Method and kit for prognosis of OPA1 gene induced diseases, E.G. Kjers optic atrophy
10501798 ยท 2019-12-10
Assignee
- UNIVERSITE TOULOUSE III-PAUL SABATIER (Toulouse, FR)
- Centre National De La Recherche Scientifique (Paris, FR)
Inventors
Cpc classification
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
Providing Nuclear factor (erythroid-derived 2)-like 2 (NRF2)-activated genes products, e.g. SOD1 and CAT, in their use in the prognosis of an OPA1 gene- or OPA1 gene product-deficit-induced disease, or related complications, e.g. optic atrophy and optic neuropathy, in a biological sample selected from fibroblasts, epithelial cells, blood samples or a mixture thereof, of a patient affected or suspected to be affected by the disease.
Claims
1. A method for the in vitro diagnosis and treatment of OPA1-deficit induced autosomal dominant optic atrophy (DOA, OMIM# 165500) and/or a complication associated with OPA1-deficit induced DOA selected from DOA plus syndrome disorders in a subject, comprising measuring in a biological sample selected from the group consisting of fibroblasts, epithelial cells, blood samples and mixtures thereof, of said subject, expression and/or activity of a Nuclear Factor (erythroid-derived 2)-like 2 (NRF2)-activated gene product selected from the group consisting of NRF2, SOD1, SOD2, catalase, GSTP1, NQO1, Glutathione Reductase, Peroxiredoxin 1, Hemeoxigenase 1, Thioredoxin reductase 1, and Glutamate Cystein Ligase, comparing said expression and/or activity measured in said biological sample of said subject to that of a measured expression and/or activity of a same NRF2-activated gene product in a biological sample selected from the group consisting of fibroblasts, epithelial cells, blood samples and a mixture thereof taken from a control subject, determining that said expression and/or activity measured in said biological sample from said subject is lower than said measured expression and/or activity in said biological sample from said control subject, and concluding said subject as suffering from said OPA1-deficit induced DOA and/or said complication associated with OPA1-deficit induced DOA, administering to said subject suffering from said OPA1-deficit induced DOA and/or said complication associated with OPA1-deficit induced DOA a treatment comprising administering at least one compound selected from the group consisting of Glutathione, Vitamin A, Vitamin C, Vitamin E, Coenzyme Q10 and Coenzyme Q10 analogs, Manganese, Iodide, Carotenoid terpenoids, Natural phenols, Phenolic acids and their esters, nonflavonoid phenolics, organic antioxidants selected from the group consisting of Capsaicin, Bilirubin, oxalic acid, phytic acid, N-Acetylcysteine, R--Lipoic acid, and fat and water soluble Uric acid, ARE inducers selected from the Sulforafane, Nordihydroguaiaretic acid, Diallyl Sulfid, Diallyl disulfid, Diallyl trisulfid, Pterostilbene, 1,2-dithiole-3-thione (D3T), 5,6-dihydro-cyclopento-(c)-1,2-dithiole-(4H)-thione (CPDT), Oltipraz, Salicylcurcuminoids, BG12, and Bardoxolonemethyl, and combinations thereof.
2. The method according to claim 1, wherein said DOA plus syndrome disorders are selected from the group consisting of external ophthalmoplegia, ataxia, deafness, glaucoma, Primary Open Angle Glaucoma, myopathy, peripheral neuropathy, and neurodegenerative diseases related to the age.
3. The method according to claim 1, wherein said control subject is one of: (i) a healthy subject not suffering from said OPA1-deficit induced DOA and/or said complication associated with OPA1-deficit induced DOA and having the same age as said subject, or (ii) said subject for whom said expression and/or activity has been previously measured.
4. The method according to claim 3 wherein said control subject is said subject for whom said expression and/or activity has been previously measured the said previous measure being performed at birth of said subject.
5. The in vitro method according to claim 1 wherein the biological sample of said subject is not an invasive sample obtained from a retina or an optic nerve.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) The present invention provides a prognostic biomarker of an OPA1 gene- or OPA1 gene product-deficit-induced disease, or related complications.
(2) A prognostic biomarker is a biomarker that provides information on the likely course of the disease in an untreated individual.
(3) The present invention also provides a predictive biomarker of an OPA1 gene- or OPA1 gene product-deficit-induced disease, or related complications.
(4) A predictive biomarker is defined as a marker, which can be used to identify subpopulations of patients who are most likely to respond to a given therapy.
(5) The present invention provides a factor involved the cellular response to oxidative stress for its use in prognosis of an OPA1 gene- or OPA1 gene product-deficit-induced disease, or related complications using a sample containing fibroblasts, epithelial cells or a blood sample in a patient suspected to be affected by said disease.
(6) The present invention relates to SOD1, SOD2, catalase and aconitase as effective predictive markers for prognosing an optic neuropathy, in particular an OPA1 mutation-induced optic neuropathy, a phase of worsening of the pathological condition, the extend to which the pathological condition may worsen.
(7) Biology tests on the search for mutations of an OPA1 gene present in the samples of individuals with retinopathy or suspected to be at risk for DOA may be performed at the same time as prognosis.
(8) The OPA1 gene codes a 960 amino acids protein, and is described in WO0227022, which is incorporated herein by reference. OPA1 gene, as used herein encompasses, except where otherwise specified, an OPA1 gene of a human being, including a normal OPA1 gene, the various forms of OPA1 gene, its functional equivalents and any mutant or deleted form of the OPA1 gene.
(9) Normal OPA1 gene, as used herein encompasses an OPA1 gene which, upon transcription and translation, gives rise to a normal OPA1 polypeptide, expressed at a normal level for example a form or level of expression of the gene found in a subject who does not have clinically and molecularly diagnosed autosomal dominant optic atrophy.
(10) OPA1 peptide, OPA1 protein and OPA1 gene product are used herein interchangeably and encompass, except where otherwise specified, a peptide encoded by the coding sequence of any OPA1 gene, including a normal OPA1 gene and any mutant or deleted form of the gene, any forms of the OPA1 gene and including any fragment of less than full length and including any immature peptide.
(11) Defective OPA1 gene is taken herein to mean an OPA1 gene comprising one or more mutations, which may be in the coding sequence or in a control sequence, which cause the gene product of the gene not to carry out its normal function and/or cause the gene product to be produced at so low a level that it does not carry out its function effectively.
(12) NRF2 (Nuclear Factor-Erythroid-derived 2-like 2) is a transcription factor that in humans is encoded by the NFE2L2 gene (SEQ ID No: 11). NRF2 regulates the transcriptional activation of antioxidant and protective genes, including its own transcription.
(13) In the present invention, a complication means extra-ocular attempts and includes but is not limited to neuromuscular complications, deafness, chronic progressive external ophthalmoplegia, myopathy and neuropathy.
(14) Examples of NRF2 activated antioxidant proteins include heme oxygenase 1, superoxide dismutase, in particular superoxide dismutase 1 or 2 (SOD1 or SOD2) glutathione S-transferase (GST), and NAD(P)H dehydrogenase quinone 1 (NQO1).
(15) Examples of NRF2-activated factors are selected from NFR2, superoxide dismutase 1 (SOD1) (SEQ ID No 1), superoxide dismutase 2 (SOD2) (SEQ ID No 2), catalase (CAT) (SEQ ID No 3), glutathione S-transferase pi 1 (GSTP1) (SEQ ID No 4), NAD(P)H dehydrogenase quinone 1 (NQO1) (SEQ ID No 5), glutathione reductase (GSR) (SEQ ID No 6), thioredoxin reductase 1 (TXNRD1) (SEQ ID No 7), Peroxiredoxin (SEQ ID No 8), heme oxygenase (decycling) 1 (HMOX1) (SEQ ID No 9), glutamate-cysteine ligase modifier subunit (GCLM) (SEQ ID No 10).
(16) Gene, as used herein, includes the coding sequence, non-coding introns, and upstream and downstream control elements of a gene.
(17) Diagnosis means the determination of the affection of a person suffering from a given disorder or suspected to develop a given disorder.
(18) Prognosis means the degree of seriousness indicative of the subsequent development/evolution of a disorder and/or of complications.
(19) Therapeutic refers to the preventive, curative or palliative treatment offered to an individual.
(20) DOA and ADOA are used herein interchangeably. In the very early stages, eye affection is difficult to detect and it is not easy to determine the speed and extent of progression of the disease.
(21) A biological sample is a sample obtained from an individual for the purpose of detecting, screening/diagnosis/follow-up of OPA1-deficiency induced disease, preferably DOA, evaluating DOA development, complications or glaucoma.
(22) In a preferred embodiment said sample is a biological sample selected from a sample containing fibroblasts, preferably skin fibroblasts or epithelial cells or a blood sample, or a mixture thereof.
(23) A patient is an individual with a least one alteration of the OPA1 gene or OPA1 gene product. A patient may be an asymptomatic patient, namely a patient with no symptoms or signs of DOA or of DOA complications.
(24) A patient suspected to be affected is a patient suffering at least one symptom or sign of DOA or of DOA complications who may or may not be diagnosed with DOA or DOA plus syndrome, said patient is a patient for whom none of the known mutation of OPA1 and responsible for DOA, has been detected yet and having at least one mutation of said gene(s).
(25) A patient according to the invention may be an individual suspected to develop a disease related to OPA1 deficiency or deficit, in particular DOA, DOA plus syndrome, a complication related to DOA.
(26) As used here a patient may also be an individual diagnosed with glaucoma or suspected to have glaucoma, in particular glaucoma related to an OPA1-gene deficit, a more particularly a patient with primary open angle glaucoma.
(27) A nucleotide sequence is a sequence of nucleotide patterns, i.e. a sequence of nucleic acids or polynucleotides or fragments thereof.
(28) The structures and modifications of these sequences are either natural or the result of genetic recombination or chemical synthesis.
(29) According to this invention, an amplification primer is a nucleic sequence including 10 to 200 nucleotide patterns, preferably 15 to 25 base pairs of at least one target sequence of genetic material.
(30) Hybridisation is a process by which two nucleic sequences, such as for instance a primer and a target sequence, are linked.
(31) A hybridisation probe is a nucleic sequence of 15 to 200 nucleotide patterns, preferably 100 to 190 base pairs of at least one target sequence of genetic material. The probe has hybridisation specificity so that it hybridises with the target nucleic sequence, not with other sequences.
(32) The present inventors have focused their search on assays of specific proteins or nucleic acids of a specific NRF2-activated gene or genes products in a biological sample selected from a sample containing fibroblasts, epithelial cells, a blood sample, a mixture thereof, in order to create a biomarker for the detection of DOA, in particular DOA prognosis.
(33) For example, the presence of aconitase mRNA or protein directly in a biological sample, or the presence of NRF2-activated genes products mRNA or protein in the sample of a patient.
(34) As an illustration, they have been able to show that the aconitase protein could be detected directly in fibroblasts of an individual with DOA.
(35) The expression of NRF2 in individuals with DOA or ADOA associated with complications and in healthy individuals. The data shows that the expression of the SOD gene product in individuals with DOA, is significantly lower than in healthy individuals or individuals DOA without complications.
(36) Further, the method according to the invention also relates to the use of nucleotide sequences of a target sequence, particularly those of the SOD1, SOD2, catalase, aconitase gene, or a mixture thereof which may be used as amplification primers or hybridisation probes for the purposes of detection and/or prognosis and/or follow up of individuals suffering from DOA.
(37) Advantageously, the invention also relates to a kit for the diagnosis/prognosis/follow-up of DOA comprising at least one means for detection of OPA1 deficiency and at least one means for the detection of NRF2-activated gene product.
(38) More advantageously, the invention relates to a kit for the diagnosis/prognosis/follow-up of DOA comprising at least one means for the detection of the activity of NRF2-activated gene product, at least one means for the detection of the activity of human aconitase.
(39) This invention offers a method, process, test and kit for DOA for the purpose of prognosis, diagnosis based on the detection of at least one specific biomarker in material taken from a biological sample which is a sample containing fibroblast, epithelial cells, of blood cells.
(40) General Procedures
(41) Mice of the ENU: B6;C3-Opa.sup.1329-355delStrain and wt control mice were described elsewhere (Alavi et al., 2007). Briefly, Mice were kept in a 12 h light (10 lux)/12 h dark cycle with food and water available ad libitum in full-barrier facilities free of specific pathogens.
(42) Cell
(43) Skin or blood samples, epithelial cells of DOA patients and of healthy controls may be obtained during routine diagnostic procedures with their informed consent. Sampling sites may include the trunk, hand, knee, arm, and mouth. Samples are snap-frozen in liquid nitrogen and processed for RNA isolation as outlined below.
(44) Fibroblasts, obtained from DOA patients or from healthy volunteers after obtaining their informed consent, were cultured in Dulbecco's Modified Eagle's Medium 4.5 g/l glucose (DMEM, Invitrogen), supplemented with 10% FCS, penicillin (100 U/ml) and streptomycin (100 mg/ml) and maintained for up to 20 passages.
(45) Epithelial cells obtained from DOA patients or from healthy volunteers after obtaining their informed consent, were cultured in Dulbecco's Modified Eagle's Medium 4.5 g/l glucose (DMEM, Invitrogen), supplemented with 10% FCS, penicillin (100 U/ml) and streptomycin (100 mg/ml) and maintained for up to 10 passages.
(46) HeLa cells, (transformed human epithelial cells) from the American Type Culture Collection (Manassas, Va.) were cultured in Dulbecco's Modified Eagle's Medium 4.5 g/l glucose (DMEM, Invitrogen), supplemented with 10% FCS, penicillin (100 units/ml) and streptomycin (100 mg/ml), in an incubator at 37 C. and 5% CO.sub.2. HeLa cells were electroporated using Cell line kit R (Amaxa, Lonza) with 1.5 g of control siRNA (D-001210-02, Dharmacon Research) or human OPA1 siRNA (D-005273-03, target sequence AAAGAAGGCUGUACCGUUA, (SEQ ID No 25) Dharmacon Research) per 1.10.sup.6 cells.
(47) Cortical neurons were obtained at embryonic Day 17 from pregnant Wistar rats (Janvier) under intraperitoneal pentobarbitol (Sigma) anaesthesia. All animals (n=45, 350 embryos) in this study were ethically maintained and used. Cortices were dissected, enzymatically dissociated with papain (10 U/ml, Sigma), and exposed for 5 min in a solution that inactivated papain: DNAse I (Invitrogen) and B27 (Gibco), diluted in PBS 1 with D-Glucose (33 mM, Sigma). Cells were dissociated by trituration and filtered through a membrane (70 m, BD Falcon). Cells were then purified through a BSA solution (8%, Sigma) diluted in Neurobasal A-25 (Invitrogen). Dishes, with or without glass cover-slips, were coated with poly-D-lysine (0.1 mg/ml, Sigma) 24 h prior to culturing. For each experiment, cortices from 8 to 12 embryos per rat are mixed. Experiments were reproduced three to eight times. Cultures were grown in Neurobasal (Eurobio) supplemented with B27 (Invitrogen), 2 mM glutamine, 0.1% penicillin and streptomycin (Gibco), 250 U/ml amphotericin (Invitrogen) and 1 mM lactic acid (Sigma) at a density of 6.10.sup.5 cells per cm.sup.2.
(48) Neurons (5.10.sup.6) were electroporated after dissociation using the Rat Neuron Nucleofector Kit (Amaxa, Lonza) using an optimized protocol for primary rat cortical neurons (http://bio.lonza.com/fileadmin/groups/marketing/Downloads/Protocols/Generate d/Optimized_Protocol_101.pdf). Three micrograms of control luciferase-targeting (D-001210-02, Dharmacon Research) or OPA1-targeting (target sequence GAUUGUGCCUGACUUUAUA, Dharmacon Research (SEQ ID No 26) small interfering RNA (Dharmacon).
(49) Measurement of Oxygen Consumption
(50) Oxygen consumption rates (OCR) were performed using the XF24 Extracellular Flux Analyser (Seahorse Bioscience, North Billerica, Mass.). HeLa cells (15.10.sup.3) or neurons (3.10.sup.5) transfected with control siRNA or siRNA targeting OPA1 were plated on XF24 microplates, respectively 3 days or 6 days before OCR measurements. Dual-analyte sensor cartridges were soaked in XF Calibrant Solution (Seahorse Biosciences) in 24 well cell culture microplates overnight at 37 C. to hydrate. Approximately one hour prior to experimentation, three of four injection ports (A, B and C) on the sensor cartridge were filled with oligomycin (A: 0.6 M for neurons, 1 M for HeLa cells), Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) (B: 6 M for neurons, 1 M for HeLa cells) or rotenone (C: 50 nM for neurons, 1 M for HeLa cells) with antimycin A (C: 0.182 M for neurons and 1 M for HeLa cells). The plate was the loaded into the XF24 instrument for calibration. For oxygen consumption measurement, growth media of neurons or HeLa cells were replaced one hour before experimentation with incubation media, which consisted of DMEM supplemented with NaCl (143 mM), PhnolRed (3 mg/ml), glucose (10 mM), glutamine (2 mM) and pyruvate (2 mM) at pH 7.4, and kept at 37 C. in a non-CO2 incubator until the completion of sensor cartridge calibration. The XF24 microplate was then loaded into the Seahorse XF24 analyser following the manufacturer's instructions. All experiments were carried out at 37 C.
(51) Immunoblot Analysis
(52) Cells were lysed for 30 min in a buffer containing 50 mM Tris-HCL pH 7.5, 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 1 mM Dithiothreitol, 0.1% Triton X-100, 0.1% SDS, 1% Deoxycholate, 1% NP40 plus protease inhibitors (<<Complete>> protease inhibitor mixture, Roche Applied Science). Cell lysates were centrifuged at 14,000 rpm at 4 C. for 10 min. The supernatant corresponding to total proteins was obtained and protein concentration was determined using the Bradford Protein-assay (Bio-Rad). 100 g proteins were separated by SDS-PAGE (8-15%) and transferred to nitrocellulose membranes (Whatman, Protran). Free binding sites were blocked with 5% non fat dry milk, 0.2% Tween 20 in Tris Buffer Saline 1 pH 7.6 (blocking buffer). The membranes were probed with a primary antibody (anti-OPA1 (1/300, BD-Biosciences), anti-actin (1/25000, Chemicon), anti-HSP60 (1/8000, Sigma), anti-citrate synthase (1/3000, Abcam), anti-OXPHOS (1/200, Mitosciences), anti-NDUFB4 (1/500, Mitosciences), anti-NDUFA9 (1/100, Mitosciences), anti-SDHA (1/1000, Abcam), anti-Core 1 (1/500, Invotrogen), anti-COXIV (1/250, Cell Signaling Technology), anti-ATP5C1 (1/500, Abgent), anti-ATP5H (1/2000, Abcam), anti-aconitase (1/500, Abcam), anti-SOD1 and anti-SOD2 (1/2000, Epitomics), anti-catalase (1/3000, Abcam)) and incubated overnight at 4 C. in blocking buffer. After chemiluminescent detection of horseradish peroxidase-conjugated secondary antibody (1/10000, Abcam), scanned photographic films were analysed using ImageJ software.
(53) Immunocytochemistry
(54) Cells were fixed with PBS 1 containing 3.7% formaldehyde for 20 min.
(55) Cells were permeabilized for 5 min in PBS 1, 0.25% to 0.3% Triton X-100 optionally 1% bovine serum albumin, and incubated for 10 min at 20 C. with methanol prior to nuclear NRF2 detection. Nonspecific binding sites were blocked with 3% BSA in PBS 1 optionally comprising containing 5% normal goat serum, and/or 0.5% Tween 20 for 15-30 min to 1 hour at room temperature. Optionally Methanol fixation (10 min, 20 C.) was performed prior to nuclear NRF2 detection.
(56) Cells were immunostained with rabbit polyclonal anti-NRF2 antibody (1/50, Santa Cruz Biotechnology) for 1 h at 37 C. or with Polyclonal antibodies against NRF2 (1/50, Santa Cruz Biotechnology) incubated overnight at 4 C. in blocking solution.
(57) Cells were then incubated with Alexa fluor 488-conjugated secondary antibodies (1/300, Molecular Probes), labelled with 0.25 g/ml Hoechst in PBS 1 over 5 min and mounted in Mowiol. Immunolabelling was visualized under a fluorescence microscope (Nikon Eclipse 80i or Zeiss 710 Big) and images were acquired using NIS-Element (Nikon Digital Sight DUS2 camera) or ZEN 2011 software. Cells with accumulation of NRF2 staining in nucleus were counted by stack with Hoechst labelling nucleus using ImageJ software. Nucleus raw integrated densities (sum of pixel values) of NRF2 by m.sup.2 in neurons were measured using ImageJ software and confocal images.
(58) RT-PCR
(59) RNA Extraction
(60) The detection of the presence of RNA from a biological sample requires the extraction of total RNA from the said sample.
(61) Such extraction is carried out by any protocol for the extraction of nucleic acid from biological samples of a type known in itself. This step of purification consists in separating the nucleic acid from the other constituents and concentrating it.
(62) For example, the biological sample may be blood (5 ml), which is then centrifuged at 1200 g for 10 minutes at 4 C. In that way, the serum is separated before the total RNA is extracted.
(63) The extraction of total RNA may be carried out, for instance, using the RNeasy kit from Qiagen in accordance with the manufacturer's recommendations.
(64) The RNA samples are then stored at 80 C. until use.
(65) Of course, those skilled in the art know how to adapt the extraction, purification and preservation of nucleic acids depending on the biological samples from which they are derived.
(66) Nucleic acids circulating in the free state, that is extracellular nucleic acids, it is not necessary to lyse the circulating cells. That results in a simpler process that is less time consuming and is less expensive.
(67) Reverse Transcription
(68) Total RNA (1 g) was reverse-transcribed with a RevertAid First-Strand cDNA Synthesis kit (Fermentas, St. Leon-Rot, Germany) using oligo(dT) primers.
(69) Primers against the housekeeping gene product -actin were 5-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3 (sense) and 5-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3 (antisense). (SEQ ID No 13 and SEQ ID No 14).
(70) Negative controls with RNA instead of the complementary DNA (cDNA) templates were consistently negative.
(71) The relative intensity of the bands may be assessed using ImageQuant 5.0 software (Molecular Dynamics, Sunnyvale, Calif.) followed by normalization for -actin.
(72) PCR (Polymerase Chain Reaction) Amplification of the cDNA.
(73) The process of amplification by enzymatic polymerisation (targeted in vitro replication technique called PCR or Polymerase Chain Reaction) makes it possible to obtain, from a sample containing cDNA, important quantities of a specific DNA fragment, such as a prognostic marker, with a definite length by using a pair of nucleotide primers.
(74) This step is carried out with the help of amplification primers in order to generate amplicons of at least one target sequence of the nucleic material and a control target.
(75) The said primer and/or said probe include at least 10 nucleotide from a sequence selected from: a sequence from any one of SEQ ID No 1 to 12; or their complementary sequences; a homologous sequence of SEQ ID nos. 1 to 12 complementary or sufficiently complementary; or sufficiently homologous to hybridise with SEQ ID nos. 1 to 12 or their complementary sequences;
(76) The primer sequences and/or probes of a nucleotide sequence of the studied genes are designed from: SEQ ID No 1: Homo sapiens superoxide dismutase 1, soluble (SOD1), SEQ ID No 2: Homo sapiens superoxide dismutase 2, mitochondrial (SOD2), SEQ ID No 3: gi|262331523:5001-38136 Homo sapiens catalase (CAT), RefSeqGene on chromosome 11 SEQ ID No 4: Homo sapiens glutathione S-transferase pi 1 (GSTP1), RefSeqGene on chromosome 11 SEQ ID No 5: Homo sapiens NAD(P)H dehydrogenase, quinone 1 (NQO1), RefSeqGene on chromosome 16 SEQ ID No 6: Homo sapiens glutathione reductase (GSR), RefSeqGene on chromosome 8 SEQ ID No 7: Homo sapiens thioredoxin reductase 1 (TXNRD1), RefSeqGene on chromosome 12 SEQ ID No 8: Homo sapiens Peroxiredoxin SEQ ID No 9: Homo sapiens heme oxygenase (decycling) 1 (HMOX1), RefSeqGene on chromosome 22 SEQ ID No 10: Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM), RefSeqGene on chromosome 1 SEQ ID No 11: Homo sapiens NRF2 (NFE2L2) SEQ ID No 12: Homo sapiens aconitase 2, mitochondrial (ACO2)
(77) These primers are designed so as to overlap the splice junction in order to eliminate the signals generated by genome contamination.
(78) As an illustration, conventional PCR may be carried out with the Eppendorf MasterMix kit according to the manufacturer's recommendations or using any method known in itself.
(79) Adapted PCR cycle may be used to carry out the gene amplification of any specific sequence using a thermal cycler (for example Perkin Elmer). The primer hybridisation temperature must be calculated depending on the Tm of each primer.
(80) Alternatively, when the mRNA from a biological sample is to be analysed, reverse transcription and PCR (RT-PCR) may be carried out simultaneously in one step. One-step RT-PCR may be carried out using, for example, the kits Super Script One-Step RT-PCR and Platinum tag from Invitrogen in accordance with the manufacturer's recommendations. The RT-PCR reaction will also be carried out with a thermal cycler (for example Perkin Elmer).
(81) For each PCR test, or RT-PCR test negative controls (with no nucleic acid) and positive controls (for example from a plasmid encoding the beta actin gene) are carried out in parallel.
(82) The PCR may be quantitative. In this way, the SYBR green technique may be used, based on the standard curve obtained from plasmids encoding the studied gene.
(83) Quantitative RT-PCR is carried out with the help of the QuantiTect SYBR Green PCR Master Mix kit from Qiagen in accordance with the manufacturer's recommendations.
(84) Detection
(85) During the target nucleic acid detection step, use may be made of a specific detection probe.
(86) The hybridisation probe is a detection probe and is labelled for further detection.
(87) Functional primers may be analysed with a fluorochrome or another fluorescent or quencher that links specifically with the amplification product (double-strand DNA).
(88) To avoid primer dimers, a specific TaqMan probe may be linked to the sense and antisense primers.
(89) To correct any possible variability of the enzymatic efficiency, the expression of a target gene may be standardised by determining a ratio between the target gene and a housekeeping gene (NADPH or -actin for example), the expression of which is required and common in all individuals. The primers of housekeeping genes and particularly NADPH are for instance:
(90) TABLE-US-00001 senseprimer (SEQIDNo23) 5 AAAGGACATTTCCACCGCAAA3 antisenseprimer (SEQIDNo24) 5 GGTCGGGTCAACGCTAGGCT3
Step of Detection and Quantification
(91) For example, the products of PCR or amplicons may be separated by electrophoresis on 1.0% agarose gel, and then seen by illumination under UV after staining the DNA with ethidium bromide.
(92) The expected fragment is identified by the co-migration of a molecular size marker.
(93) Of course, the method according to the invention may be combined with or include other molecular markers in order to further increase its sensitivity and specificity depending on the condition to be searched.
(94) This invention further makes it possible to improve the screening strategy and the treatment of early forms of DOA or DOA related complications.
(95) ROS Measurement
(96) Reactive oxygen species levels were measured using the fluorescent dye 2,7-dichlorodihydrofluorescein diacetate (CM-H.sub.2DCFDA, Molecular Probes) at 4 M for 30 min at 37 C. or the fluorescent dye MitoSox (Molecular Probes) according to the manufacturer's recommendations.
(97) Glutathione Levels
(98) Cells were mixed with 200 l of 5% metaphosphoric acid were then centrifuged 1,500 g at 4 C. during 10 min. Final supernatant was used for glutathione assay (reduced GSH and oxidized GSSG measurements) which is performed by reverse-phase high-performance liquid chromatography (HPLC) as previously described in Anne Galinier et al., 2006 which is incorporated herein by reference.
(99) Enzymatic Activities
(100) Superoxide dismutase (SOD) activities (Mn SOD2, Cu/Zn SOD1 or SOD3) were assayed by using the inhibition of pyrogallol auto-oxidation. One enzymatic unit of SOD activity was defined as the amount of enzyme that inhibited pyrogallol auto-oxidation by 50% Galinier). Briefly, the assay principle is based on the self-oxidation of pyrogallol property in the presence of EDTA, the reaction inhibited by SOD. The assay is based on competition between the reaction of oxidation of pyrogallol by the ROS and by dismutation of SOD. An enzyme unit is defined as the amount of enzyme able to inhibit 50% of the oxidation of pyrogallol in assay conditions.
(101) Determination of Pyrogallol Volume Required for the Assay
(102) Optic density (OD) of the pyrogallol at 420 nm should be 0.022 maximum in Tris-DTPA. This represents the maximum absorbance at 0% inhibition. Thus, OD in 1.9 ml of buffer is read using 30 to 50 l of pyrogallol (10 mM). The reading is taken exactly 45 seconds after agitation of the tank by flipping and for 2 minutes. The required volume of pyrogallol (volume x) is fixed and will be the same throughout the assay.
(103) Catalase activity was determined by measuring decomposition of H.sub.2O.sub.2 at 240 nm as previously described in described in (Galinier) incorporated herein by reference. Briefly, cells were lysed in 100 l of Assay Buffer solution (assay the activity of aconitase, Bioxitech kit) using the Tissue Lyse (Qiagen) (2 minutes at 25 beats per minute). OD measurement is read from 1 ml of an H2O2 solution (19 mM final) diluted in 1PBS and 20 l of lysed sample added 60 s after reading 240 nm. The OD is measured at 25 C. for 4 minutes every 20 seconds. Part of the sample was used for protein dosage by assay microplate.
(104) Data are analyzed as a function of the time of reading, slope of the curve is calculated using the 4 to 6 last points of the curve using the following formula: OD1000/(43.60.920 l0.001 protein amount in g). Activity is expressed in moles of decomposed H.sub.2O.sub.2 per minute and per mg of protein.
(105) Aconitase activity measurements was performed using a protocol already described in the article of Anne-Laure Colombani et al., 2009, which is incorporated herein by reference.
(106) Aconitase activity was determined using a kit (Bioxitech 21041) and measured by spectrophotometry using a lysate of HeLa or neuronal cells, in OPA1 or mock-depleted cells according to the instruction of the manufacturer.
(107) Colorimetric Assay
(108) Briefly, samples were lysed in 250 ml of Assay Buffer solution using a Tissue Lyser (Qiagen) (2 minutes at 25 beats per minute). Aconitase activity was measured in a vessel containing 200 l of lysed sample, 200 l of substrate, 200 l of enzyme and 200 l of NADP Enzyme Reagent. Part of the sample was used for protein content determination by microplate assay. The Optic density (OD) was read at 340 nm for samples zero (base line) (Buffer alone) and the positive control, mouse liver (200 l of lysed liver as a sample) for 40 minutes at 37 C.
(109) Data Analysis
(110) After drafting the Graph OD versus time reading, the slope of the curve is determined (OD16 min OD15 min . . . ) on a number of points and the average value is calculated. The activity of aconitase is calculated using the following formula: (Average OD/(2.44356.220.001 amount of protein in g)4. The activity is expressed in milli unit enzymes micrograms of protein.
(111) Statistical Analysis
(112) Data were analyzed using paired student's t-test by systematic comparison between control small interfering RNA and small interfering RNA against OPA1. Oxygen consumption rates between siControl and siOPA1 treated cells were investigated using an unpaired student's t-test. Nucleus NRF2 raw integrated densities in control or OPA1 depleted-cells were carried out with a non-parametric test (Mann-Whitney test). *p<0.05, **p<0.01, ***p<0.001.
(113) The results explained below are illustrative of comparison experiments carried out and are not limitative in any case.
(114) In
(115) In
(116) In
(117) In
(118) In
(119) In
EXAMPLES
Example 1
(120) Cellular Antioxidant Defences are Impaired in Fibroblasts of DOA Patients
(121) To address the question of antioxidant defences in DOA patients' fibroblasts, the expression and activity of several genes or gene products according to the invention were measured in fibroblasts from healthy volunteers and DOA patients (table 1).
(122) TABLE-US-00002 TABLE 1 Characteristics of healthy volunteers with no OPA 1 gene- or no OPA1 gene product deficit (age, gender) and characteristics patients P1 to P8 used for measure of expression level of SOD1 and SOD2 in FIGS. 1A and 1B (age, gender, DNA change, protein mutation, exon, symptoms). Healthy Age volunteers (year) Gender C1 43 M C2 28 M C3 25 |F C4 new M born C5 DOA Age DNA change/ patients (year) Gender variant 1 Protein mutation Exon Disease (symptoms) P1 20 M c.1770 G > C splicing defect p? Exon 18 DOA P2 11 F c.1334_G > A p.R445H Exon 14 DOA plus syndrome with deafness P3 16 F c.1146_A > G p.I382M Exon 12 DOA and deafness P4 51 F c.2708_2711del p.(Val903Glyfs*3) Exon 27 DOA P5 30 F c.1334_G > A p.R445H Exon 14 DOA plus syndrome with deafness P6 44 M c.1937_C > T p.S646L Exon 20 DOA and multiple sclerosis P7 10 M c.1146_A > G p.I382M Exon 12 DOA and ataxia P8 35 M c.1635_C > G p.S545R Exon 17 DOA plus syndrome and ataxia
(123) The level of mRNA expression, level of protein expression and activity (when accurate) of the following biomarker: NRF2, Superoxide dismutase 1 (SOD1) (SEQ ID No 1), superoxide dismutase 2 (SOD2) (SEQ ID No 2), catalase (CAT) (SEQ ID No 3), glutathione S-transferase pi 1 (GSTP1) (SEQ ID No 4), NAD(P)H dehydrogenase quinone 1 (NQO1) (SEQ ID No 5), glutathione reductase (GSR) (SEQ ID No 6), thioredoxin reductase 1 (TXNRD1) (SEQ ID No 7), Peroxiredoxin (SEQ ID No 8), heme oxygenase (decycling) 1 (HMOX1) (SEQ ID No 9), glutamate-cysteine ligase modifier subunit (GCLM) (SEQ ID No 10), aconitase 2 (SEQ ID No 12) were analyzed in biological samples or DOA patients and compared to the level of mRNA expression, level of protein expression and activity of the same marker in healthy volunteers.
(124) The results show that some DOA patients showed altered expression of antioxidant proteins.
(125) The data show heterogeneity in the level of expression of antioxidant proteins among DOA patients and allow differentiating a subgroup of patients with a reduced level of SODs (
(126) As an example, patients P1, P3, P5, and P7 express particularly low levels of SOD1 and SOD2 proteins (
(127) More precisely, the data show heterogeneity in the level of expression of antioxidant proteins among DOA patients.
(128) The data allow differentiating two subgroups of patients with respect to the level of SOD1 and SOD2 proteins (
(129) Statistical difference was analyzed with a Mann and Whitney statistical test p=0.0159 for SOD1 and SOD2 corresponding to subgroup B.
(130) The rates of expression of antioxidant proteins described above were not correlated with the age or sex of patients but may be correlated with progression of the disease (Table 1).
(131) Patients from subgroup A present (table 1): either a strict DOA disease that means a light DOA phenotype without neurological complications, such as patient P4, this sort of patients only present optic nerve atrophy; or a DOA plus syndrome (multi-syndromic DOA) which corresponds to patients, such as P2, P6 and P8, presenting related complications, in particular additional neurological complications, such as ataxia, sensorineural deafness, multiple sclerosis, chronic progressive external ophtalmoplegia (CPEO) and sensory-motor neuropathy and myopathy in adult life.
(132) For patients presenting a DOA plus syndrome, such as patients P2, P6 and P8, the DOA plus syndrome is not associated to the modulation of expression and the activity of NRF2-activated genes products.
(133) For these patients of subgroup A, the disease and/or related complications are not worsened with respect to the antioxidant mechanism related to the NRF2 activation, because the expression and the activity of NRF2-activated genes products are not modulated by OPA1 gene or OPA1 gene product deficit. Thus, these patients can overcome oxidant stress caused by the inactivation of OPA gene.
(134) For these patients, the phenotype of the disease and/or related complications could be worsened by other genes able to modify the phenotype.
(135) Patients from subgroup A can present a strict DOA disease that means a light DOA phenotype without neurological complications, such as patient P4, this sort of patients only present optic nerve atrophy. On fundus examination, the optic disk typically presents a bilateral and symmetrical pallor of its temporal side, witnessing the loss of RGC (retinal ganglionic cells) fibers entering the optic nerve.
(136) For patients presenting a DOA plus syndrome, such as patients P2, P6 and P8, the DOA plus syndrome is not associated to the decrease of SOD1 and SOD2 expressions.
(137) For these patients of subgroup A, the disease and/or related complications are not worsened with respect to the antioxidant mechanism related to the NRF2 activation, because the expressions of SOD1 and SOD 2 are not modulated by OPA1 gene or OPA1 gene product deficit. Thus, these patients can overcome oxidant stress caused by the inactivation of OPA gene.
(138) For these patients, the phenotype of the disease and/or related complications could be worsened by other genes able to modify the phenotype.
(139) Patients from Subgroup B Present (Table 1): either a strict DOA disease that means a light phenotype of DOA disease without neurological complications, such as patient P1, this sort of patients only present optic nerve problems; or a DOA plus syndrome (multi-syndromic DOA) which corresponds to patients, such as P3, P5 and P7, presenting related complications, in particular additional neurological complications, such as ataxia, sensorineural deafness, multiple sclerosis, chronic progressive external ophtalmoplegia (CPEO) and sensory-motor neuropathy and myopathy in adult life.
(140) For these patients of subgroup B, the disease and/or related complications are worsened with respect to the antioxidant mechanism related to the NRF2 activation, because the expression and the activity of NRF2-activated genes products are modulated by OPA1 gene or OPA1 gene product deficit. Thus, these patients cannot overcome oxidant stress caused by the inactivation of OPA gene.
(141) For these patients of subgroup B, the disease and/or related complications are worsened with respect to the antioxidant mechanism related to the NRF2 activation, because the expression and the activity of NRF2-activated genes products are decreased by OPA1 gene or OPA1 gene product deficit. Thus, these patients cannot overcome oxidant stress caused by the inactivation of OPA gene.
(142) For these patients of subgroup B, the disease and/or related complications are worsened with respect to the antioxidant mechanism related to the NRF2 activation, because the expressions of SOD1 and SOD2 are decreased by OPA1 gene or OPA1 gene product deficit. Thus, these patients cannot overcome oxidant stress caused by the inactivation of OPA gene.
(143) Thus, for this subgroup of patients, a prognosis of a worsening of the disease and/or related complications can be established.
(144) For patients presenting a strict DOA disease that means a light phenotype of DOA disease without neurological complications such as patient P1, the worsening of the disease and/or related complications means that the strict DOA disease evolves to a DOA plus syndrome and/or to related complications.
(145) For patients presenting a DOA plus syndrome which correspond to patients presenting additional neurological complications, the worsening of the disease and/or related complications means that the syndrome and/or the related complications are worsened.
(146) For example, the worsening of the disease and/or related complications means that: for a patient suffering from DOA plus syndrome with a loss of visual acuity, the worsening of this complication can lead to the blindness; for a patient suffering from DOA plus syndrome with a decline in hearing, the worsening of this complication can lead to deafness.
(147) The worsening of the complications also means that a patient presenting a sort of complications, can present in addition another sort of complications.
(148) For example, a patient suffering from DOA plus syndrome with ataxia, can present DOA plus syndrome with ataxia and deafness.
(149) The antioxidant machinery was analysed in DOA patients and healthy volunteers fibroblasts. The results in
(150) The present invention provides SOD1 as a predictive biomarker for DOA, and SOD2 as another predictive biomarker for DOA. Within the group of DOA patient, a group of DOA patients showing an increased altered expression of antioxidant genes can be identified. This group corresponds to patients that experienced worsening of the disease.
(151) The present invention provides SOD1 as a predictive biomarker for DOA, and SOD2 as another predictive biomarker for DOA. Within the group of DOA patient, a group of DOA patients showing a decreased altered expression of antioxidant genes can be identified. This group corresponds to patients that experienced worsening of the disease and/or related complications.
(152) Thus, OPA1 mutations and/or decreased quantity in OPA1 induce an imbalance in the cellular redox state, weakening cells to exogenous pro-oxidative stresses. This phenomenon is one of the keys of the molecular mechanisms involved in DOA pathogenesis. The present invention provides a simple means of prognosis for OPA1-deficiency induced disease in human. The present invention provides a marker of prognosis selected from SOD1, Catalase, Aconitase, preferably SOD1, more preferably catalase, and even more preferably aconitase and SOD1, easily detectable in fibroblasts, blood cells or epithelial cells.
Example 2
(153) To support these data and complete these results, the impact of OPA1 lowering on mitochondrial respiration oxidative metabolism in rat cortical neurons in primary culture and human epithelial HeLa cells was investigated.
(154) In both cellular models, cellular respiration is diminished when OPA1 is decreased (
(155) Modulation of OPA1 Expression
(156) Both neurons and HeLa cells were transfected with siRNA directed against OPA1 (siOPA1) or against control RNA (siCtrl). OPA1 protein level relative to actin level was analysed by immunoblot. In neurons in primary culture treated with siOPA1, a decrease of 60% in OPA1 quantity was observed at 6 days after transfection (
(157) In HeLa cells, OPA1 quantity is decreased of about 90% 72 hours after transfection (
(158) Respiration is Impaired in OPA1 Down-Regulated Cells
(159) The effect of OPA1 reduction levels on mitochondrial respiration was investigated using Seahorse XF24 analyzer (Seahorse Bioscience). In all conditions, rotenone and antimycin treatment drastically inhibited OCR showing that more than 95% of oxygen consumption was due to mitochondrial respiration (
(160) In both siOPA1 transfected neurons (
(161) Thus, depletion of OPA1 both in neurons and HeLa cells induced a drastic decrease in spontaneous and maximal mitochondrial respiration without affecting the mitochondrial biomass (
(162) Total ATP cellular concentration did not vary in these conditions (data not shown). Furthermore, no difference in the total intracellular levels of NADH, H.sup.+/NAD.sup.+ was evidenced between siOPA1 and siCtrl treated HeLa cells (data not shown). The experiment suggests there is no major disruption of TCA cycle and furniture in NADH, H.sup.+ to MRC in OPA1 siRNA treated HeLa cells (data not shown).
(163) OPA1 Down Regulation Induces an Imbalance of the Redox State.
(164) Total ROS content was measured with the H.sub.2DCFDA probe. As in siOPA1 treated neurons, a 24% decrease in ROS levels was observed in OPA1 down-regulated HeLa cells 72 hours after transfection (
(165) Aconitase activity was reduced both in siOPA1 treated HeLa cells and siOPA1 treated neurons of 33.8% and 26.8% respectively (
(166) This drop could not be attributed to change in proteins quantities since aconitase protein levels are unchanged in HeLa cells and neurons (
(167) Aconitase activity was previously shown to be highly sensitive to oxidation due to damaged FeS core and an inhibition of its activity is usually used as a signature of an increased production of mitochondrial ROS. The observed total ROS decrease with an increased production of mitochondrial ROS suggested an implementation of antioxidant response. To verify this hypothesis, expression of a redox state marker, glutathione, was measured. In siOPA1 treated neurons the ratio between reduced (GSH) to oxidized (GSSG) glutathione increased by 220.2% (
(168) NRF2 Pathway is Activated upon Down Regulation of OPA1
(169) Since NRF2 pathway accounts for a great part of oxidative stress response, it was asked whether this transcription factor could be involved in the response to oxidative metabolism imbalance due to a drop of OPAL Intra-cellular localisation of NRF2 was detected.
(170) 72 hours after transfection, 68% of siOPA1 treated HeLa cells presented a NRF2 nuclear localisation whereas only 15% of siCtrl-treated HeLa cells relocalised their NRF2 in the nucleus (
(171) The increase of nuclear translocation of NRF2 leads to an increase of the expression of NRF2.
(172) Moreover as NRF2 is one of the NRF2-activated gene products, the nuclear translocation of NRF2 leads to an increase of cell expression of NRF2.
(173) The nuclear factor NRF2 is, at the inactive state, blocked into the cell cytoplasm thanks to a cytoplasmic anchorage (KEAP1 protein). When a signal, such as an increase of the ROS, there is a dissociation between KEAP1 and NRF2. NRF2 is then translocated to the nucleus, where it is going to transactivate the expression of the target genes.
(174) The present invention provides NRF2 as a predictive biomarker for DOA.
(175) An increase of both catalase quantity (88%) and activity (66%) were revealed in neurons (
(176) Similar results were obtained for GSTP1.
Example 3
(177) OPA1 Transgenic Mice Present an Imbalanced Oxidative Metabolism as Compared to Wild Type Mice of the Same Age
(178) Cortices from 4 and 10 months old transgenic mice were analyzed for their oxidative metabolism and contents in antioxidant defenses. Aconitase activity, which is a sensor of mitochondrial ROS production, was detected. A 63% inhibition of aconitase activity was measured in 4 months old OPA1 transgenic mice and a 43% inhibition in 10 months old OPA1 transgenic mice compared to litter mate mice (
(179) Data obtained in OPA1-deficit induced disease in mice confirmed that aconitase, catalase, or SOD1 (not shown) are biomarkers of disease progression (
Example 4
(180) RT-PCR
(181) Total RNA was isolated from samples, epithelial cells, fibroblasts or red blood cells, using ABI Prism Nucleic Acid PrepStation (PE Applied Biosystems, Foster City, Calif., USA) according to manufacturer recommendations.
(182) Briefly, cells were washed twice in calcium/magnesium-free phosphate-buffered saline (PBS) and then lysed with 2 nucleic acid purification lysis solution at the final concentration of 1 with calcium/magnesium-free PBS. Lysed samples were transferred to a 96-well purification tray and placed on the instrument consisting of a specific membrane that physically captures the RNA passing through with wash solutions under precisely controlled vacuum conditions. A Method of isolation of total RNA from Cultured cells was run. The isolated RNA was eluted in 100 l Nucleic Acid Purification Elution Solution.
(183) Total RNA may also be isolated from cells using an RNeasy Mini kit (Qiagen, Hilden, Germany); RNA from human samples, skin fibroblast epithelial cell or red blood cells may be derived using TRIzol (Invitrogen, Karlsruhe, Germany). DNA digestion is performed on RNeasy columns using the RNeasy-Free DNase set (Qiagen).
(184) Total RNA (1 g) was reverse-transcribed with a RevertAid First-Strand cDNA Synthesis kit (Fermentas, St. Leon-Rot, Germany) using oligo(dT) primers.
(185) Primers against the housekeeping gene product -actin were 5-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3 (sense) and 5-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3 (antisense), (SEQ ID No 13 and 14).
(186) Negative controls with RNA instead of the complementary DNA (cDNA) templates were consistently negative.
(187) The relative intensity of the bands may be assessed using ImageQuant 5.0 software (Molecular Dynamics, Sunnyvale, Calif.) followed by normalization for -actin.
(188) Real-time PCR is carried out by real-time fluorescence detection using ABsolute SYBR Green ROX Mix (Thermo Fisher Scientific, Epsom, UK) in a total volume of 20 l with the PCR MasterMix (Applied Biosystems, Foster City, Calif.) and with a 200 nM concentration of each primer.
(189) For an initial step of diagnosis of OPA1 deficit or mutation the following sequences may be used:
(190) TABLE-US-00003 (SEQIDNo35) K1S 5-CACCCAGCTTATCTTGCAAGTG-3, (SEQIDNo36) K1AS 5-AAAGCGCCCGTAACATACATCG-3, (SEQIDNo37) K2S 5-AAACATCTACCTTCCAGCTGCG-3, (SEQIDNo38) K2AS 5-TGGATCTACTTCTACTCCTCGG-3, (SEQIDNo39) K3S 5-GTCAAATGGACCCTCATGGAAG-3 (SEQIDNo40) K3AS 5-CCCAAGCAACCTCTACTGCTTT-3, (SEQIDNo41) K4S 5-TGGAAATGATTGCCCAAGCTCG-3 (SEQIDNo42) K4AS 5-CAATGCTTTCAGAGCTGTTCCC-3 (SEQIDNo43) K5S 5-GGATTGTGCCTGACATTGTG-3 (SEQIDNo44) K5AS 5-CACTCAGAGTCACCTTAACTGG-3 (SEQIDNo45) K8S 5-CTGTGAGGTCTGCCAGTCTTTA-3 (SEQIDNo46) K8AS 5-GCTTGTCACTTTCAGATCCACG-3.
(191) Experimental conditions were as previously described in Delettre C, Griffoin J M, Kaplan J, Dollfus H, Lorenz B, Faivre L, Lenaers G, Belenguer P, Hamel C P. Mutation spectrum and splicing variants in the OPA1 gene. Hum Genet. 2001 December; 109(6):584-91. Epub 2001 Oct. 30. Incorporated herein by reference.
(192) Primers for human SOD1 RT-PCR were synthesized as follows:
(193) TABLE-US-00004 forward (SEQIDNo19) 5TTGGGCAAAGGTGGAAATGAA-3 and reverse (SEQIDNo20) 5-CACCACAAGCCAAACGACTT-3,
(194) Primers for human CATALASE RT-PCR were as follows:
(195) TABLE-US-00005 forward SEQIDNo21 5-GTCTGTGTGAGAACATTGCC-3 and reverse SEQIDNo22 5-ATGTGGCTCCCGTAGTCAG-3
(196) Primers against human heme oxygenase-1 [HO-1] were previously disclosed (Colombrita C, Lombardo G, Scapagnini G, Abraham N G. Heme oxygenase-1 expression levels are cell cycle dependent. Biochem Biophys Res Commun 2003; 308: 1001-1008) incorporated herein by reference or were designed with Primer Express software (Applied Biosystems) taking into account mono or multi spliced mRNA.
(197) Primer sequences were as follows for human SOD2:
(198) TABLE-US-00006 (SEQIDNo17) 5-GGACAAACCTCAGCCCTAACG-3 (forward) and (SEQIDNo18) 5-TTTGATGGCTTCCAGCAACTC-3 (reverse).
(199) The following primers may be used for human NQO1:
(200) TABLE-US-00007 SEQIDNo25 5-CATTCTGAAAGGCTGGTTTGA-3 (forward) SEQIDNo26 5-TTGCAGAGAGTACATGGAGC-3 (reverse)
(201) The following primers may be used for human GSTP1
(202) TABLE-US-00008 SEQIDNo27 5-GCAGGAGGGCTCACTCAAA-3 (forward) SEQIDNo28 5-AGGTGACGCAGGATGGTATT-3 (reverse)
(203) The degenerate oligonucleotide primers used for aconitase and RT-PCR conditions were previously described in Duroy A. Navarre, David Wendehenne.sup.2, Jrg Durner.sup.3, Robert Noad and Daniel Klessig. Plant Physiology February 2000 vol. 122 no. 2 573-582. Experimental conditions were as previously described in this reference which is incorporated herein by reference.
(204) The following primers may be used for human GCLC:
(205) TABLE-US-00009 SEQIDNo29 5-TGCTGTCTTGCAGGGAATGT-3 (forward) SEQIDNo30 5-CACAACCATCCACCACTGC-3 (reverse)
(206) The following primers may be used for human Glutathione Reductase:
(207) TABLE-US-00010 SEQIDNo31 5-ATCCCAACTGTGGTCTTCAG-3 (forward) SEQIDNo32 5-CACGTTGAATAGGTCTTCACA-3 (reverse)
(208) The following primers may be used for human NRF2:
(209) TABLE-US-00011 SEQIDNo33 5-TTCCTCTGCTGCCATTAGTCAGTC-3 (forward) SEQIDNo34 5-GTCCTTCCATTTCCG-AGTCACTG-3 (reverse).
(210) Reactions were performed in duplicate in an ABI Prism 7300 sequence detector (Applied Biosystems).
(211) Experimental conditions for these experiments were as previously described in Paupe V, Dassa E P, Goncalves S, Auchre F, Lnn M, Holmgren A, Rustin P. Impaired nuclear Nrf2 translocation undermines the oxidative stress response in Friedreich ataxia. PLoS One. 2009; 4(1):e4253. doi: 10.1371/journal.pone.0004253. Epub 2009 Jan. 22;
(212) Cheng Z G, Zhang G D, Shi P Q, Du B S. Expression and antioxidation of
(213) Nrf2/ARE pathway in traumatic brain injury; Asian Pac J Trop Med. 2013 Apr. 13; 6(4):305-10. doi: 10.1016/S1995-7645(13)60061-9; and
(214) Kurzawski M, Dziedziejko V, Urasiska E, Post M, Wjcicki M, Mitkiewski J, Drodzik M. Nuclear factor erythroid 2-like 2 (Nrf2) expression in end-stage liver disease. Environ Toxicol Pharmacol. 2012 July; 34(1):87-95. doi: 10.1016/j.etap.2012.03.001. Epub 2012 Mar. 11; and incorporated herein by reference.
(215) For SOD1 or SOD2, under the following conditions: initial activation for 2 minutes at 50 C., denaturation for 15 minutes at 95 C., followed by 40 cycles of 15 seconds at 95 C. and 60 seconds at 60 C., and a final cycle of 15 seconds at 95 C., 15 seconds at 60 C., and 15 seconds at 95 C. Gene expression levels of each sample were quantified according to the comparative threshold cycle (C.sub.t) method 2-.sub.t (Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-.sub.T Method. Methods 2001; 25: 402-8), using GAPDH as an internal standard. For each condition, the ground condition was set as 1.
(216) Expression of each gene was assessed by 3 independent PCR analyses. Significance of the data was determined by Student's t-test.
(217) The RNA was reverse-transcribed and PCR-amplified by using the ImProm-II Reverse Transcription System and Pfu DNA polymerase (Promega, Madison, Wis.).
(218) The products of PCR were separated by electrophoresis on 1.0% agarose gel, and then detected by blue light illumination after staining the DNA with SYBR Safe DNA stain (invitrogen).
(219) The data show a significant modulation in the expression of NRF-2 activated genes in fibroblasts when patient were going to experience a worsening phase of DOA.
Example 5
(220) OPA1 Transgenic Mice Present an Imbalanced Oxidative Metabolism as Compared to Wild Type Mice of the Same Age
(221) Cortices from 10 and 15 months old transgenic mice were analyzed for their oxidative metabolism and contents in antioxidant defenses. Aconitase activity, which is a sensor of mitochondrial ROS production, was detected. A significant inhibition of aconitase activity was measured in 10 months old OPA1 transgenic mice and a significant inhibition in 15 months old OPA1 transgenic mice compared to litter mate mice (
(222) Next, the rate of expression of SOD1 (
Example 6
(223) Results are also obtained on the prognosis of the progression of OPA1 gene or OPA1 gene product deficit-induced disease of transgenic OPA1+/ mice. and wild type mice by analysis of the amounts of SOD1, SOD 2 and catalase in their retina.
(224) Results are also obtained on new born transgenic OPA1+/ mice and wild type new born mice by analysis of the amounts of SOD1, SOD2 and catalase in their cortices and retina.
(225) Results are also obtained on patients in term of phenotype and analysis of kinetics of patients for whom the phenotype has already been determined.
REFERENCES
(226) Alavi, M V,_ Stefanie Bette,_ Simone Schimpf, Frank Schuettauf, Ulrich Schraermeyer, Hans F. Wehrl, Lukas Ruttiger, Susanne C. Beck, Felix Tonagel, Bernd J. Pichler, Marlies Knipper, Thomas Peters, Juergen Laufs and Bernd Wissinger. A splice site mutation in themurine Opa1 gene features pathology of autosomal dominant optic atrophy Brain (2007), 130, 1029{circumflex over ()}1042.
(227) Amati-Bonneau P, Milea D, Bonneau D, Chevrollier A, Ferre M, Guillet V, et al. OPA1-associated disorders: phenotypes and pathophysiology. The international journal of biochemistry & cell biology. 2009; 41(10): 1855-65.
(228) Bosch et al., 2014. The American Journal of Human Genetics, Volume 94, Issue 2, 303-309, 23 Jan. 2014.
(229) Cohn A C, Toomes C, Potter C, Towns K V, Hewitt A W, Inglehearn C F, et al. Autosomal dominant optic atrophy: penetrance and expressivity in patients with OPA1 mutations. American journal of ophthalmology. 2007; 143(4):656-62.
(230) Colombani, Anne-Laure.2009. Dysfonctionnement du glucose sensing crbral. Altration de la signalisation redox dans l'hypersensibilit hypothalamique au glucose chez le rat Zcker obse. 196 p
(231) Delettre C.sup.1, Lenaers G, Griffoin J M, Gigarel N, Lorenzo C, Belenguer P, Pelloquin L, Grosgeorge J, Turc-Carel C, Perret E, Astarie-Dequeker C, Lasquellec L, Arnaud B, Ducommun B, Kaplan J, Hamel C P. Nuclear gene OPA1, encoding a mitochondrial dynamin-related protein, is mutated in dominant optic atrophy. Nat Genet. 2000 October; 26(2):207-10.
(232) Koopman W J, Distelmaier F, Smeitink J A, Willems P H. OXPHOS mutations and neurodegeneration. The EMBO journal. 2013; 32(1):9-29.
(233) Lenaers G, Hamel C, Delettre C, Amati-Bonneau P, Procaccio V, Bonneau D, et al. Dominant optic atrophy. Orphanet journal of rare diseases. 2012; 7:46.
(234) Osellame L D, Blacker T S, Duchen M R. Cellular and molecular mechanisms of mitochondrial function. Best practice & research Clinical endocrinology & metabolism. 2012; 26(6):711-23.
(235) P Reynier.sup.1,*, P Amati-Bonneau.sup.1,*, C Verny.sup.2, A Olichon.sup.3, G Simard.sup.1, A Guichet.sup.7, C Bonnemains.sup.7, F Malecaze.sup.4, M C Malinge.sup.7, B Pelletier.sup.7, P Calvas.sup.6, H Dollfus.sup.5, .sup.3, Y Malthiry.sup.1, G Lenaers.sup.3, D Bonneau.sup.7 2004. Med Genet; 41:cl10 doi:10.1136/jmg.2003.016576
(236) Yu-Wai-Man P, Griffiths P G, Burke A, Sellar P W, Clarke M P, Gnanaraj L, et al. The prevalence and natural history of dominant optic atrophy due to OPA1 mutations. Ophthalmology. 2010; 117(8):1538-46, 46 el.
(237) Yu-Wai-Man P, Griffiths P G, Gorman G S, Lourenco C M, Wright A F, Auer-Grumbach M, et al. Multi-system neurological disease is common in patients with OPA1 mutations. Brain: a journal of neurology. 2010; 133 (Pt 3):771-86.
(238) Yu-Wai-Man P, Trenell M I, Hollingsworth K G, Griffiths P G, Chinnery P F. OPA1 mutations impair mitochondrial function in both pure and complicated dominant optic atrophy. Brain: a journal of neurology. 2011; 134 (Pt 4):e164.
(239) Zeviani M. OPA1 mutations and mitochondrial DNA damage: keeping the magic circle in shape. Brain: a journal of neurology. 2008; 131 (Pt 2):314-7.