METHOD OF CULTURING SEGMENTED FILAMENTOUS BACTERIA IN VITRO

20190367867 ยท 2019-12-05

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to an in vitro method of culturing a segmented filamentous bacterium strain, comprising co-culturing said segmented filamentous bacterium strain with a eukaryotic host cell, wherein the culture is performed at an O.sub.2 level inferior to 5% in a rich tissue culture liquid medium containing bacterial medium components including iron. The present invention also relates to methods for genetically modifying a segmented filamentous bacterium strain comprising a step a culturing the strain in vitro.

    Claims

    1. An in vitro method of culturing a segmented filamentous bacterium strain, comprising co-culturing said segmented filamentous bacterium strain with a eukaryotic host cell, wherein the culture is performed at an O.sub.2 level inferior to 5% in a rich tissue culture liquid medium containing bacterial medium components including iron.

    2. An in vitro method of culturing a segmented filamentous bacterium strain, comprising the steps of: a) growing a eukaryotic host cell on a solid culture medium; b) immerging the eukaryotic host cells grown in step a) in a eukaryotic host cell-SFB liquid culture medium; c) challenging the cell culture of step b) with a SFB strain, preferably an intracellular SFB offspring; d) co-culturing the live eukaryotic host cell and the SFB strain in the liquid culture medium at an O.sub.2 level inferior to 5%; and optionally e) recovering the cultured SFB strain.

    3. The method according to claim 1 or claim 2, wherein the eukaryotic host cell is an epithelial cell or a cancer cell.

    4. The method according to any one of claim 1 to 3, wherein the eukaryotic host cell is a cell from the gastrointestinal tract or a carcinoma cell.

    5. The method according to any one of claim 1 to 4, wherein the eukaryotic host cell is selected from the group consisting the human Caco-2, TC7 or HeLa cell lines or mouse mICcl2 or CMT93 cell lines.

    6. The method according to any one of claim 2 to 5, wherein in step a) the eukaryotic host cell is grown at an O.sub.2 level between 0% and 5%, preferably between 0.5 and 3%, more preferably between 1 and 2.5%.

    7. The method according to any one of claims 2 to 6, wherein in step b) the eukaryotic host cell-SFB liquid culture medium is a rich tissue culture medium containing bacterial medium components including iron.

    8. The method according to any one of claims 1 to 7, wherein the liquid culture medium comprises DMEM/F12 advanced medium, supplemented with fetal calf serum, non-essential amino acids, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, brain-heart infusion, a yeast/peptone/casein amino-acid mixture and iron.

    9. The method according to any one of claim 1 to 8, wherein in step b) the SFB strain is in the form of a filament or an intracellular offspring.

    10. The method according to any one of claim 2 to 9, wherein in step c), the SFB strain is closely contacted with or in directly contacted with the eukaryotic host cell.

    11. The method according to any one of claim 1 to 10, wherein the co-culture of the eukaryotic host cell and the SFB is performed at an O.sub.2 level between 0% and 5%, preferably between 0.5 and 3%, more preferably between 1 and 2.5%.

    12. The method according to any one of claim 1 to 11, wherein iron is at a concentration between 0.015 and 0.05 mM.

    13. The method according to any one of claim 2 to 12, wherein the cultured SFB strain is recovered in a form of a filament, an intracellular offspring or a spore.

    14. A method for genetically modifying a segmented filamentous bacterium strain by conjugation, comprising the steps of: i) genetically modifying an Escherichia coli strain with a recombinant shuttle vector DNA comprising a DNA sequence of interest to introduce in the SFB strain, wherein the said shuttle vector DNA is capable of replicating in the E. coli strain, and in the SFB strain to be targeted for genetic modification; ii) co-culturing the genetically modified E. coli strain obtained in step i) together with the SFB strain to be targeted for genetic modification according to in vitro method of culturing of any one of claims 2 to 13, wherein: in step c) of said method of culturing, the cell culture of step b) is challenged with both the SFB strain to be targeted for genetic modification, preferably an intracellular SFB offspring, and said genetically modified E. coli strain; and in step d) of said method of culturing, the live eukaryotic host cell, the SFB strain and the genetically modified E. coli strain are co-cultured in the liquid culture medium at an O.sub.2 level inferior to 5%; iii) recovering the genetically modified SFB strain of step ii).

    15. A method for genetically modifying a segmented filamentous bacterium strain by electroporation, comprising the steps of: i) culturing and recovering a segmented filamentous bacterium strain according to the in vitro method of culturing of any one of claims 2 to 13; ii) mixing the SFB strain recovered in step i) with a purified plasmid to be transfoimed, preferably in glycerol/H.sub.2O; iii) applying an electric pulse to the mixture obtained in step ii); iv) recovering the genetically transformed SFB strain.

    16. A method for genetically modifying a segmented filamentous bacterium strain by chemical transformation, comprising the steps of: i) culturing and recovering a segmented filamentous bacterium strain according to the in vitro method of culturing of any one of claims 2 to 13; ii) mixing the SFB strain recovered in step i) with a purified plasmid to be transformed, preferably in glycerol/calcium chloride; iii) incubating the mixture obtained in step ii); iv) optionally applying a heat shock to the mixture; v) recovering the genetically transformed SFB strain.

    17. An isolated genetically modified SFB strain expressing an antigen of interest derived from a microorganism or a cell different from a SFB.

    18. A live genetically modified SFB strain expressing an antigen of interest derived from a microorganism or a cell different from a SFB for use as a medicament, preferably for use in preventing or treating a disease caused by a microorganism from which said antigen derives or a cancer.

    19. A therapeutic immunogenic composition comprising a live genetically modified SFB strain expressing an antigen of interest derived from a microorganism or a cell different from a SFB.

    Description

    [0135] FIG. 1: Growth and growth requirements of SFB in vitro. a, Gram stain and length of SFB before and after 5-m filtration; b, qPCR of SFB growth on host cells at the indicated conditions; c, SEM images of 4-day-old SFB filaments grown anaerobically on TC7 cells on transwells; d-i, SFB growth at low oxygen concentrations (d), on the indicated cell line seeded on transwells; e, on TC7 cells at indicated cell confluence; f, g, under various b, i, h, Statistical analysis using the two-tailed ttest (*P=<0.05, **P=<0.01, ***P=<0.001).

    [0136] FIG. 2: Differentiation of SFB from filaments to intracellular offspring during in vitro growth. A, Schematic representation of an SFB filament highlighting stages of its growth and differentiation. Gram stain of SFB after 4 days of growth on B, TC7 cells incubated at the indicated condition, and C, TC7 cells grown on transwells in low oxygen. Analysis of SFB grown on mICcl2 cells (D-G) and TC7 cells (H) on transwells at 1-2.5% O2: D, qPCR quantification (means.d. of triplicates); E, length of individual SFBs; F, Gram stain; and G, segment length analysis of representative 2-day-old SFB filaments. H, SEM of SFB after 4 days of growth. B-H, Representative images and values from one of three experiments performed in triplicate with (D) meanss.d.

    [0137] FIG. 3: Viability, colonization, and immunostimulatory potential of in vitro-grown SFB. a, SFB length after growth on TC7 cells on transwells; b, quantification and c, Gram stain of SFB growth on TC7 cells on transwells before and after a 3-day sub-culturing of the 5-m filtrate; d-k, analysis of germ-free C57BL/6 mice gavaged with either filament/intracellular offspring mix, intracellular offspring, or faeces of SFB-monoassociated mice (SFBVivo); d, quantification of ileum-associated SFB; e, k, Host gene expression in the ileal lamina propria; representative flow cytometry plots and quantification of (f, g) B220+ B cell and (i, j) CD45+CD3+CD4+ T cell frequencies of the indicated markers; h, faecal secretory IgA quantification by ELISA. a-k, Images and values are representatives from one of two experiments performed (a-c) in duplicate with meanss.d. or (d-k) performed with four to six mice per group. Statistical analysis using the two-tailed t-test (***P=<0.001).

    [0138] FIG. 4: SFB-host cell interaction and host response. SEM of SFB attached to subconfluent (A) and confluent (B) mICcl2 cells after 2 days of intracellular offspring challenge. C, Merge (M) of 4,6-diamidino-2-phenylindole (DAPI) (D) and actin (A) stain of mICcl2 cells challenged with intracellular offspring for 2 days showing confocal slices (s) and Z-projections. D, SEM of 3-day-old SFB filament attached to TC7 cells. Host response using qPCR analysis of mICcl2 cells (E, F, H) and TC7 cells (G) 3 days after challenge with (E-G) SFB or (H) various MAMPs. NS, not significant; BDL, below detection limit. Images and values are representatives from one of two experiments performed in triplicate (A-D) or are cumulative values from four experiments performed in triplicate with box plots of 25-75% centiles with min/max whiskers (E-G) or meanss.e.m.; (H) with a two-tailed t-test statistical analysis (*P=<0.05, **P=<0.01, ***P=<0.001).

    [0139] FIG. 5. Intestinal colonization of in vitro-grown SFB and host response. a, b, qPCR quantification (a) and SEM (b) of in vitro-grown SFB used for gavage. c, qPCR quantification of SFB in faecal samples. d, SEM of SFB attachment in vivo at 25 days after gavage of C57BL/6 mice with SFBVivo or SFBVitro. e, SEM of 21-day SFBcolonized germ-free C3H/HeN mouse ileum showing vacant attachment sites. f, Host gene expression in the ileal lamina propria in conventional or germ-free mice colonized with either SFB or E. coli for 21 days. Images and values are representatives from one of two experiments (a-e) or are cumulative values from two experiments performed with a total of seven germ free, four SFB, five E. coli, and four conventional mice (f), showing box plots of 25-75% centiles with median and minimum/maximum whiskers. c, f, Two-tailed t-test statistical analysis (*P=<0.05, **P=<0.01).

    EXAMPLE 1

    Growth and Host Interaction of Mouse Segmented Filamentous Bacteria In Vitro

    [0140] Materials and Methods

    [0141] Cell Culture and SFB-Specific Culture Medium

    [0142] TC7, CMT93, and HeLa cells were cultured in DMEM (Gibco 31885) with 10% inactivated fetal calf serum (FCS; AbCys CVFSVF00-0U) and non-essential amino acids (Invitrogen 11140-035). mICcl2 were maintained in DMEM/F12 advanced medium (Gibco 12634) with 2% inactivated FCS and Glutamax (Gibco 35050) and supplemented with 10 nM hEGF (Sigma E9644), 50 nM dexamethasone (Sigma D4902) and 1 nM triiodothyronine (Sigma T5516). HeLa cells were obtained from ATCC. All cell lines were tested for mycoplasma every 2 weeks and always found to be negative. Cells were plated either on regular 12-well tissue culture plates or on Costar transwell plates with 0.4-m filters (Sigma CLS3460 and Fisher Scientific W2127P) from 1 to 3 days before the experiment such that a monolayer was present at the start of the experiment and added to a low oxygen chamber overnight for slowly lowering oxygen concentrations in the medium of the cells. At the start of SFB culturing, the TC7, CMT93, HeLa and mICcl2 medium is first replaced with (equilibrated: 1% oxygen) medium before SFB addition (directly to the TC7 cells).

    [0143] SFB medium was made up as follows: DMEM/F12 advanced medium with 2% FCS, Glutamax and 12.5 mM HEPES (Sigma H0887) with the following supplementation: 1 in 100 dilution of (1) brain-heart infusion (BD Difco 237500) 5 concentrated, (2) peptone/yeast (BBL Biosafe 211862) at 10% and casein amino acids at 5% (DIFCO 0320-01-1), (3) ribose/cellobiose/mannose (Sigma: R9629, C7252, M6020) at 200 mM; 1 in 1,000 dilution of (1) ferrous sulphate (Merck 3965) at 10 mM, (2) ferric ammonium citrate (LabGuard 0658) at 12.5 mM, (3) Hemin (Sigma 51280) at 1.5 mM in 50% ethanol with 1.4 N NH4OH, (4) sodium ascorbate at 10 mg ml.sup.1 with 1-phosphoascorbate at 500 mM (Sigma: A4034, 49752); 1 in 10,000 dilution of retinoic acid (Sigma R2625) at 30 mg ml.sup.1 in DMSO; 1 in 500 dilution of (1) sperm DNA (Life Technologies 15632-011) at 10 mg ml.sup.1 digested for 1 h with 10 l DNaseI (Roche 04 716 728 001) at 37 C. and heat inactivated at 75 C. for 30 min, (2) RNA at 10 mg ml.sup.1 (Sigma R6750) undigested. SFB medium specific medium supplements, except for the nucleotides and hemin were prepared fresh every 2 weeks and otherwise stored at 4 or 20 C. for retinoic acid, and nucleotides. When mICcl2 cells were used, SFB medium was further supplemented with hEGF, dexamethasone, and triiodothyronine. Notably, additional supplementation with 0.2% yeast extract (BD 212750; 1/100 from 20%) further improves SFB growth and it is not necessary to add ascorbate, phosphoascorbate or hemin.

    [0144] Purification of Intracellular Offspring from SFB-Monoassociated Mice and Infection Protocol

    [0145] All liquids used for the isolation of intracellular offspring were pre-equilibrated overnight in an anaerobic chamber set to 0% oxygen. SFB-monoassociated JH.sup./ mice were killed aseptically in a tissue culture hood and then placed in an anaerobic cabinet for dissection. The ileal, caecal, and colonic contents were resuspended in 50 ml PBS and homogenized by vortexing. Homogenates were passed through a 100-m mesh to remove large faecal debris. The filtrate was spun at 8,000 g for 5 min to pellet bacteria and insoluble material, and the pellet was resuspended in 3 ml PBS per mouse killed, layered onto 3 ml 50% and 2 ml 30% Nycodenz (AbCYS 1002424) solution made with PBS in 15 ml Falcon tubes and spun for 10 min at 4,000 g. SFB within the 30% fraction were collected, diluted in PBS, and bacteria were pelleted for 10 min at 8,500 g. Pellets were resuspended in 15 ml pre-equilibrated PBS by pipetting/vortexing and filtered through a 5-m filter (Sigma Z612502). The filtrate was again centrifuged for 5 min at 8,000 g and the pellet was resuspended in an appropriate amount of pre-equilibrated culture medium. Usually one mouse was killed for every four 12-well plates used, and 50 l of bacterial suspension was added to each well. To facilitate adhesion, cells challenged with SFB were sealed in ziplock bags within the cabinets, removed from the cabinet, and spun for 10 min at 300 g.

    [0146] SFB are allowed to grow in the presence of eukaryotic cells for 3 days during which the oxygen concentration is increased incrementally from 1% on day 0 to 1.5% on day 1, to 2% on day 2, and to 2.5% on day 3. Subcultures can be prepared on day 3 by taking aliquots of the culture supernatant and using this to challenge freshly prepared eukaryotic cells (prepared as described above on transwell filters and at low oxygen conditions).

    [0147] SFB Recovery, and Quantification and Analysis of SFB Growth

    [0148] To recover SFB, the culture supernatant was collected and centrifuged for 4 min at 8,000 g and the pellet was resuspended in 100 l PBS, of which 20 l was spotted on glass slides for the Gram stain, 30 l was mixed with an equal volume of 50% glycerol and frozen at 80 C., and the remaining 50 l was used for DNA extraction. The DNA was isolated with a Qiagen stool kit (51504; without the use of the inhibitor tablet) and diluted 1 in 20. SFB growth was enumerated by qPCR analysis of the 16S rRNA genes using the following primer pairs: the SFB specific F: 5-AGGAGGAGTCTGCGGCACATTAGC-3 (SEQ ID NO: 1); and the universal R: 5-TCCCCACTGCTGCCTCCCGTAG-3 (SEQ ID NO: 2). For qPCR, 6 l of diluted SFB DNA was mixed with 1.5 l of a 4 mM primer mix and 7.5 l of Power SybrGreen Master mix (Applied 4368708) and run on an ABI 7900HT machine in a 384-well plate. Statistical analysis used a two-tailed Student's t-test (*P=<0.05, **P=<0.01, ***P=<0.001). SFB segment length analysis used ImageJ. For SEM analysis, SFB-containing supernatants were washed with PBS and suctioned onto 0.1-m filters (Watman 110405) and fixed in 0.1 M cacodylate buffer containing 2.5% glutaraldehyde before being processed. Cells for SEM were fixed in PHEM buffer (18.14 g PIPES, 6.5 g HEPES, 3.8 g EGTA, 0.99 g MgSO4 per litre with 10 M KOH to pH 7.0) containing 4% sucrose and 2.5% glutaraldehyde, and processed for SEM. For fluorescence, cells were fixed in PBS/3.7% PFA, peimeabilized with PBS/0.1% Triton X-100, stained with DAPI and A568-phalloidin, and stacks of 0.4-m slices were taken on a Leica SP5 confocal microscope.

    [0149] Colonization of Germ Free Mice with In Vitro-Grown SFB

    [0150] This experiment was done independently twice with similar results; one experiment is shown. SFB grown in vitro for 3 days on TC7 and mICcl2 cells on transwells were divided in equal parts and one half was filtered through a 5-m filter to obtain a fraction containing intracellular offspring only. Bacteria were concentrated by centrifugation to obtain 0.25 ml of bacteria in PBS per mouse. The number of animals used followed availability of animals, isolators, and input quantities. Randomization or blinding was otherwise not performed. Two groups of four 11-week-old C57BL/6 male and female mice maintained at the germ-free facility were starved for one night, gavaged with 0.25 ml 400 mM sodium bicarbonate, followed by 0.25 ml of in vitro-grown SFB. Age-matched control mice were colonized with in vivo-derived SFB as described below. Faecal samples were collected for each mouse at various times during a 3 week period, SFB DNA was extracted using a Qiagen stool kit and quantified on the basis of qPCR analysis of 16S rDNA and comparison with a SFB DNA sample of known SFB genome concentration as determined by Illumina sequencing. To monitor SFB associated with the ileum, DNA was extracted from frozen ileal biopsies using the method in Godon et aL, 1997.

    [0151] Isolation and Staining of Lamina Propria Lymphocytes from C57BL/6 Mice

    [0152] Age-matched germ-free B6 mice and mice colonized with either in vitro- or in vivo-grown SFB for 3 weeks were analysed for their innate and adaptive immune response as described in Ivanov et al., 2009. Briefly, after excision of Peyer's patches, the mouse small intestine was washed in PBS, and ileal samples were placed in RNAlater for RNA extraction, complementary DNA (cDNA) synthesis, and qPCR analysis using SYBR or Taqman technologies (Applied Biosystems) and a QuantStudio7 qPCR machine. Values were normalized to TfrC.

    [0153] Lamina propria lymphocytes (LPL) were prepared as previously described by Gaboriau-Routhiau et al., 2009. The remaining small intestine was incubated four times in 60 ml of PBS-3 mM EDTA (Sigma) for 10 min at 37 C., and digested in 60 ml of RPMI 1640 with 20% FCS (Gibco), 100 U ml.sup.1 collagenase (Sigma), and 175 U ml.sup.1 DNase I (Sigma) for 40 min at 37 C. LPL were then purified on a 40-80% Percoll gradient run for 15 min at 2,000 g and resuspended in DMEMGlutamax with 8% FCS, 1 mM HEPES, 0.02 mM folic acid, 0.67 mM L-arginine, and 0.27 mM L-asparagine (all from Sigma).

    [0154] Analysis of LPL for surface antigens and intracellular expression of IL-17 and IL-10 was by flow cytometry as described5. Briefly, LPL were stimulated for 4 h with 100 ng ml.sup.1 phorbol 12-myristate 13-acetate and 1 g ml.sup.1 ionomycin, in the presence of Brefeldin A (10 g ml.sup.1) (all from Sigma). Cells used for surface analysis were left unstimulated. For surface staining, LPL were labelled for 20 min at 4 C. with a cocktail of the following antibodies: FITC-anti-GL7 (clone GL7), PerCP-anti-CD8a (clone 53-6.7), APC-H7-anti CD4 (clone GK1.5), AF647-anti-B220 (clone RA3-6B/2) (all from BD Pharmingen), PE-anti-IgA (Southern Biotech), and eFluor450-anti-CD45 (clone 30-F11) and PECy7-anti-CD3 (clone 145-2C11) (both from eBioscience).

    [0155] For intracellular cytokine staining, cells were further fixed in 2% PFA for 20 min at room temperature (24 C.), and washed and stained overnight at 4 C. with PE-anti-IL-17 (clone TC11-18H10) and APC-anti-IL-10 (clone JES5-16E3) (BD Pharmingen) diluted in PBS-1% FCS-0.5% saponin (Sigma). Labelled cells were analysed with a FACSCanto II and FACSDiva software (BD Biosciences). Gates were set on living cells after Aqua live/dead dye exclusion (Invitrogen).

    [0156] For qPCR analysis, the median value of germ-free mice was calculated and used as the reference value of 1 for comparison of the median value of the test samples.

    [0157] Colonization of Germ-Free Mice with SFB from Faeces and E. coli

    [0158] Germ-free male and female C3H/HeN mice were obtained from INRA (ANAXEM platform) germ-free facilities. Eight- to nine-week-old germ-free mice were gavaged with 0.5 ml of either fresh anaerobic cultures of E. coli MG1655 or faecal homogenate from SFBmonoassociated mice (Ivanov et al., 2009). Colonization by SFB was monitored in faeces through bacterial DNA extraction and 16S rDNA amplification by qPCR using specific primer pairs for SFB. Values were normalized to Ccl25, a constitutively expressed epithelial cell marker, and compared with the median value from germ-free control mice. Germ-free and gnotobiotic mice were maintained in plastic isolators and fed ad libitum on a commercial diet sterilized by -irradiation (40 kGy). The numbers of animals used followed availability of animals, isolators, and were obtained from two independent experiments. Randomization or blinding was otherwise not performed. Gnotobiotic mice were killed on day 21 after colonization in parallel with age-matched germ-free controls. All animal procedures were performed in accordance with French legislation and EEC regulations for the care and use of laboratory animals, approved by the local ethics committee and authorized by the French Ministry of Research.

    [0159] Host Response In Vitro to SFB Growth and MAMP Stimulation

    [0160] Host response to SFB and MAMPs included pooled results from four independent experiments with three technical samples. Generally a minimum of triplicate biological replicates were used and increased if trends were clear but significance not. After 3 days of in vitro growth of SFB on either mICcl2 or TC7 cells on transwells in SFB medium lacking hemin and sodium ascorbate, at 1-2.5% oxygen, cells were lysed and RNA was extracted using a Nucleospin RNA kit (Macherey-Nagel). cDNA was synthesized using RNA superscript II, oligo dT, RNaseout, and dNTPs (Invitrogen), and pPCR was performed on an ABI 7900HT and QuantStudio7 (Life Technologies) qPCR machine using the protocol described by Schnupf et al., 2012. TaqMan assays were performed as suggested by the supplier. Values were normalized to B2M and Ct values for Reg3, Tnf, and Fabp2 were set to 41 in control cells owing to the lack of transcript detection. MAMP stimulation used the following agonists at the highest concentrations recommended by the supplier (Invivogen): Pam2CSK4 (tlrlpm2 s-1) at 100 ng ml.sup.1, Pam3CSK4 (tlrl-pms) at 300 ng ml.sup.1, peptidoglycan of E. coli K12 (Tlr-ksspgn) at 10 g ml.sup.1, MDP (tlrl-mdp) at 10 g ml.sup.1, CpG (tlr-1584) at 3 g ml.sup.1, flagellin (tlrl-pstfla-5) at 100 ng ml.sup.1. Excess for flagellin (10) was also tested and found to be similar.

    [0161] Mouse and Human qPCR Primers Used

    [0162] Mouse Taqman Assays:

    [0163] B2M Mm00437762_m1, TfrC Mm00441941_m1, Ccl25 Mm00436443_m1, Fabp2 Mm00433188_m1, Reg3g Mm01181783_g1, Fut2 Mm00490152_S1, Aqp3 Mm01208559_m1, Pigr Mm00465049_m1, Ltf Mm00434787_m1, Tff3 Mm00495590_m1, Tnfa Mm00443258_m1, IL1a Mm00439620_m1, IL1b Mm00434228_m1, IL6 Mm00446190_m1, IL15 Mm00434210_m1, IL18 Mm00434225_m1, Cxcl2 Mm00436450_m1, Ccl2 Mm00436450_m1, Ccl5 Mm01302428_m1, Ccl7 Mm01308393_g1, Ccl20 Mm01268754_m1, Ccl28 Mm00445039_m1, Csf2 Mm01290062_m1

    [0164] Mouse Sybr Primers

    TABLE-US-00001 B2M: F: (SEQIDNO:3) tcagtcgtcagcatggctcgc; R: (SEQIDNO:4) tccggtgggtggcgtgagtatac iNos: F: (SEQIDNO:5) cagctgggctgtacaaacctt; R: (SEQIDNO:6) cattggaagtgaagcgtttcg Saa1: F: (SEQIDNO:7) catttgttcacgaggcatcc; R: (SEQIDNO:8) gtttttccagttagcttccttcatgt Saa2: F: (SEQIDNO:9) tgtgtatcccacaaggtttcaga; R: (SEQIDNO:10) ttattaccctctcctcctcaagca Saa3: F: (SEQIDNO:11) cgcagcacgagcaggat; R: (SEQIDNO:12) ccaggatcaagatgcaaagaatg Cxcl1: F: (SEQIDNO:13) tggctgggattcacctcaag; R: (SEQIDNO:14) caagcctcgcgaccattct Cxcl10: F: (SEQIDNO:15) gccgtcattttctgcctcat; R: (SEQIDNO:16) gcttccctatgcccctcatt

    [0165] Human Taqman Assays:

    [0166] B2M Hs00984230_m1, Saa1 Hs00761940_s1, Saa2 Hs01667582_m1, IL6 Hs00985639_m1, IL8 Hs99999034_m1, Ccl20 Hs01011368_m1, Reg3g Hs00417999_m1, iNos Hs01075529_m1, Cxcl10 Hs00171042_m1, Fut2 Hs00382834_m1, IL15 Hs01003716_m1, IL18 Hs01038788_m1, Ccl5 Hs00982282_m1

    [0167] Results

    [0168] SFB-Host Cell Co-Culturing System

    [0169] SFB strain (Bolotin et al., 2014) isolated from monoassociated mice was deposited at CNCM (Collection Nationale de Cultures de Microorganismes, 25 rue du Docteur Roux, Paris) on Dec. 23, 2014, under the accession number CNCM I-4932 (Arthromitus muris strain referred to as SFB-mouse-NL). SFB were cultured with eukaryotic cells grown in low but physiological oxygen conditions (He et al., 1999) in a rich tissue culture medium containing bacterial medium components and additional supplements. SFB from monoassociated mice were collected, filtered through a 100-m mesh, separated from most other faecal matter using a Nycodenz column and passed through a 5-m filter to obtain a pure culture of unicellular intracellular offspring (average 0.7 m) (FIG. 1a). Eukaryotic cells grown on tissue culture wells or transwells were placed in a humidified anaerobic cabinet, challenged with intracellular offspring, and kept at either strict anaerobic conditions within a sealed box or left in the anaerobic cabinet where the oxygen concentration was maintained at low levels (0.5-1.4% O2). After 4 days, bacterial growth in the culture supernatant was quantified by quantitative PCR (qPCR) using SFB-specific 16S rDNA primers (FIG. 1b) and confirmed using scanning electron microscopy (SEM) (FIG. 1c). SFB growth was observed in all conditions for most cell lines assayed but growth was usually enhanced on transwells compared with tissue culture wells and growth was significantly better in the presence of oxygen, revealing SFB to be a relatively aerotolerant anaerobe. Both human (TC7/HeLa) and mouse (mICcl2/CMT93) cell lines supported growth but the TC7 was the most resilient cell line generally supporting SFB growth most robustly. On the basis of temporal analysis, the highest exponential growth phase occurred between days 1 and 3, with an average maximum doubling time of 5.0 h (FIG. 1d).

    [0170] Growth Requirements for SFB

    [0171] SFB growth had a striking dependence on host cell number, decreasing in number with decreasing cell density (FIG. 1e). In addition, negligible growth occurred in medium alone, medium supplemented with cell lysate, or when cells were fixed before SFB challenge (FIG. 1f), indicating that live host cells are required for SFB proliferation. SFB also required close contact for efficient growth as only little growth (0-6%) occurred when intracellular offspring were added to the bottom chamber of transwells or when bacteria were placed in transwells above TC7 cells in tissue culture wells (FIG. 1f, g). Yet, as host cell contact was not an absolute requirement, it suggests that host cells may release a soluble factor that promotes SFB growth. To address the requirement for medium supplementation, SFB were grown on TC7 cells in complete medium or medium missing individual additives. Brain-heart infusion, a yeast/peptone/casein amino-acid mixture, and particularly iron supplementation were critical for SFB growth (FIG. 1h, i).

    [0172] In the 1970s, transmission electron microscopy studies of SFB present in the murine gut led to a proposed life cycle: attachment to epithelial cells via the holdfast at the intracellular offspring tip leads to filamentous growth and is followed by a complex developmental progression that starts at the distal tip and ultimately leads to intracellular offspring formation and release (FIG. 2A) (Chase et al., 1976; Ferguson et al., 1979). According to this model, when filaments grow beyond 50 m in length, the large primary filament segments start to undergo a symmetrical division to form smaller secondary segments. These differentiate by dividing asymmetrically to form a mother/daughter cell. The daughter cell becomes engulfed and subsequently divides to form two intracellular offspring within the surrounding mother cell segment. Intracellular offspring are then released from the filament by breakdown of the filament septa and cell wall and reattach to the host.

    [0173] In vitro, growth of SFB on TC7 cells often yielded considerable quantities of long filaments that could be clumped together in a hairball-like phenotype easily seen with the naked eye (FIG. 2B). Most of these filaments were undifferentiated after 4 days, with only some filaments showing a characteristic heterogeneous staining of differentiating filaments (FIG. 2B, left-hand column, bottom two panels). Intracellular offspring could be seen located at the filament tip or occasionally in the central part of a filament (FIG. 2C), similar to filaments recovered from SFB-monoassociated mice (data not shown). Differentiation of SFB occurred on all four cell lines tested, but we noticed that differentiation was more pronounced when higher oxygen concentrations (1-2.5%) were used. In time-course analysis at this higher oxygen concentration (FIG. 2D), only short bacteria were detected 1 day after challenge (FIG. 2E, F). After 2 days, only long filaments were present (FIG. 2E, F) and the bacterial septa could be identified quite clearly using the Gram stain (FIG. 2F). Three types of filament were found (FIG. 2F, G): short filaments with long intracellular segments of 2.6 m; medium-sized filaments with smaller intracellular segments of 1.2 m; and medium to long filaments that had a more heterogeneous distribution of segment lengths including very small segments (FIG. 2F, G) and rare segments with half-circular structures (FIG. 2F, Day 2-3, arrow) that resembled the engulfment of a daughter cell by a mother cell. After 3 days of growth, most filaments had differentiated, at least in part, to the final intracellular offspring stage and intracellular offspring could be seen in a characteristic doublet orientation at the filament tip where the filament cell wall appeared to have lost its structure (FIG. 2F, far left column). Many intracellular offspring of varying lengths were also no longer associated with filaments. SEM confirmed the presence of the needle-like holdfast structure on intracellular offspring and at the tip of filaments (FIG. 2H, b-g), and could clearly distinguish between undifferentiated thin and smooth filaments (FIG. 2H, a, e-g) and those that were broader with a heterogeneous and bulbous morphology that corresponded to differentiating filaments (FIG. 2H, a, g, h) (Chase et al., 1976; Ferguson et al., 1979). In addition, cell-wall remnants could be detected at the distal tip of differentiating filaments where intracellular offspring had been released (FIG. 2H, h and Extended Data FIG. 1b) (Chase et al., 1976). Together, these data demonstrate that in vitro culturing of SFB supports the full differentiation of in vitro-grown SFB filaments to the intracellular offspring stage and confirms the SFB life cycle inferred from in vivo observations.

    [0174] Viability and Infectivity of In Vitro Formed Intracellular Offspring

    [0175] SFB were first grown on TC7 cells under aerobic conditions (FIG. 3a) until many intracellular offspring appeared. After one additional day, intracellular offspring were no longer present and the average bacterial length was significantly longer, indicating intracellular offspring outgrowth into filaments. Similarly, when intracellular offspring grown in vitro were separated from filaments by filtration through a 5-m filter and added to newly plated cells, SFB numbers increased and the newly formed filaments differentiated into intracellular offspring at the filament tip (FIG. 3b, c), demonstrating filamentation and differentiation of in vitro-formed intracellular offspring. To assess whether SFB grown in vitro retained their ability to colonize mice and stimulate the characteristic innate and acquired immune responses, SFB grown in vitro for 3 days were divided into a filament/intracellular offspring fraction and a pure intracellular offspring fraction (FIG. 5a, b) and gavaged into germ-free mice. Colonization was firmly established by both inputs at 5 days after gavage (FIG. 5c) despite a 140-fold input difference for the filament/intracellular offspring and intracellular offspring fractions. However, unlike mice gavaged with SFB derived from faecal samples (SFBVivo), which generally showed good colonization of the ileum, mice gavaged with in vitro-grown SFB (SFBVitro) had much lower numbers of SFB colonizing the ileum (FIG. 3d and Extended Data FIG. 1d); instead they showed heavy colonization of the caecum (FIG. 5d). Thus, although SFBVitro clearly can attach to the ileum, these results suggest that ileal colonization may be more efficient by intracellular offspring released from spores found in the faecal input, possibly because of the expression of flagella at this particular stage of the life cycle (Pamp et al., 2012). Notably, the magnitude of the innate host response (FIG. 3e) was proportional to the colonization level of the ileum (FIG. 3e) and not the overall SFB faecal load (Extended Data FIG. 1c), revealing the requirement for ileal attachment of SFB to induce the innate host response. Similar to SFBVivo, albeit with less potency, SFBVitro were also able to stimulate the B-cell compartment in Peyer's patches (FIG. 3f, g), enhance IgA secretion in the faeces (FIG. 3h), and increase the number of Th17 cells and the level of IL-17A messenger RNA in the small intestine lamina propria (FIG. 3i-k).

    [0176] SFB-Host interaction and the Host Response to SFB Growth.

    [0177] Despite the apparent requirement for close contact between host cells and SFB for efficient growth, a tight interaction was not readily observed. However, when the interaction was promoted by gently spinning intracellular offspring onto cells, SFB filaments were found attached to mICcl2 cells (FIG. 4A-C). This stable interaction was accompanied by actin accumulation surrounding the filament tip (FIG. 4C) and could leave structurally intact vacant W attachment sites (FIG. 4A, c), similar to those observed in the ileum of mice (FIG. 5e). Attached filaments included both undifferentiated ones and those that had reached the final intracellular offspring stage. Contrary to in vivo results (Tannock et al., 1984), attachment in vitro was not species specific (FIG. 4D). To assess the similarity in the host response to SFB in vitro and in vivo, it was analysed the gene expression profile of epithelial derived host factors known to be regulated by SFB colonization (Ivanov et al., 2009; Gaboriau-Routhiau et al., 2009; Goto et al., 2014; Shima et al., 2008; Lcuyer et al., 2014). It was found that the gene regulation in vitro closely recapitulated gene regulation in vivo (FIG. 4E), thereby further supporting the in vitro model system. Going beyond previously implicated epithelial factors, it was tested several additional cytokines, chemokines, and host defence genes (FIG. 4F). The data show that SFB growth leads to a strong inflammatory host response, with the induction of pleiotropic inflammatory mediators such as tumour-necrosis factor- (TNF-), interleukin-1- (IL1-), and serum amyloid A 1-3 (Saa1-3), induction of several innate host defence mechanisms (Reg3, iNos, and lactoferrin), and an immunological environment that is conducive for the recruitment of B cells, the transmigration of IgA, recruitment and activation of T cells, and recruitment of neutrophils, dendritic cells, as well as monocytes. In agreement, it was observed that the transcript level of most immune genes that are upregulated during co-culture with mICcl2 cells in vitro was also increased by SFB, and not by Escherichia coli, during colonization experiments in vivo (FIG. 5f). Conversely, the transcriptional response in the human TC7 cell line was divergent from that observed in mICcl2 cells and less consistent with in vivo results (FIG. 4g). Lastly, by using an array of microbe-associated molecular patterns (MAMPs), it was demonstrated that the inflammatory response to SFB in vitro is probably shaped by the activation of TLR2 (FIG. 4h).

    [0178] Conclusion

    [0179] These data demonstrate the successful culturing of SFB in vitro and provide new insights into SFB growth requirements and the host response to SFB challenge. These data suggest that in vivo, attachment of SFB to the ileal surface is an important feature to elicit epithelial cell responses, whereas in vitro, where attachment remained infrequent, the close proximity of SFB and cells appears largely to bypass the need for attachment to deliver the stimulating signal(s). These findings highlight the importance of the privileged location of the replicative niche of SFB at the ileal epithelial surface in mediating the stimulatory potential of SFB.

    EXAMPLE 2

    Methods for Genetically Modifying a SFB Strain

    [0180] A series of modular shuttle vectors designed for use in Clostridia species (Heap et al., 2009) are tested for their ability to be stably introduced into SFB during in vitro growth using both conjugation and transformation. Each plasmid contains a different origin of replication with a choice of antibiotic resistance cassettes, multiple cloning sites and promoters. Conjugation and transformation are performed during in vitro growth of SFB.

    [0181] Conjugation

    [0182] An auxotrophic E. coli strain requiring the addition of Diaminopimelic acid to the medium for growth is used as a donor strain as this strain can be easily selected against in rich medium with the absence of diaminopimelic acid.

    [0183] SFB strain is purified from monoassociated mice as described above and intracellular offsprings (IOs) are added to host cells (TC7 cells) grown on either tissue culture or transwell plates under conditions described for SFB growth above.

    [0184] After substantial growth has occurred (2-4 days), diaminopimelic acid (100 ug/ml) and the donor E. coli strain (requiring dap addition for growth and carrying a plasmid) is added and centrifuged together with cells and SFB and maintained for a given time (e.g., 4-8 hours).

    [0185] Alternatively, in vitro grown (cultured) SFB are collected and mixed with the aforementioned E. coli strain and pelleted (all under low oxygen) and maintained in a pellet for varying amounts of time (e.g., 4-8 hours).

    [0186] Bacteria are collected and washed 2 with regular SFB growth medium lacking diaminopimelic acid before being put on fresh eukaryotic cells (always at low oxygen) with regular SFB medium but complemented with the appropriate antibiotic to which the conjugal plasmid gives SFB resistance to.

    [0187] After a given time (0-24 hours), SFV are collected and gavaged into germfree mice.

    [0188] Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water. The optimal and minimal regime of antibiotic use in the drinking water that is needed to cure SFB monoassociated mice from SFB is determined prior and used to select for recombinant SFB.

    [0189] Transformation by Electroporation

    [0190] As described above, SFB are grown (cultured) in vitro for 2-4 days on TC7 cells.

    [0191] SFB are collected and put on ice. Under low oxygen conditions and working with solutions put on ice, SFB are washed 6 with 10% glycerol/pre-equilibrated water before being resuspended and concentrated with 10% glycerol/H2O.

    [0192] Purified plasmid DNA is added and SFB is electroporated (6.5 kV.Math.cm.sup.1 to 25 kV.Math.cm.sup.1).

    [0193] SFB are placed in regular SFB medium again and spun onto fresh cells. SFB are allowed to recover for 3-24 hours before selective antibiotic be added overnight.

    [0194] SFB are gavaged into GF mice.

    [0195] Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water.

    [0196] Transformation by the Chemical Method: Calcium Chloride and Heat Shock

    [0197] As described above, SFB are grown in vitro for 2-4 days on TC7 cells.

    [0198] SFB are collected and put on ice. Under low oxygen conditions and working with solutions put on ice, SFB are washed 5 with 0.1M calcium chloride before being resuspended and concentrated with 10% glycero/0.1M calcium chloride.

    [0199] Purified plasmid DNA is added to SFB and incubated for 30 minutes.

    [0200] SFB are heat shocked at 42 C. for 30 seconds before being placed in regular SFB medium again and spun onto fresh cells. SFB are allowed to recover for 3-24 hours before selective antibiotic be added overnight.

    [0201] SFB are gavaged into GF mice.

    [0202] Alternatively, the above procedure may be performed at room temperature only without heat shock.

    [0203] Recombinant SFB are selected for and maintained by antibiotic treatment of the drinking water.

    REFERENCES

    [0204] Bolotin, A. et al., Genome Announc. 2, 1-2 (2014). [0205] Chappert, P. et al., Immunity 38, 1198-1210 (2013). [0206] Chase, D. G. & Erlandsen, S. L., J. Bacteriol. 127, 572-583 (1976). [0207] Danchin A., Molec. gen. Genet. 150, 293-299 (1977). [0208] Davis, C. P. and Savage, D. C., Infection and Immunity 13, 180-188 (1976). [0209] Ericsson, A. C., et al., Comparative Medicine, 64, 90-98 (2014). [0210] Ferguson, D. J. & Birch-Andersen, A., Acta Pathol. Microbiol. Scand. B 87, 247-252 (1979). [0211] Ferreira, P. C. D. et al., FEMS Immunol Med Microbiol. 54, 245-254 (2008). [0212] Ferreira, P. C. D. et al., Clinical and Vaccine Immunology 18, 1823-1833 (2011). [0213] Fleckenstein, J. et al., Expert Review of Vaccines 13, 631-639 (2014). [0214] Gaboriau-Routhiau, V. et al. Immunity 31, 677-689 (2009). [0215] Ghaem-Maghami, M. et al., Infect. Immun. 69, 5597-5605 (2001). [0216] Godon, J. J. et al., Appl. Environ. Microbiol. 63, 2802-2813 (1997). [0217] Goto, Y. et al., Science 345, 1254009 (2014). [0218] He, G. et al., Proc. Natl Acad. Sci. USA 96, 4586-4591 (1999). [0219] Heap, J. T., et al., J. Microbiol. Methods, 78, 79-85 (2009). [0220] Heine, S. J. et al., Vaccine 31, 2919-2929 (2013). [0221] Ivanov, I. I. et al., Cell 139, 485-498 (2009). [0222] Jepson, M. A. et al., Infect. Immun. 61, 4001-4004 (1993). [0223] Kaper, J. B. et al., Nat Rev Micro 2, 123-140 (2004). [0224] Klaasen, H. et al., FEMS Microbiol. 88, 165-180 (1992). [0225] Kriegel, M. A. et al., Proc. Natl Acad. Sci. USA 108, 11548-11553 (2011). [0226] Kuwahara, T. et al., DNA Res. 18, 291-303 (2011). [0227] Lcuyer, E. et al., Immunity 40, 608-620 (2014). [0228] Lee, Y. K. Proc. Natl Acad. Sci. USA 108 (Suppl 1), 4615-4622 (2011). [0229] Martinez-Becerra, F. J. et al., Infect. Immun. 80, 1222-1231 (2012). [0230] Mills, J. A. et al., Infect. Immun. 56, 2933-2941 (1988). [0231] Paccez J. D. et al., Vaccine 25, 4671-4680 (2007). [0232] Pamp, S. J. et al., Genome Res. 22, 1107-1119 (2012). [0233] Parsot, C. Curr. Opin. Microbiol. 12, 110-116 (2009). [0234] Prakash, T. et al., Cell Host Microbe 10, 273-284 (2011). [0235] Schnupf, P. & Sansonetti, P. J., PLoS ONE 7, e36446 (2012). [0236] Schnupf, P. et al., Semin. Immunol. 25, 342-351 (2013). [0237] Sczesnak, A. et al., Cell Host Microbe 10, 260-272 (2011). [0238] Shima, T. et al., FEMS Immunol. Med. Microbiol. 52, 69-77 (2008). [0239] Tannock, G. W. et al., Appl. Environ. Microbiol. 47, 441-442 (1984). [0240] Wu, H. J. et al., Immunity 32, 815-827 (2010). [0241] Yang, Y. et al., Nature 510, 152-156 (2014). [0242] Yin, Y. et al. ISME J. 7, 615-621 (2012). [0243] Yurkovetskiy, L. et al., Immunity 39, 400-412 (2013).