Zika virus vaccine composition and application thereof
10501529 ยท 2019-12-10
Assignee
Inventors
Cpc classification
C12N2770/24122
CHEMISTRY; METALLURGY
C12N2770/24134
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C07K16/1081
CHEMISTRY; METALLURGY
C07K14/1825
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
A61K47/68
HUMAN NECESSITIES
Abstract
Provided herein are a mutant envelope protein of Zika virus and a nucleic acid molecule including a nucleotide sequence encoding the mutant envelope protein. The mutant envelope protein, which preferably has a threonine substitution at 105.sup.th position, or an asparagine substitution at 248.sup.th position and a threonine substitution at 250.sup.th position in an amino acid sequence of SEQ ID NO: 1, includes an N-glycan masking a fusion loop region of the mutant envelope protein of Zika virus. Also provided herein is a vaccine composition, including the mutant envelope protein or a recombinant virus including the nucleic acid molecule. Also provided herein is a method of preventing Zika virus infection and reducing antibody-dependent enhancement of dengue virus infection, including administering to a subject in need thereof an effective amount of a vaccine composition including the mutant envelope protein of Zika virus.
Claims
1. A mutant envelope protein of Zika virus, comprising an N-glycan masking a fusion loop region of the mutant envelope protein of Zika virus, wherein the mutant envelope protein of Zika virus has an asparagine substitution at 248.sup.th position and a threonine substitution at 250.sup.th position in an amino acid sequence of SEQ ID NO: 1.
2. A nucleic acid molecule, comprising a nucleotide sequence encoding the mutant envelope protein of Zika virus according to claim 1.
3. A vaccine composition, comprising the mutant envelope protein of Zika virus according to claim 1.
4. The vaccine composition according to claim 3, further comprising a precursor membrane protein of Zika virus.
5. A vaccine composition, comprising a recombinant virus including the nucleic acid molecule according to claim 2.
6. The vaccine composition according to claim 5, wherein the recombinant virus comprises a gene encoding a precursor membrane protein of Zika virus.
7. The vaccine composition according to claim 5, wherein the recombinant virus is a recombinant adenovirus.
8. A method of preventing Zika virus infection and reducing antibody-dependent enhancement of dengue virus infection, comprising administering to a subject in need thereof an effective amount of a vaccine composition including a mutant envelope protein of Zika virus, wherein the mutant envelope protein of Zika virus comprises an N-glycan masking a fusion loop region of the mutant envelope protein of Zika virus, wherein the mutant envelope protein of Zika virus has an asparagine substitution at 248.sup.th position and a threonine substitution at 250.sup.th position in an amino acid sequence of SEQ ID NO: 1.
9. The method according to claim 8, wherein the mutant envelope protein of Zika virus is expressed by a recombinant virus.
10. The method according to claim 9, wherein the recombinant virus is a recombinant adenovirus.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included here to further demonstrate some aspects of the present invention, which can be better understood by reference to one or more of these drawings, in combination with the detailed description of the embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
(8) In the following detailed description of the embodiments of the present invention, reference is made to the accompanying drawings, which are shown to illustrate the specific embodiments in which the present disclosure may be practiced. These embodiments are provided to enable those skilled in the art to practice the present disclosure. It is understood that other embodiments may be used and that changes can be made to the embodiments without departing from the scope of the present invention. The following description is therefore not to be considered as limiting the scope of the present invention.
(9) Definition
(10) As used herein, the data provided represent experimental values that can vary within a range of 20%, preferably within 10%, and most preferably within 5%.
(11) As used herein, the fusion loop region of the envelope protein of Zika virus or the mutant envelope protein thereof comprises the fusion loop of the envelope protein or the mutant envelope protein, and the region stereostructurally adjacent to the fusion loop, including the b strand, the bc loop, the ij loop, and the A strand. The fusion loop refers to the protein fragment on the amino acid residues 98 to 113, the b strand refers to the protein fragment on the amino acid residues 67 to 74, the bc loop refers to the protein fragment on the amino acid residues 75 to 89, the ij loop refers to the protein fragment on the amino acid residues 248 to 256, and the A strand refers to the protein fragment on the amino acid residues 313 to 320.
(12) As used herein, the term N-glycan refers to a glycan covalently linked to the asparagine of a protein with an N-glycosidic bond, comprising about at least ten different kinds of monosaccharide units. The N-glycans have different molecular weights and structures depending on monosaccharide components.
(13) Materials and Methods
(14) Cell Culture
(15) The cells used in the following examples can be purchased from the American Type Culture Collection (ATCC). The cells include human embryonic kidney cell line 293A (ATCC CRL-1573), human chronic myeloid leukemia cell line K562 (ATCC CCL-243), and Vero cells from African green monkey kidney epithelium (ATCC CCL-81) and Vero E6 cells (ATCC CRL-1586). The 293A cells were cultured in Dulbecco's Modified Essential Medium (DMEM) (Thermo Fisher Scientific) supplemented with 5% fetal bovine serum (FBS) and 100 U/ml penicillin and streptomycin (Invitrogen). The K562 cell lines were cultured in Iscove's Modified Dulbecco's Medium (IMDM) (Thermo Fisher Scientific) supplemented with 10% FBS and 100 U/ml penicillin and streptomycin. The Vero cells and the Vero E6 cells were cultured in Minimum Essential Medium (MEM) (Thermo Fisher Scientific) supplemented with 5% FBS and 100 U/ml penicillin and streptomycin. The abovementioned cells were cultured at 37 C. and 5% CO.sub.2.
(16) Virus
(17) ZIKV is the strain PRVABC59 (GenBank: KU501215.1); DENV2 is the strain NGC M29095. Both viruses were amplified in Vero cells. Briefly, Vero cells were infected with these viruses and cultured in MEM at 37 C. and 5% CO.sub.2 for 5 days. The supernatant was collected after centrifuging the resultant cultured medium to obtain viral stocks. The viral stocks were stored at 80 C.
(18) Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE)
(19) The samples were mixed with SDS-loading dye (50 mM Tris-HCl [pH 6.8], 2% SDS, 0.05% dithiothreitol (DTT), 0.1% bromophenol blue, and 10% glycerol) at a ratio of 3:1, and then boiled for 5 minutes. The samples were then loaded into gel which composed of 5% stacking gel (315 L of 1 M Tris [pH 6.8], 25 L of 10% SDS, 415 L of 30% acrylamide mix, 1.7 mL of deionized water, 25 L of 10% ammonium persulfate (APS), and 5 L of TEMED) and 10% separating gel (1.25 mL of 1.0 M Tris [pH 8.8], 50 L of 10% SDS, 1.67 mL of 30% acrylamide mix, 2 mL of deionized water, 50 L of 10% APS, and 5 L of TEMED). SDS-PAGE was performed in the following conditions: 80 V for the stacking step, and 120-150V for the separating step.
(20) Western Blotting
(21) Samples were transferred from SDS-PAGE gel to nitrocellulose (NC) membrane at 135V, and the membrane was treated with Tris(hydroxymethyl)amino buffered saline supplemented with 5% fat-free milk (abbreviated as TBST solution; 50 mM Tris, 150 mM sodium chloride, and 0.05% Tween-20), followed by shaking for at least one hour to block non-specific binding to antibodies. The membrane was washed by the TBST solution thrice, treated with anti-ZIKV envelope protein polyclonal rabbit antibodies (primary antibodies) (GeneTex) diluted 1:5000 in the TBST solution at 4 C. overnight, and washed by the TBST solution thrice. Secondary antibodies (HRP-conjugated goat anti-rabbit IgG, GeneTex) diluted 1:10000 in the TBST solution were used to detect primary antibodies, followed by washing thrice with the TBST solution. Upon detection, an enhanced chemiluminescence reagent (Western Lighting ECL; Perkin Elmer) was added to the membrane to generate a luminescence signal, and the membrane was blotted to Medical X-ray Films (Fujifilm).
(22) Recombinant Adenovirus Titer Determination
(23) The titer of the recombinant adenovirus was determined using the viral plaque assay to determine the amount of viral plaques that are caused by adenovirus in monolayer 293A cells. Briefly, the 293A cells were seeded in a 6-well plate at a cell density of 10.sup.6 cells per well. After one-day incubation at 37 C., recombinant adenovirus stocks ten-fold serially diluted with DMEM were added to each, followed by incubation at 37 C. overnight. Thereafter, the medium containing viruses was removed. Cells were overlaid with DMEM supplemented with 1% agarose (2 mL per well), cultured at 37 C. for 1-3 days, and DMEM was added again. Plaques were quantified in vision 7-10 days post-infection and were reported as plaque forming units (PFUs).
(24) Mice Immunization and Sample Collection
(25) BALB/c mice (6 weeks) were used in this experiment. Each mouse was intraperitoneally injected with 200 L of phosphate buffered saline solution (abbreviated as PBS; 137 mM sodium chloride, 2.7 mM potassium chloride, 4.3 mM disodium hydrogen phosphate, 1.4 mM potassium dihydrogen phosphate, dissolved in deionized water, pH 7.4) containing 10.sup.8 CFU of recombinant adenovirus or PBS only. Each group of mice was given two immunizations at intervals of about three weeks. Blood samples were collected from the tail of mice two weeks after the second injection. Sera was isolated from the blood samples by centrifugation at 3000 rpm for 30 minutes, heated at 56 C. for 30 minutes to inactivate complement, and then stored at 20 C. for further analysis.
(26) Determination of Antibody Content
(27) The titer of immunoglobulin G (IgG) in the serum of immunized mice is determined by an enzyme-linked immunosorbent assay (ELISA). First, a binding solution (0.05 M carbonate buffer, pH 9.6) containing 0.2 g/mL recombinant protein was added to a 96-well plate to form a recombinant protein coating. The 96-well plate was washed with the TBST solution, and blocking was performed for 1 hour at room temperature with 1% bovine serum albumin (BSA) in PBS, followed by washing with the TBST solution. Thereafter, the aforementioned serum was serially diluted by 1:40 or 1:100 with a dilution buffer containing 1% BSA and 0.05% Tween 20 in PBS for three-fold serial dilution, and added to the 96-well plate, followed by cultivation at room temperature for 1 hour. After washing with the TBST solution, the 96-well plate was incubated with HRP-conjugated goat anti-mouse IgG diluted 1:5000 at room temperature for 1 hour, followed by washing with the TBST solution. The substrate of HRP (3,3,5,5-Tetramethyl-benzidine, TMB; Biolegend) was added to the 96-well plate. After performing color reaction for 15 minutes in the dark, the reaction was terminated with 2 N sulfuric acid. Absorbance at 450 nm (OD.sub.450) for each well was measured using an ELISA reader. Statistically significant difference was compared via two-way ANOVA.
(28) Plaque Reduction Neutralization Test (PRNT)
(29) The titer of neutralizing antibodies in serum of immunized mice was determined using the plaque reduction neutralization test (PRNT). First, immunized mice sera were 2-fold diluted in a dilution ratio of 1:4 with PBS, and 100 L of the dilution was mixed with 100 PFU of ZIKV in equal volume, followed by incubation at 37 C. for 1 hour. The mixture of the serum and virus was added to the 6-well plate seeded with Vero cells at 510.sup.5 cells/well a day before, followed by incubation at 37 C. for 1 hour. Thereafter, the mixture in the 6-well plate was removed, and the decanted plate was overlaid with MEM supplemented with 1% methyl cellulose, 7.5% sodium bicarbonate, 100 U/mL penicillin-streptomycin, and 1M 2-[4-(2-hydroxyethyl) piperazin-1-yl]ethanesulfonic acid (HEPES) (2 mL/well). After 4-6 days of incubation at 37 C., the overlaid medium was removed and the cells were fixed and stained with 0.64% sodium chloride solution containing 1% crystal violet and 2% formaldehyde at room temperature for at least 1 hour, and back stained with water to quantify the viral plaque. The viral plaque amounts that are reduced by the serum-virus mixture treatment can be used to calculate the neutralization percentage of serum with different dilution multiples and to plot neutralizing curves compared to the viral plaque amounts when the cells are treated with virus alone. The titer of the neutralizing antibody is defined as the serum dilution multiple that reduces the viral plaque amounts by 50%, expressed as PRNT.sub.50. PRNT.sub.50 was calculated based on the neutralization test data via regression by Graph Pad Prism version 6.
(30) Antibody-Dependent Enhancement (ADE) Assay
(31) DENV was mixed with each immunized mice sera to infect Fc receptor-bearing K562 cells to determine infection enhancement Immunized mice sera or 4G2 antibodies were 4-fold serially diluted from 1:10 with IMEM, and 100 L of the dilution was mixed with DENV2 (MOI=1) in an equal volume, followed by incubation at 37 C. for 1 hour. The mixture of the serum or the antibody and virus was added to K562 cells, followed by incubation at 37 C. for 2 hours. After washing with IMDM, the cells were seeded in a 24-well plate and incubated at 37 C. for 48 hours. Thereafter, the cells were fixed by 4% paraformaldehyde in PBS at room temperature for 30 minutes and placed at 4 C. overnight, and then treated with 0.1% Triton X-100 in PBS for 5 minutes to increase cell permeability. Cells were stained with Alexa Flour 488-labeled 4G2 antibody (1:200 in blocking buffer) for 30 minutes at room temperature, and then resuspended in PBS for flow cytometry analysis (CytoFLEX, Backmen). Fold of enhancement was compared to K562 cells that incubated with DENV2 only.
Example 1
(32) Preparation of Recombinant Adenovirus Expressing Mutant Envelope Protein
(33) To mask the fusion loop and its adjacent region of ZIKV that is cross-reactive, six mutant envelope proteins with an N-glycan modification in the fusion loop region were designed in this Example 1, and the N-glycosylation sites are shown in
(34) TABLE-US-00001 TABLE 1 Mutant Amino Acid Sequence of Envelope Protein Mutation Site N-glycosylation Site ZE.sub.C74NP75V Residues 74 and 75 of b .sup.74NVT.sup.76 strand and bc loop ZE.sub.C105T Residue 105 of fusion .sup.103NGT.sup.105 loop ZE.sub.A248NA250T Residues 248 and 250 of .sup.248NHT.sup.250 ij loop ZE.sub.R252N Residue 252 of ij loop .sup.252NQT.sup.254 ZE.sub.T313N Residue 313 of A strand .sup.313NFT.sup.315 ZE.sub.T315NI317T Residues 315 and 317 of .sup.315NKT.sup.317 A strand
(35) To construct an adenoviral expression vector comprising the gene encoding the mutant envelope protein, a codon-optimized DNA was prepared in a synthetic manner, including a DNA fragment encoding the C protein terminal signal peptide (SEQ ID NO:2), a gene encoding the precursor membrane protein of the wild-type ZIKV (SEQ ID NO:3), and a gene encoding the envelope protein of the wild-type ZIKV (SEQ ID NO:4) from 5 end to 3 end. The DNA and the primers listed in Table 2 were subjected to site-directed mutagenesis using polymerase chain reaction (PCR) to obtain the DNA comprising the gene encoding the mutant envelope protein. The sequence of the DNA comprising the gene encoding the mutant envelope protein was confirmed by DNA sequencing, and the DNA was cloned into entry vector pENTR1A (Invitrogen) via KpnI and XhoI restriction sites, followed by cloning into adenoviral expression vector pAd/CMV/V5-DEST (Thermo Fisher Scientific) by way of LR Clonase II Enzyme Mix.
(36) TABLE-US-00002 TABLE2 Mutant Envelope SequenceofForward Protein Primer(F)andReversePrimer(R) ZE.sub.C74NP75V F:GATAGCAGAAATGTCACCCAGGG(SEQIDNO:5) R:CCCTGGGTGACATTTCTGCTATC(SEQIDNO:6) ZE.sub.C105T F:GGCAATGGCACTGGCCTGTTT(SEQIDNO:7) R:AAACAGGCCAGTGCCATTGCC(SEQIDNO:8) ZE.sub.A248NA250T F:TTCAAGGATAACCACACCAAGAG(SEQID NO:9) R:CTCTTGGTGTGGTTATCCTTGAA(SEQID NO:10) ZE.sub.R252N F:CACGCCAAGAACCAGACAGTG(SEQIDNO:11) R:CACTGTCTGGTTCTTGGCGTG(SEQIDNO:12) ZE.sub.T313N F:GCCGCCTTCAACTTCACCAAG(SEQIDNO:13) R:CTTGGTGAAGTTGAAGGCGGC(SEQIDNO:14) ZE.sub.T315N1317T F:TTCACCTTCAACAAGACCCCTG(SEQID NO:15) R:CAGGGGTCTTGTTGAAGGTGAA(SEQID NO:16)
(37) To obtain recombinant adenoviral particles that can be used to prepare vaccines, the aforementioned adenoviral expression vector was transfected into 293A cells by Turbofect reagent (Fermentas) after exposing inverted terminal repeats (ITRs) by digestion of restriction enzyme Pad. After the transfected cells were cultured at 37 C. for 11-14 days until 95% cells detached with cytopathic effect, the cells and the medium were collected. The cell lysates thus obtained were freezed and thawed from 80 to 37 C. for 3 rounds to destroy cells and release intracellular viral particles. The supernatant of the cell lysates was collected by centrifugation (3000 rpm, 10 minutes, 4 C.) to obtain stocks of the recombinant adenovirus, and the stocks were stored at 80 C. The recombinant adenoviruses that can be used to express the precursor membrane protein of ZIKV (comprising the amino acid sequence of SEQ ID NO:17) and the mutant envelope proteins ZE.sub.C74NP75V, ZE.sub.C105T, ZE.sub.A248NA250T, ZE.sub.R252N, ZE.sub.T313N, or ZE.sub.T315N1317T are designated as AdZ-prME-74, AdZ-prME-105, AdZ-prME-248, AdZ-prME-252, AdZ-prME-313, and AdZ-prME-315, respectively. As a control, the recombinant adenovirus that can be used to express the precursor membrane protein and the envelope protein of the wild-type ZIKV is designated as AdZ-prME-wt.
(38) Western blotting was performed to confirm whether human cells can express the mutant envelope protein with an N-glycan after infected with the aforementioned recombinant adenovirus. 10.sup.6 293 A cells were seeded in a 6-well plate. After one day of incubation, the cells were infected with the aforementioned recombinant adenovirus at multiplicity of infection (MOI) of 2 for 24 hours. Thereafter, the infected cells were treated with Glo lysis buffer (Promega) for 5 minutes, and the supernatant of the cell lysates was collected by centrifugation (10000g, 20 minutes, 4 C.). To examine the presence of the N-glycan on the mutant envelope protein, the supernatant was boiled and treated with PNGaseF (NEB) at 37 C. for 1-2 hours, followed by SDS-PAGE and Western blotting analysis. As shown in
Example 2
(39) Immune Injection of Recombinant Adenovirus Elicits Antigen-Specific IgG
(40) To examine the immune effect regarding the mutant envelope protein of ZIKV of the present invention, two doses of PBS (negative control group) or the recombinant adenovirus (10.sup.8 PFU/200 L) in Example 1 were administered to BALB/c mice (4-5 mice in each group) by intraperitoneal injection, and the total IgG titers of domain III (ZDIII) of the envelope protein of ZIKV in serum of the mice were detected using enzyme-linked immunosorbent assay (ELISA). The interval of two immune injections is about three weeks, and blood samples of the mice were collected two weeks after the second injection. The endpoint titer of the total IgG is the serum dilution multiple that results in an OD.sub.450 value of 0.2 in the ELISA experiment.
(41)
Example 3
(42) Immune Injection of Recombinant Adenovirus Elicits Neutralizing Antibodies Against ZIKV
(43) In the present example, after different immune injections according to the method described in Example 2, the titer of neutralizing antibodies against ZIKV in sera of immunized mice was determined using the plaque reduction neutralization test (PRNT). During the experiment, ten-fold diluted immunized sera or its two-fold serial dilutions were mixed and incubated with 100 PFU of ZIKV. Vero cells were then infected with the mixture of sera and virus to calculate the amount of viral plaques and to obtain the neutralizing curves. The titer of the neutralizing antibody is defined as the serum dilution multiple that reduces the viral plaque amounts by 50%, expressed as PRNT.sub.50.
(44)
Example 4
(45) Immunized Sera of Recombinant Adenovirus Reduces Enhancement of DENV Infection
(46) In the present example, after different immune injections according to the method described in Example 2, the antibody-dependent enhancement (ADE) assay was used to determine whether the immunized sera of mice reduce antibody-dependent enhancement of DENV infection. During the experiment, ten-fold diluted immunized sera or its two-fold serial dilutions were mixed and incubated with DENV2. Lymphoblast cells K562 were then infected with the mixture of sera and virus to measure the fold of infection enhancement. The fold of infection enhancement was compared with the degree of infection of K562 cells that only incubated with viruses. 4G2 antibodies against the envelope protein of Flavivirus were used as the positive control for the ADE assay of DENV, and the antibodies have been demonstrated to recognize envelope proteins of DENV and ZIKV.
(47)
(48) In summary, the mutant envelope protein of ZIKV of the present invention has additional N-glycosylation modifications due to specific point mutations. In contrast to antibodies elicited by the wild-type envelope protein that neutralize ZIKV but significantly enhance DENV infection, the mutant envelope protein masks the fusion loop region that is highly conserved and cross-reactive by the N-glycan, and can elicit antibodies which neutralize ZIKV but reduce antibody-dependent enhancement of DENV infection in a subject. Therefore, the mutant envelope protein of ZIKV of the present invention enhances the individual's immunity against ZIKV infection and at the same time reduces the risk of suffering from critical illness of DENV infection in a subject. Accordingly, the mutant envelope protein of ZIKV, particularly the mutant envelope protein comprising single substitution of C105T or double substitutions of A248N and A250T, or a recombinant virus including the nucleic acid molecule comprising the nucleotide sequence encoding the mutant envelope protein can be used to prepare the vaccine composition having the dual efficacy described above.
(49) Although the present invention has been described with reference to the preferred embodiments, it will be apparent to those skilled in the art that a variety of modifications and changes in form and detail may be made without departing from the scope of the present invention defined by the appended claims.