H52 IBV vaccine with heterologous spike protein

Abstract

The present invention relates i.a. to an H52 IBV (infectious bronchitis virus) encoding for a heterologous S (spike) protein or fragment thereof. Further, the present invention relates to an immunogenic composition comprising said H52 IBV encoding for a heterologous S (spike) protein or fragment thereof. Furthermore, the present invention relates to methods for immunizing a subject comprising administering to such subject the immunogenic composition of the present invention. Moreover, the present invention relates to methods of treating or preventing clinical signs caused by IBV in a subject of need, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition according to the present invention.

Claims

1. A recombinant, infectious bronchitis virus (IBV) comprising an H52 IBV backbone having at least 95% sequence identity to SEQ ID NO: 78 and a heterologous IBV spike protein (S protein) or fragment thereof, wherein the heterologous IBV S protein is from a different genotype or serotype than the H52 IBV and replaces the homologous H52 IBV S protein or fragment thereof, wherein the heterologous IBV S protein or fragment thereof is of a non-Massachusetts genotype or serotype, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5, 6, 9, 10, 11, 12, 13, 14, 15, or 16 or wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 7 or 8, and wherein the heterologous IBV S protein or fragment thereof has a length of at least 1000 amino acids.

2. The IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: 4/91, QX, Q1, Arkansas, Variant 2, and Brazil.

3. The IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: 4/91 and QX.

4. The IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5 or SEQ ID NO: 6 or wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 7 or 8.

5. A method for immunizing a subject, comprising: administering to the subject an immunogenic composition comprising a recombinant IBV comprising an H52 IBV backbone having at least 95% sequence identity to SEQ ID NO: 78 and a heterologous IBV S protein or fragment thereof, wherein the heterologous IBV S protein is from a different genotype or serotype than the H52 IBV and replaces the homologous H52 IBV S protein or fragment thereof, wherein the heterologous IBV S protein or fragment thereof is of a non-Massachusetts genotype or serotype, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5, 6, 9, 10, 11, 12, 13, 14, 15, or 16 wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 7 or 8, and wherein the heterologous IBV S protein or fragment thereof has a length of at least 1000 amino acids.

6. The method of claim 5, wherein a protective immune response effective to reduce or eliminate subsequent IBV-infection clinical signs in the subject, relative to a non-vaccinated control subject of the same species, is elicited by administration of the immunogenic composition.

7. The method of claim 5, wherein a protective immune response effective to reduce ciliostasis risk in the subject, relative to a non-vaccinated control subject of the same species, is elicited by administration of the immunogenic composition.

8. The method of claim 5, wherein the subject is a poultry.

9. The method of claim 5, wherein the method is effective to prevent or reduce ciliostasis, rales, egg drop, kidney lesions, watery diarrhea, weight loss, viral load, and/or viral shedding in the subject relative to a non-vaccinated control subject of the same species if the subject is subsequently infected with IBV.

10. The method of claim 5, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from the group consisting of: 4/91 and QX, and wherein administration of the immunogenic composition to an animal results in 82-100% protection against challenge with a spike-homologous challenge strain.

11. An immunogenic composition comprising a recombinant IBV comprising an H52 IBV backbone having at least 95% sequence identity to SEQ ID NO: 78 and a heterologous IBV S protein or fragment thereof, wherein the heterologous IBV S protein is from a different genotype or serotype than the H52 IBV and replaces the homologous H52 IBV S protein or fragment thereof, and wherein the heterologous IBV S protein or fragment thereof is of a non-Massachusetts genotype or serotype, and wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5, 6, 9, 10, 11, 12, 13, 14, 15, or 16 or wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 7 or 8 wherein the heterologous IBV S protein or fragment thereof has a length of at least 1000 amino acids.

12. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: 4/91, QX, Q1, Arkansas, Variant 2, and Brazil.

13. The immunogenic composition of claim 12, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: 4/91 and QX.

14. The immunogenic composition of claim 11, wherein the immunogenic composition is a vaccine.

15. The immunogenic composition of claim 11, wherein the immunogenic composition is part of a kit.

16. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5 or SEQ ID NO: 6 or wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 7 or 8.

17. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from the group consisting of: 4/91 and QX, and wherein administration of the immunogenic composition to an animal results in 82-100% protection against challenge with a spike-homologous challenge strain.

18. A recombinant, infectious bronchitis virus (IBV) comprising an H52 IBV backbone and a heterologous IBV spike protein (S protein) or fragment thereof, wherein the heterologous IBV S protein is from a different genotype or serotype than the H52 IBV and replaces the homologous H52 IBV S protein or fragment thereof, wherein the heterologous IBV S protein or fragment thereof is of a non-Massachusetts genotype or serotype, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 5, 6, 7, 8, wherein the heterologous IBV S protein or fragment thereof has a length of at least 1000 amino acids, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from the group consisting of 4/91 and QX, and wherein administration of the immunogenic composition to an animal results in 82-100% protection against challenge with a spike-homologous challenge strain.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. In ovo replication kinetics for H52 rIBV CR88 S ecto in comparison to recombinant wild type viruses H52 and CR88. One data point represents the mean of 5 samples per time point. Error bars indicate the standard deviation.

(2) FIG. 2. Summary of ciliostasis scoring. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while absence of ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (p<0.007).

(3) FIG. 3. Summary of RT-qPCR results of kidney tissues. Each individual bird is indicated by one data point.

(4) FIG. 4. Summary of RT-qPCR results of choanal swab eluates. Each individual bird is indicated by one data point.

(5) FIG. 5. Summary of ciliostasis scoring. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while absence of ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (p<0.0001).

SEQUENCES OVERVIEW

(6) SEQ ID NO:1: H52 IBV spike (S) protein. SEQ ID NO:2: H52 IBV nucleocapsid (N) protein. SEQ ID NO:3: H52 IBV envelope (E) protein. SEQ ID NO:4: H52 IBV membrane glycoprotein (M) protein. SEQ ID NO:5 and 6: Heterologous S protein or fragment from genotype or serotype 4/91. SEQ ID NO:7 and 8: Heterologous S protein or fragment thereof from genotype or serotype QX. SEQ ID NO:9 and 10: Heterologous S protein or fragment thereof from genotype or serotype Q1. SEQ ID NO:11 and 12: Heterologous S protein or fragment thereof from genotype or serotype Arkansas.

(7) SEQ ID NO:13 and 14: Heterologous S protein or fragment thereof from genotype or serotype Variant 2. SEQ ID NO:15 and 16: Heterologous S protein or fragment thereof from genotype or serotype Brazil. SEQ ID NO:17: IBV CR88 spike nucleic acid coding sequence. SEQ ID NO:18: IBV H52 spike ectodomain nucleic acid coding sequence SEQ ID NO:19: pUC57-s H52 rIBV donor plasmid. SEQ ID NO:20: IBV CR88 spike ectodomain nucleic acid coding sequence. SEQ ID NO:21: pUC57-s H52 rIBV CR88 S Ecto donor plasmid. SEQ ID NO:22 to SEQ ID NO:77: Primer. SEQ ID NO:78: EU817497 (H52 IBV nucleotide sequence) SEQ ID NO:79: AF352315 (H52 IBV S protein amino acid sequence) SEQ ID NO:80: AY044185 (H52 IBV N protein amino acid sequence) SEQ ID NO:81: AF352310 (H52 IBV N protein amino acid sequence) SEQ ID NO:82: AF317210 (H52 IBV E protein amino acid sequence) SEQ ID NO:83: AF286185 (H52 IBV M protein amino acid sequence) SEQ ID NO:84 and SEQ ID NO:85: Primer

EXAMPLES

(8) The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are merely illustrative and are understood not to limit the scope or the underlying principles of the present invention.

Example 1

Generation of Recombinant IBV H52 in Which the Coding Sequence For the H52 Spike or Spike Ectodomain is Replaced by the Coding Sequence For a Heterologous Spike or Spike Ectodomain

(9) Donor Plasmid Construction

(10) Exemplary the replacement of the H52 spike ectodomain by the CR88 ectodomain is described in detail: The IBV CR88 spike nucleic acid coding sequence (SEQ ID NO:17) is synthesized by a commercial supplier. It is used as a template to replace the IBV H52 spike ectodomain nucleic acid coding sequence (SEQ ID NO:18) in the pUC57-s IBV-5-1b-S-SIR-3T donor plasmid described by van Beurden et al. (Virol J. 2017; 14(1):109), hereafter referred to as pUC57-s H52 rIBV donor plasmid (SEQ ID NO:19). Bases 1717 to 4941 of SEQ ID NO:19 are replaced with the corresponding IBV CR88 spike ectodomain nucleic acid coding sequence (SEQ ID NO:20) which corresponds to bases 55 to 3285 of SEQ ID NO 15, respectively. This generates the pUC57-s H52 rIBV CR88 S Ecto donor plasmid (SEQ ID NO:21) in which the IBV CR88 spike ectodomain is encoded by bases 1717 to 4947. For this, the pUC57-s H52 rIBV donor plasmid (SEQ ID NO:19) is digested using the unique restriction sites 5′ (EcoRV) and 3′ (PmlI) close to the H52 spike coding sequence to linearize the plasmid and remove the H52 spike and flanking sequences. The QIAquick gel extraction kit (Qiagen) is used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike coding sequence. The CR88 spike ectodomain nucleic acid coding sequence and the flanking 5′ and 3′ IBV H52 sequences are amplified in three separate PCR reactions with Q5® High-Fidelity DNA Polymerase (NEB; see table 1 for primers). The PCR products are purified by QIAquick gel extraction (Qiagen) and are used for Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the kit protocol to generate the pUC57-s H52 rIBV CR88 S Ecto donor plasmid.

(11) TABLE-US-00001 TABLE 1 Gibson assembly primers designed with the NEBuilder online tool by NEB and used to generate PCR products to assemble the pUC57-s H52 rIBV CR88 S Ecto donor plasmid. PCR Product Primer 1 H52 5′ cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) flank tatcatagagcaaagcactacatagtgcacac (SEQ ID NO: 23) 2 CR88 spike actatgtagtgctttgctctatgataataatacttacg (SEQ ID NO: 24) Ectodomain cataccaaggccatttaatataagttttgagaattgagag (SEQ ID NO: 25) 3 H52 3′ aacttatattaaatggccttggtatgtgtgg (SEQ ID NO: 26) flank cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27)
Targeted RNA Recombination and Rescue of Recombinant IBV

(12) For the generation of recombinant IBV the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1):109) is applied. In brief, the H52 murinized (m)IBV is generated as described. For the generation of H52 rIBV CR88 S Ecto, LR7 cells are infected with H52 mIBV and electroporated with in vitro transcript generated from the pUC57-s H52 rIBV CR88 S Ecto donor plasmid and subsequently injected into 8 day old embryonated SPF chicken eggs (VALO BioMedia). After up to 9 days of incubation at 37.5° C. and 60% humidity, the allantoic fluids of all eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation by the QIAamp viral RNA mini kit (Qiagen) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1323 and PO1729 binding in H52 IBV 1ab and CR88 IBV S ectodomain are used (table 2) specific for recombinant IBV but not mIBV. The positive allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is selected for two rounds of end-point dilution in 8-day old SPF eggs. Nucleic acids isolation of samples of the limiting dilution is performed using the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) with the KingFisher™ Duo Prime Purification System (ThermoFisher) and are subsequently analyzed for the presence of rIBV by the RT-PCR described above. After the second limiting dilution the positive-tested allantoic fluid of the egg inoculated with the highest dilution is used for propagation in 10-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:1000 in 1×PBS and 100 μl is injected per egg. Allantoic fluid is harvested 48 hours post inoculation, cleared from debris and stored at −80° C. To confirm the sequence derived from the donor plasmid in the generated rIBV, viral nucleic acids are isolated with the QIAamp viral RNA mini kit followed by the SuperScript III One-Step RT-PCR using the primers listed in table 3, QIAquick PCR purification and subsequent Sanger sequencing with the same primers, performed by a commercial supplier.

(13) TABLE-US-00002 TABLE 1 Primers to identify recombinant IBV after rescue Amplicon name sequence Region [bp] PO1323 TCAGCATGGACGTGTGGTTA (SEQ ID NO: 28) lab ~970 PO1729 aggttggcacctatatgggg (SEQ ID NO: 29) spike

(14) TABLE-US-00003 TABLE 2 Sequencing primers to confirm sequence of the donor region in H52 rIBV CR88 S Ecto PCR Name Sequence Region Amplicon [bp]  1 PO765 tgacttggtttgaagatggc (SEQ ID NO: 30) Pol 1ab  904 PO730 aagagatgttggtaacacct (SEQ ID NO: 31) Pol 1ab  2 PO706 gacagagcacaagtttgatc (SEQ ID NO: 32) Pol 1ab 1044 PO1409 ggagtgaaaacaagatcacc (SEQ ID NO: 33) S  3 PO1398 aatttaacagttagcgtatc (SEQ ID NO: 34) S  801 PO1410 tttgtatacgagagccatca (SEQ ID NO: 35) S  4 PO1399 ggtcctactagatgtaaggg (SEQ ID NO: 36) S  809 PO1411 ctctctttgacctacaccat (SEQ ID NO: 37) S  5 PO1400 ttgccttcagtatgtttgtg (SEQ ID NO: 38) S  803 PO1412 agtgaagaaagtctacctgt (SEQ ID NO: 39) S  6 PO1401 atttcctccgtacttcaaga (SEQ ID NO: 40) S  786 PO1413 tgaagataataatggcaaaagc (SEQ ID NO: 41) S  7 PO1402 tcttgaaacactctcaattct (SEQ ID NO: 42) S 1471 PO715 ggtcaccagtatatttctgc (SEQ ID NO: 43) M  8 PO710 ggtcaacaatgtaattttgct (SEQ ID NO: 44) 5ab  958 PO734 cttgtcctgctttgttaaga (SEQ ID NO: 45) 5ab  9 PO1405 ttataggttggcttgtacgc (SEQ ID NO: 46) 5ab 1025 PO716 gcccatccttaataccttcc (SEQ ID NO: 47) N 10 PO759 ctcgcattacaaaggctaag (SEQ ID NO: 48) N 1123 PO719 gctctaactctatactagcct (SEQ ID NO: 49) 3′-UTR
Generation and characterization of H52 recombinant IBV in which the coding sequence for the H52 spike or spike ectodomain is replaced by the coding sequence for a spike or spike ectodomain from another IBV genotype

(15) The same methods as described for the generation of H52 rIBV CR88 S Ecto are applied to generate and characterize recombinant H52 IBV in which the spike coding sequence (bases 1663 to 5151 in SEQ ID NO:19) or the H52 spike ectodomain coding sequence (bases 1717 to 4941 of SEQ ID NO:19) is replaced with the coding sequences for the IBV spikes or spike ectodomains of the serotypes and genotypes listed in Table 3.

(16) TABLE-US-00004 TABLE 3 Primers used for Gibson assembly of H52 rIBV donor plasmids with heterologous spike or spike ectodomain spike PCR product Primer CR88 S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO: 5 gtttgtccaacatctcttaccagtaacttacc (SEQ ID NO: 50) 2 CR88 S ttactggtaagagatgttggacaaaccgcttttac (SEQ ID NO: 51) ggactttggatcattaaacagactttttaggtctgtattg (SEQ ID NO: 52) 3 H52 3′ flank aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO: 53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) QX S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO: 7 acttcaccaacatctcttaccagtaacttacc (SEQ ID NO: 54) 2 QX S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO: 55) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO: 52) 3 H52 3′ flank aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO: 53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) QX S Ecto 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO: 8 aatcaaacaaattagcactacatagtgcacac (SEQ ID NO: 56) 2 QX S ecto actatgtagtgctaatttgtttgattctgataataattatg (SEQ ID NO: 57) cataccaaggccacttaatataagttttaattattgaaagttcttc (SEQ ID NO: 58) 3 H52 3′ flank aacttatattaagtggccttggtatgtgtgg (SEQ ID NO: 59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) Q1 S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO: 60) SEQ ID NO: 9 acttccccaacatctcttaccagtaacttacc (SEQ ID NO: 61) 2 Q1 S ttactggtaagagatgttggggaagtcactg (SEQ ID NO: 62) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO: 52) 3 H52 3′ flank aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO: 53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO: 63) Q1 S Ecto 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO: 10 tatcaaacaaagcagcactacatagtgcacac (SEQ ID NO: 64) 2 Q1 S Ecto actatgtagtgctgctttgtttgataataatgaaac (SEQ ID NO: 65) cataccaaggccatttaatataagtcttgagtattgaaag (SEQ ID NO: 66) 3 H52 3′ flank gacttatattaaatggccttggtatgtgtgg (SEQ ID NO: 67) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) Ark S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO: 60) SEQ ID NO 11 acttcaccaacatctcttaccagtaacttacc (SEQ ID NO: 54) 2 Ark S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO: 55) ctttggatcattaaacagactttttaggtctg (SEQ ID NO: 84) 3 H52 3′ flank gtctgtttaatgatccaaagtcccactag (SEQ ID NO: 85) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO: 63) Ark S Ecto 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO 12 tgtcatataaattagcactacatagtgcacac (SEQ ID NO: 68) 2 Ark S Ecto actatgtagtgctaatttatatgacaacgaatcttttg (SEQ ID NO: 69) cataccaaggccacttaatataagttttgagtattgaaag (SEQ ID NO: 70) 3 H52 3′ flank aacttatattaagtggccttggtatgtgtgg (SEQ ID NO: 59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) Variant 2 S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO: 60) SEQ ID NO 13 acttcaccaacatctcttaccagtaacttacc (SEQ ID NO: 54) 2 Variant 2 S ttactggtaagagatgttggtgaagtcactg (SEQ ID NO: 55) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO: 52) 3 H52 3′ flank aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO: 53) Variant 2 S 1 H52 5′ flank cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO: 63) Ecto cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO 14 2 Variant S tatcaaacagagcagcactacatagtgcacac (SEQ ID NO: 71) Ecto actatgtagtgctgctctgtttgataataatcag (SEQ ID NO: 72) cataccaaggccacttaatataagttttaattattgaaagttcttc (SEQ ID NO: 58) 3 H52 3′ flank aacttatattaagtggccttggtatgtgtgg (SEQ ID NO: 59) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27) Brazil S 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatg (SEQ ID NO: 60) SEQ ID NO 15 gttgaaccaacatctcttaccagtaacttacc (SEQ ID NO: 73) 2 BR-1 S ttactggtaagagatgttggttcaacctcttttac (SEQ ID NO: 74) ggactttggatcattaaacagactttttaggtctg (SEQ ID NO: 52) 3 H52 3′ flank aaagtctgtttaatgatccaaagtcccactag (SEQ ID NO: 53) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaag (SEQ ID NO: 63) Brazil S Ecto 1 H52 5′ flank cagagcacaagtttgatcttgtgatatctgatatgtatacagacaatgattc (SEQ ID NO: 22) SEQ ID NO 16 tattgtacaaagaagcactacatagtgcacac (SEQ ID NO: 75) 2 BR-1 S Ecto actatgtagtgcttctttgtacaataatgatagctatg (SEQ ID NO: 76) cataccaaggccatttaatataagtttttaaaatagaaagtgtttc (SEQ ID NO: 77) 3 H52 3′ flank aacttatattaaatggccttggtatgtgtgg (SEQ ID NO: 26) cttaactcctggaattactaaccacgtgtaccaaaataaacaacaagc (SEQ ID NO: 27)
Primers in table 2 and 3 are used for identification and sequencing of the different recombinant viruses and are adapted to the respective spike sequence if necessary.

Example 2

In Ovo Replication Kinetics

(17) Eight day-old embryonated chicken eggs are inoculated with 10.sup.2 EID.sub.50 of rIBV and the respective controls. Eggs are incubated at 37.5° C., 60% humidity and candled daily 0, 8, 24, 34, 48 and 72 hours after inoculation and embryo mortality is recorded. Five preselected eggs per sample and time point are removed and transferred to 4° C. for at least 2 hours. Subsequently, the allantoic fluid is harvested and stored at −80° C. For analysis, samples are thawed and diluted 1:10 in 1×PBS without Ca and Mg and nucleic acids are extracted with the QIAamp DNA Blood Mini kit (Qiagen) with addition of carrier RNA using the Hamilton Starlet pipet robot. Extracted nucleic acids are analyzed by RT-qPCR for the relative amount of IBV RNA with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the ABI™ 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific). All nucleic acid samples are analyzed in triplicates using a 10-fold dilution series of IBV H52 as reference.

(18) For H52 rIBV CR88 S Ecto in comparison to the recombinant wild type viruses H52 and CR88 slightly similar replication kinetics are observed at early time points. However, after 32 hours all viruses reach comparable ct values. All embryos are alive at 32 hours post inoculation, while at time point 48 hours post infection all remaining embryos are dead for all samples. Therefore, the replication of H52 rIBV CR88 S ecto is considered equally efficient compared to the wild type viruses (see Figure 1).

Example 3

Preparation of Vaccine and Challenge Virus

(19) To demonstrate the efficacy of the H52 rIBV with heterologous spike or spike ectodomain in chickens, an aliquot of the virus stock is thawed and 10-fold diluted in 1×PBS to determine the 50% embryo infectious dose (EID.sub.50) by inoculation of 100 μl into five 8-day old embryonated chicken eggs per dilution. Eggs are incubated at 37.5° C., 60% humidity until 7 days post inoculation. Eggs with dead embryos after 24 hours are excluded from the experiment. All other eggs with dead embryos at 7 days post inoculation are considered positive. All eggs with living embryos are candled from the bottom at 7 days post inoculation to identify dwarfs, which are considered positive. The EID.sub.50/ml is calculated with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497). For vaccination the virus stock is diluted in 1×PBS to obtain a titer of 10.sup.4.3 EID50/ml (10.sup.3 EID50 per chicken in 50 μl).

(20) The challenge viruses for genotypes and serotypes 793B, QX, Q1, Ark, Variant 2 and Brazil are propagated in 10-day-old embryonated SPF eggs. 24 hours post inoculation the eggs are transferred to 4° C. for at least 2 hours. The allantoic fluid is harvested, aliquoted and stored at −80° C. The virus titer is determined as described above. The titer is set to 10.sup.4.3 to 10.sup.5.3 EID.sub.50/ml by dilution with 1×PBS (10.sup.3 to 10.sup.4 EID.sub.50 per chicken in 50 μl).

Example 4

Determination of Vaccine Efficacy

(21) Fertilized SPF eggs are incubated for 18 days in an egg setter at 99.7° F. and 50% humidity with 1 turn per hour. At day 18 of incubation the eggs are candled and fertile eggs are transferred to the hatcher and incubated at 99° F. and 70% humidity until hatch. Chicks without clinical signs or deformation are randomly distributed into respective treatment groups and transferred into separate isolators. At least two chicks serve as strict negative control (SNC) group, five chicks are enrolled in the challenge control (CC) group and at least 10 in groups which are vaccinated with the recombinant IBV with heterologous spike or spike ectodomain and and subsequently challenged. Animals are kept under housing conditions in compliance to local and national requirements for animal welfare recommendations. The light regime is adjusted to 16 hours light per day. Feed and water are provided ad libitum. After transfer to the isolator, chicks are vaccinated (1-day old) with 10.sup.3 EID.sub.50 per chicken via eye drop (total volume 50 μl, 25 μl per eye) while the SNC and CC groups remain untreated. At 21 days post vaccination chickens of the CC and vaccinated groups are challenged with 10.sup.3 to 10.sup.4 EID.sub.50 per chicken of the respective spike-homologous challenge strain (793B, QX, Q1, Ark, Variant 2 or Brazil) via eye drop (total volume 50 μl, 25 μl per eye). At 7 days post challenge all chickens are euthanized, choanal swabs are taken and kidneys are removed and stored in RNAlater Stabilization Solution (ThermoFisher) at 4° C. for IBV-specific RT-qPCR analysis. In addition, tracheas are removed and transferred into 50 ml tubes with warm cell culture medium. Afterwards, tracheas are cleaned from connective tissues and flushed with cell culture medium. The tracheas are cut into tracheal rings using the McIlwain tissue chopper set to 0.6-0.8 mm slice thickness. Per trachea three rings of the upper part, four rings of the middle part and three rings of the lower part are analyzed for cilia beating by light microscopy and scored for ciliostasis (see table 5). A ring is recorded as normal if more than 50% of the internal ring shows vigorous cilia movement (Score 2 and lower). A ring is recorded as positive for ciliostasis if less than 50% of the cilia are beating (Score 3 and 4). For IBV-specific RT-qPCR analysis kidney tissue pieces are warmed up to room temperature and transferred to separate 2 ml Precellys tubes, which are filled with medium and PBS, respectively. Kidneys are homogenized with the Precellys® tissue homogenizer (Bertin Instruments) for 1×20 sec at 6800 rpm. Choanal swabs are eluted in 2 ml 1×PBS. Nucleic acids are isolated from 200 μl eluate and tissue homogenate respectively using the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). RT-qPCR is performed as described for the in ovo kinetics above, except for using a StepOnePlus™ Real-Time PCR System (ThermoFisher) for analysis in duplicates.

(22) TABLE-US-00005 TABLE 4 Scoring of ciliostasis in tracheal rings Ciliar activity [%] Ciliostasis score 100 0 <100 - 75 1  <75 - 50 2  <50 - 25 3  <25 - 0  4

Example 5

Efficacy of Recombinant IBV H52 Encoding a Heterologous Spike or Spike Ectodomain

(23) The objective of the studies is to demonstrate that recombinant IBV H52 (Mass genotype) encoding a heterologous spike or spike ectodomain is able to confer protection against challenge with a spike-homologous challenge strain.

(24) It is analyzed if the recombinant IBV H52 encoding the spike ectodomain of IBV CR88 (4/91 genotype) is able to confer protection against challenge with a virulent 793B strain (4/91 genotype), considered as homologous challenge for the encoded IBV CR88 spike ectodomain and as heterologous challenge considering the IBV H52 backbone. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with H52 rIBV CR88 S Ecto at 1-day of age determine a titer of 10.sup.4.13 EID.sub.50/ml (target 10.sup.4.3 EID.sub.50/ml) and 10.sup.4.69 EID.sub.50/ml (target 10.sup.4.3 EID.sub.50/ml) for the 793B challenge virus applied at 21 days post vaccination, respectively. Ciliostasis is scored as described above and results are depicted in Error! Reference source not found.2 and summarized in Table 5 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0).

(25) TABLE-US-00006 TABLE 5 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered not affected if not fewer than 9 out of 10 rings show normal ciliar activity. Group Vaccine Challenge Mean Ciliostasis Score not affected [%] 1 — — 0.83 100 2 — 793B 32.9 20 3 H52 rIBV CR88 S 793B 10.64 82 Ecto
All animals of the strict negative control show normal cilia movement while 80% animals of the challenge control group are positive for ciliostasis. In contrast, 82% of the animals vaccinated with H52 rIBV CR88 S Ecto are protected. In addition, the viral load in kidneys and choanal swabs of animals vaccinated with H52 CR88 S Ecto is reduced compared to the challenge control (FIG. 3 and FIG. 4).

(26) Further, it is analyzed if the recombinant IBV H52 encoding the spike of IBV QX is able to confer protection against challenge with a virulent D388 QX strain, considered as homologous challenge for the encoded IBV QX spike and as heterologous challenge considering the IBV H52 backbone. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with H52 rIBV QX S at 1-day of age determine a titer of 10.sup.4 EID.sub.50/ml while the QX vaccines exceeds a titer of 10.sup.5 EID.sub.50/ml (target 10.sup.4.3 EID.sub.50/ml). The titer of 10.sup.4.83 EID.sub.50/ml (target 10.sup.4.3 EID.sub.50/ml) is determined for the D388 QX challenge virus applied at 21 days post vaccination, respectively. Ciliostasis is scored as described above and results are depicted in Error! Reference source not found.5 and summarized in Table 5 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0).

(27) TABLE-US-00007 TABLE 7 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered not affected if not fewer than 9 out of 10 rings show normal ciliar activity. Group Vaccine Challenge Mean Ciliostasis Score Not affected [%] 1 — — 0 100 2 — D388 QX 38.4 0 3 QX vaccine D388 QX 3.5 100 3 H52 rIBV QX S D388 QX 5.9 100
All animals of the strict negative control show normal cilia movement while all animals of the challenge control group are positive for ciliostasis. In contrast, 100% of the animals vaccinated with H52 rIBV QX S or the QX vaccine are protected.

(28) Similar results are obtained with the other H52 rIBV with heterologous spikes or spike ectodomains.

(29) The results highlight the suitability of IBV 4/91 strains as a potent backbones for the generation of recombinant IBV with heterologous spike and show excellent results, in particular, when compared to prior art data for the IBV Beaudette backbone.