991-995 (2013). [0327] 31. Calvanese, V. et al. Sirtuin 1 regulation of developmental genes during differentiation of stem cells. Proc Nall Acad Sci USA 107, 13736-13741 (2010). [0328] 32. Lee, Y. L. et al. Sirtuin 1 facilitates generation of induced pluripotent stem cells from mouse embryonic fibroblasts through the miR-34a and p53 pathways. PloS one 7, e45633 (2012). [0329] 33. Si, X. et al. Activation of GSK3beta by Sirt2 is required for early lineage commitment of mouse embryonic stem cell. PloS one 8, e76699 (2013). [0330] 34. Xiong, Y. & Guan, K. L. Mechanistic insights into the regulation of metabolic enzymes by acetylation. J Cell Biol 198, 155-164 (2012). [0331] 35. Marchler-Bauer, A. et al. CDD: NCBI's conserved domain database. Nucleic acids research 43, D222-226 (2015). [0332] 36. Gamblin, S. J. et al. Activity and specificity of human aldolases. Journal of molecular biology 219, 573-576 (1991). [0333] 37. Park, K. S. et al. Transcription elongation factor Tcea3 regulates the pluripotent differentiation potential of mouse embryonic stem cells via the Lefty1-Nodal-Smad2 pathway. Stem Cells 31, 282-292 (2013). [0334] 38. Ivanova, N et al. Dissecting self-renewal in stem cells with RNA interference. Nature 442, 533-538 (2006). [0335] 39. Mu, W. L. et al. Sox2 Deacetylation by Sirtl Is Involved in Mouse Somatic Reprogramming. Stem Cells 33, 2135-2147 (2015). [0336] 40. Miranda, K. C. et al. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 126, 1203-1217 (2006). [0337] 41. Suh, M. R. et al. Human embryonic stem cells express a unique set of microRNAs. Developmental biology 270, 488-498 (2004). [0338] 42. Wang, G. et al. Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2-induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation. Proceedings of the National Academy of Sciences of the United States of America 110, 285 8-2863 (2013). [0339] 43. Gomes, P., Outeiro, T. F. & Cavadas, C. Emerging Role of Sirtuin 2 in the Regulation of Mammalian Metabolism. Trends in pharmacological sciences 36, 756-768 (2015). [0340] 44. Hallows, W. C., Yu, W. & Denu, J. M. Regulation of glycolytic enzyme phosphoglycerate mutase-1 by Sirtl protein-mediated deacetylation. The Journal of biological chemistry 287, 3850-3858 (2012). [0341] 45. Tsusaka, T. et al. Deacetylation of phosphoglycerate mutase in its distinct central region by SIRT2 down-regulates its enzymatic activity. Genes Cells 19, 766-777 (2014). [0342] 46. Xu, Y. et al. Oxidative stress activates SIRT2 to deacetylate and stimulate phosphoglycerate mutase. Cancer Res 74, 3630-3642 (2014). [0343] 47. Li, T. et al. Glyceraldehyde-3-phosphate dehydrogenase is activated by lysine 254 acetylation in response to glucose signal. J Biol Chem 289, 3775-3785 (2014). [0344] 48. Somers, A. et al. Generation of transgene-free lung disease-specific human induced pluripotent stem cells using a single excisable lentiviral stem cell cassette. Stem Cells 28, 1728-1740 (2010). [0345] 49. Takahashi, K. et al. Induction ofpluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872 (2007). [0346] 50. Kislinger, T. et al. Global survey of organ and organelle protein expression in mouse: combined proteomic and transcriptomic profiling. Cell 125, 173-186 (2006). [0347] 51. Zhou, J. Y. et al. Galectin-3 is a candidate biomarker for amyotrophic lateral sclerosis: discovery by a proteomics approach. Journal of proteome research 9, 5133-5141 (2010). [0348] 52. Kim, D. et al. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell stem cell 4, 472-476 (2009).
TABLE-US-00003 TABLE2 Listofhyperacetylatedproteins inhESCsincludesfiveglycolyticenzymes. Acession Molec. hDF hESC hESC/ Representative Seq Description No. Weight peptide peptide hDF G-stat p-value peptide ID Fattyacid IPI00026781 273kDa 3 34 11.33 30.46916 3.39E-08 (R)FPQLDSTSFAN SEQ synthase SR(D) ID NO: 30 Fructose- IPI00418262 48kDa 1 10 10 8.547244 0.003460458 (R)YASIQQGIVPI SEQ bisphosphate VEPEILPDGDHDLK ID aldolase (R) NO: 31 Ubiquitin-like IPI00645078 118kDa 1 10 10 8.547244 0.003460458 (R)YDGQVAVFGSD SEQ modifier- LQEK(L) ID activating NO: enzyme1 32 ATPsynthase IPI00303476 57kDa 2 18 9 14.72257 0.000124547 (K)TVLIELINVAK SEQ subunitbeta, (A) ID mitochondrial NO: 33 Isoformalpha- IPI00465248 47kDa 2 13 6.5 9.014181 0.002678928 (K)VNQIGSVTESI SEQ enolase QAK(L) ID NO: 34 Phospho- IPI00169383 45kDa 4 21 5.25 12.67387 0.000370802 (R)AHSSVGVNLPQ SEQ glycerate K(A) ID kinase1 NO: 35 Actin, IPI00021439 42kDa 4 17 4.25 8.661848 0.003249416 (K)DSYVGDEAQSK SEQ cytoplasmic1 (R) ID NO: 36 Transitional IPI00022774 89kDa 5 20 4 9.637238 0.001906718 (R)IVSQLLTLMDG SEQ endoplasmic LK(Q) ID reticulum NO: ATPase 37 14-3-3 IPI00021263 28kDa 4 15 3.75 6.782773 0.009204181 (R)YLAEVAAGDDK SEQ protein (K) ID zeta/delta NO: 38 Isoform1 IPI00003865 71kDa 7 26 3.71 11.64198 0.0006448 (K)NQVAMNPTNTV SEQ ofHeat FDAK(R) ID shockcognate NO: 71kDaprotein 39 Protein IPI00009904 73kDa 4 11 2.75 3.39696 0.065316682 (K)VEGFPTIYFAP SEQ disulfide- SGDK(K) ID isomeraseA4 NO: 40 Heatshock IPI00414676 83kDa 15 40 2.67 11.7914 0.000595049 (R)TLTIVDTGIGM SEQ proteinHSP TK(A) ID 90-beta NO: 41 Isoform1of IPI00784295 85kDa 7 16 2.29 3.617618 0.057170688 (K)HSQFIGYPITL SEQ Heatshock FVEK(E) ID protein NO: HSP90-alpha 42 IsoformLongof IPI00883857 91kDa 6 13 2.17 2.640709 0.104157079 (R)GYFEYIEENK SEQ Heterogeneous (Y) ID nuclear NO: ribonucleo- 43 proteinU Tubulinalpha- IPI00180675 50kDa 9 19 2.11 3.651513 0.056018296 (K)TIGGGDDSFNT SEQ 1Achain FFSETGAGK(H) ID NO: 44 Tubulinbeta- IPI00007752 50kDa 13 27 2.08 5.005292 0.025269938 (R)IMNTFSVVPSP SEQ 2Cchain K(V) ID NO: 45 60kDa IPI00784154 61kDa 5 10 2 1.69899 0.192420068 (K)VGGTSDVEVNE SEQ heatshock K(K) ID protein, NO: mitochondrial 46 Pyruvate IPI00220644 57kDa 5 10 2 1.69899 0.192420068 (R)LNFSHGTHEYH SEQ kinaseM1/M2 AETIK(N) ID NO: 47 Heatshock IPI00304925 70kDa 7 13 1.86 1.828022 0.176361396 (K)NQVALNPQNTV SEQ 70kDa FDAK(R) ID protein1A/1B NO: 48 Fructose- IPI00465439 39kDa 9 16 1.78 1.986449 0.158712633 (K)GILAADESTGS SEQ bisphosphate IAK(R) ID aldolaseA NO: 49 Glyceraldehyde- IPI00219018 36kDa 9 16 1.78 1.986449 0.158712633 (R)GALQNIIPAST SEQ 3-phosphate GAAK(A) ID dehydrogenase NO: 50 78kDaglucose- IPI00003362 72kDa 15 24 1.6 2.095762 0.147708093 (R)IINEPTAAAIA SEQ regulated YGLDK(R) ID protein NO: 51 Hydroxy- IPI00008475 57kDa 0 14 19.40812 1.06E-05 (K)VTQDATPGSAL SEQ methylglutaryl- DK(I) ID CoAsynthase, NO: cytoplasmic 52 THOcomplex IPI00328840 28kDa 0 13 18.02183 2.18E-05 (R)SLGTADVHFER SEQ subunit4 (K) ID NO: 53 Nuclease- IPI00031812 36kDa 0 13 18.02183 2.18E-05 (K)EDVFVHQTAIK SEQ sensitive (K) ID element-binding NO: protein1 54 Insulin-like IPI00008557 63kDa 0 11 15.24924 9.42E-05 (R)MVIITGPPEAQ SEQ growthfactor2 FK(A) ID RNAbinding NO: protein1 55 Isoform1of IPI00219526 61kDa 0 11 15.24924 9.42E-05 (K)FNISNGGPAPE SEQ Phospho- AITDK(I) ID glucomutase-1 NO: 56 Isocitrate IPI00027223 47kDa 0 10 13.86294 0.000196638 (K)VEITYTPSDGT SEQ dehydrogenase QK(V) ID [NADP] NO: cytoplasmic 57
TABLE-US-00004 TABLE3 ListofhypoacetylatedproteinsinhESCs. Acession Molec. hDF hESC hESC/ Representative Description No. Weight peptide peptide hDF G-stat p-value peptide Talin-1 IPI00298994 270kDa 11 17 0.65 1.295739 0.254993 (R)ILAQATSDLVN SEQID AIK(A) NO:58 Actininalpha1 IPI00921118 107kDa 7 11 0.64 0.896353 0.343761 (K)VLAVNQENEQL SEQID isoform3 MEDYEK(L) NO:59 Isoform1of IPI00022418 263kDa 13 23 0.57 2.814651 0.093407 (K)WCGTTQNYDAD SEQID Fibronectin QK(F) NO:60 Isoform2of IPI00418169 40kDa 6 11 0.55 1.49256 0.22182 (K)LSLEGDHSTPP SEQID AnnexinA2 SAYGSVK(A) NO:61 Non-POUdomain- IPI00304596 54kDa 6 12 0.5 2.038788 0.153332 (R)PVTVEPMDQLD SEQID containing DEEGLPEK(L) NO:62 octamer- bindingprotein IsoformA1-Aof IPI00465365 34kDa 3 9 0.33 3.139489 0.076418 (R)EDSQRPGAHLT SEQID Heterogeneous VK(K) NO:63 nuclearribo- nucleoproteinA1 Isoform1of IPI00019502 227kDa 6 25 0.24 12.51282 0.000404 (R)LTEMETLQSQL SEQID Myosin-9 MAEK(L) NO:64 AnnexinA6 IPI00221226 76kDa 2 9 0.22 4.818173 0.028161 (R)PANDFNPDADA SEQID K(A) NO:65 IsoformB1of IPI00396378 37kDa 2 9 0.22 4.818173 0.028161 (R)EESGKPGAHVT SEQID Heterogeneous VK(K) NO:66 nuclearribo- nucleoproteins A2/B1 p180/ribosome IPI00856098 166kDa 4 19 0.21 10.63107 0.001112 (K)LLATEQEDAAV SEQID receptor AK(S) NO:67 Cytoskeleton- IPI00141318 66kDa 5 24 0.21 13.54034 0.000233 (K)SINDNIAIFTE SEQID associated VQK(R) NO:68 protein4 IsoformAof IPI00021405 74kDa 4 32 0.13 24.79069 6.39E-07 (K)AAYEAELGDAR SEQID Prelamin-A/C (K) NO:69 Isoform1of IPI00022200 344kDa 1 13 0.08 12.2032 0.000477 (K)SDDEVDDPAVE SEQID Collagen LK(Q) NO:70 alpha-3(VI) chain Isoform2of IPI00413958 287kDa 1 29 0.03 32.82015 1.01E-08 (K)GAGTGGLGLTV SEQID Filamin-C EGPcEAK(I) NO:71 Neuroblast IPI00021812 629kDa 0 21 29.11218 6.83E-08 (R)FPQLDSTSFAN SEQID differentiation- SR(D) NO:72 associated proteinAHNAK Talin-1 IPI00298994 270kDa 11 17 0.65 1.295739 0.254993 (R)ILAQATSDLVN SEQID AIK(A) NO:73
TABLE-US-00005 TABLE 4a Meta-analyses of hPSCs and their differentiated cells. hESCs, hiPSCs, and their differentiated cells were grouped and meta-analysis for HAT family was performed using GEO2R. The meta-analysis did not reveal any change in HAT expression pattern in hESC and hiPSC. GEO accession numbers GSE28633, GSE18265, GSE20013, GSE39144, and GSE9709 were used for the analysis. Adj. P. Val indicates P-value adjustment for mutiple comparisons. adj Gene GSE# ID P. Val P Value symbol Gene title Expression Samples Ref. GSE28633 ILMN_2095840 4.24E03 4.37E04 KAT6A K(lysine) Down 3 hESCs and 3 30 acetyltransferase 6A Neural cells ILMN_1725244 5.27E02 9.20E03 HAT1 histone Up acetyltransferase 1 ILMN_2293692 8.25E02 1.59E02 CREBBP CREB binding Up protein (CBP) ILMN_1782247 9.32E02 1.85E02 KAT2A K(lysine) Up acetyltransferase 2A (GCN5) GSE18265 None 4 hESCs, 3 hiPSCs 31 and 1 hFF GSE20013 A_23_P339480 5.73E07 7.12E08 HAT1 histone Up 4 hESCs, 4 ECs 32 acetyltransferase 1 (hESCs) and 4 A_32_P159651 3.39E06 6.09E07 KAT2B K(lysine) Down HUVECs acetyltransferase 2B A_24_P941586 5.38E06 1.05E06 KAT6B K(lysine) Up acetyltransferase 6B GSE39144 226547_at 2.53E08 1.97E10 KAT6A K(lysine) Down 3 hESCs, 6 Unpublished acetyltransferase 6A hiPSCs, 4 Neurons 203845_at 1.18E07 1.89E09 KAT2B K(lysine) Down (hESCs), 7 acetyltransferase 2B Neurons (hiPSCs) 202423_at 2.00E06 8.79E08 KAT6A K(lysine) Down and 1 hDF acetyltransferase 6A 239585_at 3.02E06 1.54E07 KAT2B K(lysine) Down acetyltransferase 2B GSE9709 203845_at 0.0139 2.98E04 KAT2B K(lysine) Down 6 hiPSCs and 2 33 acetyltransferase 2B hDFs 1559142_at 0.23203 4.59E02 KAT6A K(lysine) Down acetyltransferase 6A
TABLE-US-00006 TABLE 4b Meta-analyses of hPSCs and their differentiated cells. Compiled HAT family data used in this study. Expression levels of each HAT family member shown as up, down, and N/A indicate up-regulated, down-regulated, and no significant change respectively in hESCs. Numbers it parentheses indicate the number of changed expression among the 5 different studies. Gene Expression in hESCs Symbol Gene Title (# of studies) HAT1 histone acetyltransferase 1 Up (1) KAT2A K(lysine) acetyltransferase 2A Up (1) (GCN5) KAT2B K(lysine) acetyltransferase 2B Down (3) KAT5 K(lysine) acetyltransferase 5 N/A KAT6A K(lysine) acetyltransferase 6A Down (3) KAT6B K(lysine) acetyltransferase 6B Up (1) KAT7 K(lysine) acetyltransferase 7 N/A KAT8 K(lysine) acetyltransferase 8 N/A
TABLE-US-00007 TABLE 5a Meta-analyses of HDAC family gene expression. hESCs, hiPSCs, and their differentiated cells were grouped and meta-analyses performed by GEO2R for HDAC family gene expression. adj GSE# ID P. Val P Value Gene symbol Gene title Expression Samples Ref. GSE28633 ILMN_1727458 2.62E06 5.03E08 HDAC1 histone deacetylase 1 Up 3 hESCs and 3 30 ILMN_2398711 2.36E05 7.88E07 SIRT2 sirtuin 2 Down Neural cells ILMN_2291644 1.03E04 4.82E06 SIRT5 sirtuin 5 Down ILMN_1657868 1.05E04 4.94E06 SIRT4 sirtuin 4 Down ILMN_1810856 1.48E04 7.55E06 HDAC5 histone deacetylase 5 Down ILMN_1739083 2.71E04 1.55E05 SIRT1 sirtuin 1 Up ILMN_1683059 1.06E03 8.15E05 SIRT5 sirtuin 5 Up ILMN_1723494 1.17E02 1.49E03 SIRT2 sirtuin 2 Down ILMN_1798546 2.96E02 4.55E03 HDAC6 histone deacetylase 6 Down ILMN_1799598 6.10E02 1.10E02 SIRT5 sirtuin 5 Up ILMN_1772455 7.43E02 1.40E02 HDAC3 histone deacetylase 3 Up GSE18265 218878_s_at 0.03419 1.31E03 SIRT1 sirtuin 1 Up 4 hESCs, 3 hiPSCs 31 220047_at 0.11623 1.18E02 SIRT4 sirtuin 4 Up and 1 hFF 205659_at 0.1889 3.00E02 HDAC9 histone deacetylase 9 Up 220605_s_at 0.20971 3.70E02 SIRT2 sirtuin 2 Down GSE20013 A_23_P122304 2.38E08 1.22E09 HDAC2 histone deacetylase 2 Up 4 hESCs, 4 ECs 32 (hESCs) and 4 A_24_P125283 7.40E07 9.75E08 HDAC5 histone deacetylase 5 Up HUVECs A_23_P98022 6.75E09 2.11E10 SIRT1 sirtuin 1 Up A_23_P142455 1.99E06 3.24E07 SIRT2 sirtuin 2 Down GSE39144 228813_at 1.62E05 1.38E06 HDAC4 histone deacetylase 4 Down 3 hESCs, 6 Unpublished 223908_at 3.25E06 1.70E07 HDAC8 histone deacetylase 8 Up hiPSCs, 4 Neurons 218878_s_at 7.66E06 5.29E07 SIRT1 sirtuin 1 Up (hESCs), 7 1558331_at 2.23E06 1.02E07 SIRT2 sirtuin 2 Down Neurons (hiPSCs) 219185_at 1.19E05 9.30E07 SIRT5 sirtuin 5 Up and 1 hDF GSE9709 232870_at 0.08736 7.98E03 HDAC10 histone deacetylase Down 6 hiPSCs and 2 33 10 hDFs 229408_at 0.13408 1.70E02 HDAC5 histone deacetylase 5 Down 223908_at 0.21785 4.08E02 HDAC8 histone deacetylase 8 Up 1558331_at 0.06372 4.61E03 SIRT2 sirtuin 2 Down 220605_s_at 0.12525 1.51E02 SIRT2 sirtuin 2 Down 222080_s_at 0.15282 2.15E02 SIRT5 sirtuin 5 N/A 229112_at 0.18893 3.15E02 SIRT5 sirtuin 5 N/A
TABLE-US-00008 TABLE 5b Compiled data used in this study for HDAC family. Expression levels of each family member shown as up, down, and N/A indicate up-regulated, down-regulated, and no significant change respectively in hESCs. Numbers in parentheses indicate the number of changed expression among the 5 different studies. Gene Expression in hESCs Symbol Gene Title (# of studies) SIRT1 sirtuin 1 Up (4/5) SIRT2 sirtuin 2 Down (5/5) SIRT3 sirtuin 3 N/A SIRT4 sirtuin 4 Up (1)/Down (1) SIRT5 sirtuin 5 Up (2)/Down (1) SIRT6 sirtuin 6 N/A SIRT7 sirtuin 7 N/A
TABLE-US-00009 TABLE 5c Compiled data used in this study for Sirtuin family. Expression levels of each family member shown as up, down, and N/A indicate up regulated, down-regulated, and no significant change respectively in hESCs. Numbers in parentheses indicate the number of changed expression among the 5 different studies. Gene Expression in hESCs Symbol Gene Title (# of studies) HDAC1 histone deacetylase 1 Up (1) HDAC2 histone deacetylase 2 Up (1) HDAC3 histone deacetylase 3 Up (1) HDAC4 histone deacetylase 4 Down (1) HDAC5 histone deacetylase 5 Up (1)/Down (2) HDAC6 histone deacetylase 6 Down (1) HDAC7 histone deacetylase 7 N/A HDAC8 histone deacetylase 8 Up (2) HDAC9 histone deacetylase 9 Up (1) HDAC10 histone deacetylase 10 Down (1) HDAC11 histone deacetylase 11 N/A
TABLE-US-00010 TABLE 6a List of hESC lines and normal somatic cell lines used for web-based data analyses of FIG. 1B. Embryonic stem cell lines Normal cells Human embryonic stem cell (H9) Lung fibroblast cell line WI-38 Human embryonic stem cell (T3) Embryonic skin fibroblast D551 cell line Human embryonic stem cell (SA01) Extravillous trophoblast cell line SGHPL-5 Human embryonic stem cell (HD90) Neonatal foreskin keratinocyte NHEK cell line Human embryonic stem cell (VUB01) Extravillous trophoblast cell line HTR-8_SVneo Human embryonic stem cell (HS181) Neonatal melanocyte cell line HEM-N Human embryonic stem cell (WIBR3) Fibroblast of skin cell line GM-5659 Human embryonic stem cell (HS235) Umbilical vein cell line HUVEC Human embryonic stem cell (HD129) Melanocyte cell line Hermes 1 Human embryonic stem cell (HD83) Melanocyte cell line HEM-LP Human embryonic stem cell (HUES6) Melanocyte cell line Hermes 2B Human embryonic stem cell (WIBR1) Breast epithelial cell line HMEC Human embryonic stem cell (Cythera) Testis fibroblast cell line Hs 1.Tes Human embryonic stem cell (HUES8) Kidney epithelial cell line HEK-293 Human embryonic stem cell (WIBR2) Skin keratinocyte HaCaT cell line Human embryonic stem cell (BG01) Human embryonic stem cell (H7) Human embryonic stem cell (H14) Human embryonic stem cell (CSES4) Human embryonic stem cell (H14A) Human embryonic stem cell (H13) Human embryonic stem cell (H13B) Human embryonic stem cell (ES4) Human embryonic stem cell (H1) Human embryonic stem cell (ES2)
TABLE-US-00011 TABLE 6b List of originally published data sets for all cell lines used for web-based data analyses. GSE# Description Platform Ref. GSE1822 Kidney epithelial cell line HEK-293 Affymetrix Human Genome U133A Array 52 GSE2638 Breast epithelial cell line HMEC Affymetrix Human Genome U133A Array 53 GSE4975 Skin keratinocyte cell line HaCaT Affymetrix Human Genome U133A Array 54 Affymetrix Human Genome U133B Array Affymetrix Human Genome U133 Plus 2.0 Array GSE7214 hESCs (SA01, VUB01) Affymetrix Human Genome U133 Plus 2.0 Array 55 GSE7216 Neonatal foreskin keratinocyte cell line NHEK Affymetrix Human Genome U133 Plus 2.0 Array 56 GSE9196 hESCs (H9) Affymetrix Human Genome U133 Plus 2.0 Array 57 GSE9440 hESCs (T3) Affymetrix Human Genome U133 Plus 2.0 Array 58 GSE11919 Fibroblast of skin cell line GM05659 Affymetrix Human Genome U133 Plus 2.0 Array 59 GSE12390 hESCs (HUES8) Affymetrix Human Genome U133 Plus 2.0 Array 60 GSE12583 hESCs (ES2, ES4) Affymetrix Human Genome U133 Plus 2.0 Array 61 GSE14711 hESCs (BG01) Affymetrix Human Genome U133 Plus 2.0 Array 62 GSE15148 hESCs (H1, H7, H13B, H14A) Affymetrix Human Genome U133 Plus 2.0 Array 63 GSE15220 Testis fibroblast cell line Hs 1.Tes Affymetrix Human Genome U133 Plus 2.0 Array 64 Affymetrix Human Tiling 2.0R Set, Array 1 Affymetrix Human Tiling 2.0R Set, Array 2 GSE15400 Embryonic skin fibroblast cell line D551 Affymetrix Human Genome U133 Plus 2.0 Array 65 Lung fibroblast cell line WI-38 GSE16654 hESCs (CSES4) Affymetrix Human Genome U133 Plus 2.0 Array 66 OSUCCC Human miRNA Expression custom Bioarray GSE16683 Umbilical vein cell line HUVEC Affymetrix Human Genome U133 Plus 2.0 Array 67 GSE18265 hESCs (HD83, HD90, HD129, HS181, HS235) Affymetrix Human Genome U133 Plus 2.0 Array Unpublished GSE18618 hESCs (Cythera, HUES6) Affymetrix Human Genome U133 Plus 2.0 Array 68 GSE20033 hESCs (H7, H13, H14) Affymetrix Human Genome U133 Plus 2.0 Array 69 GSE20510 Extravillous trophoblast cell lines (SGHPL-5, HTR-8_Svneo) Affymetrix Human Genome U133A Array 70 GSE21222 hESCs (BG01, WIBR1, WIBR2, WIBR3) Affymetrix Human Genome U133 Plus 2.0 Array 71 GSE22167 hESCs (H1) Affymetrix Human Genome U133 Plus 2.0 Array 72 GSE22301 Melanocyte cell lines (HEM-LP, HEM-N, Hermes 1, Hennes 2B) Affymetrix Human Genome U133A 2.0 Array 73
TABLE-US-00012 TABLE7 Summaryofpeptidefragmentsfromacetylatedlysine residuesidentifiedfromcontrolandSIRT2KD293T cells.Symbol@ indicatedthesiteofacetylation detectedbyLTQ-Orbitrapmassspectrometry. Sample Start End ModScore Acetylated Name XCorr Position Position Peptide Lys SEQID AldoA 4.841 23 42 R.IVAPGK@G Lys28 SEQIDNO:74 ILAADESTGS IAK.R 3.014 23 43 R.IVAPGKGI Lys42 SEQIDNO:75 LAADESTGSI AK@R.L 2.364 88 101 K.ADDGRPFP Lys99 SEQIDNO:76 QVIK@SK.G 2.961 100 111 K.SK@GGVVG Lys101 SEQIDNO:77 IKVDK.G 3.205 102 111 K.GGVVGIK@ Lys108 SEQIDNO:78 VDK.G 2.064 141 149 K.DGADFAK@ Lys147 SEQIDNO:79 WR.C AldoA+ 3.305 23 42 R.IVAPGK@G Lys28 SEQIDNO:80 SIRT2KD ILAADESTGS IAK.R 4.605 29 43 K.GILAADES Lys42 SEQIDNO:81 TGSIAK@R.L 2.881 88 101 K.ADDGRPFP Lys99 SEQIDNO:82 QVIK@SK.G 2.326 100 111 K.SK@GGVVG Lys101 SEQIDNO:83 IKVDK.G 2.324 100 111 K.SKGGVVGI Lys108 SEQIDNO:84 K@VDK.G 2.782 102 111 K.GGVVGIK@ Lys108 SEQIDNO:85 VDK.G 5.024 109 134 K.VDK@GVVP Lys111 SEQIDNO:86 LAGTNGETTT QGLDGLSER.C 3.101 141 149 K.DGADFAK@ Lys147 SEQIDNO:87 WR.C 3.189 319 330 K.ENLK@AAQ Lys322 SEQIDNO:88 EEYVK.R
TABLE-US-00013 TABLE8 ListofthepredictedMREsontheSIRT2mRNAs. leftmost Folding Base position energy(in pairs of Kcal/mol), in predicted includes Predicted Targeting putative span target cDNA contribution targetsite miRNAsequence hetero- of MiRNA site region fromlinker (SEQID) (SEQID) duplex target hsa_miR_25 114 5UTR -24.9 AAGCGCGTCTGCGGC CATTGCACTTGTCTCG 13 22 CGCAATG GTCTGA (SEQIDNO:89) (SEQIDNO:96) hsa_miR_92b 114 5UTR -23.799999 AAGCGCGTCTGCGGC TATTGCACTCGTCCCG 14 22 CGCAATG GCCTCC (SEQIDNO:90) (SEQIDNO:97) hsa_miR_ 1416 CDS -24.799999 TCCCCGCCACCTGCC CGTCTTACCCAGCAGT 15 22 200c* AAGGACG GTTTGG (SEQIDNO:91) (SEQIDNO:98) 839 CDS -26.6 ACAGGAGGACTTGGT CGTCTTACCCAGCAGT 15 22 GGAGGCG GTTTGG (SEQIDNO:92) (SEQIDNO:99) hsa_miR_367 133 5UTR -24.1 ATGTCTGCTGAGAGT AATTGCACTTTAGCAA 15 22 TGTAGTT TGGTGA (SEQIDNO:93) (SEQIDNO:100) 337 CDS -23.1 CCCAGGCAGGGAAGG AATTGCACTTTAGCAA 14 22 TGCAGGA TGGTGA (SEQIDNO:94) (SEQIDNO:101) 1084 CDS -24 GTACCTCCTTGCAGG AATTGCACTTTAGCAA 16 22 TGCAGCC TGGTGA (SEQIDNO:95) (SEQIDNO:102)
TABLE-US-00014 TABLE9 SequencesofprimerusedforqRT-PCRanalysesandcloning. PCRPrimerSequences(5 to3) Gene Forward SEQID: Reverse SEQID SIRT1 TAGACACGCTGGAACAGGTTGC (SEQIDNO:103) CTCCTCGTACAGCTTCACAGTC (SEQIDNO:151) SIRT2 CTGCGGAACTTATTCTCCCAGAC (SEQIDNO:104) CCACCAAACAGATGACTCTGCG (SEQIDNO:152) SIRT3 CATTCCAGACTTCAGATCGC (SEQIDNO:105) AGCAGCCGGAGAAAGTAGT (SEQIDNO:153) SIRT4 TGGGATCATCCTTGCAGGTAT (SEQIDNO:106) TGGTCAGCATGGGTCTATCA (SEQIDNO:154) SIRT5 GCCAAGTTCAAGTATGGCAGA (SEQIDNO:107) CGCCGGTAGTGGTAGAA (SEQIDNO:155) SIRT6 TGGCAGTCTTCCAGTGTGGTGT (SEQIDNO:108) CGCTCTCAAAGGTGGTGTCGAA (SEQIDNO:156) SIRT7 TGGAGTGTGGACACTGCTTCAG (SEQIDNO:109) CCGTCACAGTTCTGAGACACCA (SEQIDNO:157) Lmx1b CAAGGCATCCTTTGAGGTCTC (SEQIDNO:110) TCCATGCGGCTTGACAGAAC (SEQIDNO:158) Tuj1 CAACAGCACGGCCATCCAGG (SEQIDNO:111) CTTGGGGCCCTGGGCCTCCGA (SEQIDNO:159) TH GAGTACACCGCCGAGGAGATTG (SEQIDNO:112) GCGGATATACTGGGTGCACTGG (SEQIDNO:160) Oct4 GCTCGAGAAGGATGTGGTCC (SEQIDNO:113) CGTTGTGCATAGTCGCTGCT (SEQIDNO:161) Sox2 AACCCCAAGATGCACAACTC (SEQIDNO:114) CGGGGCCGGTATTTATAATC (SEQIDNO:162) Nanog CAAAGGCAAACAACCCACTT (SEQIDNO:115) TCTGCTGGAGGCTGAGGTAT (SEQIDNO:163) Esrrb TGTCAAGCCATGATGGAAAA (SEQIDNO:116) GGTGAGCCAGAGATGCTTTC (SEQIDNO:164) Rex1 GGCGGAAATAGAACCTGTCA (SEQIDNO:117) CTTCCAGGATGGGTTGAGAA (SEQIDNO:165) Utf1 GTCCCCACCGAAGTCTGC (SEQIDNO:118) GGACACTGTCTGGTCGAAGG (SEQIDNO:166) GDF3 AAATGTTTGTGTTGCGGTCA (SEQIDNO:119) TCTGGCACAGGTGTCTTCAG (SEQIDNO:167) Tcl1 GCCTGGGAGAAGTTCGTGTA (SEQIDNO:120) ACTAAGCGCCAGAAACTGGA (SEQIDNO:168) Ecat1 CGAAGGTAGTTCGCCTTGAG (SEQIDNO:121) CGGTGATAGTCAGCCAGGTT (SEQIDNO:169) Gbx2 GGTGCAGGTGAAAATCTGGT (SEQIDNO:122) GCTGCTGATGCTGACTTCTG (SEQIDNO:170) Pax6 ACCCATTATCCAGATGTGTTTGCCCGAG (SEQIDNO:123) ATGGTGAAGCTGGGCATAGGCGGCAG (SEQIDNO:171) Map2 CAGGTGGCGGACGTGTGAAAATTGAGAGTG (SEQIDNO:124) CACGCTGGATCTGCCTGGGGACTGTG (SEQIDNO:172) GFAP GGCCCGCCACTTGCAGGAGTACCAGG (SEQIDNO:125) CTTCTGCTCGGGCCCCTCATGAGACG (SEQIDNO:173) AADC CGCCAGGATCCCCGCTTTGAAATCTG (SEQIDNO:126) TCGGCCGCCAGCTCTTTGATGTGTTC (SEQIDNO:174) Foxa2 TGGGAGCGGTGAAGATGGAAGGGCAC (SEQIDNO:127) TCATGCCAGCGCCCACGTACGACGAC (SEQIDNO:175) Sox17 CGCTTTCATGGTGTGGGCTAAGGACG (SEQIDNO:128) TAGTTGGGGTGGTCCTGCATGTGCTG (SEQIDNO:176) AFP GAATGCTGCAAACTGACCACGCTGGAAC (SEQIDNO:129) TGGCATTCAAGAGGGTTTTCAGTCTGGA (SEQIDNO:177) CK8 CCTGGAAGGGCTGACCGACGAGATCAA (SEQIDNO:130) CTTCCCAGCCAGGCTCTGCAGCTCC (SEQIDNO:178) CK18 AGCTCAACGGGATCCTGCTGCACCTTG (SEQIDNO:131) CACTATCCGGCGGGTGGTGGTCTTTTG (SEQIDNO:179) Msx1 CGAGAGGACCCCGTGGATGCAGAG (SEQIDNO:132) GGCGGCCATCTTCAGCTTCTCCAG (SEQIDNO:180) B-T GCCCTCTCCCTCCCCTCCACGCACAG (SEQIDNO:133) CGGCGCCGTTGCTCACAGACCACAGG (SEQIDNO:181) Glut1 TGGCATCAACGCTGTCTTCT (SEQIDNO:134) AACAGCGACACGACAGTGAA (SEQIDNO:182) Glut2 GCTGCGAATAAACAGGCAGG (SEQIDNO:135) AGGGTCCCAGTGACCTTATCT (SEQIDNO:183) Glut3 GACCCAGAGATGCTGTAATGGT (SEQIDNO:136) GGGGTGACCTTCTGTGTCCC (SEQIDNO:184) Glut4 ATTGCTCATGCCCCTACTCA (SEQIDNO:137) CCTGGTGAAGAGTGCCCCTA (SEQIDNO:185) Glut5 GCATGAAGGAAGGGAGGCTG (SEQIDNO:138) ACAGACCACAGCAACGTCAA (SEQIDNO:186) Glut6 TCTCAGCGGCCATCATGTTT (SEQIDNO:139) GGCGTAGCCCATGATGAAGA (SEQIDNO:187) Glut7 CATTCCATTGGGCCCAGTCCT (SEQIDNO:140) TGAAACTGTAGGCACCGATGG (SEQIDNO:188) AldoA CAGGGACAAATGGCGAGACTA (SEQIDNO:141) GGGGTGTGTTCCCCAATCTT (SEQIDNO:189) AldoB TGTCTGGTGGCATGAGTGAAG (SEQIDNO:142) GGCCCGTCCATAAGAGAAACTT (SEQIDNO:190) AldoC GCCAAATTGGGGTGGAAAACA (SEQIDNO:143) TTCACACGGTCATCAGCACTG (SEQIDNO:191) ENO1 GCCGTGAACGAGAAGTCCTG (SEQIDNO:144) ACGCCTGAAGAGACTCGGT (SEQIDNO:192) ENO2 CCGGGAACTCAGACCTCATC (SEQIDNO:145) CTCTGCACCTAGTCGCATGG (SEQIDNO:193) ENO3 TATCGCAATGGGAAGTACGATCT (SEQIDNO:146) AAGCTCTTATACAGCTCTCCGA (SEQIDNO:194) PGK1 GAACAAGGTTAAAGCCGAGCC (SEQIDNO:147) GTGGCAGATTGACTCCTACCA (SEQIDNO:195) PGK2 AAACTGGATGTTAGAGGGAAGCG (SEQIDNO:148) GGCCGACCTAGATGACTCATAAG (SEQIDNO:196) GAPDH GGGTGTGAACCATGAGAA (SEQIDNO:149) GTCTTCTGGGTGGCAGTGAT (SEQIDNO:197) -actin CATGTACGTTGCTATCCAGGC (SEQIDNO:150) CTCCTTAATGTCACGCACGAT (SEQIDNO:198)