METHOD OF PREPARING THREE-DIMENSIONAL CELL SPHEROID INCLUDING ADIPOSE-DERIVED STEM CELLS AND HEPATOCYTES
20190374580 ยท 2019-12-12
Assignee
Inventors
Cpc classification
C12N5/0667
CHEMISTRY; METALLURGY
C12N2501/113
CHEMISTRY; METALLURGY
C12N2502/1382
CHEMISTRY; METALLURGY
C12N2501/165
CHEMISTRY; METALLURGY
C12N5/0671
CHEMISTRY; METALLURGY
A61K9/16
HUMAN NECESSITIES
C12N2537/00
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
Abstract
Provided is a method of preparing a three-dimensional cell spheroid, the method including forming the cell spheroid by co-culturing adipose-derived stem cells or mesenchymal stem cells with hepatocytes. According to the cell spheroid prepared by the method, the secretome secreted by the adipose-derived stem cells affects hepatocyte maturation, and therefore, hepatic functions of the finally formed three-dimensional cell spheroid, i.e., organoid, may be enhanced. Further, a composition including a culture medium of the adipose-derived stem cells may prevent or treat liver diseases including hepatitis, hepatotoxicity, cholestasis, fatty liver, etc., and may enhance hepatic functions.
Claims
1. A method of preparing a three-dimensional cell spheroid, the method comprising: adherent-culturing adipose-derived stem cells or mesenchymal stem cells in a culture plate having a hydrophobic surface; co-culturing the cells with hepatocytes by additionally seeding the hepatocytes into the culture plate; and forming the three-dimensional cell spheroid by detaching the adipose-derived stem cells or the mesenchymal stem cells; and the hepatocytes from the culture plate as a density of the adherent adipose-derived stem cells or mesenchymal stem cells; and the hepatocytes increases.
2. The method of claim 1, wherein the cell spheroid has a diameter of 300 m to 2000 m.
3. The method of claim 1, wherein the surface of the culture plate is coated with a cell growth factor.
4. The method of claim 3, wherein the cell growth factor is selected from the group consisting of vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), epidermal growth factor (EGF), platelet-derived endothelial growth factor (PDGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), heparin binding domain (HBD), and fragments thereof having cell adhesive activity.
5. The method of claim 1, wherein the surface of the culture plate is further coated with an artificial ligand.
6. The method of claim 1, wherein the adipose-derived stem cells or the mesenchymal stem cells and the hepatocytes are mixed at a ratio of 1:5 to 5:1.
7. The method of claim 1, wherein the co-culture is performed for 20 hours to 60 hours.
8. A three-dimensional cell spheroid prepared by the method of claim 1.
9. A method of preventing or treating a liver disease, the method comprising administering to a subject a cellular therapeutic agent comprising three-dimensional cell spheroids comprising adipose-derived stem cells or mesenchymal stem cells; and hepatocytes.
10. The method of claim 9, wherein the cellular therapeutic agent comprises a culture medium of the cell spheroids.
11. The method of claim 10, wherein the culture medium is mixed at a ratio of 100 l to 500 l per 1 unit of the cell spheroids.
12. The method of claim 10, wherein the culture medium is obtained from a medium where the adipose-derived stem cells or the mesenchymal stem cells are three-dimensionally cultured.
13. The method of claim 10, wherein the culture medium comprises a factor promoting hepatocyte division and maturation.
14. The method of claim 9, wherein the liver disease is selected from the group consisting of hepatitis, hepatotoxicity, cholestasis, fatty liver, cirrhosis, liver ischemia, alcoholic liver disease, hepatic abscess, hepatic coma, hepatatrophia, and hepatic cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] These and/or other aspects will become apparent and more readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings in which:
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] An aspect provides a method of preparing a three-dimensional cell spheroid, the method including adherent-culturing adipose-derived stem cells or mesenchymal stem cells in a culture plate having a hydrophobic surface; co-culturing the cells with hepatocytes by additionally seeding the hepatocytes into the culture plate; and forming the three-dimensional cell spheroid by detaching the adipose-derived stem cells or mesenchymal stem cells; and the hepatocytes from the culture plate as a density of the adherent adipose-derived stem cells or mesenchymal stem cells; and the hepatocytes increases.
[0026] As used herein, the term cell spheroid or three-dimensional cell spheroid refers to a state in which two or more cells are aggregated, and may be in a tissue form or in a multicellular form. Each cell spheroid may be present as a tissue itself or as a part thereof, or may be present as a multicellular cluster. The cell spheroid may include a stromal cell-differentiated cell-like tissue.
[0027] As used herein, the term three-dimensional refers to a structure having a model with three geometric parameters (e.g., depth, width, and height, or X-, Y-, and Z-axes) rather than two dimensional parameters. Therefore, the cell spheroid according to a specific embodiment refer to a cell spheroid that may be cultured in a three-dimensional manner, i.e., may be cultured in a floating state while being detached from the culture plate, and three-dimensionally formed into spheres, sheets, or similar three-dimensional forms (e.g., a similar tissue) while proliferating. In addition, the three-dimensional cell spheroid may refer to a cell spheroid that is formed in a multilayer or spherical form, rather than a cell spheroid that is formed in a single cell layer like a general cell spheroid. Further, the cell spheroid according to a specific embodiment may refer to a cell spheroid formed by itself without the need to use an artificial three-dimensional porous extracellular matrix, for example, a synthetic polymer support such as a sheet, a hydrogel, a film, and a scaffold, or a natural polymeric support, by using tissue engineering techniques. The tissue engineering technique is distinguished from formation of the three-dimensional cell spheroid according to a specific embodiment in which the matrix, rather than the cell, is three-dimensional. The cell spheroid may have a diameter of 300 m or more, for example, 300 m to 2,000 m, 400 m to 1,500 m, 500 m to 1,000 m, 500 m to 900 m, or 700 m to 800 m.
[0028] The adipose-derived stem cell may be isolated from a human adipose tissue. The human adipose tissue may appropriately include mature adipocytes and a connective tissue surrounding them. The human adipose tissue may be any adipose tissue obtained by any method used to collect fat regardless of the site of an individual's body. For example, the human adipose tissue may include a subcutaneous adipose tissue, a bone marrow adipose tissue, a mesenteric adipose tissue, a gastric adipose tissue, or a retroperitoneal adipose tissue. Further, isolation of the adipose-derived stem cells from the human adipose tissue may be performed by a known method. For example, the adipose-derived stem cells may be obtained from adipose tissues by liposuction, sedimentation, enzymatic treatment of collagenase, etc., removal of suspension cells such as red blood cells, etc. by centrifugation. The isolated adipose-derived stem cells or mesenchymal stem cells exhibit an excellent proliferation rate up to the passage number of 16 even after several subculturing. Therefore, in the subsequent formation of the three-dimensional cell spheroid, multipotent adipose-derived stem cells isolated from the human adipose tissue or mesenchymal stem cells may be used as they are at passage 1 or those subcultured to 60% confluency at passage 10 or more may be used.
[0029] The culture plate may be a culture plate from which the cells may be detached as the density of the cells increases due to cell-cell adhesion lower than cell-plate surface adhesion. The culture plate may be prepared by using a material containing a substance capable of non-integrin cell adhesion or may be coated with the material. The culture plate may be a culture plate that is surface-treated with a polymer imparting hydrophobicity to a common cell culture plate, or a cell culture plate prepared by such a polymer. Such a hydrophobic polymer may include, for example, one or more selected from polystyrene (PS), polymethyl methacrylate (PMMA), polyethylene terephthalate (PET), polyvinyl chloride (PVC), polyethylene (PE), polypropylene (PP), polytetrafluoroethylene (PTFE), aliphatic polyester-based polymer such as poly(L-lactic acid) (PLLA), poly(D,L-lactic acid) (PDLLA), poly(glycolic acid) (PGA), poly(caprolactone) (PCL), poly(hydroxyalkanoate), polypolydioxanone (PDS), polytrimethylene carbonate, or a copolymer of these units such as poly(lactic acid-co-glycolic acid) (PLGA), poly(lactic acid-co-caprolactone) (PLCL), poly(glycolic acid-co-caprolactone) (PGCL), or a derivative thereof. In addition, the culture plate may have a hydrophobic silanized surface, a carbon nanotube (CNT) surface, a hydrocarbon-coated surface, or a metallic (e.g., stainless steel, titanium, gold, platinum, etc.) surface.
[0030] In another specific embodiment, for more effective adhesion of the cells onto the culture plate than physical adsorption by interactions between the adipose-derived stem cells or the mesenchymal stem cells and the hydrophobic surface of the culture plate, a growth factor having adhesive activity to stromal cells is immobilized on the surface of the culture plate, and then biochemical interactions between the immobilized growth factor and cells may be used. In this regard, the growth factor may include those having adhesive activity to cells, and binding of the growth factor to the cells may be non-integrin adhesion. The growth factor may include, for example, vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), epidermal growth factor (EGF), platelet-derived endothelial growth factor (PDGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), heparin binding domain (HBD), and fragments thereof having cell adhesive activity. Further, the growth factor may be immobilized on the surface of the culture plate at a concentration of 5 g/ml to 30 g/ml, for example, 5 g/ml to 30 g/ml, 5 g/ml to 25 g/ml, 10 g/ml to 30 g/ml, 10 g/ml to 25 g/ml, or 10 g/ml to 20 g/ml. Further, in another specific embodiment, the co-culture may be performed for 20 hours to 60 hours, for example, 20 hours to 60 hours, 20 hours to 50 hours, 20 hours to 50 hours, 30 hours to 45 hours, 30 hours to 40 hours, or 24 hours to 48 hours. In this regard, when the culture time is less than the above range, there is a problem in that the cultured cells do not completely aggregate as a spheroid. When the culture time exceeds the above range, there is a problem in that viability of the cell spheroid decreases.
[0031] Further, the surface of the culture plate may be additionally coated with an artificial ligand. The artificial ligand may be an artificial ligand specific to hepatocytes, and has an amphipathic property. For example, when the surface of the culture plate may be coated with PVLA as the artificial ligand, frequency of hepatocyte spheroid formation may be increased because the PVLA has a site capable of binding to the surface of the hepatocyte and a site capable of binding to the polystyrene surface. In this regard, the artificial ligand may be, for example, a polystyrene derivative including a residue such as PVMeA, PVCA, PV6Gna, galactose/N-acetyl D-galactosamine, etc. and having a hepatocyte-specific receptor binding ability.
[0032] Another aspect provides a three-dimensional cell spheroid prepared by the above method. The cell spheroid may have a multilayer or a spherical form which is formed by the adipose-derived stem cells or mesenchymal stem cells and the hepatocytes, and may include 110.sup.4 cells to 110.sup.5 cells, for example, 110.sup.4 cells to 110.sup.5 cells, 110.sup.4 cells to 910.sup.4 cells, 110.sup.4 cells to 810.sup.4 cells, 110.sup.4 cells to 510.sup.4 cells, 310.sup.4 cells to 110.sup.5 cells, or 410.sup.4 cells to 110.sup.5 cells per 700 m to 800 m of the diameter of the cell spheroid.
[0033] Still another aspect provides a three-dimensional cell spheroid including adipose-derived stem cells or mesenchymal stem cells; and hepatocytes. A specific description of the cell spheroid is the same as above.
[0034] Further, the adipose-derived stem cells or the mesenchymal stem cells; and the hepatocytes may be mixed at a ratio of 1:5 to 5:1. For example, the adipose-derived stem cells or the mesenchymal stem cells; and the hepatocytes may be mixed at a ratio of 1:5 to 5:1, 1:4.5 to 4.5:1, 1:3.5 to 3.5:1, 1:3 to 3:1, 1:2 to 2:1, or 1:1 to 2:1. In this regard, when the mixing ratio of the cells is less than the above range, there is a problem in that the culture cells may not form one spheroid but may be fragmented. When the mixing ratio of the cells exceeds the above range, there is a problem in that hepatic characteristics of the cell spheroid may be reduced due to the reduced amount of hepatocytes included in the cell spheroid.
[0035] Still another aspect provides a cellular therapeutic agent for treating a liver disease, the cellular therapeutic agent including the cell spheroid. A specific description of the cell spheroid is the same as above. Still another aspect provides a method of preventing or treating a liver disease, the method including administering the cellular therapeutic agent to a subject. In a specific embodiment, the method may further include a culture medium of the cell spheroids including the adipose-derived stem cells or the mesenchymal stem cells; and the hepatocytes.
[0036] As used herein, the term cellular therapeutic agent refers to a drug (US FTA regulation) which is cells or tissues isolated from humans, cultured and produced through special manipulations and is used for the purpose of treatment, diagnosis, and prevention, and refers to a drug obtained by proliferating and selecting living autologous, allogeneic, or xenogeneic cells ex vivo or by a series of actions, such as alteration of biological properties of the cells in different ways, in order to restore functions of cells or tissues, and used for the purpose of treatment, diagnosis, and prevention of a disease.
[0037] Specifically, the cellular therapeutic agent of a specific embodiment may be used for treating liver diseases including hepatitis, hepatotoxicity, cholestasis, fatty liver, cirrhosis, liver ischemia, alcoholic liver disease, etc.
[0038] Still another aspect provides a pharmaceutical composition for preventing or treating the liver disease, the pharmaceutical composition including the cell spheroid and/or the culture medium thereof. A specific description of the cell spheroid is the same as above.
[0039] The culture medium refers to a solution that is remained by removing cell spheroids after culturing the adipose-derived stem cells or the mesenchymal stem cells; and the hepatocytes for a predetermined period in a medium capable of supporting growth and survival of separated cell spheroids in vitro, and the culture medium may include all of proteins such as growth factors and cytokines secreted from cells during a culture period and nutrients remaining after being consumed during culture. Specifically, the culture medium is a medium obtained from the culture medium where the adipose-derived stem cells or the mesenchymal stem cells are cultured in a three-dimensional manner, and may include a substance promoting hepatocyte division and maturation, for example, secretome, etc. Further, the liver disease may be selected from the group consisting of hepatitis, hepatotoxicity, cholestasis, fatty liver, cirrhosis, liver ischemia, alcoholic liver disease, hepatic abscess, hepatic coma, hepatatrophia, and hepatic cancer.
[0040] In a specific embodiment, when the cell spheroid formed in a diameter of 700 m to 800 m is defined as 1 unit, the cell spheroid may be mixed at a ratio of 1 unit per 100 l to 500 l, for example, 100 l to 500 l, 100 l to 400 l, 150 l to 500 l, 150 l to 450 l, or 150 l to 350 l of the culture medium. In this regard, when the mixing ratio is less than the above range, there is a problem in that it is difficult to obtain the prophylactic or therapeutic effect on liver diseases.
[0041] The pharmaceutical composition for preventing or treating liver diseases according to still another aspect may be used after being prepared in an oral formulation such as a powder, a granule, a tablet, a capsule, a suspension, an emulsion, a syrup, an aerosol, etc., or in a formulation for external use, a suppository, or a sterile injectable formulation according to common methods. For the preparation, the pharmaceutical composition may include an appropriate carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions.
[0042] The carrier, excipient, or diluent may include a variety of compounds such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc., or a mixture thereof.
[0043] Upon preparation, the formulation may be prepared using a commonly used diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, etc.
[0044] A solid formulation for oral administration may be prepared by mixing the cell spheroid and/or the culture medium thereof with one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate, talc, etc. may be used.
[0045] A liquid formulation for oral administration may include a suspension, a solution for internal use, an emulsion, a syrup, etc. and may include various kinds of excipients, e.g., humectants, sweeteners, fragrances, preservatives, etc., in addition to simple diluents commonly used, such as water and liquid paraffin.
[0046] A formulation for parenteral administration may include a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, and a suppository. For the non-aqueous solvent and the suspension, propylene glycol, polyethylene glycol, a vegetable oil such as olive oil, and an injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, Tween 61, cacao butter, laurin butter, glycerogelatin, etc. may be used.
[0047] An administration dose of the pharmaceutical composition for preventing or treating liver diseases according to still another aspect may vary depending on a patient's conditions, body weight, disease severity, a type of a drug, administration route and period, but may be appropriately selected by those skilled in the art. However, for better effects, the administration dose may be 0.0001 mg/kg to 2,000 mg/kg, 0.001 mg/kg to 2,000 mg/kg per day. The administration may be performed once or several times a day. However, the scope of the present disclosure is not limited to the above administration dose.
[0048] The pharmaceutical composition for preventing or treating liver diseases according to still another aspect may be administered to mammals such as rats, mice, livestock, humans, etc. via various routes. All modes of administration may be contemplated, for example, administration may be made orally, rectally or by intravenous, intramuscular, subcutaneous, endometrial, or intracerebroventricular injection.
[0049] Still another aspect provides a health functional food composition for improving hepatic functions, the health functional food composition including the cell spheroid and/or the culture medium thereof. Specific descriptions of the cell spheroid and the culture medium thereof are the same as above.
[0050] With regard to the health functional food for improving hepatic functions according to still another aspect, when the cell spheroid and/or the culture medium thereof is used as an additive of the health functional food, it may be used as it is or together with another food or food ingredients and may be appropriately used according to a common method. A mixing amount of the effective ingredients may be appropriately determined according to the purpose of use such as prevention, health, or treatment.
[0051] The health functional food may be in a formulation of any one of general foods or beverages as well as in a formulation of a powder, a granule, a pill, a tablet, or a capsule.
[0052] The kind of the food is not particularly limited, and examples of the food to which the above substance may be added may include meats, sausages, breads, chocolates, candies, snacks, cookies, pizzas, ramen, other noodles, gums, dairy products including ice cream, various kinds of soups, beverages, teas, drinks, alcoholic beverages, vitamin complexes, etc., and may include all kinds of foods from the common point of view.
[0053] Generally, during preparation of foods or beverages, the cell spheroid and/or the culture medium thereof may be added in an amount of 15 parts by weight or less, or 10 parts by weight or less, based on 100 parts by weight of raw materials. However, in the case of a long-term intake of the food for the purpose of health and hygiene or for health control, the amount may be less than the above range. Further, since the present disclosure has no safety problem in terms of using a fraction of a natural product, the amount may be more than the above range.
[0054] Among the health functional foods according to still another aspect, the beverage may include additional ingredients such as various flavoring agents, natural carbohydrates, etc., as in common beverages. The natural carbohydrates may include monosaccharides such as glucose, fructose, etc., disaccharides such as maltose, sucrose, etc., polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents, natural flavoring agents such as taumatin or stevia extracts, or synthetic flavoring agents such as saccharin or aspartame may be used. A proportion of the natural carbohydrates may be about 0.01 g to about 0.04 g, or about 0.02 g to about 0.03 g per 100 mL of the beverage according to the present disclosure.
[0055] Additionally, the health functional food for improving hepatic functions according to the present disclosure may include a variety of nutrients, vitamins, electrolytes, flavoring agents, colorants, pectic acid or salts thereof, alginic acid or salts thereof, organic acids, protective colloidal thickening agents, pH modifiers, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages, etc. Additionally, the composition for improving hepatic functions may include fruit flesh for the preparation of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in a mixture. A proportion of these additives may be, but is not limited to, generally selected from the range of 0.01 part by weight to 0.1 part by weight with respect to 100 parts by weight of the health functional food of the present disclosure.
[0056] In a method of preparing a cell spheroid according to an aspect, adipose-derived stem cells and hepatocytes are co-cultured, and therefore, secretome secreted by the adipose-derived stem cells affects maturation of hepatocytes, thereby enhancing hepatic functions of the finally formed three-dimensional cell spheroids, i.e., organoids. Further, a composition including a culture medium of the adipose-derived stem cells may prevent or treat liver diseases including hepatitis, hepatotoxicity, cholestasis, fatty liver, etc., and may enhance hepatic functions.
[0057] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings, wherein like reference numerals refer to like elements throughout. In this regard, the present embodiments may have different forms and should not be construed as being limited to the descriptions set forth herein. Accordingly, the embodiments are merely described below, by referring to the figures, to explain aspects of the present description. As used herein, the term and/or includes any and all combinations of one or more of the associated listed items.
[0058] Hereinafter, preferred examples will be provided for better understanding of the present disclosure. However, the following examples are provided only for understanding the present disclosure more easily, but the content of the present disclosure is not limited thereby.
EXAMPLE
Example 1. Direct Induction of Hepatocyte Phenotype from Mouse Induced Hepatic Progenitor
[0059] To obtain a large amount of mature hepatocytes which are required in the liver tissue engineering, mouse induced hepatic progenitors (miHeps) directly trans-differentiated from mouse embryonic fibroblast (MEF) were used. In detail, the cells were obtained by introducing, using a pMX viral vector, two factors of Foxa3 and HNF4a, which are known to hepatocyte-specific upstream regulating factors, into MEFs which were obtained by primary culture in E16.5 mouse.
[0060] Fibroblasts were cultured in a DMEM medium for 3 days, and then miHep were seeded at a density of 210.sup.4 cells/cm.sup.2 and cultured in a hepatocyte growth medium containing 20 ng/ml of HGF and 20 ng/ml of EGF for 7 days. Thereafter, the miHeps were isolated and cultured in a hepatocyte maturation medium containing 20 ng/ml of HGF, 20 ng/ml of EGF, and 2% DMSO 2% volume/volume (medium) for 7 days to 28 days.
[0061] To verify hepatocyte-specific phenotype of the hepatic progenitors, western blotting, RT-PCR, and immunostaining were performed to identify changes in cell morphology and hepatocyte-specific gene expression while increasing the cell culture time. Further, relative expression of related genes was quantified.
[0062]
[0063] As shown in
[0064]
[0065] As shown in
[0066]
[0067] As shown in
[0068] These results indicate that miHeps directly trans-differentiated are able to divide and mature under specific medium conditions, and induced to mature hepatocyte-like cells by long-term culture.
Example 2. Formation of hASC-miHep Organoid
[0069] 2-1. Isolation of Human Adipose-Derived Mesenchymal Stem Cell
[0070] Multipotent stem cells were isolated from a human subcutaneous adipose tissue. A subcutaneous adipose tissue of a normal person was washed with PBS containing 2% penicillin/streptomycin three times to remove contaminated blood, and chopped with operating scissors. The adipose tissue was immersed in a tissue lysis buffer previously prepared (serum-free DMEM+1% BSA(w/v)+0.3% collagenase type I) and stirred at 37 C. for 2 hours, and then centrifuged at 1,000 rpm for 5 minutes to separate a supernatant and a pellet. Thereafter, the supernatant was discarded, and the pellet was collected and washed with PBS, and then centrifuged at 1,000 rpm for 5 minutes to separate a supernatant. The separated supernatant was filtered through a 100 m mesh to remove cell debris, and the resultant was washed with PBS. The separated cells were cultured in a 10% FBS-containing DMEM/F12 medium (Welgene) for 24 hours. Then, non-adherent cells were removed by PBS washing, and cultured while replacing the 10% FBS-containing DMEM/F12 medium every two days, thereby obtaining human subcutaneous adipose tissue-derived stem cells (hASC, human adipose-derived mesenchymal stem cells).
[0071] 2-2. Preparation of Three-Dimensional Cell Spheroid
[0072] To form liver-organoids by three-dimensional cell culture, three-dimensional cell spheroids (hASC-miHep organoids) were prepared from miHeps obtained in Example 1 and hASCs obtained in Example 2-1. A polypeptide linker was fused to the amino terminus of fibroblast growth factor (FGF2) having adhesive activity to stem cells to prepare a recombinant protein having adhesive activity to stem cells. miHeps obtained in Example 1 and hASCs were co-cultured using the amino terminus of the polypeptide linker of the recombinant protein on a non-tissue culture matrix (poly-styrene-maltose-binding protein-basic fibroblast growth factor 2(PS-MBP-FGF2) matrix) having a hydrophobic surface, thereby forming organoids. In detail, hASCs obtained in Example 1-2 were seeded at a density of 0.510.sup.5 cells/cm.sup.2 on the matrix, and then incubated for 2 hours. Thereafter, miHeps obtained in Example 1 were seeded at a density of 0.510.sup.5 cells/cm.sup.2, and then further incubated for 2 days.
[0073]
[0074] As shown in
Comparative Example
[0075] miHeps cultured in Example 1 and hASCs obtained in Example 2-1 were two-dimensionally cultured to prepare a cell spheroid. In detail, adipose-derived stem cells obtained in Example 2-1 were seeded at a density of 0.510.sup.5 cells/cm.sup.2 per well in a 48-well tissue culture plate (TCP), and then incubated in a 10% FBS-containing DMEM/F12 medium for 2 hours. Thereafter, the hepatocytes cultured in Example 1 were additionally seeded at a density of 0.510.sup.5 cells/cm.sup.2 and cultured for 2 days.
[0076]
[0077] As shown in
Example 2. Identification of Hepatocyte-Specific Marker Expression of Three-Dimensional Cell Spheroid
[0078] Expression of hepatocyte-specific markers of the three-dimensional cell spheroid (hASC-miHep organoid) prepared in Example 1-3, miHeps of Example 1-1, and the two-dimensional cell spheroid (hASC-miHep organoid) prepared in Comparative Example 1 was analyzed by RT-PCR and real-time PCR. Media for miHeps are divided into a growth medium that preferentially promotes cell division so as to enable large-scale culture during a culturing process and a maturation medium that induces cell maturation while suppressing division. Therefore, miHeps were cultured under the respective conditions and divided into two different miHeps which are different in maturity. In detail, from the cell spheroid prepared using immature miHeps cultured in the hepatocyte maturation medium of Example 1 and the cell spheroid prepared using mature miHeps obtained in Example 1, total RNAs were extracted and purified at 2 days after culture using a TRIzol reagent (Invitrogen, Carlsbad, Calif., USA), chloroform (Sigma, St. Louis, Mo., USA), and 100% isopropanol (Sigma, St. Louis, Mo., USA) in accordance with the manufacturer's protocol. The extracted RNAs were dissolved in nuclease-free water, and cDNAs were synthesized using Maxime RT PreMix (iNtRon, Korea) in accordance with the manufacturer's protocol. 0.2 mM of dNTP mix (Promega), 10 pmol of target gene (vWF, CD34, PECAM1, and VEGF)-specific primers, and 0.25 unit of Taq DNA polymerase (Promega, M791A) were amplified in ABI Prism 7500 (Applied Biosystems), and the resulting PCR products were electrophoresed on a 2% agarose gel at 100 V for 40 minutes. The conditions and information of the used primers are shown in Table 1 below.
TABLE-US-00001 TABLE1 SEQ Annealing ID Size temperature Gene Primer NO. Nucleotidesequence(5.fwdarw.3) (bp) ( C.) HNF4 F 1 ATCGTCAAGCCTCCCTCTGC 26 55 R 2 GACTGGTCCCTCGTGTCACATC 22 CYP1a2 F 3 AGGAGCTGGACACGGTGGTT 20 55 R 4 AGGTGTCCCTCGTTGTGCTG 20 ALB F 5 GGCTACAGCGGAGCAACTGA 20 55 R 6 GCCTGAGAAGGTTGTGGTTGTG 22 ASGR1 F 7 GGTGACCTCCAGGGATGAGCAGAAC 25 60 R 8 CTGTTCCATCCACCCATTTCCAGGGC 26
[0079] As shown in
[0080] Additionally, relative expression of related genes was quantified. As shown in
Example 3. Characterization of Culture Medium of Three-Dimensional Cell Spheroid
[0081] To examine whether ambivalent modulation of hepatocyte-specific gene expression according to the maturity of miHeps in the co-cultured hASC-miHep organoid is attributed to factors secreted by hASCs, immature or mature miHeps cultured under two dimensional conditions were treated with conditioned medium (CM) obtained from hASCs which were cultured under two- or three-dimensional conditions. Media used in the two- or three-dimensional culture to obtain the conditioned medium were all CB-ADMSC-GM of CEFO Co. Ltd., and the adipose-derived stem cells obtained in Example 2-1 were seeded at a density of 1.010.sup.5 cells/cm.sup.2 in a 98-well tissue culture plate (TCP) or a 98-well non-tissue culture plate (NTCP) coated with MBP-FGF2, and additionally cultured for one day, thereby obtaining the tissue culture media. Thereafter, hepatocyte-specific gene expression of miHeps was examined by RT-PCR and real-time PCR. Further, to visualize the effects of the conditioned culture media on division of mature or immature miHeps and albumin, Ki-67 and albumin expression in miHeps treated with the hASC conditioned culture media was examined by immunostaining.
[0082]
[0083] As shown in
[0084]
Example 4. Effect of Secretome on hDF and hBMSC
[0085] To examine whether the effect of modulating hepatic functions of miHep by secretome of hASCs may be also observed in secretome in another mesenchymal stem cells, conditioned media obtained from human dermal fibroblasts (hDFs) and human bone marrow-derived mesenchymal stem cells (hBMSCs) were used to perform the same experiment as in Example 4.
[0086]
[0087] As shown in
Example 5. Formation of hASC-hCdH Organoids
[0088] To form hASC-hCdH organoids by three-dimensional cell culture, three-dimensional cell spheroids (hASC-hCdH organoids) were prepared from hCdHeps and hASCs obtained in Example 2-1. Organoids were prepared by co-culturing hCdHeps and hASCs on a non-tissue culture matrix (poly-styrene-maltose-binding protein-basic fibroblast growth factor 2(PS-MBP-FGF2) matrix). In detail, hASCs obtained in Example 2-1 were seeded on the matrix at a density of 0.6710.sup.5 cells/cm.sup.2, and then incubated for 2 hours. Thereafter, hCdHeps were additionally seeded at a density of 0.3310.sup.5 cells/cm.sup.2, and then incubated for 2 days.
Example 6. Formation of hASC-hCdH Organoids Using Artificial Ligand of Hepatocyte-Specific Receptor
[0089] To compensate for the decrease in the yield of organoid formation as the proportion of hCdHeps cells in all the cells used for organoid formation is increased in Example 5, an artificial ligand poly[N-p-vinylvenzyl-O--galactopyranosyl-(1->4)-d-gluconamide] (PVLA) of a hepatocyte-specific protein ASGP-R was further used to prepare three-dimensional cell spheroids (hASC-hCdH organoids) from hCdHeps and hASCs obtained in Example 2-1. PVLA was further immobilized at a concentration of 10 g/ml to 20 g/ml on a non-tissue culture matrix (poly-styrene-maltose-binding protein-basic fibroblast growth factor 2(PS-MBP-FGF2) matrix) on the surface of culture plate, and then organoids were formed by co-culturing hCdHeps with hASCs. In detail, hASCs obtained in Example 2-1 were seeded on the matrix at a density of 0.6710.sup.5 cells/cm.sup.2, and then incubated for 2 hours. Thereafter, hCdHeps were additionally seeded at a density of 0.3310.sup.5 cells/cm.sup.2, and then incubated for 2 days.
Experimental Example
[0090] Characterization of Organoid
[0091] For morphological optimization of the three-dimensional cell spheroid formed in Example 5, cells in which morphological features of mature hepatocytes (
[0092] As a result, as shown in
[0093] Enhancement of Organoid Formation by PVLA Coating
[0094] To compensate for the decrease in the yield of cell spheroid formation when hepatic progenitors are co-cultured with hASCs on a non-tissue culture matrix (poly-styrene-maltose-binding protein-basic fibroblast growth factor 2(PS-MBP-FGF2) matrix), a hepatocyte-specific artificial ligand (PVLA), which specifically binds to ASGP receptors expressed on the surface of hepatocytes to weaken a binding force between the hepatocytes and a poly-styrene culture plate, was coated together with MBP-FGF2 onto the surface of the poly-styrene culture plate. In detail, as a control group of amphipathic PVLA molecule having a binding ability to both the surface of the poly-styrene culture plate and ASGP receptor which is a hepatocyte membrane protein, a similar molecule PVMA having a binding ability to the poly-styrene surface, like PVLA, but having no a binding ability to ASGP receptor was used. To examine whether hydrophobicity of the poly-styrene culture plate due to non-specific coating affects the change of yield, BSA was used.
[0095] As a result, as shown in
[0096] It should be understood that embodiments described herein should be considered in a descriptive sense only and not for purposes of limitation. Descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments.
[0097] While one or more embodiments have been described with reference to the figures, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the disclosure as defined by the following claims.