Recombinant baculovirus and method for using the same for preparing recombinant adeno-associated virus vector

10501758 ยท 2019-12-10

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombinant baculovirus, including: an adeno-associated virus Rep gene, an adeno-associated virus Cap gene, and an recombinant adeno-associated virus genome ITR-GOI (gene of interest) flanked by rAAV inverted terminal repeats (ITR). The ITR-GOI includes a 5 terminal nucleic acid fragment and a 3 terminal nucleic acid fragment. The ITR-GOI is linked to an expression cassette of the Cap gene and an expression cassette of the Rep gene through the 5 terminal nucleic acid fragment and the 3 terminal nucleic acid fragment, respectively.

Claims

1. A recombinant baculovirus, comprising: an adeno-associated virus (AAV) Rep gene, an AAV Cap gene, and a recombinant adeno-associated virus (rAAV) genome ITR-GOI (gene of interest) flanked by AAV inverted terminal repeats (ITR); wherein: the ITR-GOI comprises a 5 terminal nucleic acid fragment and a 3 terminal nucleic acid fragment; and the ITR-GOI is linked to an expression cassette of the Cap gene and an expression cassette of the Rep gene through the 5 terminal nucleic acid fragment and the 3 terminal nucleic acid fragment, respectively.

2. The recombinant baculovirus of claim 1, wherein the Rep gene has a codon-optimized sequence.

3. The recombinant baculovirus of claim 2, wherein the Rep gene has the sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

4. The recombinant baculovirus of claim 1, wherein the Cap gene has a codon-optimized sequence.

5. The recombinant baculovirus of claim 4, wherein the Cap gene has the sequence represented by SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

6. The recombinant baculovirus of claim 1, wherein each of two ends of the rAAV genome ITR-GOI comprises an inverted terminal repeat (ITR) of the adeno-associated virus genome; and the gene of interest (GOI) is disposed between the two ends of the ITR-GOI.

7. The recombinant baculovirus of claim 1, wherein the inverted terminal repeat (ITR) has a sequence represented by SEQ ID NO: 7.

8. The recombinant baculovirus of claim 1, wherein the 5 terminal nucleic acid fragment and the 3 terminal nucleic acid fragment have a length of 80-140 bp.

9. The recombinant baculovirus of claim 1, wherein the 5 terminal nucleic acid fragment and the 3 terminal nucleic acid fragment have a sequence represented by SEQ ID NO: 8 or SEQ ID NO: 9.

10. The recombinant baculovirus of claim 1, wherein the adeno-associated virus is adeno-associated virus serotype 2.

11. A method for preparing a recombinant adeno-associated vims vector, the method comprising: (a) constructing a baculovirus by integrating a target gene into a genome of the recombinant baculovirus of claim 1; (b) infecting an isolated host cell with the baculovirus of (a) to produce a recombinant adeno-associated virus; and (c) purifying the recombinant adeno-associated virus of (b).

12. The method of claim 11, wherein in (a), a shuttle vector based on a baculovirus expression system is used.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of a recombinant baculovirus;

(2) FIG. 2A is a schematic diagram of a packing process of a rAAV;

(3) FIG. 2B is a schematic diagram of a shuttle plasmid pFast. Bac. Dual (pFBD) of the baculovirus expression system;

(4) FIG. 2C is a schematic diagram of the structure of a recombinant shuttle plasmid integrated with the components required for producing rAAV;

(5) FIG. 2D is a schematic diagram of the process for producing rAAV by infecting Sf9 cells with the recombinant baculovirus;

(6) FIG. 3A is a schematic diagram of fluorescence microscopy images of a control group of the Sf9 cell;

(7) FIG. 3B is fluorescence microscopy images of the experimental group three days after infecting Sf9 cells with the recombinant baculovirus in Examples 1-3;

(8) FIG. 4A is a verification result of rAAV prepared according to combination 1 in infecting HEK293 cells and Sf9 cells;

(9) FIG. 4B is a verification result of rAAV prepared according to combination 2 in infecting HEK293 cells;

(10) FIG. 4C is a verification result of rAAV prepared according to combination 3 in infecting HEK293 cells;

(11) FIG. 5A is a TEM image after rAAV particles are negatively dyed;

(12) FIG. 5B is an enlarged view (2.5 times) of FIG. 5A;

(13) FIG. 6A is fluorescence microscopy images of HEK293 cells infected with purified rAAV;

(14) FIG. 6B is fluorescence microscopic images of the C57 mice hippocampal cortical neurons of mice infected with purified rAAV; and

(15) FIG. 6C is an enlarged view of FIG. 6B (2 times).

DETAILED DESCRIPTION OF THE EMBODIMENTS

(16) To make the objectives, technical solutions, and advantages of the invention more comprehensible, the disclosure is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely used to explain the invention, and are not intended to limit the invention. In addition, the technical features involved in the various embodiments of invention described below can be combined with each other as long as the two do not conflict with each other.

(17) The recombinant baculovirus of the invention has a genome as shown in FIG. 1, which is preferably AcMNPV clone E2 (genome sequence of Genbank accession No. KM667940.1, see, Journal of Virology, August 1993, p. 4566-4579) or AcMNPV clone C6 (genome sequence of Genbank accession No. NC_001623.1) integrated with the Rep gene, the Cap gene, and rAAV genome ITR-GOI. The baculovirus AcMNPV is double-stranded circular DNA of 133,894 bp. The sequence and mapping references is described in Virology, 1994. 202 (2): p. 586-605, and the structure of AcMNPV Bacmid (bMON14272) is described in J Virol, 1993. 67 (8): p. 4566-79. The Rep gene, the Cap gene, and the ITR-GOI were inserted into the Tn7 site of bacmid (bMON14272). The Rep gene and the Cap gene are optimized based on ribosomal leaky scanning principle. The rAAV genome ITR-GOI comprises a pair inverted terminal repeats (ITR) of AAV genome at two ends and a gene of interest (GOI) in the middle, and is linked to an expression cassette of the Rep gene and the Cap gene through a 5 terminal nucleic acid fragment or a 3 terminal nucleic acid fragment. The Rep gene and the Cap gene can be upstream or downstream of the ITR core expression cassette.

(18) The Rep gene is codon-optimized based on ribosomal leaky scanning principle, and can be transcribed into an mRNA by the PH promoter to achieve the functional expression of the Rep72 and Rep52. The sequence of Rep gene is one of SEQ ID Nos. 1 to 3.

(19) The Cap gene is codon-optimized based on ribosomal leaky scanning principle, and can be transcribed into an mRNA through the P10 promoter to achieve functional expression of the three capsid proteins of VP1, VP2, and VP3 near the natural ratio (1:1:10). The sequence of the Cap gene is one of SEQ ID Nos. 4 to 6.

(20) The ITR-GOI is linked to the expression cassette of the Rep gene and the Cap gene by the ligation nucleic acid fragments at both ends. ITR is a terminal inverted repeat of the AAV genome, preferably the ITR sequence of AAV type 2 as SEQ ID No. 7. The 5 or 3 terminal nucleic acid fragment is preferably a ligation nucleic acid sequence of between 80 bp-140 bp, represented by SEQ ID No. 8 or SEQ ID No. 9. The ITR-GOI core expression cassette is a GFP gene expression cassette containing a CMV promoter, a GFP gene, and a ploy A (PA) component.

(21) The preferred combination of the Rep, the Cap, and the ITR-GOI integrated into the baculovirus genome is shown in FIG. 2C.

(22) The recombinant baculovirus of the invention is prepared as follows:

(23) A. The codon-optimized Rep and Cap genes are obtained by gene synthetic methods; The ITR-GOI is obtained by conventional molecular cloning techniques; and

(24) B. The Rep gene, the Cap gene, and the ITR-GOI obtained in step A are integrated by molecular cloning into pFast. Bac. Dual (pFBD) shuttle vector according to the Bac to Bac system to obtain the recombinant baculovirus.

(25) The genomic DNA of rAAV vector contains exogenous gene of interest which replaces the AAV coding gene and the ITR sequences which is required for virus replication and packaging. The Rep gene and the Cap gene and helper virus functions were supplied by trans-compensation for the production of rAAV, as shown in FIG. 2A. It is very difficult to integrate the Rep gene, the Cap gene, and ITR-GOI into single baculovirus. First, the cloning combination and operation of the three elements are complicated and difficult. Second, each of the three elements has a key role in the successful production of rAAV, and the combination of the three elements cannot disrupt the function of each other. Therefore, in traditional methods, the three elements are either separately integrated into host cells or baculoviruses. The invention optimized the sequences of the Rep gene and the Cap gene and constructed the ligation sequences at the two ends of the ITR-GOI so as to integrate the Rep gene, the Cap gene, and the ITR-GOI into pFBD shuttle vector and maintain the biological function of the three elements, thereby achieving large-scale production of rAAV of stable quality. As such, by replacing the exogenous gene of interest (GOI) fragment carried by the ITR-GOI or replacing the Cap gene or Rep gene of AAV of different serotype, rAAV can be flexibly produced to meet the requirement.

(26) The recombinant baculovirus of the invention for producing the recombinant adeno-associated virus vector for gene therapy is prepared as follows:

(27) (1) constructing a recombinant baculovirus by integrating AAV Rep gene, Cap gene, and rAAV genome ITR-GOI contained a functional gene in the genome of the recombinant baculovirus;

(28) Preferably, the recombinant baculovirus of the invention uses the pFast. Bac. Dual (pFBD) shuttle vector as a backbone carrier (as shown in FIG. 2B) and contains three optimized functional components (as shown in FIG. 2C), and takes advantage of the Bac to Bac system;

(29) (2) infecting a host cell with the recombinant baculovirus prepared in the step (1) to produce a large amount of recombinant adeno-associated virus; Specifically, the following steps are performed: infecting Sf9 insect cells with the recombinant baculovirus (BEV) (as shown in FIG. 2D); suspension cultured Sf9 cells in shake flasks to a cell density of 310.sup.6 cells/ml; infecting the Sf9 cells with recombinant baculovirus (BEV) at a multiplicity of infection (MOI) of 5, shaking culturing the infected cells at 27 C., 120 rpm for 3 days; centrifuging cell suspension at 3000 rpm for 5 minutes, and collecting culture supernatant and cell pellet; and

(30) (3) purifying the recombinant adeno-associated virus prepared in step (2).

(31) rAAV is mainly present in cell pellets. The rAAV produced can be used for further application after separation and purification operations.

(32) The Bac-A system of the invention utilizes a recombinant baculovirus to provide the replication, packaging elements for rAAV production and the ITR-GOI, resulting in a higher percentage of intact rAAV particles and high virus quality. Moreover, the rAAV production capacity of a single cell has also been obviously improved. The Bac-A system has high flexibility, high versatility, high virus quality, and high yield, which is suitable for large-scale production and can effectively solve the problem of large-scale preparation of rAAV.

(33) The disclosure is applicable to various types of adeno-associated virus. The following examples are based on adeno-associated virus type 2 (AAV2):

Example 1: Preparation and Amplification of Recombinant Baculovirus (BEV)

(34) The pFast. Bac. Dual (pFBD) shuttle vector in Bac to Bac baculovirus expression system was used for integrating the three major components required for the preparation of rAAV, i.e., the Cap gene, the Rep gene, the ITR-GOI, in a recombinant baculovirus. In the example, the Rep gene based on AAV type 2 has a sequence which is a codon-optimized sequence based on ribosomal leaky scanning principle, and the Rep gene was under the control of PH promoter to achieve the functional expression of Rep72 and Rep52. The Rep gene sequence is represented SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3 (corresponding to RepA, RepB, and RepC, respectively). In the example, the Cap gene based on AAV type 2 was codon-optimized based on the ribosomal leaky scanning principle. The Cap gene was under the control of the P10 promoter to achieve expression of the capsid proteins of VP1, VP2, and VP3 near natural ratio (1:1:10). The Cap gene sequence is SEQ ID No. 4, SEQ ID No. 5, or SEQ ID No. 6 (corresponding to CapA, CapB, and CapC, respectively). The ITR use the ITR nucleic acid sequence of AAV type 2, i.e., the sequence of SEQ ID No. 7. The ITR-GOI contains expression cassette of green fluorescent protein (GFP), the expression of which is controlled by CMV promoter so as to detect rAAV activity. The ITR-GOI is linked to the expression cassettes of the Rep gene and the Cap gene via a 5 terminal nucleic acid fragment or a 3 terminal nucleic acid fragment. The 5 terminal nucleic acid fragment or the 3 terminal nucleic acid fragment is a sequence of SEQ ID No. 4 (link A) or SEQ ID No. 5 (link B).

(35) In the example, three representative combinations of the major components of the recombinant baculovirus were selected;

(36) 1. CapA-LinkA-(ITR-GFP)-linkA-RepA

(37) 2. CapB-LinkB-(ITR-GFP)-linkB-RepB

(38) 3. CapC-LinkA-(ITR-GFP)-linkB-RepC

(39) A recombinant shuttle plasmid pFBD/Cap-(ITR-GFP)-Rep was constructed by placing the ITR-GFP between the P10 and PH promoters of the pFBD vector by ligating the nucleic acid fragments according to the conventional molecular cloning technique as shown in FIG. 2C.

(40) The sequence of P10 promoter is:

(41) TABLE-US-00001 (SEQIDNo.10) ATACGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAA GAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTA AATTACATTTTATTTACAATCACTCGAC

(42) The sequence of PH promoter is:

(43) TABLE-US-00002 (SEQIDNo.11) ATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTA TTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATAT TCCGGATTATTCATACCGTCCCACCATCGGGCGC

(44) The sequence between P10 promoter and PH promoter is

(45) TABLE-US-00003 (SEQIDNo.12) ACTCCGGAATATTAATAG

(46) The recombinant shuttle plasmid was transformed into DH10Bac containing the AcMNPV baculovirus genome according to the Bac-to-Bac system protocol. Recombinant baculovirus genome (Bacmid) was obtained by Tn7 transposon element-mediated recombination. Positive bacteria containing recombinant Bacmid were obtained by blue-white screening and PCR identification. Recombinant Bacmid was extracted and purified and transfected into adherently cultured Sf9 cells. Sf9 cells were completely infected with recombinant baculovirus and showed obvious cytopathic effect (CPE). The cell culture was centrifuged at 3000 rpm for 5 min, and the resulting recombinant baculovirus was present in the supernatant.

(47) The supernatant was used to infect adherently cultured Sf9 cells and cultured for 3 days. The control group of uninfected Sf9 cells were in the normal state without GFP expression (as shown in FIG. 3A), while the Sf9 cells infected by the BEV of combinations 1, 2, and 3 had a significant CPE phenomenon and obvious GFP expression, as the results shown in FIG. 3B, showing that the combinations successfully produced recombinant baculovirus. BEV produced from transfected Sf9 cells was used to infect adherently cultured or suspension cultured Sf9 cells, and the infected Sf9 cells showed CPE after 3 days; then the cell culture fluid was centrifuged at 3000 rpm for 5 min, and the BEV supernatant was obtained. The titer of the BEV was determined by the method of Fluorescent Quantitative PCR. See, Proc Natl Acad Sci USA, 2009. 106 (13): 5059-64.

Example 2: Production of rAAV Via Infecting the Sf9 Cell Line with BEV and Verification of Virus Activity Thereof

(48) The Sf9 cells cultured in suspension were infected with BEV prepared in Example 1 at MOI=5. Three days after infection, the cell culture was centrifuged at 3000 rpm for 5 minutes to collect the culture supernatant and the cell pellet. The BEV was released mainly into the supernatant of the medium by secretion, and some of the un-released BEV was also present in Sf9 cells. The rAAV was mainly present in the nuclei of Sf9 cells, and some of the rAAV was released into the supernatant because of the cytopathic effect (CPE) after infection of Sf9 cells. As a result, BEV and rAAV were present in both culture supernatants and cell pellets.

(49) The activity of the rAAV produced by Sf9 cells infected with the recombinant baculovirus was tested. For the combination 1 of Example 1, the experimental results of virus infection of HEK293 cells and Sf9 cells confirmed that the Bac-A system produced rAAV. The experimental results are shown in FIG. 4A. The detailed process and the results are as follows: The cell pellets were lysed by freeze-thaw using liquid nitrogen and a 37 C. water bath for three times, then centrifuged at 5000 rpm for 5 min and supernatant of cell lysis was collected. Because rAAV was enveloped, its activity was not affected by heating at 60 C. for 30 minutes, whereas recombinant baculovirus (BEV) was enveloped and lost its activity after treatment at 60 C. for 30 minutes. A simple infection-based method was used to test the rAAV activity (FIG. 4.A). For rAAV2 (293 cells derived) samples, in 293 cells-based infection assays, both the treated and untreated can express GFP. In Sf9 cells-based infection assays, both the treated and untreated cannot express GFP, it indicates that rAAV2 do not infect Sf9 cells. For BEV/Cap-(ITR-GFP)-Rep supernatant samples, which contain the major secreted BEV and some rAAV. In 293 cells-based infection assays, both the treated and untreated can express GFP, while the GFP expression of the treated decrease significantly, because inactive BEV do not express GFP and only some rAAV can express GFP. In Sf9 cells-based infection assays, the untreated can express GFP, but the treated cannot express GFP. For BEV/Cap-(ITR-GFP)-Rep infected Sf9 cells lysate supernatant samples, which contain some non-secret BEVs and the major rAAV. In 293 cells-based infection assays, both the treated and untreated can express GFP, but GFP expression of the treated decrease slightly. It indicates that there is large amount of rAAVs expressing GFP. In Sf9 cells-based infection assays, the untreated can express GFP, while the treated cannot express GFP (FIG. 4A). The results demonstrate that rAAV2 is successfully generated in the novel BEV infected Sf9 cells.

(50) The HEK293 cells infected with rAAV prepared by using combinations 2 and in Example 1 were tested according to the above method. The experimental results show that the above rAAV infected HEK293 cells have significant GFP expression, as shown in FIGS. 4B and 4C. The above results demonstrate that the Bac-A system produces active rAAV.

Example 3: Purification and Titer Test of rAAV

(51) Since the rAAV prepared via the three combinations in Example 1 is virtually indistinguishable, the rAAV prepared in Example 1 was taken as an example for the subsequent purification of the rAAV produced by the Bac-A system, detection of the activity, and the like.

(52) About 110.sup.8 Sf9 cells was collected after recombinant BEV infection. After adding 10 mL of lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 2 mM MgCl.sub.2, pH 8.0), the cell pellets were lysed by freeze-thaw using liquid nitrogen and a 37 C. water bath for three times, and then centrifuged at 5000 rpm for 5 min. The supernatant was collected, and nuclease Benzonase was added to the supernatant to a final concentration of 50 U/ml. The mixture was incubated in water bath at 37 C. for 60 min. After centrifugation at 5000 rpm for 10 min, the supernatant was collected. The supernatant was extracted with chloroform and the extracted supernatant was further purified by two-phase precipitation with a solution containing 13.2% (NH.sub.4).sub.2SO.sub.4 and 10% PEG8000 (J Virol Methods, 2007. 139 (1): 61-70, J Virol Methods, 2012. 179 (1): 276-80). The two-phase precipitated supernatant was dialyzed and desalted with a PBS solution and concentrated to a final volume of 1 mL by an Amicon ultra-4 (100 kD cutoff) dialysis column and stored at 80 C. after aseptic aliquots. The titer of rAAV was determined by fluorescence quantitative PCR, and the titer unit was expressed as virus genome (VG)/ml.

(53) The rAAV yield of the purification process is shown in Table 1. The experimental results showed that the yield of rAAV in a single Sf9 packaging cell was up to 1.7810.sup.5 VG. After the purification, the recovery rate reached 32.9%.

(54) TABLE-US-00004 TABLE 1 rAAV purification process yield analysis rAAV rAAV Volume concentration amount rAAV Purification step (mL) (VG/mL) (VG) yield (%) Lysate treated 20 8.91 10.sup.11 1.78 10.sup.13 100 supernatant Chloroform treated 20 7.54 10.sup.11 1.51 10.sup.13 84.8 supernatant two-phase 28 4.72 10.sup.11 1.32 10.sup.13 74.2 precipitated supernatant Dialysis treated 1 5.86 10.sup.12 5.86 10.sup.12 32.9 supernatant

Example 4: Electron Microscopy and Integrity Assay of rAAV Particles

(55) A drop of purified rAAV of 10 L was adsorbed on a 200 mesh carbon-coated copper mesh for 5 min, and was then washed 4 times with ultrapure water, and then a drop of 1% uranyl acetate was added. The sample was dried in air for 5 min. Finally, the virus particles were observed by transmission electron microscopy.

(56) The intact rAAV particles were hexagonal uniform particles and the defective rAAV particles that do not contain nucleic acid were dyed in middle part, as shown in FIGS. 5A and 5B. Electron micrographs showed that the ratio of intact rAAV particles was over 75%, and the results between different preparation batches were repeatable.

Example 5: Detection of rAAV Activity at Cell Level In Vitro and in Mouse Brain In Vivo

(57) HEK293 cells were seeded into 96-well plates at 110.sup.4 cells/well and were infected with the purified rAAV of corresponding concentration gradient, and were detected by fluorescence microscopy GFP expression 48 h after infection, as shown in FIG. 6A. Purified rAAV was microinjected into hippocampus area of C57 mice brains. Three weeks after injection, the rat brain sections were taken to observe the rAAV infected mouse brain neurons under a fluorescence microscope. Green fluorescence was GFP expressed after rAAV infection and blue fluorescence was neuronal nuclei labeled with DAPI dye, as shown in FIG. 6B.

(58) The above results show that the rAAV produced by the Bac-A system of the disclosure has high activities both in cultured cells and animal model.

(59) Unless otherwise indicated, the numerical ranges involved in the invention include the end values. While particular embodiments of the invention have been shown and described, it will be obvious to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects, and therefore, the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention.