MUTANT MOUSE-DERIVED PANCREATIC ORGANOID AND USE THEREOF

Abstract

Provided are a three-dimensional pancreatic organoid derived from the pancreas of a genetically modified mouse, a method for fabricating the three-dimensional pancreatic organoid, and use of the three-dimensional pancreatic organoid for drug effect verification and/or drug screening.

Claims

1.-16. (canceled)

17. A method for screening a candidate substance for treating a pancreatic disease, comprising: (a) a step of preparing a three-dimensional pancreatic organoid derived from a genetically modified mouse, the organoid being derived from the pancreas of the genetically modified mouse, wherein the genetically modified mouse has a modification which is deletion of exon 11 in BRCA2 gene; and (b) a step of treating the organoid with a candidate substance for treating a pancreatic disease.

18. The method according to claim 17, further comprising: (c) a step of determining the candidate substance as a drug for treating a pancreatic disease which is resistant to a histone deacetylase inhibitor drug, in a case where the candidate substance has a therapeutic effect for a pancreatic disease.

19. The method according to claim 17, wherein the pancreatic disease is pancreatic cancer.

20. A pancreatic organoid in which BRCA2 is conditionally deleted, the organoid being derived from a pancreatic tissue of a mouse which carries a loxP cassette and a Cre-expressing plasmid such that exon 11 in BRCA2 gene is conditionally deleted.

21. The pancreatic organoid according to claim 20, wherein the organoid has disease of pancreatic cancer.

22. The pancreatic organoid according to claim 20, wherein the organoid is for screening a candidate therapeutic substance for treating a pancreatic disease which is resistant to a histone deacetylase inhibitor drug.

23. A method for fabricating the pancreatic organoid according to claim 20, comprising: (a) a step of constructing a vector in which a loxP cassette is inserted into a position of intron 11 in BRCA2 gene; (b) a step of introducing the vector and a Cre-expressing plasmid into mouse embryonic stem cells (ES cells); (c) a step of producing a BRCA2 conditional mutant mouse from a mouse developed from the mouse embryonic stem cells; (d) a step of breeding the BRCA2 conditional mutant mouse with a Cre mouse (CreER), to produce a mouse (Brca2F11/F11; CreER) in which BRCA2 is conditionally deleted; and (e) a step of fabricating an organoid from a pancreatic tissue of the mouse in which BRCA2 is conditionally deleted.

24. The method according to claim 23, wherein the organoid has disease of pancreatic cancer.

25. The method according to claim 23, wherein the organoid is for screening a candidate therapeutic substance for treating a pancreatic disease which is resistant to a histone deacetylase inhibitor drug.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0049] FIG. 1 illustrates images obtained by observing, through an inverted microscope (Zeiss), states in which pancreatic organoids derived from BRCA2 and/or TERC gene-deleted mutant mice are cultured.

[0050] FIG. 2A illustrates a photograph showing gel electrophoresis results which identify genetic modification (deletion of exon 11 in BRCA2 gene (Brca2.sup.F11/F11), knockout of TERC gene (mTR.sup./), and insertion of CreER gene (CreER) in organoids (M: DNA marker for band size discrimination, DW (distilled water): negative control of PCR, WT: wild-type, Brca2.sup.F11/F11: band identifying that Brca2 exon 11 is flanked by loxP, mTR.sup./: band identifying that the TERC gene is knocked out, CreER: band identifying that the Cre recombinase gene is inserted).

[0051] FIG. 2B illustrates gel electrophoresis results showing PCR products of the organoids identified as having BRCA2.sup.F11/F11 genotype, depending on presence or absence of treatment with 4-OHT, in which () is a result obtained in a case where treatment with 4-OHT is not performed, and (+) is a result obtained in a case where treatment with 4-OHT is performed to induce deficiency of exon 11 in BRCA2 gene.

[0052] FIG. 3 illustrates an image obtained by observing, through an inverted microscope (Zeiss), a result obtained by culturing pancreatic organoids derived from mutant mice which have been transgenic with K243R mutant of BubR1 gene.

[0053] FIG. 4 illustrates a photograph showing a gel electrophoresis result which identifies whether K243R mutant of BubR1 gene has been inserted in pancreatic organoids derived from genetically modified mice (BubR1.sup.K243R/+) (M: DNA marker for band size discrimination, DW (distilled water): negative control of PCR).

[0054] FIG. 5 illustrates photographs showing states of pancreatic organoids derived from BRCA2 gene-deleted mice (Brca2.sup.F11/F11; CreER) which have been treated with histone deacetylase inhibitor (HDACi).

[0055] FIG. 6 illustrates photographs showing states of pancreatic organoids derived from BRCA2 gene-deleted mice (Brca2.sup.F11/F11; CreER) which have been treated with PARP-1 inhibitor or plk1 inhibitor alone or together with histone deacetylase inhibitor (HDACi).

[0056] FIG. 7 illustrates results obtained by observing, through live cell tracking using equipment of IncuCyte S3 Live-Cell Analysis System (Essen Bioscience), mouse pancreatic organoids having a wild-type gene for 24 hours after treatment with Trichostatin A (TSA) at 1 uM (scale bar: 2.1 mm).

[0057] FIG. 8 illustrates photographs showing a degree of growth for organoids, depending on presence or absence of treatment with 4-hydroxytamoxifen (4-OHT), the organoids being pancreatic organoids derived from Brca2.sup.F11/F11; mTR.sup./; Cre-ER mice (G3) which have undergone three generations through breeding.

[0058] FIG. 9 illustrates fluorescence images showing an immunofluorescence analysis result for pancreatic organoids derived from BubR1.sup.K243R/+ mice. The left image shows a result for pancreatic organoids derived from wild-type mice, and the right image shows a result for pancreatic organoids derived from BubR1.sup.K243R/+ mice.

DETAILED DESCRIPTION OF INVENTION

[0059] Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are merely illustrative and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that the examples as described below can be modified within the scope that does not depart from the essential spirit of the invention.

EXAMPLE 1

Construction of Pancreatic Organoids Derived from Transgenic Mice

[0060] Mice (Brca2.sup.F11/Ff11; exon 11-deleted) in which loxP had been located to flank a position of exon 11 in BRCA2 gene through Cre-loxP recombination using bacteriophage P1 so that conditional induction of defective BRCA2 is possible using CreER recombinase (Jos Jonkers, Ralph Meuwissen, Hanneke van der Gulden, Hans Peterse, Martin van der Valk and Anton Berns. 2001. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nature Genetics. Vol. 29, pages 418-425), mice (mTR.sup./) in which telomerase RNA component (TERC) gene had been knocked out to lose activity of telomerase, and CMV-Cre mice (CreER) with CMV promoter were prepared.

[0061] 1.1. Construction of Targeting Vector for Exon of BRCA2

[0062] In order to target BRCA2 locus, a 13.5-kb lambda phage clone containing exons 8-12 of mouse BRCA2 gene (NM_001081001.2) was isolated from the genomic 129/Sv library (Agilent technologies). The phage inset was excised with NotI and subcloned into pGEM5 (Promega). Then, loxP-PGKneor-PGKtk-loxP dual selection cassette (Thermo Fisher Scientific) was inserted into AvrII position in intron 11 of the mouse BRCA2 gene, and a single loxP site was inserted into NspV position in intron 10 in direct orientation with the floxed selection cassette.

[0063] 1.2. Construction of Targeting Vector for Telomerase RNA Component (TERC) gene

[0064] Mice in which the telomerase RNA component (TERC) gene (GebBank Accession No. NR_001579.1) has been completely deleted were obtained from Jackson lab (Stock No: 004132, B6.Cg-Terctm1Rdp/J) and used for the following experiments.

[0065] 1.3. Production of Mice (Brca2.sup.F11/F11; CreER) in which Exon 11 of BRCA2 has been Deleted

[0066] The vector prepared in Example 1.1 above was isolated and purified, and introduced, by electroporation, into 129/Ola-derived mouse embryonic stem cells (ES cells) of E11 subclone IB10 (The Netherlands Cancer Institute). Colonies in which floxed selection marker and loxP site had been precisely inserted were selected by Southern blot. A mixture obtained by mixing Cre-expressing plasmids pOG231 (Addgene) and PGKpuro (Addgene) at a molar ratio of 10:1 was introduced into the embryonic stem cells by electroporation, to transiently induce Cre recombinase activity and puromycin resistance. 20 hours after electroporation, puromycin (1.8 g/ml) was added to the medium and cultured for 48 hours. Dead cells were removed and surviving embryonic stem cells were further cultured in a non-selective medium for 10 days. The obtained embryonic stem cell clones were analyzed by Southern blotting to identify successful deletion of floxed marker, insertion of single loxP site, and generation of a conditional allele.

[0067] The obtained 12 to 15 mutant 129/Ola embryonic stem cells were injected into C57B1/6 blastocysts to generate germline chimera, which was bred with FVB/N mice (Jackson Laboratory) to produce outbred heterozygous offspring (BRCA2 conditional mutants). The obtained BRCA2 conditional mutants were bred with Cre mice (CMV-Cre mice (CreER) with CMV promoter; Jackson Laboratory, Stock No. 004847) so that Cre-mediated deletion of floxed allele in the germline was performed, thereby producing mice (designated by Brca2.sup.F11/F11; CreER or Brca2.sup.F11/F11; mTR.sup.+/+; CreER) in which BRCA2 is conditionally deleted.

[0068] 1.4. Production of Mice (Brca2F.sup.11/F.sup.11; mTR.sup./; CreER) in which exon 11 of BRCA2 has been Deleted and TERC Gene has been Knocked Out

[0069] As in Example 1.3 above, the Brca2.sup.F11/F11; CreER mice were obtained from the offspring produced by breeding the Brca2.sup.F11/F11 mice with the CreER mice. These Brca2.sup.F11/F11; CreER mice were bred with the mTR.sup./+ mice (Example 1.2) to obtain offspring. From the obtained offspring, Brca2.sup.F11/F11; CreER; mTR.sup./+ mice were obtained, and bred with each other to obtain Brca2.sup.F11/F11; CreER; mTR.sup./ mice with a Mendelian probability.

[0070] 1.5. Production of Mice (BubR1.sup.K243R/+) which have been Transgenic with K243R Mutant of BubR1 Gene

[0071] BubR1 gene which had been mutated, through site-directed mutagenesis, to induce substitution (K243R) of the 243.sup.rd lysine (K) with arginine (R) in BubR1 (GenBank NP_033903.2; coding gene: NM_009773.3) was inserted into 129/Sv embryonic stem (ES) cells (Agilent Technologies) using pBluescript KS (+) vector (Addgene). The resultant was injected into blastocysts of C57BL/6 mice, to obtain heterologous mutant mice (BubR1.sup.K243R/+) which had been transgenic with a mutant gene that encodes BubR1 having K243R mutation (see Inai Park et al. 2013. Loss of BubR1 acetylation causes defects in spindle assembly checkpoint signaling and promotes tumor formation. Journal of Cell Biology. 202 (2):295).

EXAMPLE 2

Fabrication of Pancreatic Organoids Derived from Mutant Mice in which BRCA2 Gene and/or TERC Gene have been Deleted

[0072] Pancreatic organoids were fabricated from respective mutant mice produced in Examples 1.3 and 1.4 above by the methods as described below:

[0073] Each mouse was euthanized and then dissected to obtain a pancreatic tissue. As a dissociation solution, a mixture obtained by performing mixing of 3 to 5 ml of Hank's Balanced Salt Solution (HBSS; GIBCO), 1 mg/ml of collagenase P (Roche), and 0.1 mg/ml of DNase 1 (Sigma Aldrich) was prepared by being warmed in water bath at 37 C. The obtained entire mouse pancreatic tissue (Vpan=1.08 mg/mm.sup.3) was transferred to a 100 mm Petri dish. Then, 100 ul of the prepared dissociation solution was added thereto, and the tissue was finely cut 5 to 10 times using scissors or a knife. The finely cut pancreatic tissue (Vpan=1.08 mg/mm.sup.3) was transferred to a 50 ml conical tube, to which 3 to 5 ml of the dissolution solution was added. The tube was incubated by being placed in a shaking incubator at 230 rpm and 37 C. After 10 to 15 minutes, the tube was removed and 10 to 15 ml of cold FBS was added thereto. The obtained dissociated pancreatic tissue was passed through a 100 m cell strainer and washed 2 to 3 times with HBSS. The pancreatic tissue, which did not pass through the cell strainer, was observed under a microscope, and ductal cells were chosen and picked. A process, in which the picked ductal cells were centrifuged at 1500 rpm for 10 minutes to collect pellets and then washing with HBSS was performed, was repeated twice.

[0074] The obtained cell pellets and 200 ul of Matrigel (Corning) were mixed so that a volume ratio of the cell pellets and the Matrigel was 1:5, and then respectively seeded into a 12-well or 24-well plate in an amount (of 100 to150 ul based on the 12-well plate) per well. About one hour after seeding, when the Matrigel had hardened, a medium was added in an amount of 1 ml based on the 12-well plate or 500 ul based on the 24-well plate, and incubated for 48 to 72 hours or longer in an incubator at 37 C. and 10% CO.sub.2. The culture medium used at this time had the following composition: A mixture of Advanced DMEM/F-12 (Dulbecco's Modified Eagle Medium/Ham's F-12; Thermo Fisher Scientific) with 1% (vol/vol) penicillin/streptomycin, 10 mM HEPES, 1% GlutaMAX, 1:50 B27 supplement (Gibco), 1 mM N-acetylcysteine, 5% (vol/vol) Rspo 1-conditioned medium (Hans Clevers lab), 10 mM nicotinamide, 10 nM recombinant human [Leu15]-gastrin I (Sigma Aldrich), 50 ng/ml of recombinant mouse EGF (Peptron), 100 ng/ml of recombinant human FGF10 (Peptron), and 25 ng/ml of recombinant human Noggin (Peptron) or 5% (vol/vol) Noggin-conditioned medium (Hans Clevers lab).

[0075] In order to induce deletion of the BRCA2 gene and/or the TERC gene, the organoids were treated with 4-hydroxytamoxifen (4-OHT). Specifically, 4-hydroxytamoxifen (4-OHT) was dissolved in the organoid culture to be at 400 nM and cultured for 3 weeks or longer, starting from a time point, at which 24 to 48 hours lapsed after the pancreas was initially isolated from the mice and then culture thereof into organoid was constructed, until immediately before a time point at which treatment with a drug was performed for the drug screening as described below (see Examples 4 and 5).

[0076] The results obtained by observing, with an inverted microscope (Zeiss), results caused by the above-described culture of the pancreatic organoids are illustrated in FIG. 1. As illustrated in FIG. 1, it can be identified that pancreatic organoids were successfully produced regardless of whether the BRCA2 gene and/or the TERC gene is deleted (whether treatment with 4-OHT is performed). It can be identified that the BRCA2 gene-deficient organoids were somewhat small in shape, but grew in a similar pattern to a wild type as the culture gradually proceeded.

[0077] Genomic PCR DNA gel electrophoresis was performed on the genomic DNA extracted by lysis of the obtained pancreatic organoids, so that genotype of the organoids was identified. Specifically, PCR was performed by repeating 30 cycles, each cycle including denaturation at 95 C. for 1 minute, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 1 minute; and for electrophoresis, 5 ul of PCT product was mixed with 5 ul of Bromophenol or xylene on 1% (w/v) agarose gel and electrophoresed at 100 mV. The primers used at this time were as follows:

TABLE-US-00001 TABLE1 SEQ ID Primer Nucleicacidsequence(5.fwdarw.3) NO Brca2-11F CTCATCATTTGTTGCCTCACTTC 1 Brca2-11R TGTTGGATACAAGGCATGTAC 2 mTR-WT GCACTCCTTACAAGGGACGA 3 mTR-common CTTCAATTTCCTTGGCTTCG 4 mTR-mutant ATTTGTCACGTCCTGCACGACG 5 CRE-3F CGGCATGGTGCAAGTTGAAT 6 CRE-3R CGGTGCTAACCAGCGTTTTC 7 CRE- CTAGGCCACAGAATTGAAAGATCT 8 internal-F CRE- GTAGGTGGAAATTCTAGCATCATCC 9 internal-R

[0078] The obtained results are illustrated in FIGS. 2A and 2B. FIG. 2A illustrates a photograph showing gel electrophoresis results which identify genetic modification (deletion of exon 11 in BRCA2 gene) (Brca2.sup.F11/F11), knockout of TERC gene (mTR.sup./), and insertion of CreER gene (CreER) in organoids (M: DNA marker for band size discrimination, DW: negative control of PCR, WT: wild-type, Brca2.sup.F11/F11: band identifying that Brca2 exon 11 is flanked by loxP, mTR.sup./: band identifying that the TERC gene is knocked out, CreER: band identifying that the Cre recombinase gene is inserted).

[0079] FIG. 2B illustrates gel electrophoresis results showing PCR products of the organoids identified as having BRCA2.sup.F11/F11 genotype in FIG. 2A, depending on presence or absence of treatment with 4-OHT, in which (-) is a result obtained in a case where treatment with 4-OHT is not performed, and (+) is a result obtained in a case where treatment with 4-OHT is performed to induce deficiency of exon 11 in BRCA2 gene. As illustrated in FIG. 2B, it can be identified that in a case where treatment with 4-OHT was performed, a length of the PCR products became shorter than that in a case where treatment with 4-OHT was not performed, indicating deficiency of exon 11 in the BRCA2 gene.

EXAMPLE 3

Fabrication of Pancreatic Organoids Derived from Heterologous Mutant Mice which have been Transgenic with K243R Mutant of BubR1 Gene

[0080] With reference to the method in Example 2, pancreatic organoids were fabricated from the heterologous mutant mice (BubR1.sup.K243R/+) which had been produced in Example 1.5 above and in which the mutant of BubR1 gene inducing K243R mutation had been knocked in. For comparison, pancreatic organoids derived from wild-type mice were fabricated with reference to Example 2.

[0081] The results obtained by observing the obtained pancreatic organoids with an inverted microscope (Zeiss) are illustrated in FIG. 3. As illustrated in FIG. 3, it can be identified that pancreatic organoids can be successfully produced from the mutant mice (BubR1.sup.K243R/+), as in the wild-type mice.

[0082] Genomic PCR DNA gel electrophoresis was performed on the genomic DNA extracted by lysis of the obtained pancreatic organoids, so that genotype of the organoids was identified. Specifically, PCR was performed by repeating 30 cycles, each cycle including denaturation at 95 C. for 1 minute, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 1 minute; and for electrophoresis, 5 ul of PCT product was mixed with 5 ul of Bromophenol or xylene on 1% (w/v) agarose gel and electrophoresed at 100 mV. The primers used at this time were as follows:

TABLE-US-00002 TABLE2 SEQ Nucleic ID Primer acidsequence(5-3) NO BubR1K243R/+ F GAGGTAAAGGCAGGGGAATC 10 BubR1K243R/+ R GAGAAAGCGGGGGTCATTAT 11

[0083] The obtained results are illustrated in FIG. 4. FIG. 4 illustrates a photograph showing a gel electrophoresis result which identifies whether K243R mutant of BubR1 gene has been inserted in pancreatic organoids derived from genetically modified mice (BubR1.sup.K243R/+) (M: DNA marker for band size discrimination, DW: negative control of PCR). As identified in the lane indicated as BubR1.sup.K243R/+ in FIG. 4, bands at 145 bp and 219 bp are observed, which means that knock-in of the gene in question has successfully been achieved.

EXAMPLE 4

Drug Responsiveness Test of Pancreatic Organoids from Mutant Mice

[0084] With reference to the method in Example 2 above, pancreatic organoids derived from BRCA2 gene-deleted mice (Brca2.sup.F11/F11; CreER) were prepared. 4-hydroxytamoxifen (4-OHT) was added thereto in an amount of 400 nM, and the resultant was cultured for 3 weeks or longer so that partial deletion (deletion of exon 11) in BRCA2 gene was induced (see Example 2). For comparison, organoids (with normal BRCA2 gene) for which treatment with 4-OHT had not been performed was also prepared.

[0085] Electrophoresis results which identify BRCA2 deletion in pancreatic organoids derived from BRCA2 gene-deleted mice (Brca2.sup.F11/F11; CreER) are illustrated in FIG. 5A.

[0086] Organoids with normal BRCA2 gene (for which treatment with 4-OHT had not been performed) and organoids in which BRCA2 had been partially deleted (exon 11-deleted) were seeded in the same amount into 24-well plates. On the next day after seeding, the organoids were treated with a mixture of histone deacetylase inhibitor (HDACi), an anticancer agent, with a culture medium (see Example 2). Types and treatment concentrations of HDACi used at this time are shown in Table 3 below:

TABLE-US-00003 TABLE3 TypeofHDACi Treatmentconcentration TrichostatinA(TSA) 1uM Suberoylanilidehydroxamic 17uM acid(SAHA) LMK-235 3uM FK-228,Romidepsin 10nM

[0087] At this time, treatment with HDACi and treatment with 4-OHT were not performed simultaneously for pancreatic organoids in which BRCA2 had already been knocked out. 3 days after treatment (primary treatment) with HDACi, the culture medium was replaced with a fresh medium, and treatment (secondary treatment) with each HDACi was performed again at the concentration indicated in Table 3. Here, the primary treatment with HDACi was performed about 24 to 48 hours after seeding of the organoids, and 3 days after that, the second treatment was performed. At 6 days after the primary treatment with HDACi, a state of the organoids for which the treatment with HDACi had been performed was observed using an inverted microscope.

[0088] The obtained results are illustrated in FIG. 5. As illustrated in FIG. 5, it was observed that responsiveness to the tested drugs differs depending on the presence or absence of the BRCA2 gene. Through this observation, it can be identified that the Brca2.sup.F11/F11 mouse pancreatic organoid can be usefully used for identification of effects of a drug related to the BRCA2 gene and/or for drug screening.

[0089] In addition, using the above-described method, states of the organoids obtained in cases of being treated with Olaparib (10 uM), a PARP-1 inhibitor, or BI2536 (10 nM), a plk 1 inhibitor, alone or in combination with HDACi (TSA 200 nM) were observed, and the results are illustrated in FIG. 6. As illustrated in FIG. 6, it was observed that responsiveness to the tested drugs differs depending on the presence or absence of the BRCA2 gene. Through this observation, it can be identified that the Brca2.sup.F11/F11 mouse pancreatic organoid can be usefully used for identification of effects of a drug related to the BRCA2 gene and/or for drug screening.

[0090] In addition, the results obtained by observing, through live cell tracking using equipment of IncuCyte S3 Live-Cell Analysis System (Essen Bioscience), mouse pancreatic organoids having a wild-type gene for 24 hours after treatment with Trichostatin A (TSA) at 1 uM are illustrated in FIG. 7. Respective images are images taken on a 4-hour basis. Scale bar represents 2.1 mm.

EXAMPLE 5

Construction of Model, which Simulates Carcinogenesis caused by Alternative Telomere Maintenance Mechanism (Alternative Lengthening of Telomeres (ALT)), by Continuous Culture of Brca2.SUP.F11/F11.; mTR.SUP./.; Cre-ER Mouse Pancreatic Organoids

[0091] A cancer model simulating mechanism of alternative lengthening of telomeres (ALT) which maintains a length of telomeres without telomerase and causes continuous division was constructed through Brca2.sup.F11/F11; mTR.sup./; Cre-ER generation 3 (G3) mouse pancreatic organoids which had been obtained, through three generations, by breeding of Brca2.sup.F11/F11; mTk.sup./; Cre-ER mice with each other. In order to overcome a disadvantage of two-dimensionally cultured ALT cell lines used in existing ALT studies, that is, a disadvantage that genomic mutations have already accumulated and all environmental characteristics in the body are not reflected, ALT-induced mice (G3) were produced through three-way breeding of Brca2F11/F11; mTR/-; Cre-ER mice. In addition, pancreas-derived organoids which can simulate an in-vivo environment of the organ in the mice in question and allows direct identification of whether growth is inhibited were constructed, and it was identified that actual ALT is induced, and thus inhibition of growth due to deficiency of telomerase is overcome.

[0092] For construction of the ALT model of mouse pancreatic organoids, with reference to Example 2, pancreatic organoids were constructed from Brca2.sup.F11/F11; mTk.sup./; Cre-ER mice which had undergone three generations (G3) through breeding. Then, treatment with tamoxifen (4-OHT) was performed or not performed so that Brca2 deficiency was induced or not induced. A treatment amount of 4-OHT was set as 400 nM. The pancreatic organoids were seeded on plates and the treatment was performed once every 2 days from one day after seeding the pancreatic organoids on the plates until treatment with a drug. Then, the organoids were observed with an inverted microscope (Zeiss) once every three days, and the results are illustrated in FIG. 8. Subculture was performed on the 10.sup.th day in the order of [I], [II], and [III] illustrated in FIG. 8, and a degree of growth thereof was compared.

[0093] In [I], it was identified that the organoids (+4-OHT) which are deficient in both BRCA2 and TERC exhibit somewhat slower growth than the organoids (4-OHT) which are deficient in only TERC.

[0094] In [II] (mechanically dissociated from [I]) , it was identified that the organoids (4-OHT) which are deficient in only TERC exhibit inhibited growth as compared with the previous subculture, and that the organoids (+4-OHT) which are deficient in both BRCA2 and TERC exhibit slow growth as compared with the previous subculture.

[0095] In [III] (mechanically dissociated from [II]), it was identified that the organoids (4-OHT) which are deficient in only TERC exhibit greatly decreased growth and are in a state where no more sustainable culture is possible, and that the organoids (+4-OHT) which are deficient in both BRCA2 and TERC are in a state where sustainable culture is possible. From these results, it is identified that organoids in which an ALT mechanism is activated and carcinogenesis proceeds were cultured.

EXAMPLE 6

Imaging on BubR1.SUP.K243R/+ Mouse Pancreatic Organoids through Immunofluorescence Assay (IFA)

[0096] With reference to Examples 2 and 3, the BubR1.sup.K243R/+ mouse pancreatic organoids were cultured, and then staining with DAPI (blue), Tublin (green), and BubR1 (red) was performed, through which it was identified that the constructed organoids can be utilized as a new model to study genome instability.

[0097] First, a process, in which the cultured organoids are transferred to a 15 ml conical tube, the tube is filled with cold PBS up to 15 ml, centrifugation is performed at 1200 rpm for 5 minutes, and washing with PBS is performed, was repeated three times to remove Matrigel. The cells were fixed by adding 4% (w/v) paraformaldehyde (PFA), incubated for 30 minutes, and then washed three times with PBS. Triton X-100 solution (in PBS; concentration: 1% (v/v)) was added to the cell sample and incubation was performed for 1 hour. Then, Triton X-100 solution (in PBS; concentration: 2% (v/v)) was added thereto and washing was performed twice. Then, blocking buffer (0.279 g of BSA, 450 ul of goat serum, 180 ul of Triton X-100, 450 ul of PBS 20X, 7920 ul of DW) was added thereto and incubation was performed for 30 minutes. Treatment with BubR1 antibody (BD Biosciences) was performed and incubation was performed for 16 hours. Washing with 0.2% (v/v) PBS-T (Triton X-100 solution in PBS) was performed three times for 20 minutes each time. HRP-tagged secondary antibody (Thermo Fisher Scientific) was added thereto and incubation was performed for 16 hours. Washing with 0.2% (v/v) PBS-T was performed three times for 20 minutes each time, and treatment with FITC-conjugated Tublin antibody (Abcam) was performed at a ratio of 1:1000. Incubation was performed for 2 days. Washing with 0.2% (v/v) PBS-T was performed three times for 20 minutes each time. Then, DAPI was added thereto and incubation was performed for one day. After removing the supernatant, the resultant was transfer to an 8-well chamber and fluorescence images were observed using a confocal microscope.

[0098] The observed fluorescence images are illustrated in FIG. 9. In FIG. 9, the left image shows a result for pancreatic organoids derived from wild-type mice, and the right image shows a result for pancreatic organoids derived from BubR1.sup.K243R/+mice.