Reagent and method for fluorescence quantitative real-time PCR detection of RCL

11697848 · 2023-07-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a reagent and method for detecting a replication-competent lentivirus (RCL) by fluorescence quantitative real-time polymerase chain reaction (PCR). In particular, the present invention provides a primer and probe combination for detecting RCL, and a method for performing detection using said primer and probe; the present invention also provides a reagent kit comprising said primer and probe. The primer and probe combination of the present invention detects RCL with high amplification efficiency and good specificity, and can be used for RCL detection and RCL monitoring of clinical patient peripheral blood samples which may occur during a production process.

Claims

1. A reagent combination comprising: (i) a first primer pair for specific amplification of vesicular stomatitis virus G protein (VSV-G) gene and a first probe, wherein, the first primer pair comprises: a first forward primer consisting of the sequence of SEQ ID NO: 1, and a first reverse primer consisting of the sequence of SEQ ID NO:2; wherein the first probe consists of the sequence of SEQ ID NO: 3 and a first detectable label; and (ii) a second primer pair for specific amplification of VSV-G gene and a second probe, wherein, the second primer pair comprises: a second forward primer consisting of the sequence of SEQ ID NO: 4, and a second reverse primer consisting of the sequence of SEQ ID NO: 5; wherein the second probe consists of the sequence of SEQ ID No: 6 and a second detectable label.

2. The reagent combination of claim 1, wherein the amplification efficiency of the reagent combination for detecting replication competent lentivirus (RCL) is ≥90%.

3. A detection kit comprising the reagent combination of claim 1.

4. The detection kit of claim 3, wherein the kit further comprises reagents for amplification.

5. The reagent combination of claim 2, wherein the amplification efficiency of the reagent combination for detecting RCL is ≥92%.

6. The reagent combination of claim 5, wherein the amplification efficiency of the reagent combination for detecting RCL is ≥95%.

7. The reagent combination of claim 1, wherein the first and the second detectable labels are fluorophores.

Description

MODES FOR CARRYING OUT THE PRESENT INVENTION

(1) Through extensive and intensive research, the inventors have unexpectedly discovered for the first time a primer and probe combination for detecting RCL by fluorescence quantitative real-time PCR, and a method for performing detection using the primer and probe. The present invention also provides a reagent kit comprising the primer and probe. Experiments have shown that using the primer and probe combination of the present invention to detect RCL has high amplification efficiency and good specificity, and is suitable for clinical and laboratory detection. The present invention has been completed on the basis of this.

(2) Specifically, the primer and probe combination of the present invention can be used for detection of RCL which may be produced during a production process and for RCL monitoring of clinical patient peripheral blood samples. The present invention also established and verified a method for detecting VSV-G sequence of a sample with the primer and probe combination of the present invention using the Taqman probe method, using human genomic DNA as background.

(3) Vesicular stomatitis virus-fusion promoting envelope G protein (VSV-G) is a glycosylated membrane protein, which plays a decisive role in the two initial steps of virus entry into host cells: the attachment of the virus to the surface of the host cell and the pH-dependent endosomal membrane fusion induced by the virus. VSV-G is an envelope protein with a wide host range, which can infect most human cells, and cells from species far away from humans such as zebrafish and drosophila. It is currently widely used in lentiviral vectors, and it can expand the infective lineage of lentiviral vectors. VSV-G plays an important role in gene and cell therapy.

(4) TaqMan qPCR

(5) TaqMan probe method is a highly specific quantitative PCR technology. The core is to use the 3′.fwdarw.5′ exonuclease activity of Taq enzyme to cut off the probe to generate a fluorescent signal. Since the probe and the template are specifically bound, the intensity of the fluorescence signal represents the quantity of the templates.

(6) The quantitative PCR reaction system of the TaqMan probe method comprises a pair of PCR primers and a probe. The probe only specifically binds to the template, and its binding site is between the two primers. The 5′ end of the probe is labeled with a reporter group (Reporter, R) such as FAM™ (fluorescein amidites), VIC® (2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein), etc. The 3′ end is labeled with a fluorescence quencher group (Quencher, Q), such as TAMRA™ (carboxytetramethylrhodamine), etc. When the probe is complete, the fluorescent energy emitted by the reporter group is absorbed by the quencher group, and an instrument cannot detect the signal. As the PCR progresses, Taq enzyme encounters the probe bound to the template during the chain extension process, and its 3′.fwdarw.5′ exonuclease activity will cut off the probe. Therefore, the reporter group will be taken far away from the quencher group, and its energy will not be absorbed. That is, a fluorescent signal will be generated. Therefore, after each PCR cycle, the fluorescent signal also has a synchronous exponential growth process like the target fragment. The intensity of the signal represents the copy number of the template DNA.

(7) As used herein, the term “probe” refers to a gene probe, that is, a nucleic acid probe, which is a nucleic acid sequence (DNA or RNA) complementary to the target gene with a detection label and a known sequence. The gene probe combines with the target gene through molecular hybridization to generate a hybridization signal, which can reveal the target gene from the vastest genome.

(8) Reagent Combination

(9) The present invention relates to a reagent combination for detecting RCL, comprising:

(10) (i) an upstream primer with the sequence shown in SEQ ID NO: 1, a downstream primer with the sequence shown in SEQ ID NO: 2 and a probe with the sequence shown in SEQ ID NO: 3 (that is, the VSV-G9 reagent combination as described below);

(11) or,

(12) (ii) an upstream primer with the sequence shown in SEQ ID NO: 4, a downstream primer with the sequence shown in SEQ ID NO: 5 and a probe with the sequence shown in SEQ ID NO: 6 (that is, the VSV-G8 reagent combination as described below).

(13) The reagent combination of the present invention is used in the Taqman probe method to detect RCL, and has high amplification efficiency and good specificity.

(14) Detection Method and Detection Kit

(15) The present invention relates to a detection method for detecting RCL, wherein the method comprises: using the reagent combination of the first aspect of the present invention to perform fluorescence quantitative real-time PCR on a DNA sample to be tested; and calculating the Cq value and VSV-G gene copy number of the DNA sample to be tested to determine whether the sample contains RCL.

(16) The method of the present invention can detect a sample selected from the group consisting of: (i) a replication competent lentivirus, (ii) a biological product using lentivirus as a vector, and (iii) blood, bone marrow fluid, tissues and organs of human or an animal (such as a rodent, primate).

The Main Advantages of the Present Invention Include

(17) (a) Suitable for RCL detection during gene/cell therapy using lentiviral vector with VSV-G as envelope

(18) (b) High specificity and no specific response to genome background

(19) (c) Providing a duplex PCR method which can simultaneously detect reference gene

(20) The present invention will be further illustrated below with reference to the specific examples. It is to be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. For the experimental methods in the following examples the specific conditions of which are not specifically indicated, they are performed under routine conditions, e.g., those described by Sambrook et al., in Molecule Clone: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press, 1989, or as instructed by the manufacturers, unless otherwise specified. Unless indicated otherwise, parts and percentage are weight parts and weight percentage.

(21) General Materials

(22) 1. Main Reagents

(23) TABLE-US-00001 Reagent name Source Item No. Use QIAamp DNA blood Midi kit Qiagen 51185 For extracting cell or blood genomic DNA Custom Taqman copy number Thermo Fisher Designed Primer/probe of VSV-G analysis by the sequence probe/primer-VSPCT_CDDJ inventors XJG Taqman genotyping master Thermo Fisher 4304437 For amplifying the target mix kit gene C8166 Genomic DNA C8166 cell The cells As genome background extraction come from the CBMG production department, derived from ATCC Non-transduced human T cell Non-transduced The cells As genome background genomic DNA human T cell come from CBMG production department CBMG-PRM1 plasmid The strains come CBMG Standard curve and from China production positive control Plasmid Vector department Strain Cell Line Gene Collection Center (Biovector Science Lab, Inc.). After monoclonal selection and identification, amplification culture and plasmid purification were performed. Diluent (for real-time PCR) Takara 9160 For diluting plasmid to make standard curves DNA suspension (10 mM Tris, TEKNOVA T0221 For dissolving primers and 0.1m MEDTA, pH 8.0) probes, and for preparing storage solutions for primers and probes

(24) 2. Primer and probe information

(25) VSV-G1 to VSV-G4 primers were synthesized by GenScript, and the probes were synthesized by Invitech (VSV-G2 was not included).

(26) VSV-G5 and VSV-G6 primers and probes were synthesized by GenScript.

(27) VSV-G7 to VSV-G10 primers and probes were synthesized by Invitech.

(28) TABLE-US-00002 SEQ ID VSV-G1 5’ to 3’ sequence NOs Forward CGAGATGGCTGATAAGGATCTC SEQ ID primer NO: 7 Reverse ATTGATTATGGTGAAAGCAGGAC SEQ ID primer NO: 8 Probe 6 SEQ ID FAM-TGCTGCAGCCAGATTCCCTGAATG- NO: 9 TAMARA

(29) VSV-G1 primers and probes were designed with reference to Escarpe P, Zayek N, Chin P, Borellini F, Zufferey R, Veres G, and Kiermer V, Development of a sensitive assay for detection of replication-competent recombinant lentivirus in large-scale HIV-based vector preparations, Mol Ther. 2003 August; 8(2):332-41.

(30) TABLE-US-00003 VSV-G3 5’ to 3’ sequence SEQ ID NOs Forward GACCTCAGTGGATGTAAG SEQ ID NO: primer 10 Reverse CTGGAGAGATTGGAAGAC SEQ ID NO: primer 11 Probe 6 FAM-CTAATTCAGGACGTT-MGB SEQ ID NO: 12

(31) TABLE-US-00004 VSV-G4 5’ to 3’ sequence SEQ ID NOs Forward GCAAGGAAAGCATTGAAC SEQ ID NO: primer 13 Reverse CTGGACAATCACTGCTTC SEQ ID NO: primer 14 Probe 6 FAM-CATCCGTCACAGTTGC-MGB SEQ ID NO: 15

(32) TABLE-US-00005 VSV-G5 5’ to 3’ sequence SEQ ID NOs Forward CCAGAAGGGTCAAGTATC SEQ ID NO: primer 16 Reverse CAGAGGGAATAATCCAAGA SEQ ID NO: primer 17 Probe 6 FAM- SEQ ID NO: TGCTCCATCTCAGACCTCAGT-BHQ1 18

(33) TABLE-US-00006 VSV-G6 5’ to 3’ sequence SEQ ID NOs Forward GCAAGGAAAGCATTGAAC SEQ ID NO: primer 19 Reverse CCGTCACAGTTGCATATC SEQ ID NO: primer 20 Probe 6 SEQ ID NO: FAM-AACTTGGCTGAATCCAGGCTT- 21 BHQ1

(34) TABLE-US-00007 VSV-G7 5’ to 3’ sequence (catalogue SEQ ID (VSPCT_CDH49U6) No. 4400294, lotnumber: 3007087) NOs Forward primer AGTCAGACTCCCATCAGGTGT SEQ ID NO: 22 Reverse primer TTGACCCTTCTGGGCATTCAG SEQ ID NO: 23 Probe 6 SEQ ID FAM-CCTTATCAGCCATCTCGAACCAG-MGB NO: 24

(35) TABLE-US-00008 VSV-G8 SEQ ID (VSPCT_CDFVKPC) 5’ to 3’ sequence NOs Forward primer GGATGTGTCATGCTTCCAAATGG SEQ ID NO: 4 Reverse primer GTGAAGGATCGGATGGAATGTGTTA SEQ ID NO: 5 Probe 6 SEQ ID FAM-ACCAGCGGAAATCACAAGTAGTG-MGB NO: 6

(36) TABLE-US-00009 VSV-G9 SEQ (VSPCT_CDDJXJG) 5’ to 3’ sequence ID NOs Forward primer GAAAGGGAACTGTGGGATGACT SEQ ID NO: 1 Reverse primer GAACTGGTCCTCAGAACTCCATT SEQ ID NO: 2 Probe 6 SEQ ID FAM-CATATGAAGACGTGGAAATTGGACCC-MGB NO: 3
RPP30 and TERT primers were synthesized by GenScript. RPP30 and TERT probes were synthesized by Invitech.

(37) TABLE-US-00010 RPP30 5’ to 3’ sequence SEQ ID NOs Forward GTGGTAGTGCATAGACTTTA SEQ ID NO: primer 25 Reverse GAGGACATTTGAGGAGTG SEQ ID NO: primer 26 Probe VIC-CATCCGTCACAGTTGC- SEQ ID NO: TAMARA 27

(38) TABLE-US-00011 SEQ ID TERT 5’ to 3’ sequence NOs Forward GGATCTTGTAGATGTTGG SEQ ID NO: primer 28 Reverse TCCCAGAGAGGTTTCTAC SEQ ID NO: primer 29 Probe VIC-CTGTTCACCTAGAGTCGCCAAG- SEQ ID NO: TAMARA 30

(39) 4. C8166 Cell Line

(40) The C8166 cell line is a human leukemia cell, which is liable to lentivirus infection and entry. It was used as a susceptible host of lentivirus in the RCL detection by cell co-culture method, which is conducive to the replication and amplification of low-level RCL.

(41) 5. Standard

(42) The standard was used for preparing standard curves to establish a quantitative relationship between the quantification cycle (Cq) and the copy number. In the present program, the CBMG-PRM1 plasmid containing the VSV-G sequence was doubly diluted and 100 ng of human genomic DNA was added as a background, then the mixture was used as a standard.

(43) 6. Quality Control-Negative Control (NC)

(44) Negative control standards include: No template control (NTC), which only lacks template in the qPCR reaction system for detecting the presence of dimer and reagent contamination; background negative control (BNC), using C8166 genomic DNA (gDNA) or human non transduced T cell (hNT) gDNA as the template in the qPCR reaction system for detecting the influence of gDNA on qPCR amplification, which can also be used for monitoring the contamination of reagents and sample loading process.

(45) 7. Quality Control-Positive Control (PC)

(46) The quality control-positive control is the background gDNA of the same concentration (set as 100 ng in the present experiment) containing different copy numbers of CBMG-PRM1 plasmids. Quality control-positive control is used for evaluating the performance of the experiment.

(47) General Methods

(48) Screening of VSV-G Primers/Probes by TaqMan qPCR Method

(49) Screening criteria: 1) Correlation coefficient (R.sup.2)≥0.99; 2) Amplification efficiency (Efficiency): 90%-110%; 3) No amplification of NTC and BNC.

(50) qPCR Detection Experiment Process

(51) 1. Genomic DNA Extraction, Quality Control and Preservation

(52) (1) The genomic DNA was extracted from 2×10.sup.6 cells/tube of cells with reference to the operation manual of QIAamp DNA blood Midi Extraction Kit; (2) The DNA concentration and OD260/280 value were detected by NanoDrop 2000. The genomic DNA concentrations of the sample to be tested and the human cells (including C8166 cells and hNT) used as the genomic background were adjusted to 25 ng/μl. If the DNA concentration was on the high side, enzyme-free H.sub.2O was added for dilution. If the concentration is on the low side, a vacuum centrifugal concentrator was used to concentrate. The genomic DNA stock solution and 25 ng/μ1 was cryopreserved at −80° C.
2. Plasmid Dilution (1) The copy numbers of the plasmid per microliter of stock solutions were calculated according to the formula: (6.02×10.sup.14)×(ng/μ1))/(DNA length×660)=copies/μl; (2) The plasmid solutions were diluted to 10.sup.10 copies/μl stock solution; (3) The 10.sup.10 copies/μl stock solution was sub packaged in 11 μl/tube and cryopreserved at −80° C. to avoid repeated freezing and thawing.
3. Quality Control-Positive Control

(53) The following quality control-positive controls are required in this method validation:

(54) TABLE-US-00012 Quality control- Assay positive times control(_copies (each assay plasmid + 100 ng was repeated C8166gDNA) Use 3 times) 1 Sensitivity experiment 20 2 Sensitivity experiment 20 5 Sensitivity experiment 20 10 Sensitivity experiment, lowest 40 quantitative line experiment 20 Sensitivity experiment, lowest 40 quantitative line experiment 50 Lowest quantitative line experiment 20 100 Lowest quantitative line experiment, 36 repeatability experiment, reproducibility experiment, accuracy experiment 200 Lowest quantitative line experiment, 20 repeatability experiment, reproducibility experiment, accuracy experiment 10.sup.4 Repeatability experiment, 16 reproducibility experiment, accuracy experiment 10.sup.6 Repeatability experiment, 16 reproducibility experiment, accuracy experiment

(55) The above quality control-positive controls were diluted in one batch and then sub packaged in 15 μl/tube/test and cryopreserved at −80° C. to avoid repeated freezing and thawing.

(56) 4. Doubling Dilution of the Standard

(57) The following reagents were taken from −80° C. refrigerator and placed at 4° C. after thawing: 10.sup.10 copies/μl CBMG-PRM1 plasmid stock solution, 10.sup.10 copies/μl pUC57-TERT plasmid stock solution, 10.sup.10 copies/μl pUC57-RPP30 plasmid stock solution, T cell gDNA (C8166 gDNA or hNTgDNA), quality control-positive control;

(58) 4.1 Doubling Dilution of CBMG-PRM1 Plasmid+Background Genomic DNA Standard (Single Plasmid Standard)

(59) (1) According to the method shown in the following table, the standards were diluted in a 1.5 ml centrifuge tube with diluent in turn and centrifuged in a micro centrifuge; the operations were taken place on ice and the products were placed at 4° C. for use to obtain CBMG-PRM1 plasmid solutions of different concentrations/copy numbers:

(60) TABLE-US-00013 Concentration of the .sup. 10.sup.9 .sup. 10.sup.8 .sup. 10.sup.7 .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 10 0 plasmid solution to be prepared copies/μl Dilution diluent added/μl 90 90 90 90 90 90 90 90 90 40 process Concentration .sup. 10.sup.10 .sup. 10.sup.9 .sup. 10.sup.8 .sup. 10.sup.7 .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 — of the plasmid solution added copies/μl Volume of the 10 10 10 10 10 10 10 10 10 — plasmid solution added/μl Remarks For example, to prepare 10.sup.8 copies/μl plasmid solution, 90 μl diluent was added to a 1.5 ml tube; 10.sup.9 copies/μl plasmid solution was mixed and centrifuged, from which 10 μl plasmid solution was taken and added to the 1.5 ml centrifuge tube and mixed, thus obtaining the 10.sup.8 copies/μl plasmid solution.

(61) Note: When single CBMG-PRM1 plasmid is used as a standard, and no gDNA is used as a background control, step (1) is sufficient. (2) The above-mentioned plasmid solutions of different concentrations were taken to prepare CBMG-PRM1 plasmid+100 ng gDNA standard solutions in 1.5 ml centrifuge tubes according to the method shown in the following table, centrifuged with a micro centrifuge, operated on ice, and placed at 4° C. for use to obtain standard solutions of different concentrations:

(62) TABLE-US-00014 Standard solution number Std6 Std5 Std4 Std3 Std2 Std1 BNC Dilution Volume of 16 16 16 16 16 16 16 process gDNA added/μl Concentration .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 10 0 of the plasmid solution added copies/μl Volume of  4  4  4  4  4  4 4 the plasmid solution added/μl Remarks For example, to prepare the standard solution Std6, 16 μl of gDNA solution was added to a 1.5 ml centrifuge tube, then 4 μl of plasmid solution with a concentration of 10.sup.6 copies/μl was added and mixed.
4.2 Doubling Dilution of Double-Plasmid Standard (Containing VSV-G Plasmids and Reference Gene Plasmids, No Background gDNA)

(63) According to the method shown in the following table, the standards were diluted in 1.5 ml centrifuge tubes with diluent in turn and centrifuged in a micro centrifuge; the operation was taken place on ice and the products were placed at 4° C. for use to obtain double-plasmid standard solutions of different concentrations/copy numbers:

(64) TABLE-US-00015 Standard solution number - - - Std6 Std5 Std4 Std3 Std2 Std1 Std0 B Concentration of the .sup. 10.sup.9 .sup. 10.sup.8 .sup. 10.sup.7 .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 10 1 0 plasmid solution to be prepared copies/μl Dilution diluent 80 90 90 90 90 90 90 90 90 90 90 process added/μl Concentration .sup. 10.sup.10 .sup. 10.sup.9 .sup. 10.sup.8 .sup. 10.sup.7 .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 10 — of CBMG-PRM1 plasmid solution added copies/μl Concentration .sup. 10.sup.10 .sup. 10.sup.9 .sup. 10.sup.8 .sup. 10.sup.7 .sup. 10.sup.6 .sup. 10.sup.5 .sup. 10.sup.4 .sup. 10.sup.3 .sup. 10.sup.2 10 — of pUC57-RPP30 plasmid solution added copies/μl Volume of the 20 10 10 10 10 10 10 10 10 10 — plasmid solution added/μl Remarks To prepare 10.sup.9 copies/μl plasmid solution, 80 μl of diluent was added to an EP tube; 10 μl of CBMG-PRM1 plasmid solution and pUC57-RPP30 plasmid solution (10.sup.10 copies/μl) were taken and added to the EP tube and mixed, respectively, thus obtaining the 10.sup.9 copies/μl plasmid solution. To prepare 10.sup.8 copies/μl plasmid solution, 90 μl of diluent was added to an EP tube; 10 μl solution of 10 .sup.9 copies/μl containing CBMG-PRM1 plasmids and pUC57-RPP30 plasmids were added to the EP tube and mixed, thus obtaining the 10.sup.8 copies/μl plasmid solution.
5. Preparation of Reaction System (Mix)
5.1 Preparation of CBMG-PRM1 Plasmid+100 ng gDNA Reaction System (Including the Standard and Quality Control-Positive Control) (Mix-VSV-G)

(65) TABLE-US-00016 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × VSV-G primer/probe Mix  1 μl μl Template (1 μl CBMG-PRM1 plasmid + 4 μl  5 μl   gDNA) H.sub.2O  4 μl μl Total volume 20 μl μl n = test × 3 Template loading volume: 5 μl/well

(66) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(67) 5.2 Preparation of Sample VSV-G Target Gene Detection Reaction System (Mix-Sample)

(68) TABLE-US-00017 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × VSV-G primer/probe Mix  1 μl μl Template (gDNA from sample)  8 μl   H.sub.2O  1 μl μl Total volume 20 μl μl n = test × 3 Template loading volume: 8 μl/well, i.e. 200 ng/well

(69) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(70) 5.3 Preparation of Reference Gene Standard Curve Detection Reaction System (Mix-Reference-Std)

(71) TABLE-US-00018 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × RPP30 or TERT primer/probe mix  1 μl μl Template (1 μl pUC57-RPP30 or pUC57-TERT  1 μl   plasmid) H.sub.2O  8 μl μl Total volume 20 μl μl n = test × 3 Loading volume of template: 1 μl/well

(72) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(73) 5.4 Preparation of Reference Gene Sample Detection Reaction System (Mix-Reference)

(74) TABLE-US-00019 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × RPP30 or TERT primer/probe mix  1 μl μl Template (1 μl pUC57-RPP30 or  1 μl   pUC57-TERT plasmid) H.sub.2O  8 μl μl Total volume 20 μl μl n = test × 3 Template loading volume: 1 μl/well, i.e. 25 ng/well

(75) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(76) 5.5 Preparation of Double-Plasmid Standard Duplex qPCR Reaction System

(77) TABLE-US-00020 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × VSV-G primer/probe Mix  1 μl μl 20 × Reference Primer/Probe Mix  1 μl μl Template (CBMG-PRA3 plasmid +  1 μl   pUC57-RPP30 plasmid) H.sub.2O  7 μl μl Total volume 20 μl μl n = test × 3 Loading volume of template: 1 μl/well

(78) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(79) 5.6 Preparation of Single Plasmid Standard Duplex qPCR Reaction System

(80) TABLE-US-00021 Solution 1× ( n + n × 10%)× 2× Taqman genotyping master mixture 10 μl μl 20 × VSV-G primer/probe Mix  1 μl μl 20 × Reference Primer/Probe Mix  1 μl μl Template (CBMG-PRA3 plasmid)  1 μl μl gDNA background (C8166 or NT, 1000 ng)  X μl μl H.sub.2O  X μl μl Total volume 20 μl μl Loading volume of template: 1 μl/well

(81) The above solutions were added to 1.5 ml centrifuge tubes, operated on ice, mixed upside down, centrifuged in a micro centrifuge, and placed at 4° C. for use.

(82) 6. qPCR detection

(83) 6.1 Single-Plex qPCR detection

(84) (1) According to the following table, 15 μl of the above-prepared reaction system “Mix-VSV-G”, 12 μl of “Mix-Sample” were taken and added to a 96-well PCR reaction plate, and 19 μl of “Mix-Reference-Std” and “Mix-Reference” were added to the 96-well PCR reaction plate;

(85) TABLE-US-00022 1 2 3 4 5 6 7 8 9 10 11 12 A NTC NTC NTC B BNC BNC BNC C Std1 Std1 Std1 PC PC PC sample sample sample D Std2 Std2 Std2 E Std3 Std3 Std3 F Std4 Std4 Std4 G Std5 Std5 Std5 H Std6 Std6 Std6 Std: CBMG-PRM1 plasmids + 100 ng gDNA standard or pUC57-RPP30 or pUC57-TERT plasmids; NTC: No Template Control; BNC: Background Negative Control; PC: Positive control (___copies CBMG-PRM1 plasmid + 100 ng gDNA) (2) The standards: std6, std5, std4, std3, std2, std1, and NC or PC were added to the corresponding wells in sequence, the detection of VSV-G standard curve was 5 μl/well; the detection of “sample to be tested” VSV-G was 8 μl/well and sequentially added to the corresponding well; the detection of reference gene curve and the “sample to be tested” were both 1 μl/well. (3) The 96-well PCR reaction plate was blocked with sealing membrane, then centrifuged at 200×g for 2 minutes; (4) the plate was placed into Quant Studio Dx real-time PCR, and the reaction conditions for Taqman Universal PCR Master Mix was set as follows:

(86) Standard conditions:

(87) UNG incubation: 2 min at 50° C.

(88) Polymerase activation: 10 min at 95° C.

(89) PCR: 40 cycles

(90) Degeneration: 15 sec at 95° C.

(91) Annealing/Extension: 60 sec at 60° C.

(92) 6.2 Detection of Double-Plasmid Standard Duplex qPCR

(93) (1) According to the following table, 19 μl of the duplex PCR reaction system “Std” prepared above was added to the 96-well PCR reaction plate;

(94) TABLE-US-00023 1 2 3 4 5 6 7 8 9 10 11 12 A NTC NTC NTC B Std0 Std0 Std0 C Std1 Std1 Std1 PC PC PC sample sample sample D Std2 Std2 Std2 E Std3 Std3 Std3 F Std4 Std4 Std4 G Std5 Std5 Std5 H Std6 Std6 Std6 Std: Standard containing CBMG-PRM1 plasmids and pUC57-RPP30 plasmids; NTC: No template control; (2) The standards std6, std5, std4, std3, std2, std1, std0 and blank control B were added to the corresponding wells in sequence with 1 μl/well; (3) The 96-well PCR reaction plate was blocked with sealing membrane, then centrifuged at 200×g for 2 minutes; (4) The plate was place into Quant Studio Dx real-time PCR, and the reaction conditions for Taqman genotyping master mixture was set as follows:

(95) Standard conditions:

(96) Polymerase activation: 10 min at 95° C.

(97) PCR: 40 cycles

(98) Degeneration: 15 sec at 95° C.

(99) Annealing/Extension: 60 sec at 60 ° C.

(100) 7. Experimental Data Quality Control Parameters

(101) (1) Amplification efficiency 90%˜110%; (2) Standard curve for the standard R.sup.2≥0.99; (3) Negative controls include NTC and BNC: at least 2 repeated wells among the 3 repeated wells have no amplification, i.e. Cq>40, if 1 repeated well has amplification, Cq need to be >average Cq.sub.LOD (mean Cq.sub.LOD).

(102) If any one of the above 3 points does not meet the requirements, the experiment needs to be repeated.

(103) 8. Data Processing and Analysis

(104) (1) After the reaction, a standard curve was outputted by software, which was composed of at least 5 points;
9. Result Judgment of RCL Detection
According to the standard curve, the Cq value of each sample and the VSV-G gene copy number of 100 ng genome was outputted by software automatically;

(105) In order to facilitate the determination of the positive and negative results of RCL, the copy number of LOD+100 ng C8166 gDNA was used as the quality control-positive control (PC) in the experiment. The average Cq value of each experiment was used as the positive threshold.

(106) TABLE-US-00024 RCL No. qPCR results status Pass/Fail solution 1 3 out of 3 repeats contain Negative Pass NA undetectable VSV-G 2 2 out of 3 repeats contain Negative Pass NA undetectable VSV-G, 1 detectable, Cq > average Cq .sub.LOD as pc 3 1 out of 3 repeats contains Negative Pass NA undetectable VSV-G, 2 detectable, Cq > average Cq .sub.LOD as pc 4 1 out of 3 repeats contains Initial Fail Repeat; The result of undetectable VSV-G, positive repeated qPCR needs 2 detectable, Cq ≤ average to meet No.1 - No.3 Cq .sub.LOD as pc 5 Repeated qPCR: 1 out of 3 Positive Fail Cell-based RCL repeats contains detection was undetectable VSV-G, performed by a third 2 detectable, Cq ≤ average party Cq .sub.LOD as pc

EXAMPLE 1

(107) Screening of Primer/Probe Pairs for the Reference Gene

(108) Doubly diluted 293T gDNA was used for making standard curve, to test two primer/probe pairs RPP30 and TERT.

(109) The results are shown in Table 1. The amplification efficiency of RPP30 was 99.24%, and the amplification efficiency of TERT was 83.22%.

(110) TABLE-US-00025 TABLE 1 Concentrations of two primer/probe pairs of reference gene and the result parameter information Primer/ probe Primer Probe Threshold Amplification name (μM) (μM) value efficiency R.sup.2 TERT 0.4 0.2 0.04 83.22% 0.997 RPP30 0.4 0.2 0.05 99.24% 0.985 pUC57-RPP30 plasmid doubling dilution was used for making a standard curve once again to test the effectiveness of RPP30 primer/probe. The results showed that the amplification efficiency of RPP30 primer/probe was 93.77%, and R.sup.2 was 0.995. Follow-up experiments were conducted with primer/probe pairs of RPP30.

EXAMPLE 2

(111) Screening of Probe/Primer Pairs for VSV-G Gene Detection

(112) Doubly diluted 293T gDNA was used to make standard curve, to test VSV-G1, VSV-G3, VSV-G4, VSV-G5, VSV-G6, VSV-G7, VSV-G8, VSV-G9 primer/probe pairs.

(113) The results are shown in Table 2. From the perspective of amplification efficiency, the amplification efficiencies of VSV-G4, VSV-G6, VSV-G8, and VSV-G9 are between 90% and 110%. However, the background of VSV-G6 was relatively high. When only 293T gDNA was used as the background template, the Cq value was 38.6. While the sensitivity of VSV-G4 was relatively low. When the VSV-G template was 10 copies, the Cq value was 39.2, when 10.sup.6 copies, the Cq value is 21.8. The sensitivity of VSV-G1 was also relatively low. The Cq value was 38.3 when the VSV-G template was 10 copies.

(114) TABLE-US-00026 TABLE 2 the concentration of each VSV-G primer/probe pair and the result parameter informations with 293T gDNA as background control Cq value Primer/ 0 (293T (10 copies Probe Primer Probe Threshold Amplification gDNA) of VSV-G name (μM) (μM) value efficiency R.sup.2 background templates) VSV-G1 0.9 0.25 0.068 93.68% 0.994  ND* 38.3 VSV-G3 0.8 0.4 0.04 88.41% 0.986 ND 38.6 VSV-G4 0.8 0.4 0.08 91.15% 0.987 39.43 39.2 VSV-G5 0.8 0.25 0.04 52.33% 0.984 ND ND VSV-G6 0.9 0.25 0.08 94.73% 0.997 38.6 36.6 VSV-G7 0.9 0.25 0.08 88.81% 0.996 ND 37.0 VSV-G8 0.9 0.25 0.1 94.97% 0.998 ND 35.9 VSV-G9 0.9 0.25 0.1 92.70% 0.999 ND 37.0 *ND means not detectable, that is, not detected

(115) CAR-NCgDNA and C8166 gDNA were used as background templates respectively. The amplification efficiencies, R.sup.2 and background conditions of VSV-G6, VSV-G8, VSV-G9 primers/probes were detected again.

(116) The results with CAR-NCgDNA as a background control are shown in Table 3. The results with C8166gDNA as a background are shown in Table 4. The results showed that VSV-G6 primer/probe and 293T gDNA had non-specific binding and amplification. VSV-G8 and VSV-G9 primers/probes had good specificity under three genomic backgrounds: 293T, C8166, and NC (non-transduced T cells), and the amplification efficiencies were also 90%˜110%. In the subsequent double probes/primers test, VSV-G8 and VSV-G9 primers/probes were used for testing.

(117) TABLE-US-00027 TABLE 3 Concentrations of VSV-G6, VSV-G8, VSV-G9 primer/probe pairs and the result parameters with CAR-NCgDNA as background control Cq value (10 copies Primer/Probe Primer Probe Threshold Amplification 0 (NC gDNA) of VSV-G name (μM) (μM) value efficiency R.sup.2 background templates) VSV-G6 0.8 0.25 0.1 90.04% 0.993 ND 37.7 VSV-G8 0.9 0.25 0.1 94.55% 0.995 ND 36.5 VSV-G9 0.9 0.25 0.1 96.95% 0.999 ND 35.8

(118) TABLE-US-00028 TABLE 4 Concentrations of VSV-G6, VSV-G8, VSV-G9 primer/probe pairs and the result parameters with C8166gDNA as background control Cq value (10 copies Primer/probe Primer Probe Threshold Amplification 0 (C8166 gDNA) of VSV-G name (μM) (μM) value efficiency R.sup.2 background templates) VSV-G6 0.8 0.25 0.08 91.72% 0.997 ND 37.1 VSV-G8 0.9 0.25 0.1 96.30% 0.998 ND 35.8 VSV-G9 0.9 0.25 0.1 90.68% 0.999 ND 37.0

EXAMPLE 3

(119) Detection of the Amplification Efficiency of VSV-G Primer/Probe and Reference Gene Primer/Probe in the Same Reaction Well by Double-Plasmid Method

(120) The VSV-G plasmids (CBMG-PRM1) and the reference gene plasmids (pUC57-RPP30) were doubly diluted by 10 times and placed in a same well as a template to establish a standard curve. Duplex PCR was performed to detect the interference of the two probe/primer pairs. In this example, the combination of VSV-G8 and internal reference RPP30 and the combination of VSV-G9 and internal reference RPP30 were tested.

(121) The results are shown in Table 5. In the duplex PCR reaction of the VSV-G8/RPP30 primer probe combination, neither the amplification of VSV-G8 nor the amplification of RPP30 was significantly affected. In the duplex PCR reaction of the VSV-G9/RPP30 primer probe combination, neither the amplification of VSV-G9 nor the amplification of RPP30 was significantly affected.

(122) The result parameters of the two probe/primer pairs detected by duplex PCR are as follows:

(123) TABLE-US-00029 Cq value (10 copies Primer/ Primer Probe Threshold Amplification of VSV-G combination Probe name (mM) (mM) value efficiency R.sup.2 templates) VSV-G8/ VSV-G8 0.9 0.25 0.1  92.90% 0.986 37.3 RPP30 RPP30 0.4 0.2 0.04 101.35% 0.986 37.6 VSV-G9/ VSV-G9 0.9 0.25 0.1 101.80% 0.991 35.2 RPP30 RPP30 0.4 0.2 0.04  94.79% 0.998 37.4

EXAMPLE 4

(124) Detection of Double Primer/Probe PCR Reaction Under Single Plasmid+High-Quality Background

(125) Single plasmid was used for making standard curve. VSV-G gene copy number detection was performed by duplex PCR detection under high-quality background (C8166 and NT, 1000 ng). The amplification efficiencies of the VSV-G primer/probe and reference gene primer/probe and the effect of high-quality background on duplex PCRVSV-G were tested in the same reaction well.

(126) The results are shown in Table 6. The amplification efficiencies of VSV-G8 and VSV-G9 were relatively high under the background of high-quality genome, and the amplification efficiency of VSV-G9 is higher.

(127) TABLE-US-00030 TABLE 6 the results of two pairs of probe/primer pairs detected by duplex PCR with 1000 ng C8166 and NT gDNA as background Cq value Primer/ (10 copies probe Primer Probe Threshold Amplification of VSV-G Background combination name (mM) (mM) value efficiency R.sup.2 templates) C8166 VSV-G8/RPP30 VSV-G8 0.9 0.25 0.1 92.12% 0.995 37.0 gDNA RPP30 0.4 0.2 0.04 — — — VSV-G9/RPP30 VSV-G9 0.9 0.25 0.1 93.53% 0.994 36.7 RPP30 0.4 0.2 0.04 — — — NT VSV-G8/RPP30 VSV-G8 0.9 0.25 0.1 85.17% 0.989 38.1 gDNA RPP30 0.4 0.2 0.04 — — — VSV-G9/RPP30 VSV-G9 0.9 0.25 0.1 96.98% 0.997 35.6 RPP30 0.4 0.2 0.04 — — —

(128) All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications, equivalents of which falls in the scope of claims as defined in the appended claims.