COMBINATIONS AND METHODS COMPRISING A CAPSID ASSEMBLY INHIBITOR
20190365767 ยท 2019-12-05
Inventors
- George Hartman (Lansdale, PA, US)
- Osvaldo FLORES (North Wales, PA, US)
- Klaus KLUMPP (West Chester, PA, US)
- Man Iu LAM (Fort Lee, NJ, US)
- Jan Martin BERKE (Beerse, BE)
Cpc classification
A61K31/522
HUMAN NECESSITIES
C12N7/06
CHEMISTRY; METALLURGY
A61K31/706
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/095
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61K31/7072
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
International classification
A61K31/7072
HUMAN NECESSITIES
A61K31/40
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61K31/522
HUMAN NECESSITIES
Abstract
The present disclosure is directed to capsid assembly inhibitor compositions and methods for use in the treatment of hepatitis B virus infection.
Claims
1-35. (canceled)
36. A combination product comprising a therapeutically effective amount of a core protein allosteric modulator (CpAM) and a therapeutically effective amount of reverse transcriptase inhibitor, wherein the core protein allosteric modulator is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents, wherein the core protein allosteric modulator is compound 2: ##STR00025## or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof; and the reverse transcriptase inhibitor is lamivudine.
37. A combination product comprising a therapeutically effective amount of a core protein allosteric modulator (CpAM) and a therapeutically effective amount of reverse transcriptase inhibitor, wherein the core protein allosteric modulator is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents, wherein the core protein allosteric modulator is compound 3: ##STR00026## or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof; and the reverse transcriptase inhibitor is lamivudine.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
DETAILED DESCRIPTION OF THE INVENTION
[0086] The present disclosure is directed to methods of using a capsid assembly inhibitor for the treatment of hepatitis B virus (HBV) infection. In particular, provided herein is a method of treating an HBV infection in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor. In an embodiment, the CpAM is a core protein allosteric modulator that causes aberrant, defective or incomplete assembly of HBV capsids. In another embodiment, the CpAM is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents. Also provided herein are methods for treating an HBV infection a patient in need thereof comprising administering a CpAM (e.g., a compound of Formula I, Formula IA, Formula IB, Formula IIA, Formula IIIA or Formula IIIB, Compound 1, Compound 2, or Compound 3) and a reverse transcriptase inhibitor. Further provided herein are combination products and pharmaceutical compositions comprising a CpAM (e.g., a compound of Formula I, Formula IA, Formula IB, Formula IIA, Formula IIIA or Formula IIIB, Compound 1, Compound 2, or Compound 3) and a reverse transcriptase inhibitor. Also provided herein are combination products and pharmaceutical compositions comprising a CpAM having the Formula IB and a reverse transcriptase inhibitor. Also, provided herein are methods for treating an HBV infection in patient resistant or refractory to treatment with a reverse transcriptase inhibitor or a nucleos(t)ide agent comprising administering a compound of Formula I, Formula IA, Formula IB, Formula IIA, Formula IIIA or Formula IIIB, Compound 1, Compound 2, or Compound 3. Also, provided herein are methods for treating an HBV infection in patient resistant or refractory to treatment with a reverse transcriptase inhibitor or a nucleos(t)ide agent comprising administering a compound of Formula IB.
I. Definitions
[0087] As used in the specification and in the claims, the term comprising may include the embodiments consisting of and consisting essentially of. The terms comprise(s), include(s), having, has, may, contain(s), and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that require the presence of the named ingredients/steps and permit the presence of other ingredients/steps. However, such description should be construed as also describing compositions or processes as consisting of and consisting essentially of the enumerated compounds, which allows the presence of only the named compounds, along with any pharmaceutically acceptable carriers, and excludes other compounds.
[0088] All ranges disclosed herein are inclusive of the recited endpoint and independently combinable (for example, the range of from 600 mg to 3000 mg is inclusive of the endpoints, 600 mg and 3000 mg, and all the intermediate values, such as 2000 mg). The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value; they are sufficiently imprecise to include values approximating these ranges and/or values.
[0089] As used herein, approximating language may be applied to modify any quantitative representation that may vary without resulting in a change in the basic function to which it is related. Accordingly, a value modified by a term or terms, such as about and substantially, may not be limited to the precise value specified, in some cases. In at least some instances, the approximating language may correspond to the precision of an instrument for measuring the value. The modifier about should also be considered as disclosing the range defined by the absolute values of the two endpoints. For example, the expression from about 600 to about 3000 also discloses the range from 600 to 3000. The term about may refer to plus or minus 10% of the indicated number. For example, about 10% may indicate a range of 9% to 11%, and about 1 may mean from 0.9 to 1.1. Other meanings of about may be apparent from the context, such as rounding off, so, for example about 1 may also mean from 0.5 to 1.4.
[0090] As used herein, the phrase core protein allosteric modulator (CpAM) refers to a compound that alters core protein assembly or activity (Zlotnick, Antiviral Research 121 (2015) 82-93). At least two classes of CpAMs have been identified that alter core protein assembly in two distinct ways.
[0091] A first class CpAM is shown to misdirect capsid assembly to form aberrant non-capsid polymers. This first class is hereinafter referred to as a core protein allosteric modulator that causes aberrant, defective or incomplete assembly of HBV capsids. An example of this class is heteroaryldihydropyrimidine (HAP) based compounds. At high concentrations, HAPs lead to misdirected capsid assembly to form aberrant non-capsid polymers. At sub-stoichiometirc concentrataions, when compared to Cp concentration, HAPs increase the rate of capsid assembly. Crystal structures between the HBV capsid and HAP show quaternary structure changes in the capsid, forming connected rigid bodies, with little change to the tertiary structure. An example of a HAP includes, but is not limited to, methyl 4-(2-chloro-4-fluorophenyl)-6-methyl-2-(pyridin-2-yl)-1,4-dihydropyrimidine-5-carboxylate (HAP-1).
[0092] One other type of CpAM increases the rate of capsid assembly without affecting capsid morphology, hereinafter referred to as a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents.
[0093] An example of this class are non-nucleoside-based phenylpropenamide (PPA) based compounds. PPAs increase the rate of capsid assembly without affecting capsid morphology. Cell culture studies reveal that capsids formed in the presence of PPAs are empty with respect to their viral contents, a result of blocking viral RNA packaging. Crystal structures between HBV and PPA show both quaternary and tertiary structure changes as well. Another example of such empty capsid forming CpAMs include, but are not limited to compounds of Formula I, Formula IA, Formula IB, Formula IIA, Formula IIIA or Formula IIIB, Compound 1, Compound 2, and Compound 3 described herein.
[0094] Formula IB is also an example of an a core protein allosteric modulator that causes assembly of essentially empty capsids.
[0095] As used herein, the term reverse transcriptase inhibitor refers to nucleosides and nulceotides and analogues thereof that inhibit the activity of HBV reverse transcriptase. Examples include, but are not limited to, for example, entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0096] As used herein, a reverse transcriptase inhibitor can be a purine-based reverse transcriptase inhibitor, which is a reverse transcriptase inhibitor having a purine ring, such as, but not limited to, entecavir and tenofovir.
[0097] As used herein, the term treatment or treating, is defined as the application or administration of a therapeutic agent, i.e., a compound of the invention (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnosis or ex vivo applications), who has an HBV infection, a symptom of an HBV infection or the potential to develop an HBV infection, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the HBV infection, the symptoms of the HBV infection or the potential to develop the HBV infection. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
[0098] As used herein, the term patient, individual, or subject refers to a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the patient, subject or individual is human.
[0099] As used herein, the term pharmaceutically acceptable refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
[0100] As used herein, the term pharmaceutically acceptable salt refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts of the present invention include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present invention may be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts may be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2 (1977), each of which is incorporated herein by reference in its entirety.
[0101] As used herein, the term composition or pharmaceutical composition refers to a mixture of at least one compound useful within the invention with a pharmaceutically acceptable carrier. The pharmaceutical composition facilitates administration of the compound to a patient or subject. Multiple techniques of administering a compound exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary and topical administration.
[0102] As used herein, the term pharmaceutically acceptable carrier means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Typically, such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation, including the compound useful within the invention, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, pharmaceutically acceptable carrier also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound useful within the invention, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The pharmaceutically acceptable carrier may further include a pharmaceutically acceptable salt of the compound useful within the invention. Other additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, Pa.), which is incorporated herein by reference.
[0103] The terms combination, therapeutic combination, pharmaceutical combination, or combination product as used herein refer to either a fixed combination in one dosage unit form, or non-fixed combination, or a kit of parts for the combined administration where two or more therapeutic agents may be administered independently, at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g., synergistic, effect. The term combination therapy refers to the administration of two or more therapeutic agents to treat a therapeutic condition or disorder described in the present disclosure. Such administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single formulation having a fixed ratio of active ingredients or in separate formulations (e.g., capsules and/or intravenous formulations) for each active ingredient. In addition, such administration also encompasses use of each type of therapeutic agent in a sequential or separate manner, either at approximately the same time or at different times. Regardless of whether the active ingredients are administered as a single formulation or in separate formulations, the drugs are administered to the same patient as part of the same course of therapy. In any case, the treatment regimen will provide beneficial effects in treating the conditions or disorders described herein.
[0104] The term synergistic effect refers to the action of two agents, such as, for example, a capsid assembly inhibitor and a reverse transcriptase inhibitor, producing an effect, for example, slowing the symptomatic progression of HBV-infection or symptoms thereof, which is greater than the simple addition of the effects of each drug administered alone. A synergistic effect can be calculated, for example, using suitable methods such as the Sigmoid-Emax equation (Holford, N. H. G. and Scheiner, L. B., Clin. Pharmacokinet. 6: 429-453 (1981)), the equation of Loewe additivity (Loewe, S. and Muischnek, H., Arch. Exp. Pathol Pharmacol. 114: 313-326 (1926)) and the median-effect equation (Chou, T. C. and Talalay, P., Adv. Enzyme Regul. 22: 27-55 (1984) and Chou, Pharmacol. Rev. 58: 621-681 (2006). Each equation referred to above can be applied to experimental data to generate a corresponding graph to aid in assessing the effects of the drug combination. The corresponding graphs associated with the equations referred to above are the concentration-effect curve, isobologram curve and combination index curve, respectively. In some embodiments, the combination of compounds exhibits a synergistic effect (i.e., greater than additive effect) in the treatment of HBV infection. In further embodiments, the combination of compounds exhibits a synergistic effect (i.e., greater than additive effect) in the treatment of HBV-infection.
[0105] Synergy volumes of <100, 100 to 50, 50 to 25, 25 to 25, 25 to 50, 50 to 100, and >100 indicate strong antagonism, moderate antagonism, slight antagonism, insignificant synergism/antagonism (additivity), slight synergism, moderate synergism, and strong synergism respectively.
[0106] As used herein, the term resistant or refractive to a therapeutic agent when referring to an HBV patient means that the HBV patient has innate, or achieved resistance to, the effects of the therapeutic agent as a result of contact with the therapeutic agent. Stated alternatively, the HBV patient is resistant to the ordinary standard of care associated with the particular therapeutic agent.
[0107] As used herein, treatment nave refers to the patient not having previously received treatment with a druginvestigational or approvedfor HBV infection, in particular, a nucleos(t)ide drug.
[0108] Alternatively, patients treated according to the methods of the disclosure may be treatment experienced. As used herein, treatment experienced refers to a patient who has had at least one previous course of an HBV antiviral therapy, in particular a nucleos(t)ide. In some embodiments, the last dose in this previous course occurred at least three months prior to implementing a method according to the present disclosure.
[0109] HBV infections that may be treated according to the disclosed methods include HBV genotype A, B, C, and/or D infections. However, in an embodiment, the methods disclosed may treat any HBV genotype (pan-genotypic treatment). HBV genotyping may be performed using methods known in the art, for example, INNO-LIPA HBV Genotyping, Innogenetics N.V., Ghent, Belgium).
[0110] As used herein, the term alkyl, by itself or as part of another substituent means, unless otherwise stated, a straight or branched chain hydrocarbon having the number of carbon atoms designated (i.e., C.sub.1-C.sub.6-alkyl means an alkyl having one to six carbon atoms) and includes straight and branched chains. Examples include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, neopentyl, and hexyl. Other examples of C.sub.1-C.sub.6-alkyl include ethyl, methyl, isopropyl, isobutyl, n-pentyl, and n-hexyl.
[0111] As used herein, the term alkenyl denotes a monovalent group derived from a hydrocarbon moiety containing at least two carbon atoms and at least one carbon-carbon double bond. The double bond may or may not be the point of attachment to another group. Alkenyl groups (e.g., C.sub.2-C.sub.8-alkenyl) include, but are not limited to, for example, ethenyl, propenyl, prop-1-en-2-yl, butenyl, 1-methyl-2-buten-1-yl, heptenyl, octenyl and the like.
[0112] As used herein, alkynyl, means a straight or branched hydrocarbon radical containing up to 6 carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like.
[0113] As used herein, the term alkoxy, refers to the group O-alkyl, wherein alkyl is as defined herein. Alkoxy includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, t-butoxy and the like.
[0114] As used herein, the term halo or halogen alone or as part of another substituent means, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom, preferably, fluorine, chlorine, or bromine, more preferably, fluorine or chlorine.
[0115] As used herein, the term cycloalkyl means a non-aromatic carbocyclic system that is partially or fully saturated having 1, 2 or 3 rings wherein such rings may be fused. The term fused means that a second ring is present (i.e., attached or formed) by having two adjacent atoms in common (i.e., shared) with the first ring. Cycloalkyl also includes bicyclic structures that may be bridged or spirocyclic in nature with each individual ring within the bicycle varying from 3-8 atoms. The term cycloalkyl includes, but is not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bicyclo[3.1.0]hexyl, spiro[3.3]heptanyl, and bicyclo[1.1.1]pentyl.
[0116] As used herein, the term heterocycloalkyl means a non-aromatic carbocyclic system containing 1, 2, 3 or 4 heteroatoms selected independently from N, O, and S and having 1, 2 or 3 rings wherein such rings may be fused, wherein fused is defined above. Heterocycloalkyl also includes bicyclic structures that may be bridged or spirocyclic in nature with each individual ring within the bicycle varying from 3-8 atoms, and containing 0, 1, or 2 N, O, or S atoms. The term heterocycloalkyl includes cyclic esters (i.e., lactones) and cyclic amides (i.e., lactams) and also specifically includes, but is not limited to, epoxidyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl (ie., oxanyl), pyranyl, dioxanyl, aziridinyl, azetidinyl, pyrrolidinyl, 2,5-dihydro-1H-pyrrolyl, oxazolidinyl, thiazolidinyl, piperidinyl, morpholinyl, piperazinyl, thiomorpholinyl, 1,3-oxazinanyl, 1,3-thiazinanyl, 2-azabicyclo[2.1.1]hexanyl, 5-azabicyclo[2.1.1]hexanyl, 6-azabicyclo[3.1.1]heptanyl, 2-azabicyclo[2.2.1]heptanyl, 3-azabicyclo[3.1.1]heptanyl, 2-azabicyclo[3.1.1]heptanyl, 3-azabicyclo[3.1.0]hexanyl, 2-azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.2.1]octanyl, 8-azabicyclo[3.2.1]octanyl, 3-oxa-7-azabicyclo[3.3.1]nonanyl, 3-oxa-9-azabicyclo[3.3.1]nonanyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 6-oxa-3-azabicyclo[3.1.1]heptanyl, 2-azaspiro[3.3]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, 2-oxaspiro[3.3]heptanyl, 2-oxaspiro[3.5]nonanyl, 3-oxaspiro[5.3]nonanyl, and 8-oxabicyclo[3.2.1]octanyl.
[0117] As used herein, the term aromatic refers to a carbocycle or heterocycle with one or more polyunsaturated rings and having aromatic character, i.e., having (4n+2) delocalized Tr (pi) electrons, where n is an integer.
[0118] As used herein, the term aryl means an aromatic carbocyclic system containing 1, 2 or 3 rings, wherein such rings may be fused, wherein fused is defined above. If the rings are fused, one of the rings must be fully unsaturated and the fused ring(s) may be fully saturated, partially unsaturated or fully unsaturated. The term aryl includes, but is not limited to, phenyl, naphthyl, indanyl, and 1,2,3,4-tetrahydronaphthalenyl.
[0119] As used herein, the term heteroaryl means an aromatic carbocyclic system containing 1, 2, 3, or 4 heteroatoms selected independently from N, O, and S and having 1, 2, or 3 rings wherein such rings may be fused, wherein fused is defined above. The term heteroaryl includes, but is not limited to, furanyl, thiophenyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, imidazo[1,2-a]pyridinyl, pyrazolo[1,5-a]pyridinyl, 5,6,7,8-tetrahydroisoquinolinyl, 5,6,7,8-tetrahydroquinolinyl, 6,7-dihydro-5H-cyclopenta[b]pyridinyl, 6,7-dihydro-5H-cyclopenta[c]pyridinyl, 1,4,5,6-tetrahydrocyclopenta[c]pyrazolyl, 2,4,5,6-tetrahydrocyclopenta[c]pyrazolyl, 5,6-dihydro-4H-pyrrolo[1,2-b]pyrazolyl, 6,7-dihydro-5H-pyrrolo[1,2-b][1,2,4]triazolyl, 5,6,7,8-tetrahydro-[1,2,4]triazolo[1,5-a]pyridinyl, 4,5,6,7-tetrahydropyrazolo[1,5-a]pyridinyl, 4,5,6,7-tetrahydro-1H-indazolyl and 4,5,6,7-tetrahydro-2H-indazolyl.
[0120] It is to be understood that if an aryl, heteroaryl, cycloalkyl, or heterocycloalkyl moiety is bonded or otherwise attached to a designated moiety through differing ring atoms (i.e., shown or described without denotation of a specific point of attachment), then all possible points are intended, whether through a carbon atom or, for example, a trivalent nitrogen atom. For example, the term pyridinyl means 2-, 3- or 4-pyridinyl, the term thiophenyl means 2- or 3-thiophenyl, and so forth.
[0121] As used herein, the term substituted means that an atom or group of atoms has replaced hydrogen as the substituent attached to another group.
I. Compounds
[0122] Provided herein is a method of treating an HBV infection in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor. In an embodiment, the CpAM is a core protein allosteric modulator that causes aberrant, defective or incomplete assembly of HBV capsids. In another embodiment, the CpAM is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents. The methods, combination product, and compositions provided herein comprise a compound of Formula I
##STR00011##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof and
[0123] a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt, or a prodrug thereof.
[0124] wherein
[0125] A is phenyl or pyridinyl;
[0126] B is a monocyclic 5-to-6-membered aromatic or heteroaromatic ring, wherein the aromatic ring or heteroaromatic ring is optionally substituted with one or more substitutents each independently selected from halogen or C.sub.1-C.sub.6 alkyl;
[0127] R.sup.1 is H or C.sub.1-C.sub.6 alkyl;
[0128] R.sup.2 is C.sub.1-C.sub.6 alkyl, wherein said C.sub.1-C.sub.6 alkyl is optionally substituted with one or more substitutents each independently selected from the group consisting of: halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H and CF.sub.3, or
[0129] R.sup.1 and R.sup.2 are taken together to form a C.sub.2-C.sub.7 heterocycloalkyl ring, wherein said C.sub.2-C.sub.7 heterocycloalkyl ring is optionally substituted with one or more substitutents each independently selected from the group consisting of: halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H and CF.sub.3;
[0130] each R.sup.3 is independently selected from the group consisting of: halogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, cyano, C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, and OH; and
[0131] n is 0, 1, 2, or 3.
[0132] In an embodiment of Formula I, B is a 5-membered heteroaromatic ring that is optionally and independently substituted one or more times with halogen or C.sub.1-C.sub.6 alkyl.
[0133] In an embodiment, the compound of Formula I is a compound of Formula IA
##STR00012##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof,
[0134] wherein
[0135] A is phenyl or pyridinyl;
[0136] R.sup.1 is H or C.sub.1-C.sub.6 alkyl;
[0137] R.sup.2 is C.sub.1-C.sub.6 alkyl, which is optionally and independently substituted one or more times with halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H or CF.sub.3;
[0138] R.sup.3 is independently for each occurrence halogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, cyano, C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, or OH;
[0139] X is CR.sup.4;
[0140] G.sup.3 is H or C.sub.1-C.sub.6 alkyl;
[0141] R.sup.4 is independently for each occurrence H, halogen, C.sub.1-C.sub.3 alkyl, or cyano; and
[0142] n is 0, 1, 2, or 3.
[0143] In an embodiment, the compound of Formula I is a compound of Formula IB
##STR00013##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof,
[0144] wherein
[0145] X is CR or N;
[0146] B is C.sub.5-C.sub.6 aryl, C.sub.5-C.sub.6 cycloalkyl, 5-6-membered heteroaryl, or 5-6-membered heterocyclyl, all of which may be optionally substituted with C.sub.1-C.sub.4 alkyl or halo;
[0147] R.sup.1 is H or C.sub.1-C.sub.6 alkyl;
[0148] R.sup.2 is C.sub.1-C.sub.6 alkyl, which is optionally and independently substituted one or more times with halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H or CF.sub.3;
[0149] R.sup.3 is independently for each occurrence halogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, cyano, C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, or OH;
[0150] R is C.sub.1-C.sub.4 alkyl, or halo; and
[0151] n is 0, 1, 2, or 3.
[0152] In an embodiment, the compound of Formula I is a compound of Formula II
##STR00014##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof,
[0153] wherein
[0154] R.sup.3 is halo;
[0155] G.sup.1 is H, C.sub.1-C.sub.4 alkyl, or halo;
[0156] G.sup.2 is selected from the group consisting of: H, halo, C.sub.1-C.sub.4 alkyl, and OH;
[0157] n is 0, 1, 2, or 3; and
[0158] m is 0, 1, or 2.
[0159] In another embodiment, the compound of Formula I is a compound of Formula IIIA
##STR00015##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof,
[0160] wherein
[0161] R.sup.1 is H or C.sub.1-C.sub.6 alkyl;
[0162] R.sup.2 is C.sub.1-C.sub.6 alkyl, which is optionally and independently substituted one or more times with halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H or CF.sub.3;
[0163] R.sup.3 is independently for each occurrence halogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, cyano, C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, or OH;
[0164] R.sup.4 is H, halogen, C.sub.1-C.sub.3 alkyl, or cyano; and
[0165] In yet another embodiment, the compound of Formula I is a compound of Formula IIIB
##STR00016##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, solvate thereof, or a crystalline form thereof,
[0166] wherein
[0167] R.sup.1 is H or C.sub.1-C.sub.6 alkyl;
[0168] R.sup.2 is C.sub.1-C.sub.6 alkyl, wherein said C.sub.1-C.sub.6 alkyl is optionally substituted with one or more substitutents each independently selected from the group consisting of: halogen, C.sub.1-C.sub.6 alkoxy, oxo, C.sub.1-C.sub.6 alkyl, OH, CN, CFH.sub.2, CF.sub.2H and CF.sub.3;
[0169] each R.sup.3 is independently selected from the group consisting of: halogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, cyano, C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, and OH;
[0170] G.sup.3 is H or C.sub.1-C.sub.6 alkyl;
[0171] X is CR.sup.4;
[0172] R.sup.4 is selected from the group consisting of: H, halogen, C.sub.1-C.sub.3 alkyl, and cyano; and
[0173] n is 0, 1, 2, or 3.
[0174] The methods, combination product, and compositions provided herein can comprise Compound 1:
##STR00017##
[0175] Compound 1 is also referred to herein as Compound I or Cmpd (I). Compound 1, including the synthesis thereof, is disclosed in PCT Publication No. WO/2013/096744, which is hereby incorporated by reference in its entirety.
[0176] Further, Compound 1 can exist in crystalline form, preferably one that is stable upon exposure to higher temperatures and humidity. Various crystal forms of Compound 1 are described in WO/2017/059059, which is hereby incorporated by reference in its entirety.
[0177] For example Form (XVI) of Compound 1 has an X-ray powder diffraction pattern as shown in
TABLE-US-00001 TABLE 12 X-Ray powder diffraction pattern of Form XVI of Compound 1 No. Pos. [2-theta] Peak Height [cts] 1 8.3325 177.19 2 10.9344 1935.52 3 14.3722 3710.48 4 14.9241 373.24 5 15.8427 2224.43 6 16.4561 2064.13 7 17.0677 5116.86 8 18.5296 4972.27 9 18.9049 872.76 10 20.0163 3381.98 11 20.7658 13446.21 12 21.5994 1648.19 13 22.1592 5552.43 14 22.8341 878.36 15 23.4421 2910.94 16 23.6338 2169.37 17 24.9292 12671.51 18 26.5972 15673.37 19 27.9963 3230.31 20 28.3825 1934.34 21 29.5627 1788.4 22 29.766 1697.44 23 30.4527 1526.62 24 31.1958 954.79 25 31.7034 1030.38 26 32.9259 1755.93 27 34.1563 1312 28 34.5404 2059.7 29 35.6022 1008.97 30 36.3734 2480.94 31 36.753 1575.29 32 38.3689 1684.63 33 39.7099 915.35 34 40.1675 1190.9 35 41.707 685.21 36 43.6419 800.32 37 44.6892 1534.39
[0178] Thus, in one embodiment, Compound 1 is in a crystalline form characterized by an X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of 17.1, 20.8, 22.2, 24.9, and 26.6 (Form XVI).
[0179] In a further embodiment, the crystalline form is characterized by an X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of 14.4, 17.1, 18.5, 20.0, 20.8, 22.2, 23.4, 24.9, 26.6, 28.0, and 36.4 (Form XVI).
[0180] In yet a further embodiment, the crystalline form is characterized by an X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of 8.3, 10.9, 14.4, 14.9, 15.8, 16.5, 17.1, 18.5, 18.9, 20.0, 20.8, 21.6, 22.2, 22.8, 23.4, 23.6, 24.9, 26.6, 28.0, 28.4, 29.6, 29.8, 30.5, 31.2, 31.7, 32.9, 34.2, 34.5, 35.6, 36.4, 36.8, 38.4, 39.7, 40.2, 41.7, 43.6, and 44.7 (Form XVI).
[0181] In another embodiment, the crystalline form is characterized by an X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of of 8.33, 10.93, 14.37, 14.92, 15.84, 16.46, 17.07, 18.53, 18.90, 20.02, 20.77, 21.60, 22.16, 22.83, 23.44, 23.63, 24.93, 26.60, 28.00, 28.38, 29.56, 29.77, 30.45, 31.20, 31.70, 32.93, 34.16, 34.54, 35.60, 36.37, 36.75, 38.37, 39.71, 40.17, 41.71, 43.64, and 44.69 (Form XVI).
[0182] In an embodiment, the crystalline form is characterized by an X-ray powder diffraction pattern that is substantially the same as that of
[0183] The X-ray powder diffraction pattern of Form III of Compound 1 is shown in
TABLE-US-00002 TABLE 11 X-Ray powder diffraction pattern of Compound 1 (Form III, Solvate of Acetone) No. Pos. [2-theta] Peak Height [cts] 1 6.1533 339.26 2 9.0816 1104.7 3 9.9483 1907.02 4 10.0321 1552.49 5 12.1685 3556.97 6 12.9616 383.96 7 14.2397 315.01 8 15.1483 2480.83 9 16.2048 1828.9 10 16.8775 256.66 11 18.269 953.62 12 18.6378 3776.85 13 19.9348 205.82 14 21.1993 1960.44 15 21.9332 550.39 16 22.2455 479.41 17 23.1308 548.36 18 24.4803 948.12 19 25.4636 170.21 20 25.8397 586.56 21 26.139 787.4 22 26.7489 173.31 23 27.404 149.44 24 28.053 307.13 25 28.9464 155.2 26 30.0145 564.17 27 31.9986 284.25 28 33.0882 659.21 29 34.0244 203.24 30 34.3991 227.63 31 37.0076 210.03 32 38.3419 102.07 33 40.4682 165.35 34 42.4278 144.39
[0184] In another aspect, the methods, combination product, and compositions provided herein comprise Compound 2:
##STR00018##
[0185] or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof. Compound 2 is also referred to herein as Compound II or Cmpd II. Compound 2, including the synthesis thereof, is disclosed in PCT Publication No. WO 2014/184350 which is hereby incorporated by reference in its entirety.
[0186] In yet another aspect, the methods, combination product, and compositions provided herein comprise Compound 3:
##STR00019##
[0187] or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof. Compound 3 is also referred to herein as Compound III or Cmpd (III). Compound 3, including the synthesis thereof, is disclosed in PCT Publication No WO2015/118057, which is hereby incorporated by reference in its entirety.
II. Methods
[0188] In an aspect, provided herein is a method of treating an HBV infection in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a core protein allosteric modulator (CpAM) and a therapeutically effective amount of a reverse transcriptase inhibitor. In an embodiment of the method, the CpAM is a core protein allosteric modulator that causes aberrant, defective or incomplete assembly of HBV capsids. In another embodiment of the method, the CpAM is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents. In an aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0189] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IA, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0190] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0191] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula II, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0192] In still another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IIA, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0193] In still another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of: a compound of Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0194] In still another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1:
##STR00020##
[0195] or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0196] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2:
##STR00021##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and
[0197] a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0198] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 3:
##STR00022##
or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and
[0199] a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt or a prodrug thereof.
[0200] Patients who may be treated using the described methods are in some embodiments human. Other warm-blooded animals may also be treated.
[0201] In an embodiment of the method, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, and lamivudine, or pharmaceutically acceptable salts or prodrugs thereof. Pharmaceutically acceptable prodrugs of tenofovir include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0202] In another embodiment, the reverse transcriptase inhibitor is a purine-based reverse transcriptase inhibitor.
[0203] In an embodiment, the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and the reverse transcriptase inhibitor are in separate formulations.
[0204] In another embodiment, the compound of Formula IA and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, the compound of Formula IA and the reverse transcriptase inhibitor are in separate formulations.
[0205] In another embodiment, the compound of Formula IB and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, the compound of Formula IB and the reverse transcriptase inhibitor are in separate formulations.
[0206] In an embodiment, Formula II and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, Formula II and the reverse transcriptase inhibitor are in separate formulations.
[0207] In an embodiment, Formula III and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, Formula III and the reverse transcriptase inhibitor are in separate formulations.
[0208] In an embodiment, Compound 1 and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, Compound 1 and the reverse transcriptase inhibitor are in separate formulations.
[0209] In an embodiment, Compound 2 or Compound 3 and the reverse transcriptase inhibitor are in the same formulation. In another embodiment, Compound 2 or Compound 3 and the reverse transcriptase inhibitor are in separate formulations.
[0210] In an embodiment of the method, the patient is resistant or refractory to treatment with a reverse transcriptase inhibitor. In another embodiment, the patient is resistant or refractory to treatment with a nucleoside agent. In yet another embodiment, the patient is a treatment nave patient.
[0211] In an embodiment, Compound 1 is administered in an amount from 600 mg per day to 3000 mg per day (inclusive of, e.g., about 600, about 800, about 1000, about 1200, about 1400, about 1600, about 1800, about 2000 mg). In an embodiment, Compound 1 is administered in an amount from 600 mg per day to 3000 mg per day. In a particular embodiment, Compound 1 is administered in an amount of about 2000 mg per day. In a further embodiment, Compound 1 is administered in an amount of about 1000 mg twice per day.
[0212] In an embodiment, Compound 2 or Compound 3 is administered in an amount from 5 mg per day to 600 mg per day (inclusive of, e.g., about 5, about 25, about 50, about 100, about 200, about 300, about 400, about 500, about 600 mg). In an embodiment, Compound 2 or Compound 3 is administered in an amount from 5 mg per day to 600 mg per day. In a particular embodiment, Compound 2 or Compound 3 is administered in an amount of about 25 mg per day. In a further embodiment, Compound 2 or Compound 3 is administered in an amount of about 10 mg once per day to 200 mg once per day.
[0213] In an embodiment provided herein, Compound 1 is in a crystalline form. In a further embodiment, the crystalline form is characterized by X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of 17.1, 20.8, 22.2, 24.9, and 26.6 (Form XVI).
[0214] In another embodiment of the method provided herein, the administration of the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0215] In another embodiment of the method provided herein, the administration of Compound 1 and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0216] In another embodiment of the method provided herein, the administration of Compound 2 or Compound 3 and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0217] In an embodiment, the patient is a chronically HBV-infected patient (with or without evidence of underlying liver inflammation).
[0218] In an embodiment, the method further comprises the administration of an additional HBV antiviral agent. In a particular embodiment, the additional HBV antiviral agent is pegylated interferon alpha-2a.
[0219] In an aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, wherein the patient is resistant or refractory to treatment with a reverse transcriptase inhibitor.
[0220] In an aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1 or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, wherein the patient is resistant or refractory to treatment with a reverse transcriptase inhibitor.
[0221] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2 or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, wherein the patient is resistant or refractory to treatment with a reverse transcriptase inhibitor.
[0222] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, wherein the patient is resistant or refractory to treatment with a nucleoside agent.
[0223] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1 or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, wherein the patient is resistant or refractory to treatment with a nucleoside agent.
[0224] In an embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 1 and entecavir.
[0225] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 1 and tenofovir.
[0226] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I and entecavir.
[0227] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I and tenofovir.
[0228] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IA and entecavir.
[0229] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IA and tenofovir.
[0230] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IB and entecavir.
[0231] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IB and tenofovir.
[0232] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula II and entecavir.
[0233] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula II and tenofovir.
[0234] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IIIA and entecavir.
[0235] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IIIA and tenofovir.
[0236] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IIIB and entecavir.
[0237] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula IIIB and tenofovir.
[0238] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 2 and entecavir.
[0239] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 2 and tenofovir.
[0240] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 3 and entecavir.
[0241] In another embodiment, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Compound 3 and tenofovir.
[0242] In an embodiment for treating an HBV infection, Compound 1 is administered in an amount from 600 mg per day to 3000 mg per day (e.g., about 600, about 800, about 1000, about 1200, about 1400, about 1600, about 1800, about 2000 mg). In a further embodiment, Compound 1 is administered in an amount from 600 mg per day to 2000 mg per day. In yet a further embodiment, Compound 1 is administered in an amount of about 2000 mg per day. In an embodiment of this embodiment, Compound 1 is administered in an amount of about 1000 mg twice per day.
[0243] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2 or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, wherein the patient is resistant or refractory to treatment with a nucleoside agent.
[0244] In an embodiment for treating an HBV infection, Compound 2 or Compound 3 is administered in an amount from 5 mg per day to 600 mg per day (e.g., about 5, about 25, about 50, about 100, about 200, about 300, about 400, about 500, about 600 mg). In a further embodiment, Compound 2 or Compound 3 is administered in an amount from 5 mg per day to 600 mg per day. In yet a further embodiment, Compound 2 or Compound 3 is administered in an amount of about 25 mg per day. In an embodiment of this embodiment, Compound 2 or Compound 3 is administered in an amount of about 10 mg once per day to 200 mg once per day.
[0245] In another embodiment of these methods, the administration of the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0246] In another embodiment of these methods, the administration of Compound 1 and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0247] In another embodiment of these methods, the administration of Compound 2 or Compound 3 and the reverse transcriptase inhibitor occurs over a period of time shorter than 48 weeks.
[0248] In another embodiment, the patient is a chronically HBV-infected patient (with or without evidence of underlying liver inflammation).
[0249] In an aspect, provided herein is a method of inhibiting replication of a nucleoside resistant HBV variant comprising contacting said variant with an effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof.
[0250] In an aspect, provided herein is a method of inhibiting replication of a nucleoside resistant HBV variant comprising contacting said variant with an effective amount of Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof. In yet another aspect, provided herein is a method of inhibiting replication of a nucleoside resistant HBV variant comprising contacting said variant with an effective amount of Compound 2 or Compound 3 or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof.
[0251] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and Compound A
##STR00023##
or a pharmaceutically acceptable salt thereof.
[0252] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and Compound A, or a pharmaceutically acceptable salt thereof.
[0253] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2 or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and Compound A, or a pharmaceutically acceptable salt thereof.
[0254] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and entecavir, or a pharmaceutically acceptable salt thereof. In an embodiment the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and entecavir are administered at dosages and over time intervals producing a synergistic effect.
[0255] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and entecavir, or a pharmaceutically acceptable salt thereof. In an embodiment Compound 1 and entecavir are administered at dosages and over time intervals producing a synergistic effect.
[0256] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and entecavir, or a pharmaceutically acceptable salt thereof. In an embodiment Compound 2 and entecavir are administered at dosages and over time intervals producing a synergistic effect.
[0257] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and entecavir, or a pharmaceutically acceptable salt thereof. In an embodiment Compound 3 and entecavir are administered at dosages and over time intervals producing a synergistic effect.
[0258] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and tenofovir or a pharmaceutically acceptable salt or prodrug thereof. In an embodiment the tenofovir is tenofovir disoproxil fumarate or tenofovir alafenamide fumarate. In a further embodiment the compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB and tenofovir are administered at dosages and over time intervals producing a synergistic effect.
[0259] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and tenofovir or a pharmaceutically acceptable salt or prodrug thereof. In an embodiment the tenofovir is tenofovir disoproxil fumarate or tenofovir alafenamide fumarate. In a further embodiment Compound 1 and tenofovir are administered at dosages and over time intervals producing a synergistic effect.
[0260] In another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 2, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and tenofovir or a pharmaceutically acceptable salt or prodrug thereof. In an embodiment the tenofovir is tenofovir disoproxil fumarate or tenofovir alafenamide fumarate. In a further embodiment Compound 2 and tenofovir are administered at dosages and over time intervals producing a synergistic effect.
[0261] In yet another aspect, provided herein is a method of treating an HBV infection in a patient in need thereof comprising administering to the patient a therapeutically effective amount of Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and tenofovir or a pharmaceutically acceptable salt or prodrug thereof. In an embodiment the tenofovir is tenofovir disoproxil fumarate or tenofovir alafenamide fumarate. In a further embodiment Compound 3 and tenofovir are administered at dosages and over time intervals producing a synergistic effect.
[0262] In an embodiment, provided herein is a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor for use in therapy.
[0263] In an embodiment, provided herein is a compound of Formula I and a reverse transcriptase inhibitor for use in therapy.
[0264] In an embodiment, provided herein is a compound of Formula IB and a reverse transcriptase inhibitor for use in therapy.
[0265] In an embodiment, provided herein is Compound 1 and a reverse transcriptase inhibitor for use in therapy.
[0266] In another embodiment, provided herein is Compound 2 and a reverse transcriptase inhibitor for use in therapy.
[0267] In a further embodiment, provided herein is Compound 3 and a reverse transcriptase inhibitor for use in therapy.
[0268] In an embodiment, provided herein is a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0269] In an embodiment, provided herein is a compound of Formula I and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0270] In an embodiment, provided herein is a compound of Formula IA and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0271] In an embodiment, provided herein is a compound of Formula IB and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0272] In an embodiment, provided herein is a compound of Formula II and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0273] In an embodiment, provided herein is a compound of Formula IIIA and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0274] In an embodiment, provided herein is a compound of Formula IIIB and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0275] In an embodiment, provided herein is Compound 1 and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0276] In another embodiment, provided herein is Compound 2 and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0277] In a further embodiment, provided herein is Compound 3 and a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof.
[0278] In an embodiment, provided herein is a core protein allosteric modulator (CpAM) for use in treating an HBV infection in a patient in need thereof, wherein the CpAM is for use in combination with a reverse transcriptase inhibitor.
[0279] In an embodiment, provided herein is a compound of Formula I for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula I is for use in combination with a reverse transcriptase inhibitor.
[0280] In an embodiment, provided herein is a compound of Formula IA for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula IA is for use in combination with a reverse transcriptase inhibitor.
[0281] In an embodiment, provided herein is a compound of Formula IB for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula IB is for use in combination with a reverse transcriptase inhibitor.
[0282] In an embodiment, provided herein is a compound of Formula II for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula II is for use in combination with a reverse transcriptase inhibitor.
[0283] In an embodiment, provided herein is a compound of Formula IIIA for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula IIIA is for use in combination with a reverse transcriptase inhibitor.
[0284] In an embodiment, provided herein is a compound of Formula IIIB for use in treating an HBV infection in a patient in need thereof, wherein the compound of Formula IIIB is for use in combination with a reverse transcriptase inhibitor.
[0285] In an embodiment, provided herein is Compound 1 for use in treating an HBV infection in a patient in need thereof, wherein Compound 1 is for use in combination with a reverse transcriptase inhibitor.
[0286] In another embodiment, provided herein is Compound 2 for use in treating an HBV infection in a patient in need thereof, wherein Compound 2 is for use in combination with a reverse transcriptase inhibitor.
[0287] In a further embodiment, provided herein is Compound 3 for use in treating an HBV infection in a patient in need thereof, wherein Compound 3 is for use in combination with a reverse transcriptase inhibitor.
[0288] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a core protein allosteric modulator (CpAM).
[0289] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula I.
[0290] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula IA.
[0291] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with Compound 1.
[0292] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a core protein allosteric modulator (CpAM).
[0293] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula I.
[0294] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula IA.
[0295] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula IB.
[0296] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula II.
[0297] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula IIIA.
[0298] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with a compound of Formula IIIB.
[0299] In an embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with Compound 1.
[0300] In another embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with Compound 2.
[0301] In a further embodiment, provided herein is a reverse transcriptase inhibitor for use in treating an HBV infection in a patient in need thereof, wherein the reverse transcriptase inhibitor is for use in combination with Compound 3.
[0302] In an embodiment, provided herein is a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the CpAM and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0303] In an embodiment, provided herein is a compound of Formula I and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula I and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0304] In an embodiment, provided herein is a compound of Formula IA and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula IA and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0305] In an embodiment, provided herein is a compound of Formula IB and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula IB and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0306] In an embodiment, provided herein is a compound of Formula II and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula II and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0307] In an embodiment, provided herein is a compound of Formula IIIA and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula IIIA and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0308] In an embodiment, provided herein is a compound of Formula IIIB and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein the compound of Formula IIIB and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0309] In an embodiment, provided herein is Compound 1 and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein Compound 1 and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0310] In another embodiment, provided herein is Compound 2 and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein Compound 2 and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0311] In another embodiment, provided herein is Compound 3 and a reverse transcriptase inhibitor for use in combination therapy for treating an HBV infection in a patient in need thereof, wherein Compound 3 and the reverse transcriptase inhibitor are for concurrent, sequential or separate administration.
[0312] The daily doses described herein are calculated for an average body weight of about 60 to about 70 kg and should be recalculated in case of pediatric applications, or when used with patients with a substantially diverting body weight.
III. Combination Products and Compositions
[0313] In an aspect, provided herein is a combination product comprising a core protein allosteric modulator (CpAM) and a reverse transcriptase inhibitor. In an embodiment of the combination product, the CpAM is a core protein allosteric modulator that causes aberrant, defective or incomplete assembly of HBV capsids. In another embodiment of the combination product, the CpAM is a core protein allosteric modulator that causes assembly of capsids that are essentially empty with respect to their viral contents. In an embodiment of the combination product of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0314] In embodiments, the combination product comprises at least Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and entecavir.
[0315] In embodiments, the combination product comprises at least Compound 1 or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof and tenofovir.
[0316] In embodiments, the combination product comprises at least one compound of Formula I and entecavir.
[0317] In embodiments, the combination product comprises at least one compound of Formula I and tenofovir.
[0318] In embodiments, the combination product comprises at least one compound of Formula IA and entecavir.
[0319] In embodiments, the combination product comprises at least one compound of Formula IA and tenofovir.
[0320] In embodiments, the combination product comprises at least one compound of Formula IB and entecavir.
[0321] In embodiments, the combination product comprises at least one compound of Formula IB and tenofovir.
[0322] In embodiments, the combination product comprises at least one compound of Formula II and entecavir.
[0323] In embodiments, the combination product comprises at least one compound of Formula II and tenofovir.
[0324] In embodiments, the combination product comprises at least one compound of Formula IIIA and entecavir.
[0325] In embodiments, the combination product comprises at least one compound of Formula IIIA and tenofovir.
[0326] In embodiments, the combination product comprises at least one compound of Formula IIIB and entecavir.
[0327] In embodiments, the combination product comprises at least one compound of Formula IIIB and tenofovir.
[0328] In embodiments, the combination product comprises at least Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and entecavir.
[0329] In embodiments, the combination product comprises at least Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and tenofovir.
[0330] In embodiments, the combination product comprises at least Compound 2, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and entecavir.
[0331] In embodiments, the combination product comprises at least Compound 2, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and tenofovir.
[0332] In embodiments, the combination product comprises at least Compound 3, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and entecavir.
[0333] In embodiments, the combination product comprises at least Compound 3, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, and tenofovir.
[0334] In an aspect, provided herein is a combination product comprising Compound 1, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0335] In an embodiment of the combination product, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0336] In an embodiment of the combination product, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir and lamivudine, or pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0337] In another aspect, provided herein is a combination product comprising Compound 2, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0338] In an embodiment of the combination product of Compound 2, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0339] In yet another aspect, provided herein is a combination product comprising Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0340] In an embodiment of the combination product of Compound 3, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0341] In an embodiment of the combination product, Compound 1 and the reverse transcriptase inhibitor are in the same formulation. In another embodiment of the combination product, Compound 1 and the reverse transcriptase inhibitor are in separate formulations. In a further embodiment of this embodiment, the formulations are for simultaneous or sequential administration.
[0342] In an embodiment of the combination product, Compound 2 or Compound 3 and the reverse transcriptase inhibitor are in the same formulation. In another embodiment of the combination product, Compound 2 or Compound 3 and the reverse transcriptase inhibitor are in separate formulations. In a further embodiment of this embodiment, the formulations are for simultaneous or sequential administration.
[0343] In an embodiment, the combination product is for use in the treatment of HBV infection in a patient.
[0344] In an embodiment, the combination product is for use in the treatment of HBV infection in a patient, wherein the patient is resistant to treatment with a reverse transcriptase inhibitor. In another embodiment, the combination product is for use in the treatment of HBV infection in a patient, wherein the patient is resistant to treatment with a nucleoside agent.
[0345] In an embodiment, the combination product is for use in the treatment of HBV infection in a patient, wherein the patient is treatment nave.
[0346] In an embodiment, the combination product of Compound 2 or Compound 3 is for use in the treatment of HBV infection in a patient.
[0347] In an embodiment, the combination product of Compound 2 or Compound 3 is for use in the treatment of HBV infection in a patient, wherein the patient is resistant to treatment with a reverse transcriptase inhibitor. In another embodiment, the combination product is for use in the treatment of HBV infection in a patient, wherein the patient is resistant to treatment with a nucleoside agent.
[0348] In an embodiment, the combination product of Compound 2 or Compound 3 is for use in the treatment of HBV infection in a patient, wherein the patient is treatment nave.
[0349] In an embodiment, the combination product is for use in the treatment of HBV infection in a patient, wherein the patient is a chronically HBV-infected patient (with or without evidence of underlying liver inflammation).
[0350] In an embodiment of the combination product, Compound 1 is in an amount from 600 mg to 3000 mg (e.g., about 600, about 800, about 1000, about 1200, about 1400, about 1600, about 1800, about 2000 mg). In a further embodiment of the combination product, Compound 1 is in an amount from 600 mg to 2000 mg. In another embodiment of the combination product, Compound 1 is in an amount of about 2000 mg. In yet another embodiment of the combination product, Compound 1 is in an amount of about 1000 mg.
[0351] In an embodiment of the combination product, Compound 2 or Compound 3 is in an amount from 5 mg to 600 mg (e.g., about 5, about 25, about 50, about 100, about 200, about 300, about 400, about 500, about 600 mg). In a further embodiment of the combination product, Compound 2 or Compound 3 is in an amount from 5 mg to 600 mg. In another embodiment of the combination product, Compound 2 or Compound 3 is in an amount of about 25 mg. In yet another embodiment of the combination product, Compound 2 or Compound 3 is 10 mg to 200 mg.
[0352] In an embodiment of the combination product, Compound 1 is in a crystalline form. In a further embodiment, the crystalline form is characterized by X-ray powder diffraction pattern having peaks expressed in degrees-2-theta at angles (0.2) of 17.1, 20.8, 22.2, 24.9, and 26.6 (Form XVI).
[0353] In an embodiment, the combination product further comprises an additional HBV antiviral agent. In an embodiment, the additional HBV antiviral agent is pegylated interferon alpha-2a.
[0354] In an aspect, provided herein is a combination product comprising Compound 1 or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0355] In an embodiment of the combination product, the ratio of CpAM to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment, the ratio of CpAM to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0356] In an aspect, provided herein is a combination product comprising a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0357] In an embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0358] In an embodiment of the combination product, the ratio of Formula IA to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0359] In an embodiment of the combination product, the ratio of Formula IB to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0360] In an embodiment of the combination product, the ratio of Formula II to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0361] In an embodiment of the combination product, the ratio of Formula IIIA to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0362] In an embodiment of the combination product, the ratio of Formula IIIB to reverse transcriptase inhibitor is in the range of 700:1-1:40. In another embodiment of the combination product, the ratio of Formula I to reverse transcriptase inhibitor is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0363] In an embodiment of the combination product, the ratio of Compound 1 to entecavir is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0364] In an embodiment of the combination product, the ratio of Compound 1 to tenofovir is in the range of 2:1 to 1:2, for example, 2:1, 1:1, or 1:2; 170:1 to 150:1, for example, 170:1, 160:1 or 150:1; 3:1 to 1:1, for example, 3:1, 2:1 or 1:1; or 30:1 to 10:1, for example, 30:1, 20:1 or 10:1.
[0365] In an embodiment of the combination product, the ratio of Compound 2 to entecavir is in the range of 200:1 to 1:40, for example, 200:1, 175:1, 150:1, 125:1, 100:1, 90:1, 80:1, 70:1, 60:1, 50:1, 40:1, 30:1, 20:1, 15:1, 10:1, 8:1, 5:1, 2:1, 1:1, 1:2, 1:5, 1:8, 1:10, 1:15, 1:20, 1:30, or 1:40. In another embodiment of the combination product, the ratio of Compound 2 to entecavir is in the range of 40:1 to 1:1, for example, 40:1, 30:1, 20:1, 10:1, 8:1, 6:1, 4:1, 2:1, or 1:1. In a further embodiment of the combination product, the ratio of Compound 2 entecavir is in the range of 30:1 to 10:1, for example, 30:1, 20:1 or 10:1. In yet another embodiment of the combination product, the ratio of Compound 2 to entecavir is 20:1.
[0366] In an embodiment of the combination product, the ratio of Compound 2 to tenofovir is in the range of 40:1 to 1:40, for example, 40:1, 30:1, 20:1, 15:1, 10:1, 8:1, 5:1, 2:1, 1:1, 1:2, 1:5, 1:8, 1:10, 1:15, 1:20, 1:30, or 1:40. In another embodiment of the combination product, the ratio of Compound 2 to tenofovir is in the range of 10:1 to 1:1, for example, 10:1, 8:1, 6:1, 4:1, 2:1, or 1:1. In a further embodiment of the combination product, the ratio of Compound 2 to tenofovir is in the range of 3:1 to 1:1, for example, 3:1, 2:1 or 1:1. In yet another embodiment of the combination product, the ratio of Compound 2 to tenofovir is 2:1.
[0367] In an embodiment of the combination product, the ratio of Compound 3 to entecavir is in the range of 700:1 to 1:30, for example, 700:1, 600:1, 500:1, 400:1, 300:1, 200:1, 190:1, 180:1, 170:1, 160:1, 150:1, 140:1, 130:1, 120:1, 110:1, 100:1, 20:1, 15:1, 10:1, 8:1, 5:1, 2:1, 1:1, 1:2, 1:5, 1:8, 1:10, 1:15, or 1:20. In another embodiment of the combination product, the ratio of Compound 3 to entecavir is in the range of 180:1 to 1:2, for example, 180:1, 170:1, 160:1, 150:1, 140:1, 130:1, 120:1, 110:1, 100:1, 50:1, 20:1, 10:1, 1:1, or 1:2. In a further embodiment of the combination product, the ratio of Compound 3 entecavir is in the range of 170:1 to 150:1, for example, 170:1, 160:1 or 150:1. In yet another embodiment of the combination product, the ratio of Compound 3 to entecavir is 160:1.
[0368] In an embodiment of the combination product, the ratio of Compound 3 to tenofovir is in the range of 80:1 to 1:10, for example, 80:1, 70:1, 60:1, 50:1, 40:1, 30:1, 20:1, 15:1, 10:1, 1:1, or 1:10. In another embodiment of the combination product, the ratio of Compound 3 to tenofovir is in the range of 10:1 to 1:10, for example, 10:1, 8:1, 6:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:6, 1:8, and 1:10. In a further embodiment of the combination product, the ratio of Compound 3 tenofovir is in the of range 2:1 to 1:2, for example, 2:1, 1:1, or 1:2. In yet another embodiment of the combination product, the ratio of Compound 3 to tenofovir is 1:1.
[0369] In another aspect, provided herein is a pharmaceutical composition comprising Compound 1, or a pharmaceutically acceptable salt thereof, a hydrate thereof, a solvate thereof, or a crystalline form thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0370] In an embodiment of the pharmaceutical composition, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir (including, e.g., prodrugs thereof such tenofovir disoproxil and tenofovir alafenamide) and lamivudine, or pharmaceutically acceptable salts thereof.
[0371] In another embodiment, the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
[0372] In another aspect, provided herein is a pharmaceutical composition comprising a compound of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0373] In an embodiment of the pharmaceutical composition of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0374] In another embodiment, the pharmaceutical composition of Formula I, Formula IA, Formula IB, Formula II, Formula IIIA or Formula IIIB further comprises one or more pharmaceutically acceptable carriers.
[0375] In another aspect, provided herein is a pharmaceutical composition comprising Compound 1, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0376] In an embodiment of the pharmaceutical composition of Compound 1, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0377] In another embodiment, the pharmaceutical composition of Compound 1 further comprises one or more pharmaceutically acceptable carriers.
[0378] In another aspect, provided herein is a pharmaceutical composition comprising Compound 2, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0379] In an embodiment of the pharmaceutical composition of Compound 2, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0380] In another embodiment, the pharmaceutical composition of Compound 2 further comprises one or more pharmaceutically acceptable carriers.
[0381] In yet another aspect, provided herein is a pharmaceutical composition comprising Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a reverse transcriptase inhibitor, or a pharmaceutically acceptable salt thereof.
[0382] In an embodiment of the pharmaceutical composition of Compound 3, the reverse transcriptase inhibitor is selected from the group consisting of entecavir, tenofovir, lamivudine, telbivudine, adefovir, clevudine, CMX157, AGX-1009, zidovudine, didanosine, zalcitabine, stavudine, emtricitabine, abacavir, D-D4FC, alovudine, amdoxovir, elvucitabine, delavirdine, efavirenz, nevirapine, capravirine, calanolide A, TMC278, BMS-561390, and DPC-083, or prodrugs thereof and pharmaceutically acceptable salts thereof. Pharmaceutically acceptable prodrugs of tenofovir, for example, include tenofovir disoproxil fumarate and tenofovir alafenamide fumarate.
[0383] In another embodiment, the pharmaceutical composition of Compound 3 further comprises one or more pharmaceutically acceptable carriers.
[0384] In another aspect, the present disclosure provides a kit for treating HBV infections, comprising a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, in an amount from 600 mg per day to 3000 mg per day, and a reverse transcriptase inhibitor. In another embodiment, the present disclosure provides a kit for treating HBV infections, comprising at least two or more of the group consisting of a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, in an amount from 600 mg per day to 3000 mg per day; a reverse transcriptase inhibitor; and an additional HBV antiviral agent. In some embodiments, the kit further comprises packaging and instructions. In certain embodiments, the kit comprises a pharmaceutical product comprising a pharmaceutical composition comprising a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, and a pharmaceutically acceptable carrier or diluent; and a pharmaceutical composition comprising a reverse transcriptase inhibitor and a pharmaceutically acceptable carrier or diluent.
[0385] In some embodiments, the kit comprises a pharmaceutical composition comprising a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof; an additional HBV antiviral agent; and a pharmaceutically acceptable carrier or diluent. In another embodiment, the kit comprises a pharmaceutical product comprising:
[0386] a pharmaceutical composition comprising a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, in an amount from 600 mg to 3000 mg, and a pharmaceutically acceptable carrier or diluent; and
[0387] a reverse transcriptase inhibitor;
[0388] a sealed container for housing the pharmaceutical composition;
[0389] a sealed contained for housing the reverse transcriptase inhibitor; and instructions for use.
[0390] In yet another embodiment, the kit comprises a pharmaceutical product comprising at least two or more of the group consisting of:
[0391] a pharmaceutical composition comprising a CpAM, Compound 1, Compound 2, or Compound 3, or pharmaceutically acceptable salts thereof, hydrates thereof, solvates thereof, or crystalline forms thereof, in an amount from 600 mg to 3000 mg, and a pharmaceutically acceptable carrier or diluent;
[0392] a reverse transcriptase inhibitor; and
[0393] an additional HBV antiviral agent;
further comprising:
[0394] a sealed container for housing the pharmaceutical composition;
[0395] a sealed contained for housing the interferon; and
[0396] instructions for use.
[0397] In additional embodiments, pharmaceutical kits are provided. The kit includes a sealed container approved for the storage of pharmaceutical compositions, the container containing one of the above-described pharmaceutical compositions. In some embodiments, the sealed container minimizes the contact of air with the ingredients, e.g. an airless bottle. In other embodiments, the sealed container is a sealed tube. An instruction for the use of the composition and the information about the composition are to be included in the kit.
EXAMPLES
Example 1Antiviral Activity of Compound 1 Against Lamivudine-, Tenofovir-, and Entecavir-Resistant HBV Variants
[0398] In this example, the antiviral activity of Compound 1 was determined using HepG2 liver cells transiently transfected with plasmids expression replication-competent HBV DNA and quantitation of intracellular encapsidated HBV DNA. The antiviral activity of Compound 1 was measured against nucleoside inhibitor sensitive, wild-type HBV, as well as against HBV variants resistant to nucleoside analogs that contain defined amino acid changes in the coding sequence of the reverse transcriptase protein: rtL180M/M204V, rtN236T, rtA181V, rtA181V/N236T, and rtL180M/M204V/N236T.
Example 1.1Materials and Methods
[0399] Compounds
[0400] Compound 1 was synthesized. Lamivudine (LMV), entecavir (ETV), and tenofovir disoproxil fumarate (TDF) were purchased from Toronto Research Chemicals (Toronto, Canada), which chemical structures are shown below as Compounds (IV), (V) and (VI), respectively.
##STR00024##
[0401] HBV Plasmids
[0402] Plasmid DNA constructs containing a 1.1HBV genome under the control of a CMV promoter were previously cloned from serum of an HBV infected patient prior to LMV treatment (Genbank AY220698, Fudan University, China; SEQ ID NO:1, see Table 1) and after development of resistance to LMV (Genbank AY220697, Fudan University, China; SEQ ID NO:2, see Table 1) (Zhang J M et al. 2005. J Med Virol 77: 203-208). Genotyping analysis confirmed that both isolates belong to genotype B HBV, and that the isolate collected after the development of resistance to LMV contained two amino acid changes within the polymerase gene (L180M/M204V). The HBV variant was named rtL180M/M204V to indicate that the amino acid changes were present in the reverse transcriptase (rt) protein. Two additional plasmids were generated by introducing coding sequence changes resulting in the amino acid changes N236T and A181V in the HBV polymerase, respectively. The nucleotide changes were introduced into the wild type genotype B plasmid by site directed mutagenesis according to manufacturer recommendation (Agilent Technologies; Santa Clara, Calif.; Catalog#200519) using the following primers and their corresponding reverse complement sequence (nucleotide change underlined): 5-CTT TGG GTA TAC ATT TAA CCC CTC ACA AAA C-3 (rtN236T; SEQ ID NO:3), 5-GTC CGT TTC TCT TGG TTC AGT TTA CTA GTG-3 (rtA181V; SEQ ID NO:4). In two additional plasmid constructs, the rtN236T amino acid change was also added into the rtA181V and rtL180M/M204V plasmids to generate the rtA181V/N236T double mutant and rtL180M/M204V/N236T triple mutant HBV variants, respectively. The full length HBV genome was sequenced in all plasmids to confirm that only the intended nucleotide change(s) were present in the final HBV expression constructs.
TABLE-US-00003 TABLE1 HBVgenomesequencesforplasmidconstructs SEQIDNO:1 aactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcct60 gctggtggctccagttcaggaacagtgagccctgctcaaaatactgtctctgccatatcg120 tcaatcttatcgaaaactggggaccctgtaccgaacatggagaacatcgcatcaggactc180 ctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaata240 ccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgt300 cttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatt360 tgtcctggttatcgctggatgtatctgcggcgttttatcatattcctctgcatcctgctg420 ctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct480 ctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgct540 caaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacc600 tgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtc660 cgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc720 actgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatc780 ttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacc840 ctcacaaaacaaaaagatggggatattcccttaactttatgggatatgtaattgggagtt900 ggggcacattgccacaggaacatattgtacaaaaaatcaaaatatgttttaggaaacttc960 ctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttg1020 ccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaag1080 caaaacaggcttttattttctcgccaacttacaaggcctttctgagtaaacagtatttga1140 acctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccc1200 ccactggttggggcttggccataggccatcagcgcatgcgtggcacctttgtgtctcctc1260 tgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaa1320 aactcatcgggactgacaattctgtcgtgctctcccgcaagtatacatcatttccatggc1380 tgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgg1440 cgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctcc1500 gcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgc1560 cttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccac1620 cgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagc1680 aatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggagga1740 gttgggggaggaggttaggttaatgatctttgtactaggaggctgtaggcataaattggt1800 gtgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcct1860 actgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtat1920 aaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttct1980 attcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaa2040 cattgttcacctcaccatacggcactcaggcaagctattctgtgttggggtgagttaatg2100 aatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtc2160 agctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcc2220 tgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggatt2280 cgcactcctcccgcatatagaccgccaaatgcccctatcttatcaacacttccggaaact2340 actgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacga2400 aggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcc2460 ttggacacacaaggtgggaaactttacggggctttattcttctacggtaccttgctttaa2520 tcctaaatggcaaactccttcttttcctgacattcatttgcaggaggacattgttgatag2580 atgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattat2640 gcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaacc2700 gtattatccagagtatgtagttaatcattacttccagacgcgacattatttacacactct2760 ttggaaggcggggatcttatataaaagagagtccacacgtagcgcctcattttgcgggtc2820 accatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaag2880 gcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttgg2940 accctgcattcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggaca3000 actggccggacgccaacaaggtgggagtgggagcattcgggccagggttcacccctcccc3060 atgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcag3120 ctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccac3180 ctctaagggacactcatcctcaggccatgcagtgg3215 SEQIDNO:2 aactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcct60 gctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcg120 tcaatcttatcgaagactggggaccctgtaccgaacatggagaacatcgcatcaggactc180 ctaggacccctgctcgtgttaccggcggggttttccttgttgacaaaaatcctcacaata240 ccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgt300 cgtggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatt360 tgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctctgcatcctgctg420 ctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct480 ctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgct540 caaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacc600 tgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtc660 cgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc720 actgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatc780 ttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacc840 ctcacaaaacaaaaagatggggatattcccttaacttcatgggatatgtaattgggagtt900 ggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttc960 ctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttg1020 ccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaag1080 caaaacaggcttttattttctcgccaacttacaaggcctttctgagtaaacagtatctga1140 acctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccc1200 ccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctc1260 tgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaa1320 aactcatcgggactgacaattctgtcgtgctctcccgcaagtatacatcatttccatggc1380 tgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgg1440 cgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctcc1500 gcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgc1560 cttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccac1620 cgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagc1680 aatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggagga1740 gttgggggaggagtttaagttaatgatctttgtactaggaggctgtaggcataaattggt1800 gtgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcct1860 actgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtat1920 aaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttct1980 attcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaa2040 cattgttcacctcaccatacggcactcaggcaagctattctgtgttggggtgagttaatg2100 aatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtc2160 ggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcc2220 tgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggatt2280 cgcactcctcccgcatatagaccgccaaatgcccctatcttatcaacacttccggaaact2340 actgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacga2400 aggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattcc2460 ttggacacacaaggtgggaaactttacggggctttattcttctacggtaccttgctttaa2520 tcctaaatggcaaactccttcttttcctgacattcatttgcaggaggacattgttgatag2580 atgtaagcaatttgtggggccccttacagtaaatgaaaataggagacttaaattaattat2640 gcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaacc2700 gtattatccagagtatgtagttgatcattacttccagacgcgacattatttacacactct2760 ttggaaggcggggatcttatataaaagagagtccacacgtagcgcctcattttgcgggtc2820 accatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaag2880 gcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttgg2940 accctgcattcaaagccaactcagaaaatccagattgggacctcaacccgtacaaggaca3000 actggccggacgccaacaaggtgggagtgggagcattcgggccagggttcacccctcccc3060 atgggggactgttgggttggagccctcaggctcagggtctactcacaactgtgccagcag3120 ctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccac3180 ctctaagggacactcatcctcaggccatacagtgg3215 SEQIDNO:5 aactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcct60 gctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcg120 tcaatcttatcgaagactggggaccctgtaccgaacatggagaacatcgcatcaggactc180 ctaggacccctgctcgtgttaccggcggggttttccttgttgacaaaaatcctcacaata240 ccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgt300 cgtggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatt360 tgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctctgcatcctgctg420 ctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcct480 ctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgct540 caaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacc600 tgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtc660 cgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc720 actgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatc780 ttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacc840 ctcacaaaacaaaaagatggggatattcccttaacttcatgggatatgtaattgggagtt900 ggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttc960 ctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttg1020 ccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaag1080 caaaacaggcttttattttctcgccaacttacaaggcctttctgagtaaacagtatctga1140 acctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccc1200 ccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctc1260 tgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaa1320 aactcatcgggactgacaattctgtcgtgctctcccgcaagtatacatcatttccatggc1380 tgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgg1440 cgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctcc1500 gcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgc1560 cttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccac1620 cgtgaacgcccactggaacctgcccaaggtcttgcataagaggactcttggactttcagc1680 aatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaatgagtgggagga1740 gttgggggaggagtttaagttaatgatctttgtactaggaggctgtaggcataaattggt1800 gtgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcct1860 actgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtat1920 aaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttct1980 attcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaa2040 cattgttcacctcaccatacggcactcaggcaagctattctgtgttggggtgagttaatg2100 aatctagccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtc2160 ggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcc2220 tgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggatt2280 cgcactcctcccgcatatagaccgccaaatgcccctatcttatcaacacttccggaaact2340 actgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacga2400 aggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattcc2460 ttggacacacaaggtgggaaactttacggggctttattcttctacggtaccttgctttaa2520 tcctaaatggcaaactccttcttttcctgacattcatttgcaggaggacattgttgatag2580 atgtaagcaatttgtggggccccttacagtaaatgaaaataggagacttaaattaattat2640 gcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaacc2700 gtattatccagagtatgtagttgatcattacttccagacgcgacattatttacacactct2760 ttggaaggcggggatcttatataaaagagagtccacacgtagcgcctcattttgcgggtc2820 accatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaag2880 gcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttgg2940 accctgcattcaaagccaactcagaaaatccagattgggacctcaacccgtacaaggaca3000 actggccggacgccaacaaggtgggagtgggagcattcgggccagggttcacccctcccc3060 atgggggactgttgggttggagccctcaggctcagggtctactcacaactgtgccagcag3120 ctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccac3180 ctctaagggacactcatcctcaggccatacagtgg3215
[0403] Cell Culture
[0404] HepG2 cells were obtained from the American Type Culture Collection (Manassas, Va.; ATCC Catalog#HB-8065) and maintained in humidified incubators at 37 C. and 5% CO.sub.2 in complete media containing Dulbecco's Modified Eagle Medium (DMEM) (Fisher Scientific (Life Technologies); Waltham, Mass.; Catalog#11995-065), 10% fetal bovine serum (FBS) (Life Technologies, Catalog#10082-147), 100 units/mL penicillin, 10 g/mL streptomycin, and 0.25 g/mL of Fungizone (Life Technologies, Catalog#15240-062).
[0405] Transient Transfection
[0406] HepG2 cells were seeded in collagen coated 96-well plates (BIOCOAT; Fisher Scientific, Catalog#354407) at a density of 20,000 cells/well and allowed to attach overnight at 37 C. and 5% CO.sub.2. Cells were co-transfected with HBV plasmids (100 ng/well) and Gaussia expression plasmid (10 ng/well) (THERMO SCIENTIFIC, Fisher Scientific, Catalog#16148) using the Lipofectamine LTX Plus transfection reagent according to manufacturer recommendation (Life Technologies, Catalog#15338-100). Transfection mixtures were removed the following day, cells were washed twice with complete media and were treated with serially diluted compounds at a final dimethyl sulfoxide (DMSO) concentration of 0.5%. Cells were incubated with compounds for three days, after which intracellular HBV DNA was extracted from cells and levels of secreted Gaussian luciferase was determined from the medium using the Gaussia Flash Luciferase assay kit (THERMO SCIENTIFIC, Fisher Scientific, Catalog#16158). To extract intracellular HBV DNA, cells 10 were washed once with 100 L Dulbecco's phosphate-buffered saline (Life Technologies, Catalog#14190-144) and lysed with 0.33% NP-40 (THERMO SCIENTIFIC, Fisher Scientific, Catalog#85124) by incubating for 30 minutes at room temperature (110 L/well). Turbo DNase was prepared by diluting 5-fold into Turbo DNase buffer (Life Technologies, Catalog#AM2238), and S7 nuclease (Roche Catalog#10-107-921-001, available from Sigma-Aldrich; St. Louis, Mo.) was prepared by diluting 50-fold into CUTSMART buffer (New England Bioloabs; Ipswich, Mass.; Catalog#B7204S) containing 25 M CaCl.sub.2 (GBiosciences; St. Louis, Mo.; Catalog#R033). Nuclei were pelleted by centrifugation and supernatant (35 L) was transferred into a fresh 96-well plate and treated with 2 units of Turbo DNase and 10 units of S7 nuclease at 37 C. for 60 minutes, followed by inactivation of the enzyme at 75 C. for 15 minutes. Encapsidated HBV DNA was diluted with 60 L molecular biology grade water (GBiosciences Catalog#786-293) and extracted by incubating in 50 L lysis buffer (Affymetrix Catalog#QS0010) containing 2.5 g Protease K (Affymetrix; Santa Clara, Calif. Catalog#14600) at 50 C. for 40 minutes. HBV DNA was denatured for 30 minutes at 25 C. by the addition of 2.5 M NaOH (Sigma, Catalog #S5881) to a final concentration of 0.2 M in the presence of 1 L HBV DNA probes (Affymetrix, Catalog#SF-10326). The denatured DNA was neutralized by the addition of 2 M HEPES (Sigma, Catalog#H3375) to a final concentration of 0.3 M and detected using QuantiGene assay kit (Affymetrix, Catalog#QS0010). The mean background signal from wells containing only culture medium was subtracted from all other samples, and percent inhibition at each compound concentration was calculated by normalizing to signals from cells treated with 0.5% DMSO using equation E1.
% inhibition=(DMSO.sub.aveX.sub.i)/DMSO.sub.ave100%(E1):
[0407] where DMSO.sub.ave is the mean signal calculated from the wells that were treated with DMSO control (0% inhibition control) and Xi is the signal measured from the individual wells. EC50 values, effective concentrations that achieved 50% inhibitory effect, were determined by non-linear fitting using Graphpad Prism software (San Diego, Calif.) and equation E2.
Y=Y.sub.min+(Y.sub.maxY.sub.min)/(1+10.sup.(Log EC50X)HillSlope)(E2):
[0408] where Y represents percent inhibition values and X represents the logarithm of compound concentrations.
[0409] To determine the replication competence of HBV variants, the background corrected values for HBV DNA from the QuantiGene assay were normalized using the Gaussian luciferase activity values in order to account for any differences in transfection efficiency. 11 The normalized HBV DNA values obtained from cells transfected with HBV variants were then compared with those obtained from the wild type HBV transfection, with wild-type HBV replication competence set at 100%.
Example 1.2Relative Replication Competence of Nucleoside Resistant HBV Variants
[0410] Five HBV expression plasmids were generated to represent a panel of the nucleoside resistant HBV variants that are most commonly observed in HBV infected patients treated with nucleoside drugs. The HBV nucleoside resistance panel consists of five HBV variants with the following single, double, or triple mutations in the HBV polymerase protein: (1) L180M/M204V, (2) N236T, (3) A181V, (4) A181V/N236T, and (5) L180M/M204V/N236T. A181V, N236T, and A181V/N236T were introduced into the backbone of the HBV DNA obtained from a genotype B clinical isolate (Genbank AY220698). Sequencing of the A181V, N236T, and A181V/N236T variants confirmed the intended amino acid change within the wild type genotype B HBV construct. To generate the triple mutant, N236T was introduced into the backbone of the HBV DNA obtained from the LMV resistant clinical isolate (Genbank AY220697; SEQ ID NO:5 (see Table 1)). It was previously reported that the LMV resistant clinical isolate contained a number of additional amino acid changes within the HBV genome compared to the isolate obtained prior to LMV treatment (Zhang J M et al. 2005. J Med Virol 77: 203-208). Sequencing the L180M/M204V and the L180M/M204V/N236T variants confirmed that there was an additional amino acid change at position 271 within the reverse transcriptase domain, which was consistent with the published sequence from the LMV resistant clinical isolate (Genbank AY220697; SEQ ID NO:5).
[0411] These plasmids were used to transfect HepG2 cells, and the amount of intracellular, encapsidated HBV DNA that was formed from HBV replication was quantified on day 3 after transfection. A Gaussia luciferase expression plasmid was co-transfected with HBV (Gaussia-Luc: HBV at 1:10 ratio) to allow normalization for any differences in transfection efficiency. The normalized HBV DNA signal obtained in cells transfected with wild-type HBV was defined as 100% relative replication competence. The N236T variant showed similar replication competence as wild type HBV, while the other four variants showed similar or up to two-fold higher replication competence as compared to wild type. The replication competence of all HBV variants was suitable for antiviral activity studies with nucleoside analogs and Compound 1.
Example 1.3HBV Variants were Resistant to Nucleoside Analogs but Remained Susceptible to Compound 1
[0412] HBV variants with nucleoside resistance mutations were first evaluated for their susceptibility towards the inhibitory effect of nucleoside analogs. As expected from published data (Yang et al. 2005. Antivir Ther 10: 625-633; Brunelle et al. 2005. Hep 41: 1391-1398), both rtL180M/M204V and rtL180M/M204V/N236T HBV variants were resistant to inhibition by lamivudine (LMV) and entecavir (ETV): LMV inhibited wild-type HBV with a mean EC50 value of 0.53 M, but did not inhibit replication of any of the two variants up to the highest concentration of LMV tested (100 M), while the antiviral activity of ETV was reduced by 31- and 14-fold against the rtL180M/M204V and rtL180M/M204V/N236T variants, respectively (
TABLE-US-00004 TABLE 2 Antiviral activity of Compound 1, LMV, ETV, and TDF in HepG2 cells transiently transfected with nucleoside resistant variants Fold Change WT rtL EC.sub.50 rtL 180M/M204V/ rtA181V/ Compound [M] 180M/M204V N236T rtA181V rtN236T N236T LMV 0.53 0.12 >190 >190 1.7 0.9.sup.ns 1.0 0.5.sup.ns 4.8 2.3.sup.a ETV 0.0014 0.0004 31 16.sup.a 14 4.sup.a 2.2 0.5.sup.a 0.67 0.22.sup.ns 1.8 0.6.sup.ns TDF 0.032 0.015 1.1 0.3.sup.ns 2.9 1.5.sup.b 1.4 0.05.sup.ns 2.2 1.0.sup.b 2.8 1.4.sup.b Cmpd 1 0.31 0.10 1.3 0.6.sup.ns 1.4 0.5.sup.ns 0.82 0.19.sup.ns 0.85 0.40.sup.ns 0.85 0.26.sup.ns EC.sub.50 and fold change shown as mean value standard deviation (SD) from at least three independent studies. *Mean Fold change and Fold change SD calculated from individual fold change values of mutant variants relative to mean wild-type EC.sub.50 value. .sup.aas compared to wild-type, ttest p value < 0.01; .sup.bttest p value < 0.05; .sup.nsttest p value > 0.05.
[0413] Tenofovir disoproxil fumarate (TDF) showed similar antiviral activity against wild type HBV and the rtL180M/M204V and rtA181V variants (mean EC50 values of 0.032, 0.034 and 0.043 M, respectively), but showed mean reductions in antiviral activity ranging from 2.2 to 2.9-fold against HBV variants containing the rtN236T mutation either alone or in combination with rtL180M/M204V or rtA181V (
[0414] HBV containing the rtN236T mutation remained sensitive to inhibition by LMV and ETV, similar to wild-type HBV (Table 2). A slight increase in mean EC50 values (about 2-fold) was observed for LMV and ETV when tested against the rtA181V variant (Table 2). The combination of the rtN236T to rtA181V mutations into a double mutant variant resulted in mean 4.8-fold and 1.8-fold increases in EC50 values for LMV and ETV, respectively (Table 2).
[0415] All five nucleoside resistant HBV variants were sensitive to inhibition by Compound 1 with antiviral EC50 values similar to wild-type HBV. Mean EC50 fold changes ranged from 0.82 to 1.4-fold, indicating that nucleoside resistance conferring mutations tested here did not confer cross resistance to the HBV core inhibitor Compound 1 (Table 2).
[0416] As shown in this example, phenotyping assay using HepG2 cells transiently transfected with nucleoside analogs showed that cross resistance could exist among different classes of nucleoside analogs including LMV, ETV, and TDF. In contrast, Compound 1 remained active against nucleoside resistant variants and therefore lacked cross resistance with the nucleoside analogs.
Example 2Viability of Primary Human Hepatocytes in the Presence of Compound 1 and Nucleoside Analogs Alone or in Combination
[0417] In this example, the viability of primary human hepatocytes (PHH) was determined in the presence of Compound 1 and nucleoside analogs alone or in combination. Cell viability was determined as the relative concentration of intracellular ATP concentration in compound treated as compared to untreated cells. PHH viability was similar in untreated cells and cells treated with either 300 M lamivudine (LMV), 30 M tenofovir (TFV), or 30 M entecavir (ETV). A dose dependent reduction in cell viability was observed in cells treated with Compound 1; meanCC50 values ranged from 16 to 82 M. The CC50 values obtained with Compound 1 in the presence of 300 M lamivudine (LMV), 30 M tenofovir (TFV), or 30 M entecavir (ETV) were similar to those obtained when the cells were treated with Compound 1 alone.
Example 2.1Materials and Methods
[0418] Compounds
[0419] Compound 1 was synthesized. Lamivudine, Tenofovir, and Entecavir were purchased from Toronto Research Chemicals (Toronto, Canada).
[0420] Cell Culture
[0421] Cryopreserved primary human hepatocytes from individual donors (primary hepatocyte IDs: HuM4038, HuM4055A, and HuM4059) were purchased from Triangle Research Labs (TRL; Research Triangle Park, N.C.). Cells were thawed using hepatocyte thawing medium (TRL, Catalog#MCHT50) according to manufacturers' recommendations. After centrifugation, cells were resuspended in supplemented hepatocyte plating medium (TRL, Catalog#MP250). Cells were plated in collagen Type I coated 96-well plates (Corning; Corning, N.Y.; Catalog#356407) at a density of 40,000 cells per well and maintained in humidified incubators at 37 C. and 5% CO.sub.2 overnight prior to addition of test compounds.
[0422] Cell Viability Assays
[0423] For each donor, three 96-well plates were set up to evaluate the effect of increasing concentrations of Compound 1 either alone or in combination with nucleoside analogs on hepatocyte cell viability. On each plate, cells were incubated with Compound 1 alone as duplicates, or Compound 1 in the presence of LMV, TFV, or ETV as triplicates. The effects of nucleoside analogs alone on hepatocyte cell viability were also determined in triplicates for each donor. Compound 1 was half-log serially diluted in DMSO (Sigma, Catalog #D2650) and added to primary human hepatocytes either alone or in combination with LMV (30 and 300 M), TFV (30 M), or ETV (30 M). Single and combined drugs were added to primary human hepatocytes at a final DMSO (Sigma D2650) concentration of 0.5% across all concentrations. Cells were incubated with compounds for three days, after which medium was removed and fresh medium containing compounds was added and incubated for another three days. As a no compound control, primary human hepatocytes were treated with 0.5% DMSO, and these values were then used to define the 0% inhibition level. Background signal was determined as the mean value from wells containing only culture medium. Cell viability was monitored by using CellTiter-Glo cell viability reagent according to the manufacturer protocol (Promega; Madison, Wis.; G7573). Chemiluminescence signal proportional to the amount of cellular ATP was measured by using the Victor X4 plate reader (Perkin Elmer; Waltham, Mass.). The mean background signal from the medium only wells was subtracted from all other samples, and percent inhibition was calculated using equation E1 (as in Example 1):
% inhibition=(DMSO.sub.aveX.sub.i)/DMSO.sub.ave100%(E1):
[0424] where DMSO.sub.ave is the mean signal calculated from the wells that were treated with 0.5% DMSO control (0% inhibition control) and X.sub.i is the signal measured from the individual wells. CC50 values were determined from the % inhibition data obtained at different compound concentrations by non-linear fitting using Graphpad Prism software and equation E3, in cases were % inhibition values exceeded 50% at the highest concentration tested.
Y=Y.sub.min+(Y.sub.maxY.sub.min)/(1+10.sup.(Log CC50X)HillSlope)(E3):
[0425] where Y represents percent inhibition values and X represents the logarithm of compound concentrations.
Example 2.2Effect of Compound 1 or Nucleoside Analogs on Cell Viability Using Primary Human Hepatocytes
[0426] Primary human hepatocytes from three different donors (TRL HuM4038, HuM4055A and HuM4059) were incubated with increasing concentrations of Compound 1. Cells from the same three donors were also incubated with LMV (30 and 300 M), TFV (30 M) or ETV (30 M). Analysis of cell viability was based on intracellular ATP levels after 6 days of drug treatment. There was a concentration dependent reduction of cell viability, when hepatocytes were incubated with Compound 1: CC50 values for Compound 1 ranged from 16 M to 82 M (Table 3). Previously reported CC50 values for Compound 1 using fresh (BioreclamationIVT) and cryopreserved primary hepatocytes (donors TRL HuM4038 and Invitrogen Hu1457), ranged from 14 to 27 M. No reduction of cell viability was observed when hepatocytes were treated with 30 or 300 M LMV, 30 M TFV, or 30 M ETV (Table 3).
TABLE-US-00005 TABLE 3 Effect of Compound 1, LMV, TFV, or ETV on cell viability in primary human hepatocytes HuM4038 HuM4038 HuM4055A HuM4059 Compound CC50 [M] CC50 [M] CC50 [M] CC50 [M] Cmpd 1 16 26 19 82 LMV >30 >300 >300 >300 TFV >30 >30 >30 >30 ETV >30 >30 >30 >30
Example 2.3 Combined Effect of Compound 1 with Nucleoside Analogs on Cell Viability Using Primary Human Hepatocytes
[0427] In order to determine the effect of combining Compound 1 and nucleoside analogs on cell viability, primary human hepatocytes were treated with increasing concentrations of Compound 1 in combination with single concentrations of LMV (300 M), TFV (30 M), or ETV (30 M). As shown in
TABLE-US-00006 TABLE 4 Effect of Compound 1 alone and in combination with 300 M LMV on viability of primary human hepatocytes Cmpd (I) Cmpd (I) + LMV CC50 fold change Donor ID CC50 [M] CC50 [M] mono/combo HuM4038 26 22 1.2 HuM4055A 19 19 1.0 HuM4059 83 83 1.0
TABLE-US-00007 TABLE 5 Effect of Compound 1 alone and in combination with 30 M TFV on viability of primary human hepatocytes Cmpd (I) Cmpd (I) + TFV CC50 fold change Donor ID CC50 [M] CC50 [M] mono/combo HuM4038 16 23 0.7 HuM4055A 19 19 1.0 HuM4059 83 80 1.0
TABLE-US-00008 TABLE 6 Effect of Compound 1 alone and in combination with 30 M ETV on viability of primary human hepatocytes Cmpd (I) Cmpd (I) + ETV CC50 fold change Donor ID CC50 [M] CC50 [M] mono/combo HuM4038 16 14 1.1 HuM4055A 19 21 0.9 HuM4059 83 81 1.0
[0428] In this example, the viability of primary human hepatocytes (PHH) was determined in the presence of Compound 1 and nucleoside analogs alone or in combination. Cell viability was determined as the relative concentration of intracellular ATP concentration in compound treated as compared to untreated cells. PHH viability was similar in untreated cells and cells treated with either 300 M lamivudine (LMV), 30 M tenofovir (TFV) or 30 M entecavir (ETV). A dose dependent reduction in cell viability was observed in cells treated with Compound 1; CC50 values ranged from 16 to 82 M. The CC50 values obtained with Compound 1 in the presence of 300 M lamivudine (LMV), 30 M tenofovir (TFV) or 30 M entecavir (ETV) were similar to those obtained when the cells were treated with Compound 1 alone.
Example 3Effect of the Combination of the HBV Core Inhibitor Compound 1 with Nucleoside Analogs or Other HBV Core Inhibitors on the Inhibition of HBV DNA Replication in HepG2.2.15 Cells
[0429] In this example, the combination of the HBV core modulator Compound 1 with LMV is shown to be additive as analyzed by both MacSynergy and CalcuSyn. Combining Compound 1 with TFV or ETV showed additive effect as analyzed by MacSynergy and slight to moderate synergism as analyzed by CalcuSyn. The combination of two different HBV core inhibitors showed overall additive antiviral activity. Cell viability remained above 85% in all samples treated with the highest compound concentrations, either alone or in combination.
Example 3.1Materials and Methods
[0430] HepG2.2.15 cells were treated with increasing concentrations of Compound 1 (0.05-5 M) combined with increasing concentrations of either lamivudine (LMV), tenofovir (TFV), entecavir (ETV), or Bay 41-4109 (0.01-5 M) for six days. Secreted HBV DNA was measured by Quantigene assay and cell viability was measured by CellTiter-glo assay. Synergy was measured by both MacSyngergy analysis and Calcusyn analysis.
Example 3.2Results
[0431]
[0432] Table 7 shows the synergy/antagonism volumes for Compound 1 in combination with nucleoside analogs, show the MacSynergy predicted effect. Synergy/antagonism volumes at 95% confidence of <25 M2% defined as insignificant, between 25 and 50 M2% as minor, between 50 and 100 M2% as moderate, and >100 M2% as strong synergy/antagonism. As shown, a Compound 1 showed additive effects when combined with LMV, TFV, or ETV when using MacSynergy.
TABLE-US-00009 TABLE 7 Combination Synergy Antagonism MacSynergy Compound 1 with (M.sup.2 %) (M.sup.2 %) predicted effect LMV 5.1 14.3 Additive TFV 18.5 7.3 Additive ETV 1.0 16.5 Additive
[0433] Table 8 shows the combination index (CI) values for Compound 1 in combination with nucleoside analogs. These results show that Compound 1 in combination with LMV shows an additive effect when using CalcuSyn, and slight to moderate synergy when Compound 1 is combined with TFV or ETV.
TABLE-US-00010 TABLE 8 Combination CalcuSyn Compound 1 CI Values predicted with ED50 ED75 ED90 Overall CI effect LMV 1.0 0.8 0.8 0.9 0.1 Additive TFV 0.8 0.8 0.8 0.8 0.06 Slight to moderate synergy ETV 1.0 0.5 0.5 0.7 0.4 Slight to moderate synergy
[0434]
[0435] Table 9 shows the synergy/antagonism volumes for Compound 1 in combination with another core modulator. Using MacSynergy, Compound 1 has an additive effect when combined with Bay 41-4109 (Formula B).
TABLE-US-00011 TABLE 9 Combination of Synergy Antagonism MacSynergy Compound 1 with (M.sup.2 %) (M.sup.2 %) predicted effect Bay 41-4109 2.3 3.9 Additive
[0436] Table 10 shows CI values for Compound 1 in combination with another core modulator, Bay 41-4109, showing that the combinations has additive effects as predicted using CalcuSyn.
TABLE-US-00012 TABLE 10 Combination CalcuSyn Compound 1 CI Values Overall predicted with ED50 ED75 ED90 CI effect Bay 41-4109 1.1 1.1 1.1 1.1 0.1 Additive
Example 4Effect of the Combination of the HBV Core Inhibitor Compound 2 and Compound 3 with Nucleoside Analogs on the Inhibition of HBV DNA Replication in HepG2.2.15 Cells
[0437] In this example, the combination of the HBV core modulator Compound 2 or Compound 3 with TFV or ETV is shown to be additive to synergistic as analyzed by MacSynergy.
Example 4.1Materials and Methods
[0438] The anti-HBV activity of combinations of Compound 2 and Compound 3 with the nucleos(t)ide analogues ETV or TFV was assessed in a 6-day HBV antiviral assay using qPCR for the detection of HBV DNA in the cell culture supernatant as a read-out. The combination effect was analyzed using Mac Synergy II software. The anti-HBV activity of ETV and TFV when tested as single agents in HepG2.2.15 cells as well (Table 14).
[0439] During the antiviral testing, HepG2.2.15 cells were cultured in RPMI1640 medium and the FBS was reduced to 2%. Cells were plated at a density of 50.000 cells per well into a 96-well plate.
[0440] One day after seeding of the HepG2.2.15 cells, the supernatant was removed and 200 L medium with test compounds, diluted in a checkerboard fashion, was added to the cells. After three days the medium with test compound was refreshed and the cells were incubated in the presence of compound for three additional days. At the end of the compound treatment, 150 L cell culture supernatant and 50 L PBS were added to a 96-well block for DNA extraction using the MagNA Pure 96 DNA and Viral NA Small Volume Kit. HBV DNA was detected by quantitative real time PCR (qPCR). HBV DNA was quantified by a real-time PCR assay using a LightCycler480 Probes Master kit (Roche) with primers 5-GTGTCTGCGGCGTTTTATCA-3 (sense) and 5-GACAAACGGGCAACATACCT-3 (antisense, SEQ ID NO: 7). HBV probe 5-CCTCTKCATCCTGCTGCTATGCCTCATC-3 (SEQ ID NO: 8) contains a fluorescent reporter dye (FAM) at the 5end of the probe and a quencher dye (TAMRA) at the 3end. The PCR was carried out as follows: denaturing at 95 C. for 10 minutes, followed by 40 cycles of amplification at 95 C. for 15 seconds and at 60 C. for 1 minute. Cytotoxicity testing of compounds was performed on HepG2.2.15 in parallel using the same experimental design as in the antiviral assay. The ATP lite kit from Perkin Elmer was used to detect ATP as a marker for cytotoxicity of compound treatment.
[0441] The percentage inhibition values obtained for each combination of compound concentration was calculated as the average of 3 to 5 replicate plates of the same combination per experiment. To robustly identify outliers, the distance from the average of the other 4 replicates was calculated for every data point. The distribution of these distances, over all data points, was found to be approximately normal and centered on zero, as expected, but with long tails, suggesting the presence of significant outliers. To determine a cut-off to exclude these, Tukey's outlier criterion was used, which sets the limits at the first quartile minus 1.5 times the inter-quartile range (Q11.5*(Q3Q1)) and at the third quartile plus 1.5 times the inter-quartile range (Q3+1.5*(Q3Q1)). To make the outlier filtering symmetric, the maximum of the absolute values of these limits as cut-off was taken. Marked as an outlier, and excluded from calculations, was any data point for which the absolute distance from the average of the other 4 replicates exceeded this cut-off. Removal of outliers was only performed in experiments 2 and 3. The anti-HBV activity of different combinations of anti-HBV agents was assessed using the Bliss-Independence model based on the algorithm developed by Prichard and Shipman (Prichard M N, Shipman C Jr. A three-dimensional model to analyze drug-drug interactions. Antiviral Res. 1990; 14(4-5):181-205) using the MacSynergy II software. In this model, the theoretical additive effect is calculated from the dose-response curves of the individual compounds by the equation Z=X+Y(1X), where X and Y represent the inhibition produced by drug 1 alone and drug 2 alone, respectively, and Z represents the effect produced by the combination of drug 1 and drug 2. The theoretical additive surface is subtracted from the actual experimental surface, resulting in a surface that appears as a horizontal plane at 0% inhibition if the combination was additive. Any peak above this plane indicates synergy, whereas any depression below this plane indicates antagonism. The lower limits of the 95% confidence intervals (CI) for the experimental dose-response surface were used to evaluate the data statistically. The volume of the peak or depression was calculated to quantify the overall synergy or antagonism produced. Values of synergy and antagonism at the 95% CI were considered to determine combination effect according to the Mac Synergy II handbook (which can be accessed via http://www.uab.edu/images/pediatrics/ID/MacSynergy.pdf).
TABLE-US-00013 TABLE 13 Concentration ranges of the various compounds used for each experiment Experiment Concentration Range (nM) # Compound 2 Compound 3 ETV TFV 1 1000-0.24 1000-0.24 25-0.024 250-0.24 2 250-3.9 N/A 25-0.10 250-1.0 3 250-3.9 N/A 25-0.10 250-1.0
Example 4.2Results
[0442]
TABLE-US-00014 TABLE 14 Synergy results summary for the combination of Compound 2 or Compound 3 with compounds ETV or TFV Synergy Antagonism Formula Repeat volumes volumes and Anti- measurements (95% CI lower (95% CI lower HBV agent per limit) limit) Combination combinations experiment .sup.a (M.sup.2 %).sup.b (M.sup.2 %).sup.b effect.sup.c Compound 2 + 3 0 21.92 Insignificant ETV synergism/antagonism (Experiment (additivity) 1) Compound 2 + 3 1.13 10.98 Insignificant TFV synergism/antagonism (Experiment (additivity) 1) Compound 2 + 5 14.66 2.7 Insignificant ETV synergism/antagonism (Experiment (additivity) 2) Compound 2 + 5 273.83 0.55 Strong synergism TFV (Experiment 2) Compound 2 + 5 332.45 15.1 Strong synergism ETV (Experiment 3) Compound 2 + 5 413.62 6.19 Strong synergism TFV (Experiment 3) Compound 3 + 3 79.1 13.75 Moderate ETV synergism (Experiment 1) Compound 3 + 3 144.51 2.61 Strong synergism TFV (Experiment 1)
TABLE-US-00015 TABLE 15 Anti-HBV activity of ETV and TFV when tested as single agents in HepG2.2.15 cells Median Experimental Compound EC.sub.50, nM repeat # Inhibitor Class ETV 0.07 2 Nucleoside analogue TFV 15 1 Nucleoside analogue
[0443] The ATP cytotoxicity assay described above was performed in Experiment 1. Based on the raw data (not shown), the compounds do not show toxicity in any combination.
[0444]
[0445]
[0446]
[0447] The invention is not to be limited in scope by the specific embodiments and examples described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
[0448] All references (e.g., publications or patents or patent applications) cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual reference (e.g., publication or patent or patent application) was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Other embodiments are within the following claims.