HUMAN CARDIAC TISSUE CONSTRUCT, RELATED METHODS AND USES
20190365951 · 2019-12-05
Inventors
- Elena Martínez Fraiz (Barcelona, ES)
- Ángel Raya Chamorro (L'Hospitalet de Llobregat, ES)
- Raimon Jané Campos (Barcelona, ES)
- Maria Valls Margarit (Barcelono, ES)
- Olalla Iglesias García (L'Hospitalet de Llobregat, ES)
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C12M35/02
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
A61L27/3895
HUMAN NECESSITIES
A61L27/3834
HUMAN NECESSITIES
A61L27/3804
HUMAN NECESSITIES
C08L89/06
CHEMISTRY; METALLURGY
C12N2529/00
CHEMISTRY; METALLURGY
A61L2430/20
HUMAN NECESSITIES
C08L89/06
CHEMISTRY; METALLURGY
C12M21/08
CHEMISTRY; METALLURGY
International classification
G01N33/50
PHYSICS
Abstract
The present disclosure relates to a human cardiac tissue construct, to the method for producing thereof and its uses in disease modelling, compound screening and properties evaluation, and/or therapeutic uses in heart regeneration. It further relates to a perfusion bioreactor with electrical stimulation capabilities and its use in the production of said human cardiac tissue construct. In still a further aspect, the disclosure provides a method for the non-destructive evaluation of electrophysiological activity in a cellular construct, such as a cardiac tissue construct of the disclosure.
Claims
1. A method for producing a human tridimensional macroscale cardiac construct, wherein said method comprises the following steps: (i) differentiating human pluripotent stem cells (hPSCs) or cardiac stem cells into contracting cardiomyocytes; (ii) suspending the contracting cardiomyocytes together with human fibroblasts to obtain a mixed cell suspension; (iii) seeding the mixed cell suspension into a collagen-based porous scaffold to obtain a seeded scaffold; (iv) optionally, culturing the seeded scaffold under conditions that allow cell attachment to the collagen-based porous scaffold; and (v) transferring the seeded scaffold to a bioreactor and culturing the seeded scaffold under perfusion with electrical stimulation for cardiomyocyte maturation, thereby obtaining a human tridimensional macroscale cardiac construct displaying spontaneous beating, wherein the human tridimensional macroscale cardiac construct has a thickness greater than 300 m.
2. The method according to claim 1, wherein said hPSCs in step (i) are induced pluripotent stem cells (iPSCs).
3. The method according to claim 1, wherein said differentiating in step (i) is conducted in a monolayer culture, and the contracting cardiomyocytes obtained in step (i) are disaggregated and suspended in step (ii).
4. The method according to claim 1, wherein said contracting cardiomyocytes obtained in step (i) co express cardiac Troponin T (cTnT) and myosin heavy chain (MHC).
5. The method according to claim 1, wherein in step (ii) said human fibroblasts are dermal skin fibroblasts.
6. The method according to claim 1, wherein in step (ii) said contracting cardiomyocytes and human fibroblasts are at a ratio from 10:1 to 5:1.
7. The method according to claim 1, wherein the collagen-based porous scaffold in step (iii) is a collagen and elastin-based porous scaffold.
8. The method according to claim 1, wherein the collagen-based porous scaffold in step (iii) has macropores with a mean pore size in the range of 50 to 90 m and micropores with a mean pore size in the range of 5 to 50 m.
9. The method according to claim 1, wherein the collagen-based porous scaffold in step (iii) is a hydrated scaffold.
10. The method according to claim 1, wherein the collagen-based porous scaffold in step (iii) is between 5 and 50 mm in diameter and between 0.5 and 4 mm in thickness in the hydrated form.
11. The method according to claim 1, wherein the seeding in step (iii) is conducted by perfusion seeding.
12. The method according to claim 1, wherein 5 million or more total cells are seeded in step (iii).
13. The method according to claim 1, wherein in step (iv) the seeded scaffold is cultured in ultralow attachment dishes.
14. The method according to claim 1, wherein in step (iv) the seeded scaffold is cultured for 2-4 hours.
15. The method according to claim 1, wherein during step (v) perfusion of fresh oxygenated culture medium is conducted at a flow rate per chamber of 0.1 or 0.2 ml/min.
16. The method according to claim 1, wherein in step (v) the seeded scaffold is cultured under perfusion for 3 days and under perfusion and electrical stimulation from day 4 onwards.
17. The method according to claim 1, wherein in step (v) the seeded scaffold is subjected to an electric field of about 400 V/m and a current density of about 600 A/m2.
18. The method according to claim 1, wherein the seeded scaffold is cultured in step (v) for at least 7 days.
19. The method according to claim 1, wherein step (v) is conducted in a perfusion bioreactor comprising one or more culture chambers with electrostimulation capabilities.
20. The method according to claim 19, wherein each bioreactor chamber has two electrodes.
21. A human tridimensional macroscale cardiac construct prepared by the method according to claim 1.
22. The human tridimensional macroscale cardiac construct according to claim 21, wherein said human tridimensional macroscale cardiac construct is substantially free from the collagen based-porous scaffold.
23. The human tridimensional macroscale cardiac construct according to claim 21, wherein said human tridimensional macroscale cardiac construct comprises aligned cells with synchronized beating.
24. A method for treatment of a human subject having cardiac damage, comprising administering the human tridimensional macroscale cardiac construct of claim 21 to the human subject.
25. The method according to claim 24, wherein said human subject has ischemic heart disease.
26. A method for screening or evaluating a compound for cardioprotective or cardiotoxic properties, comprising contacting the compound with the human tridimensional macroscale cardiac construct of claim 21 and determining a cardioprotective or cardiotoxic effect.
27. (canceled)
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] In a first aspect, the disclosure refers to a method for producing a human tridimensional macroscale cardiac construct, wherein said method comprises the following steps:
[0036] (i) differentiating human pluripotent stem cells or adult cardiac stem cells into contracting cardiomyocytes,
[0037] (ii) suspending the cardiomyocytes together with human fibroblasts to obtain a mixed cell suspension;
[0038] (iii) seeding the mixed cell suspension into a collagen-based porous scaffold,
[0039] (iv) optionally, culturing the seeded scaffold under conditions that allow cell attachment to the scaffold, and
[0040] (v) transferring the cardiac construct to a bioreactor and culturing it under perfusion with electrical stimulation for cardiomyocyte maturation,
[0041] thereby obtaining a human tridimensional macroscale cardiac construct displaying spontaneous beating;
[0042] wherein a macroscale construct has a thickness greater than 300 m.
[0043] Human pluripotent stem cells (hPSCs) may be used in step (i). These are stem cells having pluripotency which enables the cells to differentiate into derivatives of the three main embryo germ layers (endoderm, ectoderm, and mesoderm), and also possess self-renewing ability, which enables them to proliferate indefinitely in vitro. Examples of the pluripotent stem cells include, but are not limited to human embryonic stem (hES) cells, preferably obtained from existing hES cell lines generated without destroying a human embryo (e.g., Chung et al., 2008), or from parthenogenetic activation of an oocyte in the absence of sperm (WO 2003/046141), and induced pluripotent stem (iPSCs) cells. Alternatively, adult cardiac stem cells may also be used in step (i) for differentiation into cardiomyocytes. A number of different cardiac stem cells and stem cell lines have been described in the art, including those described in WO 99/49015, WO 2005/012510, WO 2006/052925, WO 02/09650, WO 02/13760, WO 03/103611, WO 2007/100530, WO 2009/073616, WO 2011/057249, WO 2011/057251, WO 2012/048010, WO 2006/093276, WO 2009/136283 and WO 2014/141220.
[0044] Preferably, the hPSCs in step (i) are human iPSCs. iPSCs are pluripotent cells obtained by reprogramming adult somatic cells by transient overexpression of specific nuclear factors. Takahashi et al. (Takahashi et al. 2007) disclosed for the first time methods for reprogramming differentiated cells and establishing an induced pluripotent stem cell having similar pluripotency and growing abilities to those of an ES cell. Takahashi et al. described various different nuclear reprogramming factors for differentiated fibroblasts, which include products of the following four gene families: an Oct family gene; a Sox family gene; a KIf family gene; and a Myc family gene.
[0045] The iPSCs which may be used in the method of the disclosure can be obtained for instance by the methods described by Takahashi et al. (Takahashi et al. 2007). Alternatively, other methods could be used, such as those using non-integrative Sendai virus (Ban H et al., 2011), episomal plasmids (Yu J. et al., 2009), or mRNA transfection (Warren L. et al., 2010). Moreover, the reprogrammed adult somatic cells may be from different cell types and tissue origins, including but not limited to dermal fibroblasts, epidermal keratinocytes, peripheral blood mononuclear cells, urine sediment cells, and mesenchymal stromal cells. Preferably, said human iPSCs are derived from foreskin dermal fibroblasts. More preferably, said iPSCs are from the human FIPS Ctr11-mR5F-6 cell line (National Stem Cell Bank, Institute of Health Carlos III, Spanish Ministry) used in the Examples.
[0046] Various protocols for the obtaining of cardiomyocytes from hPSCs have been described and are well known in the art. Differentiation into cardiomyocytes from hESCs may for instance be conducted via embryoid bodies (EBs) in a medium containing fetal calf serum. The differentiation protocol may optionally comprise the addition of growth factors, including but not limited to fibroblast growth factor 2 (FGF2), transforming growth factor beta (TGFbeta), vascular endothelial growth factor (VEGF); and the addition of Gsk3 inhibitors and/or Wnt inhibitors (Graichen R. et al, 2008; Yang L. et al, 2008; Kattman S J. et al, 2011; Mohr J C. et al, 2010; Azarin S M. et al, 2012; Lian X. et al, 2012; Zhang J. et al, 2012).
[0047] Preferably, hPSCs differentiation into cardiomyocytes is conducted in monolayer culture. For instance, said differentiation protocol may be based on TGF superfamily growth factors, such as protocol 1 (GiAB) in Lian X. et al., 2013, which relies upon treatment of undifferentiated hPSCs with Gsk3 inhibitor in mTeSR1, followed by Activin A and BMP4 in RPMI/B27-insulin. It also can be based on employing small molecule activators of canonical Wnt signalling followed by shRNA of -catenin expression (protocol 2, GiSB) or small molecule inhibitors of Wnt signaling (protocol 3, GiWi) in a growth factor-free system (Lian X. et al., 2013). The small molecule methods (protocols 2 and 3) use the sequential treatment of Gsk3 inhibitors and Wnt signaling inhibitors (or inducible expression of -catenin shRNA) to stimulate cardiogenesis.
[0048] In a preferred embodiment, cardiomyocyte differentiation in step (i) is conducted in monolayer culture with a method comprising the addition of a Gsk3 inhibitor (e.g., CHIR99021, Stemgent) followed by the addition of a Wnt signalling inhibitor (e.g., IWP4, Stemgent) generally at day 3 of differentiation. Preferably, the differentiation protocol is as described in the Examples, where spontaneously contracting cardiomyocytes are obtained at around day 8. These cardiomyocytes contract or beat spontaneously and this is visible at a macroscopic level.
[0049] Contracting cardiomyocytes are preferably obtained from beating clusters in the monolayer which are disaggregated, typically by trypsin-EDTA digestion, prior to suspension in step ii). In a preferred embodiment, optionally in combination with one or more of the features or embodiments described herein, the contracting cardiomyocytes used in step ii) are obtained from beating clusters around day 20, preferably at day 20 or onwards, of differentiation with the protocol as described in the Examples.
[0050] The differentiated cardiomyocytes, or a substantially pure population of cardiomyocytes, obtained in step (i) may further be characterized by expressing the markers cardiac Troponin T (cTnT) and/or myosin heavy chain (MHC).
[0051] The marker profile of the cardiomyocytes, or the substantially pure cardiomyocytes population, can be further defined by the presence and/or absence of additional markers, or by a specific profile of a combination of present and absent markers. In each case, the specific combination of markers may be present as a particular profile within a population of cells and/or a particular profile of markers on individual cells within the population.
[0052] In one particular embodiment, the cardiomyocytes and/or the substantially pure population of cardiomyocytes express one or more of cTnT and MHC at a detectable level. In a further embodiment, the cardiomyocytes and/or the substantially pure population of cardiomyocytes express both cTnT and MHC at a detectable level.
[0053] In one particular embodiment, at least about 80%, 85%, 90%, 95%, 97% or 100% of the cardiomyocytes in the substantially pure cardiomyocytes population express cTnT and/or MHC at a detectable level. In another particular embodiment, at least about 70%, 75%, 80%, 85%, 90%. 95% or 100% of the cardiomyocytes in the substantially pure cardiomyocytes population express cTnT and MHC at a detectable level. In any of these embodiments, the indicated expression levels are for instance when expression is determined by flow cytometry or fluorescence-activated cell sorting (FACS) analysis.
[0054] The cardiomyocytes and/or cells of the substantially pure population of cardiomyocytes may also express one or more, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or all of the markers selected from the group consisting of homeobox protein NKX2.5, GATA-4, GATA-6, MESP-1, ANF, SIRPA, myosin light chain 2-atrial, myosin light chain 2-ventricular, -myosin heavy chain, sarcomeric -actinin, and titin.
[0055] The term marker as used herein encompasses any biological molecule whose presence, concentration, activity, or phosphorylation state may be detected and used to identify the phenotype of a cell.
[0056] The term expressed is used to describe the presence of a marker within a cell. In order to be considered as being expressed, a marker must be present at a detectable level. By detectable level is meant that the marker can be detected using one of the standard laboratory methodologies such as PCR, blotting, immunofluorescence, ELISA, flow cytometry or FACS analysis. Preferably, determination of protein expression levels at the cell surface is conducted by flow cytometry or FACS. Expressed may refer to, but is not limited to, the detectable presence of a protein, phosphorylation state of a protein or an mRNA encoding a protein. A gene is considered to be expressed by a cell or cell population if expression can be reasonably detected after 30 PCR cycles, preferably after 37 PCR cycles, which corresponds to an expression level in the cell of at least about 100 copies per cell. The terms express and expression have corresponding meanings. At an expression level below this threshold, a marker is considered not to be expressed. The comparison between the expression level of a marker in a cardiomyocyte, and the expression level of the same marker in another cell, for example on pluripotent stem cells or fibroblasts which can be used as control cells, may be conducted by comparing the two cell types that have been isolated from the same species.
[0057] In an alternative embodiment, the cardiomyocytes and/or the substantially pure population of cardiomyocytes are considered to express a marker if the expression level of the marker is greater in the cells of the disclosure than in a control cell, for example in hPSCs or human fibroblasts. By greater than in this context, it is meant that the level of the marker expression in the cell population of the disclosure is at least 2-, 3-, 4-, 5-, 10-, 15-, 20-fold higher than the level in the control cell.
[0058] In step (ii), the method of the disclosure comprises suspending the cardiomyocytes together with human fibroblasts, preferably in culture medium, to obtain a mixed cell suspension.
[0059] By cell growth medium or cell culture medium it is meant a nutritive solution for culturing or growing cells. The ingredients that compose such media may vary depending on the type of cell to be cultured. In addition to nutrient composition, osmolarity and pH are considered important parameters of culture media.
[0060] The cell growth medium comprises a number of ingredients well known by the man skilled in the art, which typically for the culturing of eukaryotic cells includes amino acids, vitamins, organic and inorganic salts, sources of carbohydrate, lipids, trace elements (CuSO4, FeSO4, Fe(NO3)3, ZnSO4, etc.), each ingredient being present in an amount which supports the cultivation of a cell in vitro (i.e., survival and growth of cells). Ingredients may also include different auxiliary substances, such as buffer substances (like sodium bicarbonate, Hepes, Tris, etc.), oxidation stabilizers, stabilizers to counteract mechanical stress, protease inhibitors, animal growth factors, plant hydrolyzates, anti-clumping agents, anti-foaming agents. If required, a non-ionic surfactant, such as polypropylene glycol can be added to the cell growth medium as an anti-foaming agent. These agents are generally used to protect cells from the negative effects of aeration since, without an addition of a surfactant, the ascending and bursting air bubbles can lead to damage of those cells that are located on the surface of these air bubbles (sparging).
[0061] The cell growth medium is preferably an animal serum-free medium (SFM), which meant that the cell growth medium is ready to use, that is to say that it does not required serum addition allowing cells survival and cell growth. The cell growth medium is preferably chemically defined, but it may also contained hydrolyzates of various origins, from plant for instance. Preferably, said cell growth medium is non-animal origin qualified, that is to say that it does not contain components of animal or human origin (FAO status: free of animal origin). Several media are commercial available and can be used. Media for the culturing of eukaryotic cells include, for example: Ham's F12 Medium (Sigma, St. Louis, Mo.), Dulbecco's Modified Eagles Medium (DMEM, Sigma), RPMI (Invitrogen) or VP SFM (lnVitrogen). Preferably said culture medium is RPMI (Invitrogen) supplemented with B27 (Life Technologies) medium.
[0062] The introduction of the appropriate amount and type of fibroblasts has been reported to promote tissue organization and improve cell connectivity (Amano, Y. et al, 2016). Said fibroblasts are preferably dermal skin fibroblasts. The skin origin is not particularly limited, but foreskin fibroblasts are preferred. In said cell suspension cardiomyocytes and fibroblasts may be found at a ratio from 10:1 to 5:1, preferably at a 7:1 ratio.
[0063] In step (iii) the cell mixture is seeded in a collagen-based porous scaffold. The term collagen-based as used herein means that collagen is one of the main components of the scaffold. Preferably, the collagen-based porous scaffold in step (iii) is a collagen and elastin-based porous scaffold, which may be obtained for instance from bovine dermis. One advantage associated to a collagen-based scaffold is that it is a biocompatible material which will be fully degraded in the clinical setting, e.g., further to in vivo transplantation.
[0064] The collagen-based porous scaffold in step (iii) preferably has macropores with a mean pore size in the range of 50 to 90 m and micropores with a mean pore size in the range of 5 to 50 m, when the mean pore size is analyzed in dry conditions by scanning electron microscopy (SEM), e.g., under 1 mbar water pressure and without any conductive coating. More preferably, most of the pores are micropores with a mean pore size in the range between 10 and 40 m. Most preferably, the pore size distribution is as shown in
[0065] The collagen-based porous scaffold in step (iii) is preferably a hydrated scaffold, for instance this may have been hydrated in PBS for 24h prior to cell seeding. With respect to its size, the collagen-based porous scaffold may have between 5 and 50 mm, preferably about 10 mm or about 20 mm in diameter; and between 0.5 and 3 mm, preferably between 1 and 2 mm, in thickness in the hydrated form. In a preferred embodiment, optionally in combination with one or more of the features or embodiments described herein, the collagen-based porous scaffold in step (iii) has about 10 mm of diameter and thickness of about 1 mm in the hydrated form.
[0066] In a preferred embodiment, said collagen-based porous scaffold is the collagen and elastin scaffold named Matriderm (Medskin solutions Dr. Suwelack A G) described in Halim A S et al., 2010) which structural features are also shown in
[0067] Cell seeding in step (iii) is preferably conducted by perfusion so that the cell suspension is forced to pass through the scaffold, this may be conducted for instance using a perfusion loop as described in the examples. More preferably, perfusion seeding is carried out at a flow rate of 1 ml/min. In preferred embodiments, a total amount of 5 million or more of total cells are seeded in step (iii).
[0068] In step (iv) the seeded scaffold is preferably cultured in ultralow attachment dishes (e.g., Corning Ultra-Low attachment surface) to enable cell attachment to and retention within the scaffold, for instance at 37 C. in 5% CO.sub.2 and humidified atmosphere. Cell attachment may be verified by fixing and staining cross-sections of the cell construct (e.g., staining the cell nuclei with DAPI (4,6-diamidino-2-phenylindole) and analyzing it under fluorescence microscopy). Preferably, seeding efficiency is of at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%. In preferred embodiments, the human cell construct will be cultured for 2-4 hours, preferably around 3.5 hours.
[0069] In step (v) the cardiac construct is transferred to a perfusion bioreactor with electrostimulation capabilities to promote cardiomyocyte maturation. Perfusion of fresh oxygenated culture medium is conducted, preferably at a flow rate per chamber of 0.1 or 0.2 ml/min.
[0070] Preferably, electrical stimulation is applied in the culture chamber so that the cardiac construct is submitted to an electric field below 8 V/cm (Tandon et al. 2009), more preferably to an electric field around 400 V/m and a current density around 600 A/m.sup.2. These correspond to the values of the parameters when measured in the center of the culture chamber. For instance, when using a culture chamber as shown in
[0071] Preferably, in step (v) the cardiac construct is cultured under perfusion for 3 days and electrical stimulation is also continuously applied from day 4 onwards. Preferably, cell constructs are cultured in step (v) for at least 7 days, more preferably for at least 14 days.
[0072] Electrical stimulation has been proposed to be a requirement for the electrophysiological maturation of cardiac constructs, as it is a well-known regulatory signal that favors cardiomyocytes contractility, alignment and organization within cardiac tissue constructs (Radisic, M. et al, 2004; Nunes, S. S. et al, 2013). As shown in the Examples, cardiac constructs were stimulated at a frequency of 1 Hz to mimic the electrical pacing in the native human adult heart, as it was previously shown that cardiomyocytes cultured in 3D aggregates adapted their autonomous beating rate to the frequency of stimulation (Eng, G. et al, 2016). After 14 days in culture, the cardiac constructs (also referred as CardioSlice constructs) displayed signs of increased tissue maturation compared to control constructs: cardiomyocytes aligned to one another following the direction of the electric field. At the ultrastructural level, electrical stimulation yielded improved myofilament structures, as evidenced by wider sarcomeres, and more developed intercellular unions than non-stimulated macrotissues. The alignment of cardiac cells and an increased myofibril ultrastructural organization has been connected to the improved electrical and mechanical properties of cardiac constructs (Fleischer, S. et al, 2017; Mathur, A. et al, 2015). Consistent with this, CardioSlice constructs showed improved electromechanical coupling which resulted in contractions with amplitude 6-fold higher than that of control constructs. Moreover, ECG-like signals elicited by CardioSlice constructs showed a uniform and reproducible pattern of narrow, steep and well-defined QRS complexes that very much resembled actual ECG heart recordings. In contrast, the bioelectrical signals generated by control constructs were highly heterogeneous, of comparatively lower amplitude and longer duration of waveforms, indicative of slowly conducting tissues.
[0073] Another aspect of the present disclosure refers to a human tridimensional macroscale cardiac construct obtained or obtainable by a method as described herein.
[0074] The cardiac construct obtained by the method as described herein resembles myocardial tissue both structurally and functionally (as demonstrated by the electrocardiogram (ECG) which accounts for improved synchronization and electrical signal propagation, see
[0075] Accordingly, this cardiac construct may further be characterized by one or more, preferably all of the following features:
[0076] comprises mature cardiomyocytes expressing cardiac contractile proteins;
[0077] shows an increase in sarcomere width, and/or better development of intercalated discs with respect to control constructs (obtained in the absence of electrical stimulation);
[0078] presents aligned cells with synchronized beating (e.g., cells are aligned along the direction of electrical field applied and contracted in parallel to the direction of the electric field),
[0079] presents improved maturation of the electromechanical coupling machinery (as shown by increased amplitude of contraction with respect to control constructs obtained in the absence of electrical stimulation);
[0080] electrocardiogram graphs resemble those of healthy human myocardial tissue (e.g., the recorded electrical signals have narrow and step waveforms, and QRS complexes and repolarizing waves).
[0081] The mature cardiomyocytes, or a substantially pure population of mature cardiomyocytes, comprised in the cardiac cell construct obtained further to step (v) may also be characterized by expressing the markers cardiac Troponin T (cTnT) and/or alpha sarcomeric actin (ASA).
[0082] In one particular embodiment, the mature cardiomyocytes and/or the substantially pure population of mature cardiomyocytes express one or more of cTnT and ASA at a detectable level. In a further embodiment, the mature cardiomyocytes and/or the substantially pure population of mature cardiomyocytes express both cTnT and ASA at a detectable level.
[0083] In one particular embodiment, at least about 80%, 85%, 90%, 95%, 97% or 100% of the cardiomyocytes in the substantially pure cardiomyocytes population express cTnT and/or ASA at a detectable level. In another particular embodiment, at least about 70%, 75%, 80%, 85%, 90%. 95% or 100% of the cardiomyocytes in the substantially pure cardiomyocytes population express cTnT and ASA at a detectable level. In any of these embodiments, the indicated expression levels are for instance when expression is determined by flow cytometry or fluorescence-activated cell sorting (FACS) analysis.
[0084] In addition, the mature cardiomyocytes in the cardiac construct may also be characterized by being responsive to positive and negative inotropic factors. In particular, as described in the Examples, the obtained cardiac constructs have shown to modulate its beating rate upon treatment. For instance increasing its rate with a beta-adrenergic agonist compound and decreasing it upon treatment with a beta-adrenergic antagonist or a cholinergic agonist.
[0085] In preferred embodiments, the obtained macroscale cardiac construct has between 5 and 50 mm, preferably about 10 mm or about 20 mm in diameter; and between 0.5 and 3 mm, preferably between 1 and 2 mm, in thickness. Preferably, it has about 10 mm of diameter and thickness of about 1 mm.
[0086] In a further aspect, the disclosure refers to a cardiac construct as defined herein, for use in the treatment of a human subject having cardiac damage, for instance by replacement or regeneration of the damaged cardiac tissue. In a related aspect, the disclosure refers to a method of treating a subject having cardiac damage by administration of a therapeutically effective amount of the cardiac cell construct described herein. In a particular embodiment, of any thereof, said subject has ischemic heart disease. The term ischemic heart disease refers to a disease characterized by reduced blood supply to the heart. For instance, said subject has suffered a myocardial infarction or angina pectoris event.
[0087] The term effective amount as used herein refers to an amount that is effective, upon single or multiple dose administration to a subject (such as a human patient) in the prophylactic and/or therapeutic treatment of a disease, disorder or pathological condition.
[0088] In an additional aspect, the present disclosure refers to the in vitro use of a cardiac construct as described herein, for the screening or evaluation of compounds, such as drugs, on cardioprotective or cardiotoxic properties. In another aspect, the present disclosure refers to the in vitro use of a cardiac construct as described herein, for cardiac disease modeling.
[0089] In still another aspect of the present disclosure refers to a perfusion bioreactor with electrical stimulation capabilities, which would thus be suitable for electrostimulating cardiac cells with the desired pulsatile electric field.
[0090] A perfusion cell culture process involves the constant feeding of fresh media and removal of spent media and product while retaining high numbers of viable cells. Continuous perfusion of fresh media may be achieved through the use of a peristaltic pump. In a parallelized bioreactor, media can be equally distributed through the various (e.g., four) branches of the bioreactor by using flow restrictors. In some embodiments, the bioreactor is a closed-circuit and elimination of waste products is achieved by changing the culture medium manually, preferably every day, using sterile syringes. Since cells are attached to the scaffold, they are not affected by culture medium changes.
[0091] In a particular embodiment, the bioreactor comprises at least one perfusion chamber and two electrically stimulating electrodes within the chamber. Preferably, said bioreactor is a parallelized bioreactor with multiple culture chambers, for instance with 2, 3, 4, 5 or 6 chambers capable to simultaneously provide fluid perfusion and electrical stimulation to several cardiac constructs. Thus, allowing the production of multiple cardiac macrotissues under the same physiochemical conditions. The stimulating electrodes are preferably made of graphite. The bioreactor may further comprise a measuring electrode, preferably made of gold, connected with the chamber to be used as internal reference to take measurements in the center of the perfusion chamber. In a preferred embodiment, this parallelized perfusion bioreactor with electrical stimulation and measurement capabilities are as defined in
[0092] By incorporating electrodes to the bioreactor chamber, the bioreactor is provided with means to stimulate the cell constructs. In addition, the bioreactor is provided with the capability of on-line monitoring the electrophysiological behavior of the constructs in a non-destructive manner. Accordingly, in a further aspect, the disclosure provides a method for the non-destructive evaluation of electrophysiological activity in a cardiac construct, said method comprising the use of a bioreactor as described herein enabling the registration of electric signals, such as ECG-like signals.
[0093] Since no standard method to assess electrophysiological information from intact macroscale-sized heart tissue exists (Tzatzalos, E. et al, 2016), the technology developed here is unique in this context. Electromechanical coupling is usually evaluated through contractility measurements under a microscope (Radisic, M. et al, 2004; Nunes, S. S. et al, 2013; Hirt, M. N. et al, 2014). Electrophysiological activity, in turn, is recorded on isolated cardiomyocytes after tissue formation (Schaaf, S. et al, 2011; Nunes, S. S. et al, 2013), therefore requiring the destruction of the sample. Electrical activity of disaggregated cells is obtained by measuring transmembrane action potentials (Liang, P. et al, 2013), microelectrode array (MEA) recordings (Pradhapan, P. et al, 2013), impedance measurements (Nguemo, F. et al, 2012), and calcium- (Fleischer, S. et al, 2017) or voltage- (Yan, P. et al, 2102) sensitive dyes. Through the novel set-up described herein, real-time monitoring of the electrophysiological activity in thick human cardiac macroscale tissue-like constructs has been demonstrated, and ECG-like signals registered.
[0094] It is contemplated that any features described herein for the human cardiac construct can optionally be combined with any of the embodiments of any method of production, any medical use, method of treatment, method for the screening or evaluation of compounds, method for cardiac disease modelling, bioreactor or method for the non-destructive evaluation of electrophysiological activity in a cardiac construct of the invention; and any embodiment discussed in this specification can be implemented with respect to any of these. It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the disclosure. The principal features of this disclosure can be employed in various embodiments without departing from the scope of the disclosure. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this disclosure and are covered by the claims.
[0095] All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0096] The use of the word a or an may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one. The use of the term another may also refer to one or more. The use of the term or in the claims is used to mean and/or unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.
[0097] As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term comprises also encompasses and expressly discloses the terms consists of and consists essentially of. As used herein, the phrase consisting essentially of limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed disclosure. As used herein, the phrase consisting of excludes any element, step, or ingredient not specified in the claim except for, e.g., impurities ordinarily associated with the element or limitation.
[0098] The term or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
[0099] As used herein, words of approximation such as, without limitation, about, around, approximately refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as about may vary from the stated value by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15%. Accordingly, the term about may mean the indicated value5% of its value, preferably the indicated value2% of its value, most preferably the term about means exactly the indicated value (0%).
[0100] The following examples serve to illustrate the present disclosure and should not be construed as limiting the scope thereof.
EXAMPLES
Example 1
Material and Methods
Parallelized Perfusion Bioreactor System
[0101] Parallelized perfusion bioreactor (
[0102] Notably, both chambers had equivalent inner dimensions to obtain comparable tissue constructs. In both chambers the cardiac construct was held in place by two gaskets, and a continuous perfusion of culture medium at 0.1 ml/min per chamber was applied (0.4 ml/min total flow for a parallel system allocating 4 chambers). For electrically stimulated cardiac constructs, trains of monophasic square-wave pulses of 2 ms of duration and 5 V of amplitude (peak to peak) were continuously applied from day 4 of culture until the end of the experiment. For human CardioSlice constructs the frequency of the pulses was of 1 Hz, while for rat cardiac constructs it was of 3 Hz. Control cardiac constructs were cultured under the same flow conditions but without electrical stimulation. All the components were sterilized by either autoclaving or 70% ethanol with subsequent MilliQ water rinse. The whole system was placed inside an incubator with temperature and CO.sub.2 control (37 C. and 5% CO.sub.2). Images and diagrams of the bioreactor and culture chambers were processed using GNU Image Manipulation Program (The GIMP team, GIMP 2.8.18, www.gimp.org, 1997-2016).
Fabrication and Characterization of the Perfusion Chamber with Electrical Stimulation
[0103] Our custom-made perfusion chamber with electrical stimulation was fabricated by precision machining of polypropylene (PP) plastic, followed by gluing of luer connectors using cyanoacrylate. To achieve a completely watertight chamber, silicone O-rings (4.6 mm inner diameter, The O-Ring Store, LLC) and thread seal tape was used. The perfusion chamber had an inlet and an outlet to allow culture medium perfusion, two carbon rod electrodes of 3/16 in diameter (Monocomp Instrumentacin) to electrically stimulate cells and one gold electrode of 0.5 mm in diameter (Advent Research Materials) as a measuring electrode (
Electric Field Modeling
[0104] COMSOL Multiphysics software was used to predict the electric field and the current density that stimulates cells in our custom-made perfusion chamber. The electric current module was used, which considers the conductivity and permittivity of each material to solve a current conservation problem for a given electric potential. Electric fields throughout our geometry were calculated by assuming steady state, as previously described (Tandon, N. et al, 2009; Barash, Y. et al, 2005; Tandon, N. et al, 2011). To run the simulation, the exact geometry of our perfusion chamber was designed except for its internal part, where a prism was drawn to faithfully reproduce the interaction between the electrodes and the culture medium (
Structural and Mechanical Analysis of the Scaffold
[0105] Commercially available collagen and elastin-based sponges (Matriderm, MedSkin Solutions Dr. Suwelack A G) were used as 3D scaffolds (
Human iPSC Culture and Cardiac Differentiation
[0106] Human induced pluripotent stem cells (hiPSC) (FiPS Ctrl1-mR5F-6; cell line registered in the National Stem Cell Bank, Institute of Health Carlos III, Spanish Ministry) were cultured on Matrigel (10 cm diameter, Corning) coated dishes with mTeSR1 medium (Stem Cell Technologies). Cells were differentiated into cardiomyocytes in monolayer culture with modulators of canonical Wnt signaling as described in further detail in the section below and in
Human iPSC Culture and Cardiac Differentiation
[0107] Human iPSC were cultured on 10 cm Matrigel (Corning) coated dishes with mTeSR1 medium (Stem Cell Technologies). Medium was changed every day, excluding the day right after passaging. Cells were split 1:6-1:10 by incubation with 0.5 mM EDTA (Invitrogen) for 2 min at 37 C. and cell aggregates were plated on Matrigel coated dishes and maintained in culture for subsequent passages. Human iPSC were differentiated into cardiomyocytes in monolayer culture with modulators of canonical Wnt signaling as previously described.sup.46. Cells maintained on Matrigel in mTeSR1 medium were dissociated into single cells with Accutase (Labclinics) at 37 C. for 8 min and seeded onto Matrigel-coated 12-well plate at a density of 1.5 million cells per well in mTeSR1 medium supplemented with 10 M ROCK inhibitor (Sigma). Cells were cultured in mTeSR1 medium, changed daily during 3 days. When human iPSC achieved confluence, cells were treated with 10 M GSK3 inhibitor (CHIR99021, Stemgent) in RPMI (Invitrogen) supplemented with B27 lacking insulin (Life Technologies), 1% glutamax (Gibco), 0.5% penicilin-streptomycin (Gibco), 1% non-essential amino acids (Lonza), and 0.1 mM 2-mercaptoethanol (Gibco) (RPMI/B27-insulin medium) for 24 h (day 0 to day 1). After 24 h, the medium was changed to RPMI/B27-insulin and cultured for another 2 days. On day 3 of differentiation, cells were treated with 5 M Wnt inhibitor IWP4 (Stemgent) in RPMI/B27-insulin medium and cultured without medium change for 2 days. Cells were maintained in RPMI supplemented with B27 (Life Technologies), 1% L-glutamine, 0.5% penicilin-streptomycin, 1% non-essential amino acids, and 0.1 mM 2-mercaptoethanol (RPMI/B27 medium) starting from day 7, with medium change every 2 days. On day 8, contracting cardiomyocytes were obtained. Beating clusters were disaggregated (at day 20 and at day 35) by incubation with 0.25% trypsin-EDTA (Gibco) for 5-8 min at 37 C., both for their characterization and in vitro studies.
Isolation and Culture of Neonatal Rat Cardiomyocytes
[0108] Hearts from 2-3-day-old Sprague-Dawley rats were isolated following a protocol approved by Animal Experimentation Ethics Committee of the University of Barcelona (Barcelona, Spain). Briefly, ventricular tissue was excised, cut into two parts and washed with cold Calcium and Bicarbonate-Free Hank's Balanced Salt Solution with HEPES (CBFHH) buffer. Then, ventricles were cut sharply into small pieces (<1 mm.sup.3) and subjected to 20-25 cycles (3 min each, room temperature) of enzymatic digestion using ice-cold 2 mg/ml trypsin (BD Difco) in CBFHH and ice-cold 4 g/ml DNAse I (Calbiochem, Merck Millipore) in CBFHH. Pooled supernatants were collected and centrifuged at 100g for 12 min, and the pellet was resuspended in cold DMEM containing 1 g/l glucose (Life Technologies) supplemented with 10% FBS, 100 M nonessential amino acids (Life Technologies), 2 mM L-glutamine (Life Technologies), 50 U/ml penicillin and 50 g/ml streptomycin (Life Technologies). Cell suspension was filtered through a 250 m stainless steel test sieve (Filtra Vibracin), seeded into Matriderm scaffolds or in 12-well plates and cultured in DMEM containing 4.5 g/l glucose (Life Technologies) supplemented with 10% horse serum (Life Technologies), 2% Chick Embryo Extract (EGG Tech), 100 M nonessential amino acids, 2 mM L-glutamine, 50 U/ml penicillin and 50 g/ml streptomycin.
Generation of Cardiac Macrotissues
[0109]
Immunostaining Analysis
[0110] Scaffolds were fixed overnight with 4% paraformaldehyde (PFA, Sigma) at 4 C. and included in 8% agarose (Conda) for 5 min at 4 C. Blocks were cut in 200 m sections using a vibratome (0.075 mm/s advance rate, 81 Hz vibration and 1 mm amplitude) (Leica VT1000S). After three washes in 1TBS (30 min each), sections were incubated in blocking solution I (1TBS, 0.5% Triton-X100 (Sigma) and 6% donkey serum (Chemicon)) for 2 h at room temperature, and incubated with primary antibodies diluted in blocking solution II (1TBS, 0.1% Triton-X100 and 6% donkey serum) for 72 h at 4 C. in agitation. After four washes in 1TBS (30 min each), sections were incubated with secondary antibodies diluted in blocking solution II for 2 h in the dark and overnight at 4 C. Finally, sections were washed thrice with 1TBS for 30 min each and incubated with DAPI (Invitrogen) for 1 h at room temperature. Rat neonatal and differentiated cardiomyocytes seeded on gelatin-coated coverslips were fixed with 4% PFA for 15 min at room temperature and used as 2D controls. Images were taken using a SP5 confocal microscope (Leica Microsystems) and analyzed using ImageJ free software (National Institutes of Health, USA). Primary and secondary antibodies used are listed in Table 1.
TABLE-US-00001 TABLE 1 List of the primary and secondary antibodies used for immunohistochemistry analysis They were used to characterize both 2D cell cultures and cardiac macrotissues. Type Antibody Host Dilution Manufacturer Primary Actin -sarcomeric (Monoclonal IgM) Mouse 1:400 Sigma-Aldrich, A2172 Primary -actinin sarcomeric (Monoclonal IgG1) Mouse 1:100 Sigma-Aldrich, A7811 Primary Connexin-43 (Polyclonal IgG) Rabbit 1:250 Abcam, ab11370 Primary Troponin I (Polyclonal IgG) Rabbit 1:25 Santa Cruz, sc-15368 Primary Troponin T (Monoclonal IgG1) Mouse 1:100 Thermo Fisher, MS-295-P Phalloidin, Texas Red 1:40 Life technologies, T7471 Secondary Alexa Fluor 488, Goat IgG Donkey 1:200 Jackson, 705-545-147 Secondary Alexa Fluor 488, Mouse IgG Goat 1:200 Jackson, 115-546-071 Secondary Alexa Fluor 488, Mouse IgG Donkey 1:200 Jackson, 715-545-151 Secondary Cy3, Mouse IgG Goat 1:200 Jackson, 115-165-071 Secondary Cy5, Mouse IgG Goat 1:200 Jackson, 115-175-071 Secondary Cy2, Mouse IgM Goat 1:200 Jackson, 115-225-075 Secondary Cy3, Mouse IgM Donkey 1:200 Jackson, 715-165-140 Secondary Cy3, Mouse IgM Goat 1:200 Jackson, 115-165-075 Secondary DyLight 649, Mouse IgM Goat 1:200 Jackson, 115-495-075 Secondary Cy5, Mouse IgM Rabbit 1:200 Jackson, 315-175-049 Secondary Alexa Fluor 488, Rabbit IgG Donkey 1:200 Jackson, 711-545-152 Secondary Cy3, Rabbit IgG Donkey 1:200 Jackson, 711-165-152
Flow Cytometry Analysis
[0111] Characterization of human iPSC-derived cardiomyocytes was performed by flow cytometry analysis. Cells were dissociated on day 19 of differentiation using 0.25% trypsin-EDTA at 37 C. for 5 min and then fixed with 4% paraformaldehyde (Sigma) for 20 min at room temperature. After washing with 1 saponin (Sigma), cells were permeabilized using Cell Permeabilization Kit (Invitrogen) and blocked with 5% mouse serum during 15 min at room temperature. Then, cells were stained with the antibodies mouse PE-anti myosin heavy chain (MHC) (IgG2b, 1:400 BD Biosciences) and mouse Alexa Fluor 647 cardiac troponin I (cTnI) (IgG2b, 1:100, BD Biosciences). Mouse IgG2b PE (1:400 BD Biosciences) and mouse IgG2b Alexa Fluor 647 (1:100, BD Biosciences) antibodies were used as isotype controls. After incubation during 15 min at room temperature in the dark and washing twice with 1 saponin, cells were analyzed with FACS MoFlo (Beckman Coulter) and data acquisition and analysis performed by Kaluza software (Beckman Coulter).
Functional Analysis of Cardiac Macrotissues
[0112] Contractile function of cardiac macrotissues in spontaneous beating and in response to electric field stimulation was assessed in a set-up equivalent to one previously described (Tandon, N. et al, 2009; Tandon, N. et al, 2011). Briefly, two holes were drilled at one edge of two carbon rod electrodes, and a gold wire of 0.5 mm in diameter was thread through them. Insulation of the connection was performed using heat-shrink tubing (Thermo Fisher Scientific), and both electrodes were glued using cyanoacrylate at the bottom of a 35 mm MatTek glass bottom dish (MatTek In Vitro Life Science Laboratories), 1 cm apart from the edge of each electrode. The space between the electrodes was filled with Tyrode's salts solution (Sigma-Aldrich Quimica), and cardiac macrotissues were imaged and video recorded using a Stereo Microscope Leica MZ10F (Leica Microsystems) with a DFC4025C Digital Microscope Camera (Leica Microsystems). Temperature was maintained at 37 C. using a microscope-stage automatic thermocontrol system for transmitted light bases (Leica MATS Type TL, Leica Microsystems), and electrical pulses were applied using a function generator (33250A, Agilent Technologies). To determine the maximum capture rate (MCR) of the constructs, square-wave pulses of 2 ms of duration, 10 V of peak-to-peak amplitude (V.sub.pp) and 1 Hz of frequency were applied, and frequency was increased in 0.1 Hz until the cardiac macrotissue was no longer synchronously beating at the paced frequency. To measure the amplitude of contraction of each cardiac macrotissue, spontaneous beating of the constructs was recorded for at least 10 s. Then, the Fractional Area Change (FAC) of 10 beats was calculated using a custom MATLAB program (v. R2014b, Natick, Mass., USA) as previously described (Tandon, N. et al., 2009). Particle Image Velocimetry (PIV) was used to measure the velocity fields and the strain rate in beating cardiac tissue constructs. Recorded videos were analyzed using the PIVlab 1.41 software package for MATLAB (v. R2014b, Natick, Mass., USA) (Thielicke, W. & Stamhuis, E. J., 2014a; Thielicke, W. & Stamhuis, E. J., 2014b; Thielicke, W., 2014). Each frame was cross-correlated with the preceding one using 77 m77 m interrogation windows, obtaining local displacement fields (velocity field). The alignment between velocity vector fields and the direction of the electric field was assessed by the order parameter <cos 2> in every frame. If vectors were aligned in the direction of electric field, <cos 2> value was 1, whereas if vectors were perpendicular to the electric field, its value was 1. Random distribution was represented by a <cos 2> value close to 0. To determine the strain rate, built-in PIVlab functions were used. An integral of the strain rate over the beating area was determined for each frame. Positive strain rates were added up and divided by the number of contractions to obtain the strain per contraction. Images of cardiac macrotissues were taken from each video, and processed using GNU Image Manipulation Program (The GIMP team, GIMP 2.8.18, www.gimp.org, 1997-2016).
Quantitative Real-Time Polymerase Chain Reaction
[0113] Total RNA was isolated from differentiated cells and cardiac macrotissues using Trizol RNA Isolation Reagent (Life Technologies), and 1 g was used to synthesize cDNA using Transcriptor first-strand cDNA synthesis kit (Roche) according to the manufacturer's protocol. The quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using the 7900 HT Fast Real-Time PCR System (Applied Biosystems). Human GAPDH was used a housekeeping gene. RNA from human fetal and adult heart (Clontech) was used as positive control. Specific primers are listed in Table 2.
TABLE-US-00002 TABLE2 Quantitativereal-timepolymerase chainreactionprimers Gene Sense Antisense MYH6 ATTGCTGAAACCGAGAATGG CGCTCCTTGAGGTTGAAAAG (SEQIDNO:1) (SEQIDNO:2) MYH7 GCATCATGGACCTGGAGAAT ATCCTTGCGTTGAGAGCATT (SEQIDNO:3) (SEQIDNO:4) ACTC1 GCTCTGGGCTGGTGAAGG TTCTGACCCATACCCACCAT (SEQIDNO:5) (SEQIDNO:6) TNNT2 TGCAGGAGAAGTTCAAGCAG AGCGAGGAGCAGATCTTTGG CAGA(SEQIDNO:7) TGAA(SEQIDNO:8) MYL2 CAACGTGTTCTCCATGTTCG GTCAATGAAGCCATCCCTGT (SEQIDNO:9) (SEQIDNO:10) GATA4 GCGGCCTCTACATGAAGCTC CTTCCGTTTTCTGGTTTGGA (SEQIDNO:11) (SEQIDNO:12) GJA1 CAATCACTTGGCGTGACTTC CCTCCAGCAGTTGAGTAGGC (SEQIDNO:13) (SEQIDNO:14) RYR2 ACAGCACAAGCCATTCTGCA ATGTAATCCAGCCCACCCAG AGA(SEQIDNO:15) ACAT(SEQIDNO:16) SERCA2A TGAGACGCTCAAGTTTGTGG TCATGCACAGGGTTGGTAGA (SEQIDNO:17) (SEQIDNO:18) CACNA1C TTTGGTCCATGGTCAATGAG GCATTGGCATTCATGTTGG (SEQIDNO:19) (SEQIDNO:20) SCN5A GGGCAATGTCTCAGCCTTAC CATCAGCCAGCTTCTTCACA (SEQIDNO:21) (SEQIDNO:22) KCNH2 CCTTCGACCTGCTCATCTTC TGAGTAGCGATCCAGCTTCC (SEQIDNO:23) (SEQIDNO:24) KCNQ1 CGCCTGAACCGAGTAGAAGA AAGGAGAGCAGCTGGTGAAG (SEQIDNO:25) (SEQIDNO:26) GAPDH AGGGATCTCGCTCCTGGAA AGGGATCTCGCTCCTGGAA (SEQIDNO:27) (SEQIDNO:28)
Transmission Electron Microscopy
[0114] Cardiac macrotissues were fixed with 2.5% glutaraldehyde (Electron Microscopy Sciences) for 2 h at 4 C. After washing with 0.1 M cacodylate buffer (pH=7.2) (Sigma-Aldrich), cardiac macrotissues were gradually dehydrated with ethanol and embedded in epoxy resin (Ted Pella). Semithin sections (0.25 m) were cut with a diamond knife using an ultramicrotome (Leica UC6), and stained lightly with 1% toluidine blue (Panreac). Later, ultra-thin sections (0.08 m) were cut with a diamond knife, contrasted with uranyl acetate (Electron Microscopy Sciences) and lead citrate (Electron Microscopy Sciences) and examined under a JEOL 1011 transmission electronic microscope (JEOL). Images were analyzed using ImageJ free software (National Institutes of Health, USA).
Drug Treatment
[0115] Isoproterenol, carbachol and sotalol were purchased from Sigma-Aldrich. All chemicals were dissolved in distilled water to make stock solutions, and serial dilutions were made in RPMI (Invitrogen) culture medium. To test changes in the -adrenergic response, 1 M isoproterenol was injected to the bioreactor circuit through the luer injection port (Inycom). For cholinergic stimulation, 10 M carbachol was injected, and sotalol was added at 10 M to evaluate the blockade of hERG current (Braam, S. R. et al, 2013). Spontaneous activity of cardiac constructs was recorded as baseline period. Cardiac constructs were treated with pharmacological agents during 10 min for immediate analysis, followed by 5 min washout for isoproterenol and carbachol, and 15 min for sotalol.
Recording and Processing of Electrocardiogram (ECG)-Like Signals Generated by Cardiac Macrotissues
[0116] Electrocardiogram (ECG)-like signals were acquired through the three electrodes configuration built in the custom-made cell culture chamber and using an advanced transducer amplifier. The gold electrode acted as internal reference, and electrical activity of cardiac macrotissues was acquired using the gold and graphite electrodes. In particular, Amplifier I acquires activity between: Graphite+ and Reference; and Amplifier II acquires activity between: Graphite+ and Graphite (
[0117] Recorded ECG-like signals were bandpass filtered (zero-phase fourth-order Butterworth filter with cut-off frequencies of 0.2 and 125 Hz), to use the main bandwidth of the classical electrocardiographic studies. Previously, the 50 Hz line interference and harmonics were cancelled by a comb-notch filter. To improve identification of patterns in the ECG-like signals (
[0118] During the experiments involving drug treatment, instantaneous beat rate expressed as beats per minute (bpm) was calculated over ECG-like signals, generated in both control and CardioSlice constructs at baseline and after drug application. Beat rate was assessed by measuring the RR interval, which is the time elapsing between two consecutive R waves in the electrocardiogram. Relative beat rate to baseline was calculated to evaluate the behavior of cardioactive drug effects.
Statistical Analysis
[0119] Normal distribution of data was tested using the Shapiro-Wilk and Kolmogorov-Smirnov normality tests. Differences between Young modulus (E) and fractional area change (FAC) means were analyzed using Student's t-Test. Non-parametric analysis was performed using Mann-Whitney U test for sarcomere width, maximum capture rate (MCR) and <cos 2>, as well as to evaluate the beating rate change after isoproterenol and carbachol treatments. Regarding the average strain per contraction, means were compared using one-way ANOVA and subsequently analyzed using Tukey's post hoc test. The difference between the variance of experimental groups in QRS duration, QT interval and QRS amplitude was analyzed using two-sample test for variances (F-test). Software used were Origin 8.5 (OriginLab, Northampton, USA) and GraphPad Prism 6, and differences were considered significant when p<0.05.
Results
[0120] Development of a Parallelized Bioreactor for Continuous Perfusion and Electrical Stimulation/Recording of Cardiac Macroscale Constructs
[0121] To generate CardioSlice constructs, a parallelized perfusion bioreactor including electrical stimulation was designed (
[0122] The shear stress to which cells would be exposed in the perfusion bioreactor was calculated as previously described (Radisic, M. et al, 2004). The minimum flow rate needed for efficiently perfusing cardiac macrotissues depends on the overall mass balance of oxygen, and it was estimated to be 0.1 ml/min for rat cardiac tissue constructs, and 0.2 ml/min for human cardiac tissues. Then, shear stress affecting the cells within the scaffold was calculated by taking into account the flow rate, culture medium viscosity (0.0078 dyn.Math.s/cm.sup.2)(Bacabac, R. G. et al, 2005), and the volume (19.6 mm.sup.3), void fraction (0.94), and mean pore radius (8.5 m,
[0123] Next, the custom-made perfusion chambers including electrical stimulation were installed in the parallelized perfusion bioreactor (
[0124] Structural Signs of Cell and Tissue Maturation in CardioSlice Constructs
[0125] To create human cardiac macrotissues, we differentiated cardiomyocytes from hiPSC following a robust and reproducible protocol based on modulation of Wnt/-catenin signaling with small molecule inhibitors (Lian, X. et al, 2013). hiPSC differentiated in this way formed contracting monolayers comprising high percentages of cardiomyocytes, as defined by co-expression of cardiac troponin I (cTnI) and myosin heavy chain (MHC) proteins (71.65.3% cTnI.sup.+/MHC.sup.+ cells) after 20 days of differentiation (
[0126] In a first set of experiments, we tested the effects of electrical stimulation on human cardiac macrotissues. For this purpose, constructs were randomly introduced into perfusion chambers and randomly assigned to the control group (only perfusion), or to the CardioSlice group (perfusion and electrical stimulation), and maintained in culture for up to 14 days. Human cardiac macrotissues exhibited cardiomyocytes distributed along the scaffold that strongly expressed cardiac contractile proteins, including cardiac troponin T (cTnT) and -sarcomeric actin (ASA) (
[0127] The expression level of key cardiac genes was measured in control and CardioSlice constructs and compared with those of cells cultured for equivalent periods of time under conventional 2D conditions (
[0128] Biomechanical Signs of Tissue Maturation in CardioSlice Constructs
[0129] Upon harvesting from the bioreactor chambers, both control and CardioSlice constructs displayed spontaneous beating, which was much more apparent macroscopically in the case of CardioSlice constructs. Electric field stimulation had a direct impact on cell distribution within the CardioSlice constructs, as cells concentrated in the region delimited by the stimulating electrodes (
[0130] The effect of electrical stimulation on the contractility of CardioSlice constructs was further analyzed by Particle Image Velocimetry (NV). The velocity maps generated with this technique demonstrated that the velocity in each contraction was higher in CardioSlice constructs than in controls, corroborating their enhanced contractile performance (
[0131] CardioSlice Constructs Generate ECG-Like Signals
[0132] Human cardiac macrotissues produced a bioelectrical signal that was a sum of the action potentials generated by the individual cardiomyocytes comprising the construct. Such signal could be registered on the surface of constructs using the electrodes embedded within the perfusion chamber (
[0133] We next tested whether cardiomyocytes within macrotissue constructs retained the ability to respond to positive and negative inotropic factors. Similar to iPSC-derived cardiomyocytes cultured under standard 2D conditions and to control macrotissue constructs (data not shown), CardioSlice constructs increased or decreased beating rate upon treatment with isoproterenol or carbachol, respectively (
[0134] Electrical Stimulation Improves Structural Organization and Contractile Function of Rat Cardiac Macrotissues
[0135] To test the suitability of the bioreactor to generate cardiac macrotissues, a primary culture of neonatal rat cardiomyocytes was used. Tissue constructs were cultured for 7 days under perfusion (Control group) or under perfusion plus electrical stimulation (Electrical stimulation group, ES), and cell morphology and distribution was analyzed by immunofluorescence (
[0136] To further characterize cell organization and maturity, cardiac tissues were examined at ultrastructural level by transmission electron microscopy (TEM). Tissue constructs cultured under electrical stimulation showed cardiomyocytes with a well-developed and organized sarcomeric banding, including well-defined Z-bands and intercellular unions composed of desmosomes (
[0137] Functional activity of rat cardiac macrotissues was also assessed after 7 days in culture by determining the fractional area change (FAC). Cardiac macrotissues exposed to continuous electrical pacing exhibited contraction amplitude values four times higher than non-stimulated ones (
[0138] Prediction of Drug-Induced Cardiotoxicity Using CardioSlice Constructs
[0139] To investigate the ability of human cardiac macrotissues to predict drug-induced cardiotoxicity, macrotissues at day 14 of culture were incubated with sotalol, a hERG potassium channel blocker and adrenergic antagonist. Upon 10 min treatment, control cardiac macrotissues showed random increases and decreases in beating frequency, and no alteration in the morphology of ECG-like signals (
[0140] Accordingly, the bioreactor system allowed perfusing drugs through the entire tissue, mimicking in vivo microcirculation, which has also been identified as a relevant parameter for testing drug effects (Mathur, A. et al, 2015). These capabilities proved to be determinant when evaluating the drug-induced toxicity effects on our macrotissues. Typically, safety of cardiac drugs is assessed by measuring currents on hERG ion channels ectopically expressed in non-cardiac cell lines (HEK293, CHO). These assays produce false positives and false negatives, as in the cases of verapamil and alfuzosin, respectively (Mathur, A. et al, 2015). Our system allowed to determine the effects of proarrhythmic drugs on the ECG-like signal generated by CardioSlice constructs. Upon treatment with the proarrhythmic drug sotalol, CardioSlice constructs showed a pathological prolongation of the QT interval, alterations in the morphology and polarity of the QRS complex in ECG-like signals and arrhythmias, as it is seen in vivo (Straus, S. M. et al, 2006). Such responses were not identified in control constructs, even though they contained the same numbers of cardiomyocytes and fibroblasts, cultured in parallel under identical conditions (except, of course, for the continuous electrical stimulation applied to CardioSlice constructs). Because proarrhythmic behavior of drugs is oftentimes only found after they have been administered to patients, we propose that the predictive capabilities of CardioSlice constructs reflect their higher degree of close-to-human tissue-like functionality.
[0141] In summary, we have developed a method and associated technology that allows the production of thick human cardiac macrotissues with tissue-like functionality. CardioSlice constructs showed improved cellular alignment and ultrastructural organization, as well as contractility and synchronization, and were able to predict drug-induced cardiotoxicity. These data illustrate the enhanced tissue-like functionality achieved by our model. The physiological relevance of CardioSlice constructs, together with their parallel and scalable nature, and the on-line electrophysiological monitoring feature, make our technology to be in the forefront of the production of engineered human cardiac macrotissues.
REFERENCES
[0142] 1. Chien, K. R., Domian, I. J. & Parker, K. K. Cardiogenesis and the complex biology of regenerative cardiovascular medicine. Science 322, 1494-1497 (2008). [0143] 2. Hunter, P. J., Pullan, A. J. & Smaill, B. H. Modeling total heart function. Annu Rev Biomed Eng 5, 147-177 (2003). [0144] 3. Fermini, B. & Fossa, A. A. The impact of drug-induced QT interval prolongation on drug discovery and development. Nat Rev Drug Discov 2, 439-447 (2003). [0145] 4. Fleischer, S., Shapira, A., Feiner, R. & Dvir, T. Modular assembly of thick multifunctional cardiac patches. Proc Natl Acad Sci USA 114, 1898-1903 (2017). [0146] 5. Zimmermann, W. H. et al. Tissue engineering of a differentiated cardiac muscle construct. Circ Res 90, 223-230 (2002). [0147] 6. Shimizu, T. et al. Fabrication of pulsatile cardiac tissue grafts using a novel 3-dimensional cell sheet manipulation technique and temperature-responsive cell culture surfaces. Circ Res 90, e40 (2002). [0148] 7. Radisic, M. et al. Functional assembly of engineered myocardium by electrical stimulation of cardiac myocytes cultured on scaffolds. Proc Natl Acad Sci USA 101, 18129-18134 (2004). [0149] 8. Parsa, H., Ronaldson, K. & Vunjak-Novakovic, G. Bioengineering methods for myocardial regeneration. Adv Drug Deliv Rev 96, 195-202 (2016). [0150] 9. Feric, N. T. & Radisic, M. Maturing human pluripotent stem cell-derived cardiomyocytes in human engineered cardiac tissues. Adv Drug Deliv Rev 96, 110-134 (2016). [0151] 10. Schaaf, S. et al. Human engineered heart tissue as a versatile tool in basic research and preclinical toxicology. PLoS One 6, e26397 (2011). [0152] 11. Nunes, S. S. et al. Biowire: a platform for maturation of human pluripotent stem cell-derived cardiomyocytes. Nat Methods 10, 781-787 (2013). [0153] 12. Thavandiran, N. et al. Design and formulation of functional pluripotent stem cell-derived cardiac microtissues. Proc Natl Acad Sci USA 110, E4698-4707 (2013). [0154] 13. Ma, Z. et al. Self-organizing human cardiac microchambers mediated by geometric confinement. Nat Commun 6, 7413 (2015). [0155] 14. Tandon, N. et al. Electrical stimulation systems for cardiac tissue engineering. Nat Protoc 4, 155-173 (2009). [0156] 15. Godier-Furnemont, A. F. et al. Physiologic force-frequency response in engineered heart muscle by electromechanical stimulation. Biomaterials 60, 82-91 (2015). [0157] 16. Hansen, A. et al. Development of a drug screening platform based on engineered heart tissue. Circ Res 107, 35-44 (2010). [0158] 17. Mathur, A. et al. Human iPSC-based cardiac microphysiological system for drug screening applications. Sci Rep 5, 8883 (2015). [0159] 18. Amano, Y. et al. Development of vascularized iPSC derived 3D-cardiomyocyte tissues by filtration Layer-by-Layer technique and their application for pharmaceutical assays. Acta Biomater 33, 110-121 (2016). [0160] 19. Kurokawa, Y. K. & George, S. C. Tissue engineering the cardiac microenvironment: Multicellular microphysiological systems for drug screening. Adv Drug Deliv Rev 96, 225-233 (2016). [0161] 20. Lovett, M., Lee, K., Edwards, A. & Kaplan, D. L. Vascularization strategies for tissue engineering. Tissue Eng Part B Rev 15, 353-370 (2009). [0162] 21. Carrier, R. L. et al. Perfusion improves tissue architecture of engineered cardiac muscle. Tissue Eng 8, 175-188 (2002). [0163] 22. Radisic, M. et al. Medium perfusion enables engineering of compact and contractile cardiac tissue. Am J Physiol Heart Circ Physiol 286, H507-516 (2004). [0164] 23. Radisic, M., Marsano, A., Maidhof, R., Wang, Y. & Vunjak-Novakovic, G. Cardiac tissue engineering using perfusion bioreactor systems. Nat Protoc 3, 719-738 (2008). [0165] 24. Barash, Y. et al. Electric field stimulation integrated into perfusion bioreactor for cardiac tissue engineering. Tissue Eng Part C Methods 16, 1417-1426 (2010). [0166] 25. Bacabac, R. G. et al. Dynamic shear stress in parallel-plate flow chambers. J Biomech 38, 159-167 (2005). [0167] 26. Shachar, M., Benishti, N. & Cohen, S. Effects of mechanical stimulation induced by compression and medium perfusion on cardiac tissue engineering. Biotechnol Prog 28, 1551-1559 (2012). [0168] 27. Cheng, M., Moretti, M., Engelmayr, G. C. & Freed, L. E. Insulin-like growth factor-I and slow, bi-directional perfusion enhance the formation of tissue-engineered cardiac grafts. Tissue Eng Part A 15, 645-653 (2009). [0169] 28. Lian, X. et al. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/beta-catenin signaling under fully defined conditions. Nat Protoc 8, 162-175 (2013). [0170] 29. Liau, B., Jackman, C. P., Li, Y. & Bursac, N. Developmental stage-dependent effects of cardiac fibroblasts on function of stem cell-derived engineered cardiac tissues. Sci Rep 7, 42290 (2017). [0171] 30. Tiburcy, M. et al. Defined Engineered Human Myocardium With Advanced Maturation for Applications in Heart Failure Modeling and Repair. Circulation 135, 1832-1847 (2017). [0172] 31. Yang, X., Pabon, L. & Murry, C. E. Engineering adolescence: maturation of human pluripotent stem cell-derived cardiomyocytes. Circ Res 114, 511-523 (2014). [0173] 32. Xiao, Y. et al. Microfabricated perfusable cardiac biowire: a platform that mimics native cardiac bundle. Lab Chip 14, 869-882 (2014). [0174] 33. Ruan, J. L. et al. Mechanical Stress Conditioning and Electrical Stimulation Promote Contractility and Force Maturation of Induced Pluripotent Stem Cell-Derived Human Cardiac Tissue. Circulation 134, 1557-1567 (2016). [0175] 34. Soong, P. L., Tiburcy, M. & Zimmermann, W. H. Cardiac differentiation of human embryonic stem cells and their assembly into engineered heart muscle. Curr Protoc Cell Biol Chapter 23, Unit 23 28 (2012). [0176] 35. Fennema, E., Rivron, N., Rouwkema, J., van Blitterswijk, C. & de Boer, J. Spheroid culture as a tool for creating 3D complex tissues. Trends Biotechnol 31, 108-115 (2013). [0177] 36. Kensah, G. et al. Murine and human pluripotent stem cell-derived cardiac bodies form contractile myocardial tissue in vitro. Eur Heart J 34, 1134-1146 (2013). [0178] 37. Zhang, D. et al. Tissue-engineered cardiac patch for advanced functional maturation of human ESC-derived cardiomyocytes. Biomaterials 34, 5813-5820 (2013). [0179] 38. Turnbull, I. C. et al. Advancing functional engineered cardiac tissues toward a preclinical model of human myocardium. FASEB J 28, 644-654 (2014). [0180] 39. Hinson, J. T. et al. HEART DISEASE. Titin mutations in iPS cells define sarcomere insufficiency as a cause of dilated cardiomyopathy. Science 349, 982-986 (2015). [0181] 40. Huebsch, N. et al. Miniaturized iPS-Cell-Derived Cardiac Muscles for Physiologically Relevant Drug Response Analyses. Sci Rep 6, 24726 (2016). [0182] 41. Maidhof, R. et al. Biomimetic perfusion and electrical stimulation applied in concert improved the assembly of engineered cardiac tissue. J Tissue Eng Regen Med 6, e12-23 (2012). [0183] 42. Kensah, G. et al. A novel miniaturized multimodal bioreactor for continuous in situ assessment of bioartificial cardiac tissue during stimulation and maturation. Tissue Eng Part C Methods 17, 463-473 (2011). [0184] 43. Ma, Z. et al. Three-dimensional filamentous human diseased cardiac tissue model. Biomaterials 35, 1367-1377 (2014). [0185] 44. Eng, G. et al. Autonomous beating rate adaptation in human stem cell-derived cardiomyocytes. Nat Commun 7, 10312 (2016). [0186] 45. Tzatzalos, E., Abilez, O. J., Shukla, P. & Wu, J. C. Engineered heart tissues and induced pluripotent stem cells: Macro- and microstructures for disease modeling, drug screening, and translational studies. Adv Drug Deliv Rev 96, 234-244 (2016). [0187] 46. Hirt, M. N., Hansen, A. & Eschenhagen, T. Cardiac tissue engineering: state of the art. Circ Res 114, 354-367 (2014). [0188] 47. Liang, P. et al. Drug screening using a library of human induced pluripotent stem cell-derived cardiomyocytes reveals disease-specific patterns of cardiotoxicity. Circulation 127, 1677-1691 (2013). [0189] 48. Pradhapan, P., Kuusela, J., Viik, J., Aalto-Setala, K. & Hyttinen, J. Cardiomyocyte MEA data analysis (CardioMDA)a novel field potential data analysis software for pluripotent stem cell derived cardiomyocytes. PLoS One 8, e73637 (2013). [0190] 49. Nguemo, F. et al. In vitro model for assessing arrhythmogenic properties of drugs based on high-resolution impedance measurements. Cell Physiol Biochem 29, 819-832 (2012). [0191] 50. Yan, P. et al. Palette of fluorinated voltage-sensitive hemicyanine dyes. Proc Natl Acad Sci USA 109, 20443-20448 (2012). [0192] 51. Straus, S. M. et al. Prolonged QTc interval and risk of sudden cardiac death in a population of older adults. J Am Coll Cardiol 47, 362-367 (2006). [0193] 52. Tandon, N. et al. Optimization of electrical stimulation parameters for cardiac tissue engineering. J Tissue Eng Regen Med 5, e115-125 (2011). [0194] 53. Richards-Kortum, R. & Sevick-Muraca, E. Quantitative optical spectroscopy for tissue diagnosis. Annu Rev Phys Chem 47, 555-606 (1996). [0195] 54. Jiang, X. et al. Two-photon fluorescence and second-harmonic generation imaging of collagen in human tissue based on multiphoton microscopy. Scanning 33, 53-56 (2011). [0196] 55. Thielicke, W. & Stamhuis, E. J. PIVlabTowards User-friendly, Affordable and Accurate Digital Particle Image Velocimetry in MATLAB. Journal of Open Research Software 2(1):e30 (2014). [0197] 56. Thielicke, W. & Stamhuis, E. J. PIVlabTime-Resolved Digital Particle Image Velocimetry Tool for MATLAB (version: 1.41). Journal of Open Research Software (2014). [0198] 57. Thielicke, W. The flapping flight of birds: Analysis and application. Phd thesis, Rijksuniversiteit Groningen. [S.1.]: [S.n.] (2014). [0199] 58. Braam, S. R. et al. Repolarization reserve determines drug responses in human pluripotent stem cell derived cardiomyocytes. Stem Cell Res 10, 48-56 (2013). [0200] 59. Wu, Z. H. & Huang, N. E. Ensemble empirical mode decomposition: a noise-assisted data analysis method. Adv Adapt Data Anal 1, 1-4 (2009). [0201] 60. Halim A S et al., Biologic and synthetic skin substitutes: An overview. Indian Journal of Plastic Surgery 43, 23-28 (2010). [0202] 61. Chung et al., Human Embryonic Stem Cell lines generated without embryo destruction. Cell Stem Cell, 2, 113-117 (2008). [0203] 62. Takahashi et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872 (2007). [0204] 63. Graichen R, et al. Enhanced cardiomyogenesis of human embryonic stem cells by a small molecular inhibitor of p38 MAPK. Differentiation; 76:357-370 (2008). [0205] 64. Yang L, et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature; 453:524-528 (2008). [0206] 65. Kattman S J, et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell Stem Cell; 8:228-240 (2011). [0207] 66. Mohr J C, et al. The microwell control of embryoid body size in order to regulate cardiac differentiation of human embryonic stem cells. Biomaterials; 31:1885-1893. (2010). [0208] 67. Azarin S M, et al. Modulation of Wnt/beta-catenin signaling in human embryonic stem cells using a 3-D microwell array. Biomaterials; 33:2041-2049 (2012). [0209] 68. Lian X, et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci USA; 109:E1848-1857 (2012). [0210] 69. Zhang J, et al. Extracellular Matrix Promotes Highly Efficient Cardiac Differentiation of Human Pluripotent Stem Cells: The Matrix Sandwich Method. Circ Res. 111(9):1125-36 (2012). [0211] 70. Ban H et al. Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci USA. 23; 108(34):14234-9 (2011). [0212] 71. Yu J. et al. Human induced pluripotent stem cells free of vector and transgene sequences. Science 324(5928):797-801 (2009). [0213] 72. Warren L. et al. Highly efficient reprogramming to pluripotency and directed differentiation
[0214] The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.
[0215] These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.