Camp receptor protein variant and method of producing L-amino acid using the same
11697673 · 2023-07-11
Assignee
Inventors
Cpc classification
C12P13/08
CHEMISTRY; METALLURGY
C12P13/22
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12P13/08
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to a variant of cAMP receptor protein of Escherichia coli with alanine at position 35, a microorganism including the same, and a method of producing an L-amino acid using the same.
Claims
1. A cAMP receptor protein variant, wherein the cAMP receptor protein variant has transcription regulator activity of a cAMP receptor protein, has at least 80% sequence identity to the sequence of SEQ ID NO: 1, and has alanine at the position corresponding to position 35 of SEQ ID NO: 1.
2. A polynucleotide encoding a cAMP receptor protein variant, wherein the cAMP receptor protein variant has transcription regulator activity of a cAMP receptor protein, has at least 80% sequence identity to the sequence of SEQ ID NO: 1, and has alanine at the position corresponding to position 35 of SEQ ID NO: 1.
3. A vector comprising the polynucleotide of claim 2.
4. A microorganism of the genus Escherichia comprising a cAMP receptor protein variant, wherein the cAMP receptor protein variant has transcription regulator activity of a cAMP receptor protein, has at least 80% sequence identity to the sequence of SEQ ID NO: 1, and has alanine at the position corresponding to position 35 of SEQ ID NO: 1.
5. The microorganism of the genus Escherichia of claim 4, wherein the microorganism of the genus Escherichia is E. coli.
6. The microorganism of the genus Escherichia of claim 4, wherein the microorganism of the genus Escherichia produces an L-amino acid.
7. The microorganism of the genus Escherichia of claim 6, wherein the L-amino acid is L-threonine or L-tryptophan.
8. A method of producing an L-amino acid, the method comprising: culturing a microorganism of the genus Escherichia in a medium to produce the L-amino acid, wherein the microorganism comprises a cAMP receptor protein variant, wherein the cAMP receptor protein variant has transcription regulator activity of a cAMP receptor protein, has at least 80% sequence identity to the sequence of SEQ ID NO: 1, and has alanine at the position corresponding to position 35 of SEQ ID NO: 1.
9. The method of claim 8, further comprising collecting the L-amino acid from the microorganism or the medium.
10. The method of claim 8, wherein the L-amino acid is L-threonine or L-tryptophan.
Description
MODE FOR INVENTION
(1) Hereinafter, the present disclosure will be described in more detail with reference to Examples. However, it is apparent to those skilled in the art that these Examples are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these Examples.
Example 1. Preparation of Recombinant Vector pCC1BAC-Crp
1-1. Preparation of Crp Gene Fragment
(2) To obtain about 0.96 kb of a DNA fragment of SEQ ID NO: including crp gene and an expression regulatory region, genomic DNA (gDNA) of a wild-type E. coli W3110 was extracted using a Genomic-tip system of Qiagen (company), and PCR (polymerase chain reaction) was performed using the gDNA as a template and a PCR HL premix kit (manufactured by BIONEER Co., the same applies hereinafter). PCR for amplification of the crp gene fragment was performed using primers of SEQ ID NOS: 6 and 7 for 27 cycles consisting of denaturation at 95° C. for 30 sec, annealing at 56° C. for 30 sec, and elongation at 72° C. for 2 min.
(3) The PCR product was digested with EcoR I, and electrophoresis on a 0.8% agarose gel and elution were performed to obtain a DNA fragment of 0.96 Kb (hereinafter, referred to as “crp fragment”).
(4) TABLE-US-00001 TABLE 1 SEQ Name of ID NO. primer Sequence (5′-3′) 6 crp-F CACGAATTCTTTGCTACTCCACTGCGTCA 7 crp-R ACACGAATTCTTAACGAGTGCCGTAAACG
1-2. Preparation of Recombinant Vector pCC1BAC-Crp
(5) Copycontrol pCC1BAC vector (EPICENTRE, USA) was treated with EcoR I, and electrophoresis on a 0.8% agarose gel and elution were performed to obtain a product, which was then ligated with the crp fragment obtained in Example 1-1, thereby preparing a pCC1BAC-crp plasmid.
Example 2. Preparation of Recombinant Vector pCC1BAC-Crp Variant Library
2-1. Preparation of Mutant Crp Fragment by Error-Prone PCR
(6) PCR was performed using the genomic DNA of a wild-type E. coli W3110 as a template and a diversify PCR random mutagenesis kit (catalog #: K1830-1, Table III, mutagenesis reactions 4) of clonetech. In detail, PCR was performed using the primers of SEQ ID NOS: 6 and 7 as used in Example 1-1 for 27 cycles consisting of denaturation at 94° C. for 30 sec and elongation at 68° C. for 1 min.
(7) The PCR product was digested with EcoR I, and electrophoresis on a 0.8% agarose gel and elution were performed to obtain a mutated crp fragment of 0.96 Kb (hereinafter, referred to as “crp.sup.m fragment”).
2-2. Preparation of Recombinant Vector pCC1BAC-Crp Variant Library
(8) A vector pCC1BAC was treated with a restriction enzyme EcoR I, and then treated with alkaline phosphatase (NEB). The prepared vector was ligated with the crp.sup.m fragment obtained in Example 2-1, and the ligation product was transformed into TransforMax EPI300 Electrocompetent E. coli (EPICENTRE, USA) by electrophoresis. The transformed strain was cultured on an LB solid medium (15 ug/ml) containing chloramphenicol to select colonies. The colonies thus obtained were collected and subjected to plasmid prep, thereby preparing a pCC1BAC-crp.sup.m library.
Example 3. Introduction of Crp Variant Library into Threonine-Producing Stain and Selection of Growth-Improved Strain
3-1. Introduction of pCC1BAC-crp.SUP.m .Library into Threonine-Producing Stain
(9) The pCC1BAC-crp.sup.m library obtained in Example 2 was transformed into electro-competent cells of KCCM10541 which is a threonine-producing microorganism by electroporation. E. coli KCCM10541 (Korean Patent No. 10-0576342) used in this Example is E. coli prepared by inactivating galR gene in an L-threonine-producing E. coli KFCC10718 (Korean Patent No. 10-0058286).
(10) As a control group of the pCC1BAC-crp.sup.m library-introduced microorganism, pCC1BAC-crp was transformed into KCCM10541 in the same manner as above to prepare KCCM10541/pCC1BAC-crp(WT).
3-2. Comparison of Growth Rate of Recombinant Microorganism
(11) An M9 minimal medium containing 1% glucose and 0.2 g/L of yeast extract was dispensed in a deep well microplate, and then the transformant and the control strain prepared in Example 3-1 were seeded thereto, respectively. The strains were cultured using a micro size constant temperature incubator shaker (TAITEC, Japan) under conditions of 37° C. and 200 rpm by an HTS (High Throughput Screening) method for 20 hours, and growth-improved strains were selected. Among them, one kind of strain was finally selected (Table 2).
(12) KCCM10541 strain introduced with the wild-type crp gene showed a slight increase in the OD value due to additional introduction of crp, whereas the growth-improved transformant showed a high OD value after the same culture time, as compared with the wild-type crp-introduced strain. Further, the selected crp variant was subjected to plasmid mini-prep, followed by sequencing analysis. The results are summarized in Table 2.
(13) TABLE-US-00002 TABLE 2 Information of growth-improved transformant after introduction of crp.sup.m library into threonine-producing strain Strain OD600 Variation KCCM10541/pCC1BAC 2.3 — KCCM10541/pCC1BAC-crp(WT) 2.8 — KCCM10541/pCC1BAC-crpTM4 3.5 E35A
3-3. Comparison of Threonine Titer of Recombinant Microorganism
(14) To measure the threonine titer of the recombinant microorganism selected in Example 3-2, the recombinant microorganism was cultured in a threonine titration medium prepared as in the composition of the following Table 3 to examine improvement of L-threonine productivity.
(15) TABLE-US-00003 TABLE 3 Composition of threonine titration medium Composition Concentration (per liter) Glucose 70 g KH.sub.2PO.sub.4 2 g (NH.sub.4).sub.2SO.sub.4 25 g MgSO.sub.4•7H.sub.2O 1 g FeSO.sub.4•7H.sub.2O 5 mg MnSO.sub.4•4H.sub.2O 5 mg Yeast extract 2 g Calcium carbonate 30 g pH 6.8
(16) In detail, each one platinum loop of E. coli KCCM10541/pCC1BAC-crp(WT) and E. coli KCCM10541/pCC1BAC-crpTM4 cultured overnight on an LB solid medium in an incubator at 33° C. was inoculated in 25 mL of the titration medium of Table 3, respectively, and then cultured in an incubator at 33° C. and 200 rpm for 48 hours to compare sugar consumption rates and threonine concentrations.
(17) As a result, as described in the following Table 4, the KCCM10541/pCC1BAC-crp(WT) strain as the control group showed sugar consumption of 26.1 g/L at 24 hours, whereas the mutant crpTM4-introduced strain showed about 16% and 11% improvement in the sugar consumption rate, as compared with the mother strain and the wild-type crp-introduced strain, respectively.
(18) Further, when cultured for 48 hours, the wild-type crp-introduced strain showed 29.0 g/L of L-threonine production, whereas L-threonine production of the mutant strain obtained above was increased up to 31.0 g/L even though the culture speed was increased, showing about 8% and 7% improvement in the concertation, as compared with the mother strain and the wild-type crp-introduced strain, respectively.
(19) Since the introduction of crp variant increased the yield and the sugar consumption of the strain, it seems to be a good variant trait, which may greatly contribute to improvement of production efficiency during fermentation.
(20) TABLE-US-00004 TABLE 4 Comparison of titer of threonine strain including crp variant Sugar consumption Threonine Strain (g/L)* (g/L)** KCCM10541/pCC1BAC 25.0 28.8 KCCM10541/pCC1BAC-crp(WT) 26.1 29.0 KCCM10541/pCC1BAC-crpTM4 29.0 31.0 *24-hr measured value **48-hr measured value
Example 4. Introduction of pCC1BAC-crpTM4 Variant into Tryptophan-Producing Strain
4-1. Introduction of pCC1BAC-crpTM4 into Screening Strain
(21) pCC1BAC-crpTM4 obtained in Example 3 was transformed into electro-competent cells of a tryptophan-producing strain KCCM11166P by electroporation. KCCM11166P used in this Example is an L-tryptophan-producing E. coli in which tehB gene was deleted and NAD kinase activity was enhanced (Korean Patent No. 10-1261147).
(22) As a control group of the pCC1BAC-crpTM4-introduced microorganism, pCC1BAC-crp(WT) was transformed into KCCM11166P in the same manner as above to prepare KCCM11166P/pCC1BAC-crp(WT).
4-2. Comparison of Growth Rate of Recombinant Microorganism
(23) An M9 minimal medium containing 1% glucose and 0.2 g/L of yeast extract was dispensed in a deep well microplate, and then the transformant and the control strain prepared as in Example 4-1 were seeded thereto, respectively. The strains were cultured using a micro size constant temperature incubator shaker (TAITEC, Japan) under conditions of 37° C. and 200 rpm by an HTS (High Throughput Screening) method for 16 hours to confirm growth improvement of KCCM11166P/pCC1BAC-crpTM4 transformant (Table 5).
(24) KCCM11166P strain introduced with the wild-type crp gene showed an equivalent level of OD due to additional introduction of crp after the same culture time, whereas the growth-improved transformant showed a high OD value, as compared with the wild-type crp.
(25) TABLE-US-00005 TABLE 5 Information of growth-improved transformant after introduction of crpTM4 into tryptophan-producing strain Strain OD600 Variation KCCM11166P/pCC1BAC 3.4 — KCCM11166P/pCC1BAC-crp(WT) 3.5 — KCCM11166P/pCC1BAC-crpTM4 4.0 E35A
4-3. Comparison of Tryptophan Titer of Recombinant Microorganism
(26) To measure the tryptophan titer of the recombinant microorganism prepared in Example 4-2, the recombinant microorganism was cultured in a tryptophan titration medium prepared as in the composition of the following Table 6 to examine improvement of L-tryptophan productivity.
(27) TABLE-US-00006 TABLE 6 Composition of tryptophan titration medium Composition Concentration (per liter) Glucose 60 g K.sub.2HPO.sub.4 1 g (NH.sub.4).sub.2SO.sub.4 10 g NaCl 1 g MgSO.sub.4•7H.sub.2O 1 g Sodium citrate 5 g Yeast extract 2 g Calcium carbonate 40 g Sodium citrate 5 g Phenyl alanine 0.15 g Tyrosine 0.1 g pH 6.8
(28) In detail, each one platinum loop of E. coli KCCM11166P/pCC1BAC-crp(WT) and E. coli KCCM11166P/pCC1BAC-crpTM4 cultured overnight on an LB solid medium in an incubator at 37° C. was inoculated in 25 mL of the titration medium of Table 6, respectively, and then cultured in an incubator at 37° C. and 200 rpm for 48 hours to compare sugar consumption rates and tryptophan concentrations.
(29) As a result, as described in the following Table 7, the KCCM11166P/pCC1BAC-crp(WT) strain as the control group showed sugar consumption of 30.2 g/L at 22 hours, whereas the mutant crpTM4-introduced strain showed about 146% and 9% improvement in the sugar consumption rate, as compared with the mother strain and the wild-type crp-introduced strain, respectively.
(30) When cultured for 48 hours, the wild-type crp-introduced strain showed 8.4 g/L of L-tryptophan production, whereas L-tryptophan production of the mutant strain obtained above was increased up to 9.7 g/L even though the culture speed was increased, showing about 18% and 15% improvement in the concertation, as compared with the mother strain and the wild-type crp-introduced strain, respectively.
(31) Since the introduction of crp variant increased the sugar consumption of the strain and the yield, it seems to be a good variant trait, which may greatly contribute to improvement of production efficiency during fermentation.
(32) TABLE-US-00007 TABLE 7 Comparison of titer of tryptophan strain including crp variant Sugar consumption Tryptophan Strain (g/L)* (g/L)** KCCM11166P/pCC1BAC 29.0 8.2 KCCM11166P/pCC1BAC-crp(WT) 30.2 8.4 KCCM11166P/pCC1BAC-crpTM4 33.0 9.7 *22-hr measured value **48-hr measured value
Example 5. Introduction of Effective Crp Variant Endogenous Vector into Wild-Type E. coli
5-1. Introduction of Effective pCC1BAC-Crp Variant into Wild-Type-Derived Threonine-Producing Strain
(33) To examine whether the vector including the crp variant screened in Example 3 also showed equivalent effects in the wild-type strain, the pCC1BAC-crp(WT) or pCC1BAC-crpTM4 vector was transformed into the wild-type derived strain capable of producing threonine by electroporation, respectively. Further, a pCC1BAC-crp(WT)-introduced strain was prepared as a control group.
(34) The wild-type derived strain capable of producing threonine used in this Example is W3110::PcysK-ppc/pACYC184-thrABC. W3110::PcysK-ppc/pACYC184-thrABC is a strain in which a native promoter of a ppc gene encoding phosphoenolpyruvate carboxylase on the chromosome was substituted with a promoter of a cysK gene, and a threonine biosynthesis operon gene was introduced in the form of a vector to increase the number of copy, thereby increasing threonine productivity. In detail, a W3110::PcycK-ppc strain was prepared using pUCpcycKmloxP in the same manner as described in Korean Patent No. 10-0966324, and pACYC184-thrABC (Korean Patent No. 10-1865998) was transformed into the strain by electroporation.
(35) The prepared strains were cultured in a threonine test medium prepared as in the composition of the following Table 8, and growth rates and L-threonine productivities thereof were compared.
(36) TABLE-US-00008 TABLE 8 Composition of threonine test medium Composition Concentration (per liter) Glucose 70 g KH.sub.2PO.sub.4 2 g (NH.sub.4).sub.2SO.sub.4 25 g MgSO.sub.4•7H.sub.2O 1 g FeSO.sub.4•7H.sub.2O 5 mg MnSO.sub.4•7H.sub.2O 5 mg DL-methionine 0.15 g Yeast extract 2 g Calcium carbonate 30 g pH 6.8
(37) In detail, each one platinum loop of W3110 and respective strains cultured overnight on an LB solid medium in an incubator at 33° C. was inoculated in 25 mL of the titration medium of Table 8, respectively, and then cultured in an incubator at 33° C. and 200 rpm for 48 hours. The results thereof are shown in the following Table 9. As shown in the following results, the variant protein selected in the present disclosure is also able to efficiently produce threonine with a high yield in the wild-type strain.
(38) TABLE-US-00009 TABLE 9 Results of testing growth and threonine productivity of wild-type-derived strain Threonine Strain OD (g/L)** W3110::PcysK-ppc/pACYC184- 10.8 1.5 thrABC/pCC1BAC W3110::PcysK-ppc/pACYC184- 11.0 1.6 thrABC/pCC1BAC-crp(WT) W3110::PcysK-ppc/pACYC184- 13.0 2.2 thrABC/pCC1BAC-crpTM4
5-2. Introduction of Effective pCC1BAC-Crp Variant into Wild-Type-Derived Tryptophan-Producing Strain
(39) To examine whether the vector including the crp variant screened in Example 4 also showed equivalent effects in the wild-type strain, the pCC1BAC-crp(WT) or pCC1BAC-crpTM4 vector was transformed into the wild-type derived strain capable of producing tryptophan, respectively.
(40) The wild-type derived strain capable of producing tryptophan used in this Example is W3110 trpΔ2/pCL-Dtrp_att-trpEDCBA. W3110 trpΔ2/pCL-Dtrp_att-trpEDCBA is a strain introduced with a vector in which a regulatory mechanism of a tryptophan operon regulatory region was released and tryptophan operon expression was enhanced to overexpress tryptophan (Korean Patent No. 10-1532129). The vector-introduced strains were cultured in a tryptophan test medium prepared as in the composition of the following Table 10, and L-tryptophan productivities thereof were compared.
(41) TABLE-US-00010 TABLE 10 Composition of tryptophan test medium Composition Concentration (per liter) Glucose 2 g K.sub.2HPO.sub.4 1 g (NH.sub.4).sub.2SO.sub.4 12 g NaCl 1 g Na.sub.2HPO.sub.4•H.sub.2O 5 g MgSO.sub.4•H.sub.2O 1 g MnSO.sub.4•H.sub.2O 15 mg CuSO.sub.4•H.sub.2O 3 mg ZnSO.sub.4•H.sub.2O 30 mg Sodium citrate 1 g Yeast extract 1 g Phenyl alanine 0.15 g pH 6.8
(42) In detail, each one platinum loop of the strains cultured overnight on an LB solid medium in an incubator at 37° C. was inoculated in 25 mL of the test medium of Table 9, respectively, and then cultured in an incubator at 37° C. and 200 rpm for 48 hours. OD values and tryptophan concentrations were compared and shown in Table 11. As shown in the following results, the variant protein selected in the present disclosure is also able to efficiently produce tryptophan with a high yield in the wild-type strain.
(43) TABLE-US-00011 TABLE 11 Results of testing growth and tryptophan productivity of wild-type-derived strain Tryptophan Strain OD (g/L)** W3110 trpΔ2/pCL-Dtrp_att- 10.8 0.5 trpEDCBA/pCC1BAC W3110 trpΔ2/pCL-Dtrp_att- 11.0 0.6 trpEDCBA/pCC1BAC-crp(WT) W3110 trpΔ2/pCL-Dtrp_att- 13.0 1.0 trpEDCBA/pCC1BAC-crpTM4
(44) The present inventors designated the KCCM11166P-based, pCC1BAC-crpTM4-introduced strain having improved tryptophan productivity and sugar consumption rate (KCCM11166P/pCC1BAC-crpTM4) as “CA04-2809”, and then deposited the strain to the Korean Culture Center of Microorganisms (KCCM) which is the international depository authority under the Budapest Treaty, on Nov. 7, 2018 with the Accession No. KCCM12375P.
(45) These results indicate that the sugar consumption rate was improved and the L-amino acid productivity was increased in the crp variant-introduced microorganism of the genus Escherichia of the present disclosure, and consequently, the L-amino acid productivity was increased, as compared with the non-modified strain.
(46) Based on the above description, it will be understood by those skilled in the art that the present disclosure may be implemented in a different specific form without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the above embodiment is not limitative, but illustrative in all aspects. The scope of the invention is defined by the appended claims rather than by the description preceding them, and therefore all changes and modifications that fall within metes and bounds of the claims, or equivalents of such metes and bounds are therefore intended to be embraced by the claims.