INHIBITORS OF NUCLEOTIDYL TRANSFERASES AND USES IN HERPES AND HEPATITIS VIRAL INFECTIONS THEREFOR
20190365731 · 2019-12-05
Assignee
Inventors
- John Edwin Tavis (Kirkwood, MO)
- Lynda Anne Morrison (Webster Groves, MO)
- Marvin Meyers (Wentzville, MO, US)
Cpc classification
A61K31/522
HUMAN NECESSITIES
A61K31/513
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61K31/675
HUMAN NECESSITIES
A61K31/7076
HUMAN NECESSITIES
A61K31/122
HUMAN NECESSITIES
C07D213/89
CHEMISTRY; METALLURGY
A61K31/4375
HUMAN NECESSITIES
A61K31/4412
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K31/662
HUMAN NECESSITIES
A61K31/7072
HUMAN NECESSITIES
International classification
A61K31/4412
HUMAN NECESSITIES
C07D213/89
CHEMISTRY; METALLURGY
A61K31/513
HUMAN NECESSITIES
A61K31/4375
HUMAN NECESSITIES
A61K31/7076
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61K31/122
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61K31/7072
HUMAN NECESSITIES
A61K31/522
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to identification of inhibitors of hepatitis and herpesvirus replication including compounds of the formula:
##STR00001##
wherein the variables are as defined herein. Also provided are methods of treatment using agents so identified.
Claims
1. A method of inhibiting a herpesvirus or hepatitis B virus nucleic acid metabolism enzyme comprising contacting said enzyme with a compound having the formula: ##STR00042## or a compound of the formula: ##STR00043## wherein: R.sub.1 is aryl.sub.(C12), aralkyl.sub.(C18), heteroaryl.sub.(C12), alkylamino.sub.(C12), dialkylamino.sub.(C12), arylamino.sub.(C12), diarylamino.sub.(C12), aralkylamino.sub.(C18), diaralkylamino.sub.(C18), or a substituted version of any of these groups; R.sub.2 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.3 is hydrogen, amino, carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or sulfonylamine; or alkyl.sub.(C8), aryl.sub.(C8), acyl.sub.(C8), alkoxy.sub.(C8), acyloxy.sub.(C8), amido.sub.(C8), or substituted version of any of these groups; X.sub.2 is hydrogen or C(O)R.sub.a, wherein: R.sub.a is hydroxy, alkoxy.sub.(C8), or substituted alkoxy.sub.(C8); or a compound of the formula: ##STR00044## wherein: R.sub.4 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.5 and R.sub.8 are each independently hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.7 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a compound of the formula: ##STR00045## wherein: R.sub.9 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.10 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.11 is hydrogen or Y.sub.1OX.sub.1OR.sub.12; wherein: Y.sub.1 is alkanediyl.sub.(C8) or substituted alkanediyl.sub.(C8); X.sub.1 is arenediyl.sub.(C12), heteroarenediyl.sub.(C12), or a substituted version of either of these groups; R.sub.12 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a pharmaceutically acceptable salt or tautomer thereof.
2. The method of claim 1, wherein the compound is further defined as: ##STR00046## wherein: R.sub.4 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.5 and R.sub.8 are each independently hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.7 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or or a pharmaceutically acceptable salt or tautomer thereof.
3. The method of claim 1, wherein the compound is further defined as: ##STR00047## wherein: R.sub.9 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.10 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.11 is hydrogen or Y.sub.1OX.sub.1OR.sub.12; wherein: Y.sub.1 is alkanediyl.sub.(C8) or substituted alkanediyl.sub.(C8); X.sub.1 is arenediyl.sub.(C12), heteroarenediyl.sub.(C12), or a substituted version of either of these groups; R.sub.12 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a pharmaceutically acceptable salt or tautomer thereof.
4. The method of claim 1, wherein the compound is further defined as: ##STR00048## or a pharmaceutically acceptable salt or tautomer thereof.
5. The method of claim 1, wherein the compound is further defined as: ##STR00049## or a pharmaceutically acceptable salt or tautomer thereof.
6. (canceled)
7. The method of claim 1, further comprising contacting said enzyme with a second inhibitor of said enzyme.
8. (canceled)
9. The method of claim 7, wherein said enzyme is located in a cell.
10. (canceled)
11. The method of claim 9, wherein said cell is located in a living subject.
12. The method of claim 11, wherein said subject is a vertebrate infected with a herpesvirus.
13. The method of claim 12, wherein said compound is administered intravenously, intra-arterially, orally, buccally, nasally, ocularly, rectally, vaginally, topically, intramuscularly, intradermally, cutaneously or subcutaneously.
14. The method of claim 12, wherein said subject is further administered a second anti-herpesvirus therapy.
15. The method of claim 14, wherein said second anti-herpesvirus therapy is foscarnet or a nucleoside analog.
16. The method of claim 15, wherein said nucleoside analog is acyclovir, famciclovir, valaciclovir, penciclovir, or ganciclovir.
17.-18. (canceled)
19. The method of claim 1, wherein said subject has previously received a first-line anti-herpesvirus therapy.
20. The method of claim 19, wherein said herpesvirus has developed resistance to said first-line anti-herpesvirus therapy.
21. The method of claim 1, wherein said herpevirus is selected from a human alpha herpesvirus, a human beta herpesvirus or a human gamma herpesvirus.
22.-51. (canceled)
52. A method of inhibiting replication of a hepatitis B virus comprising contacting the virus with an effective amount of a compound or composition further defined as: ##STR00050## wherein: R.sub.1 is aryl.sub.(C12), aralkyl.sub.(C18), heteroaryl.sub.(C12), alkylamino.sub.(C12), dialkylamino.sub.(C12), arylamino.sub.(C12), diarylamino.sub.(C12), aralkylamino.sub.(C18), diaralkylamino.sub.(C18), or a substituted version of any of these groups; R.sub.2 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.3 is hydrogen, amino, carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or sulfonylamine; or alkyl.sub.(C8), aryl.sub.(C8), acyl.sub.(C8), alkoxy.sub.(C8), acyloxy.sub.(C8), amido.sub.(C8), or substituted version of any of these groups; X.sub.2 is hydrogen or C(O)R.sub.a, wherein: R.sub.a is hydroxy, alkoxy.sub.(C8), or substituted alkoxy.sub.(C8); or a compound of the formula: ##STR00051## wherein: R.sub.4 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.5 and R.sub.8 are each independently hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.7 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a compound of the formula: ##STR00052## wherein: R.sub.9 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.10 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.11 is hydrogen or Y.sub.1OX.sub.1OR.sub.12; wherein: Y.sub.1 is alkanediyl.sub.(C8) or substituted alkanediyl.sub.(C8); X.sub.1 is arenediyl.sub.(C12), heteroarenediyl.sub.(C12), or a substituted version of either of these groups; R.sub.12 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a pharmaceutically acceptable salt thereof.
53.-55. (canceled)
56. The method of claim 52, wherein the method is sufficient to treat an infection of a hepatitis B virus.
57. A method of treating an infection of a hepatitis B virus in a patient comprising administering a therapeutically effective amount of a compound or composition further defined as: ##STR00053## wherein: R.sub.1 is aryl.sub.(C12), aralkyl.sub.(C18), heteroaryl.sub.(C12), alkylamino.sub.(C12), dialkylamino.sub.(C12), arylamino.sub.(C12), diarylamino.sub.(C12), aralkylamino.sub.(C18), diaralkylamino.sub.(C18), or a substituted version of any of these groups; R.sub.2 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.3 is hydrogen, amino, carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or sulfonylamine; or alkyl.sub.(C8), aryl.sub.(C8), acyl.sub.(C8), alkoxy.sub.(C8), acyloxy.sub.(C8), amido.sub.(C8), or substituted version of any of these groups; X.sub.2 is hydrogen or C(O)R.sub.a, wherein: R.sub.a is hydroxy, alkoxy.sub.(C8), or substituted alkoxy.sub.(C8); or a compound of the formula: ##STR00054## wherein: R.sub.4 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.5 and R.sub.8 are each independently hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.7 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a compound of the formula: ##STR00055## wherein: R.sub.9 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; R.sub.10 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and R.sub.11 is hydrogen or Y.sub.1OX.sub.1OR.sub.12; wherein: Y.sub.1 is alkanediyl.sub.(C8) or substituted alkanediyl.sub.(C8); X.sub.1 is arenediyl.sub.(C12), heteroarenediyl.sub.(C12), or a substituted version of either of these groups; R.sub.12 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or a pharmaceutically acceptable salt thereof.
58.-59. (canceled)
60. The method of claim 1, wherein the method is sufficient to inhibit viral replication.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0078] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0079]
[0080]
[0081]
[0082]
[0083]
DETAILED DESCRIPTION
[0084] The inventors have previously demonstrated that inhibitors of nucleotidyl-transferase superfamily (NTS) enzymes can come from multiple different chemical classes. The compounds described herein may be used from a variety of different viral infections including herpesvirus and hepatitis B virus. Inhibitors of NTS enzymes like this compound may well have a high barrier to development of antiviral resistance, and its unique mode of action suggests that it should be a good candidate for combination therapy with the existing antiviral drugs to improve overall efficacy of antiviral therapy. These and other aspects of the disclosure are discussed in detail below.
A. HERPESVIRUS
[0085] Herpesviruses are a diverse group of enveloped viruses having a large, double-stranded DNA genome enclosed in an icosahedral capsid (Pellet & Roizman 2013). The herpesviruses rely on the host cell RNA polymerase II for transcription, but encode all of the enzymes needed for replication of their genomes, including DNA polymerase, helicase, primase, terminase, ribonucleotide reductase, and thymidine kinase. All herpesviruses share the capacity to establish latency in host cells, allowing them to maintain the infection for the life of the host. Periodic reactivation from latency in response to cues in the cellular environment leads to lytic replication at mucosal surfaces, causing recurrent disease and providing the opportunity for transmission to uninfected individuals.
[0086] The herpesviruses are divided into three subclasses based primarily on their cellular tropism and characteristics of the latent infection. The human alpha herpesviruses herpes simplex virus 1 (HSV-1) (Roizman et al., 2013), herpes simplex virus 2 (HSV-2) (Roizman et al., 2013) and Varicella-Zoster virus (VZV) (Arvin & Gilden 2013) establish latency in sensory neurons where they may remain quiescent for long periods of time. HSV-1 and HSV-2 are similar viruses with colinear genomes and 83% nucleotide sequence identity in protein coding regions (Dolan et al., 1998); VZV contains a smaller, less homologous genome. The human beta herpesviruses human cytomegalovirus (HCMV), human herpesvirus 6A (HHV-6A), human herpesvirus 6B (HHV-6B) and human herpesvirus 7 (HHV-7) (Yamanishi et al., 2013) establish latency predominantly in mononuclear cells. The human gamma herpesviruses Epstein-Barr virus (EBV) (Longnecker et al., 2013) and Kaposi's sarcoma herpesvirus (KSHV) (Damania & Cesarman 2013) stimulate cellular proliferation upon infection. EBV infects B lymphocytes, where it establishes latency, and also epithelial cells. By contrast, endothelial cells harbor the latent reservoir of KSHV, although the virus infects numerous other cell types as well. The genomes of latent beta and gamma herpesviruses are replicated as the host cell divides in order to maintain latent infection.
[0087] Herpesviruses related the human alpha, beta and gamma herpesviruses infect numerous animal species, including several of significant economic importance. Key among these are pseudorabies virus which infects pigs, Marek's disease virus which infects chickens, bovine herpesvirus, equine herpesvirus, and salmonid and related herpesviruses that infect game fish.
1. Pathology
[0088] Primary infections with herpesviruses produce a broad spectrum of disease. HSV-1 causes numerous maladies (Roizman et al., 2013): gingivostomatitis; eczema herpeticum; herpes gladiatorum; less common but frequently fatal encephalitis; and an increasing proportion of ulcerative anogential lesions (Gilbert et al., 2011; Horowitz et al., 2011; Pena et al., 2010; Smith & Roberts 2009). Nearly two-thirds of the U.S. population has been exposed to HSV-1 (Xu et al., 2006). HSV-2 infects approximately 17% of Americans (Xu et al., 2006) and up to 75% of some demographics world-wide (Obasi et al., 1999 and Kamali et al., 1999), with an estimated global disease burden of more than half a billion people (Looker, et al., 2008). HSV-2 is the primary cause of ulcerative anogenital lesions. In addition, HSV-1 and HSV-2 may be transmitted from a pregnant woman to her child during birth, often causing potentially fatal disseminated disease in the newborn (Kimberlin 2007). HCMV is the most common in utero virus infection (Manicklal et al., 2013), and approximately 8,000 HCMV-infected infants born each year in the U.S. suffer sensorineural deafness, chorioretinitis, and/or mental retardation (James et al., 2009). In immunocompromised individuals, HCMV can cause mononucleosis, retinitis, colitis, pneumonitis, and esophagitis. These serious HCMV infections are associated with increased morbidity and mortality (Komatsu et al., 2014). EBV causes the vast majority of infectious mononucleosis, which strikes nearly half of young adults (Luzuriaga & Sullivan 2010). Notably, of the eight human herpesviruses, a vaccine is available only for VZV.
[0089] The novel capacity of herpesviruses to establish and reactivate from latency is also associated with numerous pathologies. HSV-1 causes recurrent cold sores; a significant proportion of devastating viral encephalitis; and corneal scarring known as herpetic stromal keratitis which is the most frequent infectious cause of blindness, afflicting nearly 400,000 persons annually in the U.S. (Roizman et al., 2013). HSV-2 frequently reactivates to cause genital ulcers and prior HSV-2 infection is associated with an increased risk of human immunodeficiency virus (HIV) acquisition (Roizman et al., 2013). Infants who survive HSV-1 or HSV-2 infections often experience life-long sequellae and periodic recurrent lesions (Kimberlin 2007 and James et al., 2009). VZV reactivates in up to half of older adults (Cohen 2013), and pain associated with the classic Zoster (shingles) rash and post-rash neuralgia can be excruciating. HCMV reactivation is associated with increased incidence of restenosis after angioplasty (Popovic et al., 2012), and also causes significant morbidity and mortality in recipients of bone marrow and solid organ transplants (Snydman 2008). Latent EBV infection is associated with a variety of cancers including Burkitt's lymphoma, two types of Hodgkin's lymphoma, non-Hodgkin's lymphoma, nasopharyngeal carcinoma, and post-transplant lymphoproliferative disease. Latent KSHV infection can lead to three types of cancer: Kaposi's sarcoma, pleural effusion lymphoma, and Castleman's disease (Damania & Cesarman 2013).
[0090] Veterinary herpesviruses also take a significant toll on livestock. Marek's disease is highly contagious, spreading rapidly through flocks of chickens that have not been vaccinated. It causes T cell lymphoma with infiltration of nerves and somatic organs, leading to paralysis and death in up to 80% of infected birds (Hirari, 2001). In addition, vaccine efficacy has declined with a concomitant increase in Marek's virus virulence (Gimeno, 2008). Pseudorabies (PRV) is the second most economically important viral disease of swine. Although PRV does not cause illness in adult swine, infection of pregnant sows results in a high incidence of abortion or resorption (Smith, 1997). Piglets infected with PRV suffer coughing, sneezing, fever, constipation, and a variety of neurologic symptoms. Mortality in piglets less than one month of age is close to 100%, but declines rapidly with age (Nauwynck et al., 2007). Ruminants and dogs and cats are also susceptible to lethal PRV infection (Fenner et al., 1993). In cattle, symptoms include intense itching followed by neurological signs and death. In dogs, intense itching is accompanied by jaw and pharyngeal paralysis and subsequent death (Decaro et al., 2008). In cats, usually no symptoms are observed because the disease is so rapidly fatal (Gaskell et al., 2007). Bovine herpesviruses (BHV) cause a variety of illnesses in young cattle, and can also cause abortion. Although the illnesses caused by BHV's are mostly not life-threatening, they cause important diseases because infection may trigger a decline in meat and milk production and affect trade restrictions (Nandi et al., 2009). Equine herpesviruses typically cause respiratory disease, but certain species also cause myeloencephalopathy in horses, abortion and occasionally neonatal mortality due to pneumonia (Fortier et al., 2010). The herpesviruses of various fish species can cause significant mortality in aquaculture settings, particularly at the fingerling stage (Hanson et al., 2011). Importantly, all of these viruses share the same basic genomic replication mechanisms, so if the presumed mechanism by which the NTS enzymes inhibit HSV-1 and HSV-2 is correct, most of the other herpesvirus pathogens should also be highly sensitive to NTS inhibitors. Development of NTS inhibitors into anti-herpesvirus drugs would be particularly valuable in cases like HCMV, where current antiviral therapies frequently drive resistance and are plagued by toxicity issues (Weller and Kuchta, 2013). Finally, NTS inhibitors may be promising candidates for pan anti-herpesvirus drug development due to similarities in replication mechanisms of all the herpesviruses.
[0091] 2. Infection and Latency
[0092] Enveloped herpesvirus particles fuse with the plasma membrane of a cell, releasing viral regulatory proteins and the viral capsid containing the linear double-stranded DNA genome into the cytoplasm. The capsids deliver the viral genome to the nucleus via release through nuclear pores, whereupon the genome circularizes and becomes transcriptionally active. Viral infection at this point can proceed by two patterns, lytic or latent. In the lytic cycle, coordinated phases of viral transcription lead to expression of the viral regulatory proteins, viral enzymes, and concurrently with the onset of DNA replication, the viral structural proteins. Nascent viral capsids assemble in the nucleus and then bud through the nuclear membranes to acquire their envelope (Mettenleiter et al., 2009). Release from the cells is primarily lytic, resulting in the death of the cell. Alternatively, the virus may enter a latent state, where transcription is limited to a few viral regulatory loci and viral DNA replication is strictly limited. Upon recognition of appropriate cellular stimuli, viral transcription reverts to the lytic pattern and productive viral replication occurs.
[0093] Initial infections with alpha herpesviruses are lytic, resulting in dispersion of the virus to other cells and organs. These viruses establish latency in the unique environment of the neuron, and also in satellite cells in the case of VZV. During latency, replication of alpha herpesvirus DNA may occur at a low level because latently infected neurons contain multiple copies of the genome (Chen et al., 2002; Wang et al., 2005). Once latency is established, DNA replication increases markedly only during a reactivation event. Initial infections with beta herpesviruses are typically non-lytic but may cause cell-cell fusion. The gamma herpesviruses stimulate proliferation of infected cells, replicating their DNA along with cellular DNA replication to transmit copies of the viral genome to daughter cells (Longnecker et al., 2013). All the herpesviruses cause episodic lytic infection of at least some cell types, allowing them to be shed from mucosal surfaces to facilitate transmission to uninfected individuals.
[0094] 3. Genomic Replication
[0095] Circularization of the linear double-stranded herpesvirus DNA occurs in the nucleus shortly after viral uncoating, presumably through a recombination-mediated event. Replication of the viral DNA occurs in the nucleus within three-dimensional domains termed replication compartments (Quinlan et al., 1984). DNA replication is thought to employ a double-stranded rolling circle mechanism [reviewed in (Weller & Coen 2012; Lehman & Boehmer 1999)]. In preparation for viral DNA replication, virus-encoded transcriptional activators upregulate expression of proteins involved in nucleic acid metabolism. DNA replication then initiates at one of three viral origins of DNA replication and is mediated through action of the viral ICP6 origin binding protein. (All viral gene names in this section are for HSV-1). DNA synthesis is primed by the viral helicase/primase complex (pUL5, pUL8, and pUL52). DNA elongation occurs by coupled leading- and lagging-strand DNA synthesis through formation of a replication fork that is grossly similar to the forks that replicate cellular DNA. DNA synthesis is catalyzed by the pUL30 DNA polymerase/UL42 processivity protein complex that also possesses 5-3 exonuclease, 3-5 exonuclease, and RNase H activities. Helical torsion is relieved by the viral helicase/primase complex, and proper replication fork initiation, architecture and dynamics are promoted by the ICP8 single-stranded DNA binding protein. The initial product of DNA replication is a head-to-tail concatamer, but later in the replication cycle complex branched concatamers accumulate through recombination and/or re-initiation mechanisms. The concatamer is cleaved to unit length by the terminase complex (pUL15, pUL28, and pUL33) (Selvarajan et al., 2013) during encapsidation of the viral genome into pre-formed viral capsids. Without wishing to be bound by any theory, it is believed that some of the compounds described herein inhibit the activity of pUL15 terminase.
[0096] 4. Therapeutic Targets in the Herpesvirus Genome
[0097] Possible Targets for Nucleotidyl Transferase Superfamily Inhibitors in the Herpesvirus Genomes.
[0098] The inhibitors screened here function against HIV by binding to the viral RNase H or integrase active sites and chelating the essential divalent cations within the active site (Fuji et al., 2009; Su et al., 2010; Chung et al., 2011; Billamboz et al., 2011; Himmel et al., 2009; Kirschberg et al., 2009). Other compounds screened here are chemically related to inhibitors of the HIV RNase H and integrase. Therefore, their presumed mechanism of action is to inhibit one or more of the viral and/or cellular NTS enzymes essential for herpesviral genomic replication. This mechanism has not yet been tested.
[0099] For the herpes simplex viruses, candidate genes include the RNase H activity of the pUL30 DNA polymerase (Liu et al., 2006), the 3-5 exonuclease activity of pUL30 (Coen 1996), the strand transfer activity of ICP8 (Bortner et al., 1993; Nimonkar & Boehmer, 2003), or the 5-3 exonuclease activity of the pUL12 polymerase accessory protein (Schumacher et al., 2012) that are directly involved in virus replication (Weller & Coen 2012). The pUL15 terminase protein that cleaves the concatameric viral DNA produced by DNA replication into the mature linear monomers is also a prime candidate (Selvarajan et al., 2013).
[0100] Other herpesviruses encode proteins with functions consistent with NTS enzymes that could be plausible targets. For example, pUL98 is the HCMV ortholog of HSV pUL12 and is functionally conserved, as demonstrated by trans-complementation experiments (Gao et al., 1998). At least two of the seven HCMV proteins involved in encapsidation form an essential terminase complex which likely functions as both an endonuclease and a DNA translocase during DNA cleavage and packaging (Bogner, 2002; Hwang & Bogner, 2002; Scheffczik et al., 2002; Scholz et al., 2003). These genes are conserved throughout the herpesvirus family (Alba et al., 2001) and deletion of any of the seven results in accumulation of empty capsids in the nucleus. The human cytomegalovirus (HCMV) terminase subunits pUL56 and pUL89, encoded by the UL56 and UL89 genes, have been extensively studied. Both gene products form toroidal structures, bind DNA, and have nuclease activity (Bogner et al., 1998; Scheffczik et al., 2002). While pUL56 mediates the specific binding to pac sequences on DNA concatamers and provides energy and structural assistance for DNA translocation into the procapsids, pUL89 cleaves the DNA concatomers (Bogner, 2002). These are the orthologs of HSV terminase subunits pUL15 and pUL28.
[0101] Cellular proteins are also plausible targets for the action of the NTS inhibitors, especially because DNA recombination events appear to be important during productive replication (Weller & Coen 2012). These proteins include the human RNase H1 that could assist in removal of RNA primers for DNA synthesis. Other candidates include the Fen1 endonuclease that may assist in removal of primers (Zhu et al., 2010), and the double-stranded break repair enzymes Mre11, Rad50, NBS1, Rad51 (Weizman & Weller 2011), and Rad52 (Schumacher et al., 2012). The base-excision repair enzymes SSH2 and MLH1 which form complexes that are recruited to viral replication sites and contribute to HSV genomic replication (Mohni et al., 2011) are also plausible targets.
[0102] 5. Treatments
[0103] Herpesvirus DNA polymerase inhibitors (nucleoside analogs), including acyclovir, famciclovir, valaciclovir, penciclovir, and ganciclovir are the most common forms of treatment. A pyrophosphate analog, foscarnet, also inhibits the herpesvirus DNA polymerases. A DNA helicase-primase inhibitor, AIC316 (pritelivir), was shown to reduce HSV-2 shedding and number of days without lesions in a phase 2 clinical trial (Wald et al., 2014). However, a subsequent double-blind trial by the same group was terminated by the sponsor because of concurrent findings of toxicity in monkeys (De et al., 2015). Similarly, the helicase-primase inhibitor Amenamevir (ASP2151) is active against HSV-1 and HSV-2 in culture (Chono et al., 2010) and significantly reduced the median time to lesion healing in a phase II clinical trial (Tyring et al., 2012), but a subsequent trial was terminated due to adverse effects (De et al., 2015). CMX001 (brincidofovir), an orally bioavailable lipid conjugate of cidofovir, potentiates the antiviral effect of acyclovir in mice inoculated intranasally with HSV-1 or HSV-2 (Prichard et al., 2011). N-Methanocarbathymidine (N-MCT) reduces lethality in a mouse model of HSV-2 infection (Quenelle et al., 2011) and a guinea pig model of neonatal herpes (Bernstein et al., 2011). N-MCT also reduces acute and recurrent disease caused by HSV-2 in an adult guinea pig model. The monoamine oxidase inhibitor tranylcypromine (TCP), which also blocks the activity of histone demethylase LSD1, reduces HSV-1 infection of the cornea, trigeminal ganglia and brain of mice, corneal disease, and percentage of mice shedding virus upon induced reactivation (Yao et al., 2014). TCP has also been tested in a rabbit eye model of recurrent infection with HSV-1 and the mouse and guinea pig models of HSV-2 genital infection. An acyclic nucleoside phosphonate, PMEO-DAPym, inhibits HSV replication in a variety of cultured cell types by targeting the viral DNA polymerase (Balzarini et al., 2013). The HIV integrase inhibitor, Raltegravir, has a small amount of inhibitory activity against replication of several herpesviruses in cultured cells (Zhou et al., 2014; Yan et al., 2014) and appears to target the polymerase processivity factor UL42 (Zhou et al., 2014). Two other integrase inhibitors, XZ15 and XZ45, reduce replication of HSV-1 in cell culture by approximately 800- to 8000-fold, respectively (Yan et al., 2014). XZ45 also inhibits HCMV replication and KSHV gene expression (Yan et al., 2014).
[0104] Therapy based on existing drugs such as acyclovir is incompletely effective (Johnston et al., 2012), and viral resistance to current nucleos(t)ide analog therapies is relatively common. Acyclovir resistant variants are particularly prevalent among children, the immunocompromised, and patients with herpetic stromal keratitis (Duan et al., 2008; Wang et al., 2011; Field & Vere Hodge, 2013; Morfin & Thouvenot, 2003; Andrei & Snoeck, 2013). Ganciclovir-resistant variants occur in the naturally circulating viral population (Drew et al., 1993) and can be selected in patients over time (Marfori et al., 2007; Imai et al., 2004; Drew et al., 2001; Drew et al., 1999).
B. HEPATITIS B VIRUS
[0105] 1. Biology
[0106] Hepatitis B virus, abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. This virus causes the disease hepatitis B. In addition to causing hepatitis B, infection with HBV can lead to hepatic fibrosis, cirrhosis and hepatocellular carcinoma. It has also been suggested that it may increase the risk of pancreatic cancer.
[0107] The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains at least five other species: the pomona roundleaf bat hepatitis virus, long-fingered bat hepatitis virus, the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and the Woolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family along with Avihepadnavirus. This family of viruses have not been assigned to a viral order. Viruses similar to hepatitis B have been found in all the Old World apes (orangutan, gibbons, gorillas and chimpanzees) and from a New World woolly monkey suggesting an ancient origin for this virus in primates.
[0108] The virus is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A-H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.
[0109] The virus particle (virion) consists of an outer lipid envelope and an icosahedral nucleocapsid core composed of protein. The nucleocapsid encloses the viral DNA and a DNA polymerase that has reverse transcriptase activity similar to retroviruses. The outer envelope contains embedded proteins which are involved in viral binding of, and entry into, susceptible cells. The virus is one of the smallest enveloped animal viruses with a virion diameter of 42 nm, but pleomorphic forms exist, including filamentous and spherical bodies that both lack a core. These particles are not infectious and are composed of the lipid and protein that forms part of the surface of the virion, which is called the surface antigen (HBsAg), and are produced in excess during the life cycle of the virus. The HBV virus itself is called a Dane particle and consists of HBsAg, a lipid envelope, the core protein (HBcAg), the viral genome, and the Hepatitis B virus DNA polymerase. The functions of the small regulatory protein (HBx) are not yet well known but may be related to interfering with transcription, signal transduction, signal transduction, cell cycle progress, protein degradation, apoptosis, or chromosomal stability. The virus also produces a secreted protein called HBeAg that is an amino-terminal extension of HBcAg initiating from an upstream start codon that is involved in suppressing antiviral immune responses.
[0110] The genome of HBV is made of circular DNA, but it is unusual because the DNA is not fully double-stranded in the virion. One end of the full length strand is linked to the viral DNA polymerase. The genome is 3020-3320 nucleotides long (for the full length strand) and 1700-2800 nucleotides long (for the short length strand). The negative-sense, (non-coding), strand is the complete strand and it is complementary to the viral mRNA. The viral DNA is found in the nucleus soon after infection of the cell. The partially double-stranded DNA is rendered fully double-stranded shortly after infection of a cell by completion of the (+) sense strand and removal of a protein molecule from the () sense strand and a short sequence of RNA from the (+) sense strand. A short terminal duplication of are removed from the ends of the ()sense strand and the ends are rejoined. The mature nuclear form of the genome is called the cccDNA. The cccDNA is the template for transcription of all of the viral mRNAs.
[0111] There are four known genes encoded by the genome called C, X, P, and S. The core protein (HBcAg) is coded for by gene C, and its start codon is preceded by an upstream in-frame AUG start codon from which the pre-core protein is produced. HBeAg is produced by proteolytic processing of the pre-core protein. The DNA polymerase is encoded by gene P. Gene S is the gene that codes for the surface antigens (HBsAg). The HBsAg gene is one long open reading frame but contains three in frame start (ATG) codons that divide the gene into three sections, pre-S1, pre-S2, and S. Because of the multiple start codons, polypeptides of three different sizes called large, middle, and small (pre-S1+pre-S2+S, pre-S2+S, or S) are produced. The function of the protein coded for by gene X is not fully understood, but it has pleiotropic regulatory functions in both the cytoplasm and nucleus.
[0112] There are at least eight known genotypes labeled A through H. A possible new I genotype has been described, but acceptance of this notation is not universal. Different genotypes may respond to treatment in different ways. The genotypes differ by at least 8% of the sequence and have distinct geographical distributions and this has been associated with anthropological history. Type F which diverges from the other genomes by 14% is the most divergent type known. Type A is prevalent in Europe, Africa and South-east Asia, including the Philippines. Type B and C are predominant in Asia; type D is common in the Mediterranean area, the Middle East and India; type E is localized in sub-Saharan Africa; type F (or H) is restricted to Central and South America. Type G has been found in France and Germany. Genotypes A, D and F are predominant in Brazil and all genotypes occur in the United States with frequencies dependent on ethnicity. The E and F strains appear to have originated in aboriginal populations of Africa and the New World, respectively. Within these genotypes, 24 subtypes have been described which differ by 4-8% of the genome: [0113] Type A has two subtypes: Aa (A1) in Africa/Asia and the Philippines and Ae (A2) in Europe/United States. [0114] Type B has two distinct geographical distributions: Bj/B1 (jJapan) and Ba/B2 (aAsia). Type Ba has been further subdivided into four clades (B2-B4). [0115] Type C has two geographically subtypes: Cs (C1) in South-east Asia and Ce (C2) in East Asia. The C subtypes have been divided into five clades (C1-C5). A sixth clade (C6) has been described in the Philippines but only in one isolate to date. Type C1 is associated with Vietnam, Myanmar and Thailand; type C2 with Japan, Korea and China; type C3 with New Caledonia and Polynesia; C4 with Australia; and C5 with the Philippines. A further subtype has been described in Papua, Indonesia. [0116] Type D has been divided into 7 subtypes (D1-D7). [0117] Type F has been subdivided into 4 subtypes (F1-F4). F1 has been further divided in to 1a and 1b. In Venezuela subtypes F1, F2, and F3 are found in East and West Amerindians. Among South Amerindians only F3 was found. Subtypes Ia, III, and IV exhibit a restricted geographic distribution (Central America, the North and the South of South America respectively) while clades 1b and II are found in all the Americas except in the Northern South America and North America respectively.
[0118] The life cycle of hepatitis B virus is complex. Hepatitis B is one of a few known non-retroviral viruses which use reverse transcription as a part of its replication process:
[0119] Attachment [0120] The virus gains entry into the cell by binding to a receptor on the surface of the cell and enters it by endocytosis.
[0121] Penetration [0122] The virus membrane then fuses with the host cell's membrane releasing the DNA and core proteins into the cytoplasm.
[0123] Uncoating [0124] Because the virus multiplies via RNA made by a host enzyme, the viral genomic DNA has to be transferred to the cell nucleus by host proteins. The core proteins dissociate from the partially double-stranded viral DNA is then made fully double-stranded and transformed into covalently closed circular DNA (cccDNA) that serves as a template for transcription of four viral mRNAs.
[0125] Replication [0126] The cccDNA is the transcriptional template for all of HBV's RNAs. The largest of the mRNAs is called the pre-core mRNA that encodes HBeAg. A slightly shorter mRNA is called the pregenomic RNA that encodes the HBcAg and the viral DNA polymerase. Both the precore and pregenomic RNAs are longer than the viral genome, but only the pregenomic RNA is packaged into nascent core particles along with the viral polymerase. Reverse transcription within the capsids is catalyzed by the coordinate activity of the viral DNA polymerase's reverse transcriptase and ribonuclease H activities and results in the partially double-stranded viral DNA found within HBV virions.
[0127] Assembly and Release [0128] Progeny virions are formed budding of the viral capsid particles containing the viral DNA into endoplasmic-reticulum-derived membranes, where they pick up their envelope and HBsAgs are released from the cell by non-cytolytic secretion or are returned to the nucleus and re-cycled to produce even more copies of the nuclear cccDNA.
[0129] 2. Treatment
[0130] Currently, there are seven FDA approved drugs in the U.S. to treat chronic HBV: Intron A (Interferon Alpha), Pegasys (Pegylated Interferon), Epivir HBV (Lamivudine), Hepsera (Adefovir), Baraclude (Entecavir), Tyzeka (Telbivudine), and Viread (Tenofovir).
[0131] Adefovir, previously called bis-POM PMEA, with trade names Preveon and Hepsera, is an orally-administered nucleotide analog reverse transcriptase inhibitor (ntRTI). It can be formulated as the pivoxil prodrug adefovir dipivoxil. Adefovir works by blocking reverse transcriptase, the enzyme that is crucial for the hepatitis B virus (HBV) to reproduce in the body because it synthesizes the viral DNA. It is approved for the treatment of chronic hepatitis B in adults with evidence of active viral replication and either evidence of persistent elevations in serum aminotransferases (primarily ALT) or histologically active disease. The main benefit of adefovir over drugs like lamivudine (below) is that it takes a much longer period of time before the virus develops resistance to it. Adefovir dipivoxil contains two pivaloyloxymethyl units, making it a prodrug form of adefovir.
[0132] Lamivudine (2,3-dideoxy-3-thiacytidine, commonly called 3TC) is a potent nucleoside analog reverse transcriptase inhibitor (nRTI). It is marketed by GlaxoSmithKline with the brand names Zeffix, Heptovir, Epivir, and Epivir-HBV. Lamivudine has been used for treatment of chronic hepatitis B at a lower dose than for treatment of HIV. It improves the seroconversion of HBeAg positive hepatitis B and also improves histology staging of the liver. Long term use of lamivudine unfortunately leads to emergence of a resistant hepatitis B virus mutants with alterations to the key YMDD motif in the reverse transcriptase active site. Despite this, lamivudine is still used widely as it is well tolerated and as it is less expensive than the newer drugs and is the only anti-HBV drug many people in emerging economies can afford.
[0133] Lamivudine is an analogue of cytidine. It can inhibit both types (1 and 2) of HIV reverse transcriptase and also the reverse transcriptase of hepatitis B. It is phosphorylated to active metabolites that compete for incorporation into viral DNA. It inhibits the HIV reverse transcriptase enzyme competitively and acts as a chain terminator of DNA synthesis. The lack of a 3OH group in the incorporated nucleoside analogue prevents the formation of the 5 to 3 phosphodiester linkage essential for DNA chain elongation, and therefore, the viral DNA growth is terminated. Lamivudine is administered orally, and it is rapidly absorbed with a bio-availability of over 80%. Some research suggests that lamivudine can cross the blood-brain barrier.
[0134] Entecavir, abbreviated ETV, is an oral antiviral drug used in the treatment of hepatitis B infection. It is marketed under the trade names Baraclude (BMS) and Entaliv (DRL). Entecavir is a nucleoside analog (more specifically, a guanosine analogue) that inhibits reverse transcription and DNA replication thus preventing transcription in the viral replication process. The drug's manufacturer claims that entecavir is more efficacious than previous agents used to treat hepatitis B (lamivudine and adefovir). Entecavir was approved by the U.S.FDA in March 2005 and is used to treat chronic hepatitis B. It also helps prevent the hepatitis B virus from multiplying and infecting new liver cells. Entecavir is also indicated for the treatment of chronic hepatitis B in adults with HIV/AIDS infection. However, entecavir is not active against HIV.
[0135] Telbivudine is an antiviral drug used in the treatment of hepatitis B infection. It is marketed by Swiss pharmaceutical company Novartis under the trade names Sebivo (Europe) and Tyzeka (United States). Clinical trials have shown it to be significantly more effective than lamivudine or adefovir, and less likely to cause resistance. Telbivudine is a synthetic thymidine nucleoside analogue; it is the L-isomer of thymidine. It is taken once daily.
[0136] Tenofovir disoproxil fumarate (TDF or PMPA), marketed by Gilead Sciences under the trade name Viread, it is also a nucleotide analogue reverse transcriptase inhibitor (nRTIs) which blocks the HBV reverse transcriptase, an enzyme crucial to viral production. Tenofovir disoproxil fumarate is a prodrug form of tenofovir. Tenofovir is indicated in combination with other antiretroviral agents for the treatment of HIV-1 infection in adults. This indication is based on analyses of plasma HIV-1 RNA levels and CD4 cell counts in controlled studies of tenofovir in treatment-naive and treatment-experienced adults. There are no study results demonstrating the effect of tenofovir on the clinical progression of HIV. It also has activity against wild-type and lamivudine-resistant HBV.
C. NUCLEOTIDYL TRANSFERASE SUPERFAMILY ENZYMES
[0137] The inhibitors screened in this project were selected for their ability to inhibit the HIV RNAse H and/or integrase enzymes (or to be close chemical analogs of known inhibitors). The RNAse H and integrase are members of the nucleotidyl transferase superfamily (NTS) whose members share a similar protein fold and enzymatic mechanisms (Yang 1995). Therefore, the presumed targets of the anti-herpesvirus compounds claimed here are viral and/or cellular NTS enzymes. RNAse H enzymes (Hostomsky et al., 1993a; 1993b; 1993c) digest RNA when it is hybridized to DNA. Their physiological roles include removal of RNA primers during DNA synthesis, removal of abortive transcription products, and removal of RNA strands following reverse transcription by viruses or retrotransposons. Integrase enzymes cleave DNA strands and catalyze the covalent insertion of another DNA strand at the cleavage site. Consequently, the presumed mechanism of action for the herpesvirus inhibitors is through suppression of one or more of the nucleolytic or recombination-related activities essential for replication of the herpesvirus DNA.
[0138] The NTS family of enzymes includes E. coli RNase H I and II (Katayanagi et al., 1990, Yang et al., 1990 and Lai et al., 2000); human RNase H 1 and 2 (Lima et al., 2001, Frank et al., 1998 and Frank et al., 1998); the RuvC Holiday junction resolvase (Ariyoshi et al., 1994); and the Argonaute RNAse (Parker et al., 2004 and Song et al., 2004); retroviral RNase H enzymes including the HIV enzyme (Nowotny 2009); retroviral integrases including the HIV integrase (Dyda et al., 1994); and the hepatitis B virus (HBV) RNase H (Tavis et al., 2013). These enzymes function in a wide range of nucleic acid metabolic events, including RNA and DNA digestion, DNA recombination, DNA integration, DNA excision, replication fork repair, DNA repair, miRNA maturation, and miRNA-directed RNA cleavage. The canonical RNase H structure contains about 100 amino acids that fold into a 5-stranded -sheet overlaid with 3 -helices arranged like an H. Within the active site are four conserved carboxylates (the DEDD motif) that coordinate two divalent cations (Nowotny et al., 2005).
[0139] The RNase H enzymatic mechanism is believed to involve both divalent cations (Klumpp et al., 2003; Yang and Steitz, 1995), although a 1-ion mechanism has been proposed (Goedken and Marqusee, 2001; Keck et al., 1998). There are 3 classes of RNAse Hs distinguished by how they bind to their substrates. RNA binding by the stand-alone class typified by E. coli RNAse H I is promoted by a basic handle region (Hostomsky et al., 1993; Kwun et al., 2001). Eukaryotic RNase Hs typically contain a RHBD domain that influences nucleic acid binding. Finally, substrate binding by the retroviral enzymes can either be a property of the RNase H domain itself (e.g., Moloney murine leukemia virus) or may require the reverse transcriptase domain to provide sufficient affinity for the nucleic acid substrate (e.g., HIV) (Hostomsky et al., 1993; Smith et al., 1994).
[0140] The HBV RNase H is a NTS enzyme. Mutational analysis of the HBV RNase H revealed the DEDD active site residues to be D702, E731, D750, and D790 (numbering for HBV strain adw2) (Gerelsaikhan et al., 1996; Tavis et al., 2013). Data obtained with the HBV RNase H will be used as an example to establish how anti-RNase H drug discovery can be conducted and to establish utility of the claimed compounds against HBV replication.
[0141] HIV reverse transcription requires a virally encoded RNase H activity to remove the viral RNA after it has been copied into DNA (Freed and Martin, 2007). Consequently, the HIV RNase H activity has attracted much attention as a drug target (Billamboz et al., 2011; Bokesch et al., 2008; Budihas et al., 2005; Chung et al., 2011; Chung et al., 2010; Di et al., 2010; Didierjean et al., 2005; Fuji et al., 2009; Himmel et al., 2009; Himmel et al., 2006; Kirschberg et al., 2009; Klarmann et al., 2002; Klumpp et al., 2003; Klumpp and Mirzadegan, 2006; Shaw-Reid et al., 2003; Su et al., 2010; Takada et al., 2007; Wendeler et al., 2008; Williams et al., 2010). Over 100 anti-HIV RNase H compounds, based on a wide variety of chemical scaffolds, have been reported (Chung et al., 2011; Klumpp and Mirzadegan, 2006). They typically have inhibitory concentration-50% (IC.sub.50) values in the low M range. The large majority of these compounds inhibit the RNase H by chelating divalent cations in the active site (Billamboz et al., 2011; Chung et al., 2011; Fuji et al., 2009; Himmel et al., 2009; Kirschberg et al., 2009; Su et al., 2010), but compounds that alter the enzyme's conformation or its interaction with nucleic acids have also been reported (Himmel et al., 2006; Wendeler et al., 2008). The inhibitors typically have EC.sub.50 values 10 higher than the IC.sub.50 values, and they often cause modest cytotoxicity, leading to therapeutic indexes (TI) that are usually <10. Second-generation inhibitors with substantially improved efficacy have been reported, (Billamboz et al., 2011; Chung et al., 2011; Williams et al., 2010), and compounds with efficacy and TI values appropriate for a human drug exist (Himmel et al., 2006; Williams et al., 2010).
[0142] None of the anti-HIV RNase H compounds have entered clinical trials yet. This is due in part to their relatively low TI values but also to the large number of approved and developmental anti-HIV drugs, raising doubts about the marketability of anti-HIV RNase H compounds. Despite these challenges, the HIV RNase H remains a target of intensive ongoing drug development, as is evidenced by the large number of groups working in the field (Billamboz et al., 2011; Bokesch et al., 2008; Budihas et al., 2005; Chung et al., 2011; Chung et al., 2010; Di et al., 2010; Didierjean et al., 2005; Fuji et al., 2009; Himmel et al., 2009; Himmel et al., 2006; Kirschberg et al., 2009; Klarmann et al., 2002; Klumpp et al., 2003; Klumpp and Mirzadegan, 2006; Shaw-Reid et al., 2003; Su et al., 2010; Takada et al., 2007; Wendeler et al., 2008; Williams et al., 2010).
[0143] Because both the RNase H and integrase are NTS enzymes, some anti-RNase H compounds can inhibit the HIV integrase, and some anti-integrase compounds can inhibit the RNase H (Klarmann et al., 2002, Williams et al., 2010 and Billamboz et al., 2011). Despite this cross-inhibitory potential, resistance mutations to HIV DNA polymerase or integrase drugs have not led to cross-resistance to RNase H inhibitors (Billamboz et al., 2011 and Himmel et al., 2006).
[0144] HBV reverse transcription requires two viral enzymatic activities that are both located on the viral reverse transcriptase protein. The DNA polymerase activity synthesizes new DNA and is targeted by the nucleos(t)ide analogs. The RNase H destroys the viral RNA after it has been copied into DNA. Inhibiting the RNAse H would block DNA synthesis and consequently halt viral replication, but anti-HBV RNase H drugs have not been developed because enzyme suitable for drug screening could not be readily made. One of the inventors recently produced active recombinant HBV RNase H and identified 35 inhibitors of the RNase H (Table 1; Tavis et al., 2013; Hu et al., 2013; Tavis and Lomonosova, 2015; Lu, et al., 2015; and Cai, et al., 2014).
[0145] These examples of cross-inhibition of NTS enzymes by RNase H and integrase inhibitors provide the precedent upon which the studies with the herpesviruses rest.
D. CHEMICAL ENTITY
[0146] The compound of the present disclosure appears to inhibit a different enzymatic activity than the existing anti-hepatitis or anti-herpesvirus drugs, and does so with a striking capacity to suppress virus replication at very low toxicity to uninfected cells. This implies that it will be effective against viral isolates resistant to the existing drugs and suggests that these drugs could be combined effectively with the existing drugs to both increase efficacy and to reduce the rate of resistance development to either drug. Furthermore, the compound was more effective against HSV-2 than a currently accepted first line therapy, acyclovir, indicating that it may be more effective than the existing drugs when formulated for pharmaceutical delivery. In other embodiments, the present compounds may be used to treat infections of hepatitis B virus or used in combination with other hepatitis B virus therapies.
[0147] The compound of the present disclosure is represented by the formula below:
##STR00018##
[0148] wherein: [0149] R.sub.1 is aryl.sub.(C12), aralkyl.sub.(C18), heteroaryl.sub.(C12), alkylamino.sub.(C12), dialkylamino.sub.(C12), arylamino.sub.(C12), diarylamino.sub.(C12), aralkylamino.sub.(C18), diaralkylamino.sub.(C18), or a substituted version of any of these groups; [0150] R.sub.2 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and [0151] R.sub.3 is hydrogen, amino, carboxyl, cyano, halo, hydroxy, nitro, hydroxysulfonyl, or sulfonylamine; or alkyl.sub.(C8), aryl.sub.(C8), acyl.sub.(C8), alkoxy.sub.(C8), acyloxy.sub.(C8), amido.sub.(C8), or substituted version of any of these groups; [0152] X.sub.2 is hydrogen or C(O)R.sub.a, wherein: R.sub.a is hydroxy, alkoxy.sub.(C8), or substituted alkoxy.sub.(C8); or
[0153] a compound of the formula:
##STR00019##
[0154] wherein: [0155] R.sub.4 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; [0156] R.sub.5 and R.sub.8 are each independently hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); [0157] R.sub.6 is hydrogen, hydroxy, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and [0158] R.sub.7 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups;
[0159] a compound of the formula:
##STR00020##
[0160] wherein: [0161] R.sub.9 is alkyl.sub.(C12), aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; [0162] R.sub.10 is hydrogen, alkyl.sub.(C8), or substituted alkyl.sub.(C8); and [0163] R.sub.11 is hydrogen or Y.sub.1OX.sub.1OR.sub.12; wherein: [0164] Y.sub.1 is alkanediyl.sub.(C8) or substituted alkanediyl.sub.(C8); [0165] X.sub.1 is arenediyl.sub.(C12), heteroarenediyl.sub.(C12), or a substituted version of either of these groups; [0166] R.sub.12 is aryl.sub.(C12), aralkyl.sub.(C12), heteroaryl.sub.(C12), or a substituted version of any of these groups; or
##STR00021##
or a pharmaceutically acceptable salt or tautomer thereof.
TABLE-US-00001 TABLE 1 Non-Limiting Examples of Compounds Compound ID Structure #41
[0167] The compound of the disclosure contains one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of the chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. The compound may occur as a racemate and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single enantiomer or diastereomer is obtained. The chiral centers of the compound of the present disclosure can have the S or the R configuration.
[0168] Chemical formulas used to represent the compound of the disclosure will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Regardless of which tautomer is depicted for a given compound, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.
[0169] The compound of the disclosure may also have the advantage of being more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and/or have a better pharmacokinetic profile (e.g., higher oral bioavailability and/or lower clearance) than, and/or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.
[0170] In addition, atoms making up the compound of the present disclosure are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include .sup.13C and .sup.14C. Similarly, it is contemplated that one or more carbon atom(s) of a compound of the present disclosure may be replaced by a silicon atom(s). Furthermore, it is contemplated that one or more oxygen atom(s) of a compound of the present disclosure may be replaced by a sulfur or selenium atom(s).
[0171] The compound of the present disclosure may also exist in prodrug form. Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals (e.g., solubility, bioavailability, manufacturing, etc.), the compound employed in some methods of the disclosure may, if desired, be delivered in prodrug form. Thus, the disclosure contemplates prodrugs of the compound of the present disclosure as well as methods of delivering prodrugs. Prodrugs of the compound employed in the disclosure may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Accordingly, prodrugs include, for example, compounds described herein in which a hydroxy group is bonded to any group that, when the prodrug is administered to a subject, cleaves to form a hydroxy group.
[0172] It should be recognized that the particular anion or cation forming a part of any salt of this disclosure is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.
2. Definitions
[0173] When used in the context of a chemical group: hydrogen means H; hydroxy means OH; oxo means O; carbonyl means C(O); carboxy means C(O)OH (also written as COOH or CO.sub.2H); halo means independently F, Cl, Br or I; amino means NH.sub.2; hydroxyamino means NHOH; nitro means NO.sub.2; imino means NH; cyano means CN; isocyanate means NCO; azido means N.sub.3; in a monovalent context phosphate means OP(O)(OH).sub.2 or a deprotonated form thereof; in a divalent context phosphate means OP(O)(OH)O or a deprotonated form thereof; mercapto means SH; and thio means S; sulfonyl means S(O).sub.2; and sulfinyl means S(O).
[0174] In the context of chemical formulas, the symbol means a single bond, means a double bond, and means triple bond. The symbol ---- represents an optional bond, which if present is either single or double. The symbol represents single bond or a double bond. Thus, the formula
##STR00030##
covers, for example,
##STR00031##
And it is understood that no one such ring atom forms part of more than one double bond. Furthermore, it is noted that the covalent bond symbol , when connecting one or two stereogenic atoms, does not indicate any preferred stereochemistry. Instead, it covers all stereoisomers as well as mixtures thereof. The symbol , when drawn perpendicularly across a bond (e.g.,
##STR00032##
for methyl) indicates a point of attachment of the group. It is noted that the point of attachment is typically only identified in this manner for larger groups in order to assist the reader in unambiguously identifying a point of attachment. The symbol means a single bond where the group attached to the thick end of the wedge is out of the page. The symbol
means a single bond where the group attached to the thick end of the wedge is into the page. The symbol
means a single bond where the geometry around a double bond (e.g., either E or Z) is undefined. Both options, as well as combinations thereof are therefore intended. Any undefined valency on an atom of a structure shown in this application implicitly represents a hydrogen atom bonded to that atom. A bold dot on a carbon atom indicates that the hydrogen attached to that carbon is oriented out of the plane of the paper.
[0175] When a group R is depicted as a floating group on a ring system, for example, in the formula:
##STR00033##
then R may replace any hydrogen atom attached to any of the ring atoms, including a depicted, implied, or expressly defined hydrogen, so long as a stable structure is formed. When a group R is depicted as a floating group on a fused ring system, as for example in the formula:
##STR00034##
then R may replace any hydrogen attached to any of the ring atoms of either of the fused rings unless specified otherwise. Replaceable hydrogens include depicted hydrogens (e.g., the hydrogen attached to the nitrogen in the formula above), implied hydrogens (e.g., a hydrogen of the formula above that is not shown but understood to be present), expressly defined hydrogens, and optional hydrogens whose presence depends on the identity of a ring atom (e.g., a hydrogen attached to group X, when X equals CH), so long as a stable structure is formed. In the example depicted, R may reside on either the 5-membered or the 6-membered ring of the fused ring system. In the formula above, the subscript letter y immediately following the group R enclosed in parentheses, represents a numeric variable. Unless specified otherwise, this variable can be 0, 1, 2, or any integer greater than 2, only limited by the maximum number of replaceable hydrogen atoms of the ring or ring system.
[0176] For the chemical groups and compound classes, the number of carbon atoms in the group or class is as indicated as follows: Cn defines the exact number (n) of carbon atoms in the group/class. Cn defines the maximum number (n) of carbon atoms that can be in the group/class, with the minimum number as small as possible for the group/class in question, e.g., it is understood that the minimum number of carbon atoms in the group alkenyl.sub.(C8) or the class alkene.sub.(C8) is two. Compare with alkoxy.sub.(C10), which designates alkoxy groups having from 1 to 10 carbon atoms. Cnn defines both the minimum (n) and maximum number (n) of carbon atoms in the group. Thus, alkyl.sub.(C2-10) designates those alkyl groups having from 2 to 10 carbon atoms. These carbon number indicators may precede or follow the chemical groups or class it modifies and it may or may not be enclosed in parenthesis, without signifying any change in meaning. Thus, the terms C5 olefin, C5-olefin, olefin.sub.(C5), and olefin.sub.C5 are all synonymous. When any of the chemical groups or compound classes defined herein is modified by the term substituted, any carbon atom(s) in a moiety replacing a hydrogen atom is not counted. Thus methoxyhexyl, which has a total of seven carbon atoms, is an example of a substituted alkyl.sub.(C1-6).
[0177] The term saturated when used to modify a compound or chemical group means the compound or chemical group has no carbon-carbon double and no carbon-carbon triple bonds, except as noted below. When the term is used to modify an atom, it means that the atom is not part of any double or triple bond. In the case of substituted versions of saturated groups, one or more carbon oxygen double bond or a carbon nitrogen double bond may be present. And when such a bond is present, then carbon-carbon double bonds that may occur as part of keto-enol tautomerism or imine/enamine tautomerism are not precluded. When the term saturated is used to modify a solution of a substance, it means that no more of that substance can dissolve in that solution.
[0178] The term aliphatic when used without the substituted modifier signifies that the compound or chemical group so modified is an acyclic or cyclic, but non-aromatic hydrocarbon compound or group. In aliphatic compounds/groups, the carbon atoms can be joined together in straight chains, branched chains, or non-aromatic rings (alicyclic). Aliphatic compounds/groups can be saturated, that is joined by single carbon-carbon bonds (alkanes/alkyl), or unsaturated, with one or more carbon-carbon double bonds (alkenes/alkenyl) or with one or more carbon-carbon triple bonds (alkynes/alkynyl).
[0179] The term aromatic when used to modify a compound or a chemical group refers to a planar unsaturated ring of atoms with 4n+2 electrons in a fully conjugated cyclic system.
[0180] The term alkyl when used without the substituted modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups CH.sub.3 (Me), CH.sub.2CH.sub.3 (Et), CH.sub.2CH.sub.2CH.sub.3 (n-Pr or propyl), CH(CH.sub.3).sub.2(i-Pr, .sup.iPr or isopropyl), CH.sub.2CH.sub.2CH.sub.2CH.sub.3 (n-Bu), CH(CH.sub.3)CH.sub.2CH.sub.3 (sec-butyl), CH.sub.2CH(CH.sub.3).sub.2(isobutyl), C(CH.sub.3).sub.3(tert-butyl, t-butyl, t-Bu or .sup.tBu), and CH.sub.2C(CH.sub.3).sub.3(neo-pentyl) are non-limiting examples of alkyl groups. The term alkanediyl when used without the substituted modifier refers to a divalent saturated aliphatic group, with one or two saturated carbon atom(s) as the point(s) of attachment, a linear or branched acyclic structure, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groups CH.sub.2 (methylene), CH.sub.2CH.sub.2, CH.sub.2C(CH.sub.3).sub.2CH.sub.2, and CH.sub.2CH.sub.2CH.sub.2 are non-limiting examples of alkanediyl groups. The term alkylidene when used without the substituted modifier refers to the divalent group CRR in which R and R are independently hydrogen or alkyl. Non-limiting examples of alkylidene groups include: CH.sub.2, CH(CH.sub.2CH.sub.3), and C(CH.sub.3).sub.2. An alkane refers to the class of compounds having the formula HR, wherein R is alkyl as this term is defined above. When any of these terms is used with the substituted modifier one or more hydrogen atom has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2. The following groups are non-limiting examples of substituted alkyl groups: CH.sub.2OH, CH.sub.2C1, CF.sub.3, CH.sub.2CN, CH.sub.2C(O)OH, CH.sub.2C(O)OCH.sub.3, CH.sub.2C(O)NH.sub.2, CH.sub.2C(O)CH.sub.3, CH.sub.2OCH.sub.3, CH.sub.2OC(O)CH.sub.3, CH.sub.2NH.sub.2, CH.sub.2N(CH.sub.3).sub.2, and CH.sub.2CH.sub.2C1.
[0181] The term aryl when used without the substituted modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, said carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atoms other than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, C.sub.6H.sub.4CH.sub.2CH.sub.3 (ethylphenyl), naphthyl, and a monovalent group derived from biphenyl. The term arenediyl when used without the substituted modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, said carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:
##STR00035##
An arene refers to the class of compounds having the formula HR, wherein R is aryl as that term is defined above. Benzene and toluene are non-limiting examples of arenes. When any of these terms are used with the substituted modifier one or more hydrogen atom has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2.
[0182] The term aralkyl when used without the substituted modifier refers to the monovalent group -alkanediyl-aryl, in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the substituted modifier one or more hydrogen atom from the alkanediyl and/or the aryl group has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2. Non-limiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth-1-yl.
[0183] The term heteroaryl when used without the substituted modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and/or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term N-heteroaryl refers to a heteroaryl group with a nitrogen atom as the point of attachment. A heteroarene refers to the class of compounds having the formula HR, wherein R is heteroaryl. Pyridine and quinoline are non-limiting examples of heteroarenes. When these terms are used with the substituted modifier one or more hydrogen atom has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2.
[0184] The term acyl when used without the substituted modifier refers to the group C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, or aryl as those terms are defined above. The groups, CHO, C(O)CH.sub.3 (acetyl, Ac), C(O)CH.sub.2CH.sub.3, C(O)CH(CH.sub.3).sub.2, C(O)CH(CH.sub.2).sub.2, C(O)C.sub.6H.sub.5, and C(O)C.sub.6H.sub.4CH.sub.3 are non-limiting examples of acyl groups. A thioacyl is defined in an analogous manner, except that the oxygen atom of the group C(O)R has been replaced with a sulfur atom, C(S)R. The term aldehyde corresponds to an alkyl group, as defined above, attached to a CHO group. When any of these terms are used with the substituted modifier one or more hydrogen atom (including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2. The groups, C(O)CH.sub.2CF.sub.3, CO.sub.2H (carboxyl), CO.sub.2CH.sub.3 (methylcarboxyl), CO.sub.2CH.sub.2CH.sub.3, C(O)NH.sub.2 (carbamoyl), and CON(CH.sub.3).sub.2, are non-limiting examples of substituted acyl groups.
[0185] The term alkoxy when used without the substituted modifier refers to the group OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: OCH.sub.3 (methoxy), OCH.sub.2CH.sub.3 (ethoxy), OCH.sub.2CH.sub.2CH.sub.3, OCH(CH.sub.3).sub.2(isopropoxy), OC(CH.sub.3).sub.3(tert-butoxy), OCH(CH.sub.2).sub.2, O-cyclopentyl, and O-cyclohexyl. The terms cycloalkoxy, alkenyloxy, alkynyloxy, aryloxy, aralkoxy, heteroaryloxy, heterocycloalkoxy, and acyloxy, when used without the substituted modifier, refers to groups, defined as OR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term alkylthio and acylthio when used without the substituted modifier refers to the group SR, in which R is an alkyl and acyl, respectively. The term alcohol corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term ether corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the substituted modifier one or more hydrogen atom has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2.
[0186] The term alkylamino when used without the substituted modifier refers to the group NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: NHCH.sub.3 and NHCH.sub.2CH.sub.3. The term dialkylamino when used without the substituted modifier refers to the group NRR, in which R and R can be the same or different alkyl groups, or R and R can be taken together to represent an alkanediyl. Non-limiting examples of dialkylamino groups include: N(CH.sub.3).sub.2 and N(CH.sub.3)(CH.sub.2CH.sub.3). The terms cycloalkylamino, alkenylamino, alkynylamino, arylamino, aralkylamino, heteroarylamino, heterocycloalkylamino, alkoxyamino, and alkylsulfonylamino when used without the substituted modifier, refers to groups, defined as NHR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is NHC.sub.6H.sub.5. The term amido (acylamino), when used without the substituted modifier, refers to the group NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is NHC(O)CH.sub.3. The term alkylimino when used without the substituted modifier refers to the divalent group NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the substituted modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by OH, F, Cl, Br, I, NH.sub.2, NO.sub.2, CO.sub.2H, CO.sub.2CH.sub.3, CN, SH, OCH.sub.3, OCH.sub.2CH.sub.3, C(O)CH.sub.3, NHCH.sub.3, NHCH.sub.2CH.sub.3, N(CH.sub.3).sub.2, C(O)NH.sub.2, C(O)NHCH.sub.3, C(O)N(CH.sub.3).sub.2, OC(O)CH.sub.3, NHC(O)CH.sub.3, S(O).sub.2OH, or S(O).sub.2NH.sub.2. The groups NHC(O)OCH.sub.3 and NHC(O)NHCH.sub.3 are non-limiting examples of substituted amido groups.
[0187] The use of the word a or an, when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one.
[0188] Throughout this application, the term about is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects, or +/5% of the stated value.
[0189] The terms comprise, have and include are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as comprises, comprising, has, having, includes and including, are also open-ended. For example, any method that comprises, has or includes one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.
[0190] The term effective, as that term is used in the specification and/or claims, means adequate to accomplish a desired, expected, or intended result. Effective amount, Therapeutically effective amount or pharmaceutically effective amount when used in the context of treating a patient or subject with a compound means that amount of the compound which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.
[0191] As used herein, the term IC.sub.50 refers to an inhibitory dose which is 50% of the maximum response obtained. This quantitative measure indicates how much of a particular drug or other substance (inhibitor) is needed to inhibit a given biological, biochemical or chemical process (or component of a process, i.e. an enzyme, cell, cell receptor or microorganism) by half.
[0192] An isomer of a first compound is a separate compound in which each molecule contains the same constituent atoms as the first compound, but where the configuration of those atoms in three dimensions differs.
[0193] As used herein, the term patient or subject refers to a living vertebrate organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, bird, fish or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Non-limiting examples of human subjects are adults, juveniles, infants and fetuses.
[0194] As generally used herein, pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
[0195] Pharmaceutically acceptable salts means salts of the compound of the present disclosure which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3-phenylpropionic acid, 4,4-methylenebis(3-hydroxy-2-ene-1-carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene-1-carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, p-chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids, propionic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this disclosure is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002).
[0196] Prevention or preventing includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and/or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and/or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and/or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, including reactivation.
[0197] Prodrug means a compound that is convertible in vivo metabolically into an inhibitor according to the present disclosure. The prodrug itself may or may not also have activity with respect to a given target protein. For example, a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene-bis--hydroxynaphthoate, gentisates, isethionates, di-p-toluoyltartrates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like. Similarly, a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.
[0198] A stereoisomer or optical isomer is an isomer of a given compound in which the same atoms are bonded to the same other atoms, but where the configuration of those atoms in three dimensions differs. Enantiomers are stereoisomers of a given compound that are mirror images of each other, like left and right hands. Diastereomers are stereoisomers of a given compound that are not enantiomers. Chiral molecules contain a chiral center, also referred to as a stereocenter or stereogenic center, which is any point, though not necessarily an atom, in a molecule bearing groups such that an interchanging of any two groups leads to a stereoisomer. In organic compounds, the chiral center is typically a carbon, phosphorus or sulfur atom, though it is also possible for other atoms to be stereocenters in organic and inorganic compounds. A molecule can have multiple stereocenters, giving it many stereoisomers. In compounds whose stereoisomerism is due to tetrahedral stereogenic centers (e.g., tetrahedral carbon), the total number of hypothetically possible stereoisomers will not exceed 2.sup.n, where n is the number of tetrahedral stereocenters. Molecules with symmetry frequently have fewer than the maximum possible number of stereoisomers. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Alternatively, a mixture of enantiomers can be enantiomerically enriched so that one enantiomer is present in an amount greater than 50%. Typically, enantiomers and/or diasteromers can be resolved or separated using techniques known in the art. It is contemplated that for any stereocenter or axis of chirality for which stereochemistry has not been defined, that stereocenter or axis of chirality can be present in its R form, S form, or as a mixture of the R and S forms, including racemic and non-racemic mixtures. As used herein, the phrase substantially free from other stereoisomers means that the composition contains 15%, more preferably 10%, even more preferably 5%, or most preferably 1% of another stereoisomer(s).
[0199] Effective amount, therapeutically effective amount or pharmaceutically effective amount means that amount which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.
[0200] Treatment or treating includes (1) inhibiting a disease in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and/or symptomatology), (2) ameliorating a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and/or symptomatology), and/or (3) effecting any measurable decrease in a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease. In some embodiments, treatment of a patient afflicted with one of the pathological conditions described herein comprises administering to such a patient an amount of compound described herein which is therapeutically effective in controlling the condition or in prolonging the survivability of the patient beyond that expected in the absence of such treatment. As used herein, the term inhibition of the condition also refers to slowing, interrupting, arresting or stopping the condition and does not necessarily indicate a total elimination of the condition. It is believed that prolonging the survivability of a patient, beyond being a significant advantageous effect in and of itself, also indicates that the condition is beneficially controlled to some extent.
[0201] The above definitions supersede any conflicting definition in any reference that is incorporated by reference herein. The fact that certain terms are defined, however, should not be considered as indicative that any term that is undefined is indefinite. Rather, all terms used are believed to describe the disclosure in terms such that one of ordinary skill can appreciate the scope and practice the present disclosure.
E. THERAPEUTIC METHODS
[0202] 1. Pharmaceutical Formulations
[0203] In particular embodiments, where clinical application of an active ingredient is undertaken, it will be necessary to prepare a pharmaceutical composition appropriate for the intended application. Generally, this will entail preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities or contaminants that could be harmful to humans or animals. One also will generally desire to employ appropriate buffers to render the complex stable and allow for uptake by target cells.
[0204] Aqueous compositions of the present disclosure comprise an effective amount of the active compound, as discussed above, further dispersed in pharmaceutically acceptable carrier or aqueous medium. Such compositions also are referred to as inocula. The phrase pharmaceutically or pharmacologically acceptable refers to compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate, as well as the requisite sterility for in vivo uses.
[0205] As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
[0206] Solutions of therapeutic compositions can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[0207] The therapeutic compositions of the present disclosure are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified. A typical composition for such purpose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain 10 mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like.
[0208] Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well-known parameters.
[0209] Additional formulations are suitable for oral administration. Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. When the route is topical, the form may be a cream, ointment, a controlled release patch, salve or spray. In some embodiments, the topical formulation by used for administration to the skin, to mucosa membranes such as the eye, eye lids, the genitals, the anus, or the inside of the mouth or nose, and in particular to the cornea.
[0210] An effective amount of the therapeutic composition is determined based on the intended goal. The term unit dose or dosage refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired responses, discussed above, in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the protection desired.
[0211] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment and the potency, stability and toxicity of the particular therapeutic substance.
[0212] 2. Routes of Administration
[0213] Formulations of the present disclosure are suitable for oral administration. However, the therapeutic compositions of the present disclosure may be administered via any common route so long as the target tissue is available via that route. This includes nasal, buccal, corneal, ocularly, rectal, vaginal, or topical administration, and intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. As such, compositions would be formulated pharmaceutically in route-acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
[0214] As with dosing amounts, the timing of delivery (including intervals and total number of doses) depends on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment and the potency, stability and toxicity of the particular therapeutic substance.
[0215] 3. Combination Therapy
[0216] In many clinical situations, it is advisable to use a combination of distinct therapies. Thus, it is envisioned that, in addition to the therapies described above, one would also wish to provide to the patient more traditional pharmaceutical hepatitis or herpesvirus therapies. Examples of standard therapies are described above. Combinations may be achieved by administering a single composition or pharmacological formulation that includes both agents, or with two distinct compositions or formulations, at the same time, wherein one composition includes the agents of the present disclosure and the other includes the standard therapy. Alternatively, standard therapy may precede or follow the present agent treatment by intervals ranging from minutes to weeks to months. In embodiments where the treatments are applied separately, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agents would still be able to exert an advantageously combined effect on the subject. In such instances, it is contemplated that one would administer both modalities within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other, with a delay time of only about 12 hours being most preferred. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.
[0217] It also is conceivable that more than one administration of either the agent of the present disclosure, or the standard therapy will be desired. Various combinations may be employed, where the present disclosure compound is A and the standard therapy is B, as exemplified below:
TABLE-US-00002 A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B
[0218] Other combinations are contemplated as well. Drugs suitable for such combinations are described above and include, but are not limited to, DNA polymerase inhibitors (nucleoside analogs), including acyclovir, famciclovir, valaciclovir, penciclovir, and ganciclovir. Additionally, it is contemplated that other antiviral agents such as a pegylated interferon, interferon alfa-2b, lamivudine, adefovir, telbivudine, entercavir, or tenofovir may be used in combination with the compounds described herein.
E. EXAMPLES
[0219] The following examples are included to further illustrate various aspects of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques and/or compositions discovered by the inventors to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.
[0220] 1. Materials and Methods
[0221] Cells and Viruses.
[0222] Vero cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 3% newborn calf serum, 3% bovine growth serum, 2 mM L-glutamine and 100 IU/mL penicillin and 0.1 mg/mL streptomycin (P/S). HSV-1 #6 and HSV-2 #1 are de-identified clinical isolates from the Saint Louis University Hospital. Stocks were prepared after a single passage in cell culture and were titered by standard plaque assay (Knipe and Spang, 1982). Wild-type HSV-2 used in
[0223] Compound Selection Strategy.
[0224] The compound was selected for evaluation of its ability to inhibit HSV replication based on one or more of the following criteria: [0225] close chemical relatives of compounds that inhibit the HIV RNase H, the HIV integrase, or the HBV RNase H [0226] availability from commercial sources and/or through the NCI compound repository.
[0227] Anti-HSV-1 and -HSV-2 Replication Assay.
[0228] Compounds to be screened were diluted in PBS supplemented to contain 2% newborn calf serum and 1% glutamine, and added in 100 L volume to confluent cell monolayers in 24-well cluster plates. Immediately thereafter HSV-1 and HSV-2, diluted in the supplemented PBS medium, were added to the wells in 50 l volume such that the final concentration of compound was 50 M, 5 M and 1 M and the multiplicity of infection was 0.1. The plates were incubated at 37 C. for 1 hour and then virus-containing inoculum was removed and the wells were washed once in PBS.
[0229] Compound, diluted to 50 M, 5 M and 1 M in DMEM supplemented to contain 2% newborn calf serum and 1% each penicillin/streptomycin, was added at 0.5 mL/well. Plates were incubated at 37 C. an additional 23 hours, and then the plates were visually inspected through a phase contrast microscope for cytopathic effect, and for toxic effect. The entire contents of each well were collected by scraping. Samples were frozen at 80 C., and then subsequently thawed, sonicated, and infectious virus titer was determined by standard plaque assay on Vero cell monolayers. Because the compounds were dissolved at 10 mM in 100% DMSO, equivalent dilutions of DMSO were added to additional wells as a control for effects of the diluent. Each experiment was repeated once. EC.sub.50 values were determined as above except that serial dilutions of the compound to be tested were prepared starting at 50 M. The inhibitory values were calculated by non-linear curve-fitting in GraphPad Prism.
[0230] Toxicity Assays.
[0231] Qualitative assessments of cytotoxicity were done visually by inspecting the cells in the primary screening assays. For the quantitative assays, cells were plated in 96-well plates at 1.010.sup.4 per well. The next day the compounds were added at 0.78 to 100 M in a final concentration of 1% (v/v) DMSO, and the cells were incubated for 24 hours under conditions identical to those employed for the viral replication inhibition assays. Mitochondrial toxicity was measured by incubating the cells with 0.25 mg/mL thiazolyl blue tetrazolium bromide (MTT, SigmaAldrich Chemical Co.), the cultures were incubated for 60 min, metabolites were solubilized in acidic isopropanol, and absorbance was read at 570 nm. CC.sub.50 values were calculated by non-linear curve fitting using GraphPad Prism.
[0232] Mouse Liver Microsome Assays.
[0233] Microsomal incubations are run at a final P450 concentration of 0.25 M. The microsomal mixture is composed of 0.1M potassium phosphate containing 3.3 mM MgCl and 1 M compound (final concentration). The mixture is prewarmed for 5 min at 37 C. To initiate the reaction a 12 mM stock of NAPDH (1.2 mM, final concentration) is added to the warmed microsomal mixture and aliquots are removed at 0, 5, 10, 20 and 30 min. Samples are quenched with ice cold acetonitrile containing internal standard and either 1.8 mM EDTA or EGTA (final concentration). Samples are vortexed and spun down at 3200 rpm for 5 min. The supernant is transferred to 96-deep well plates and run on LC/MS/MS.
[0234] RNaseH Expression and Purification.
[0235] Recombinant HBV RNaseH and human RNaseH1 were expressed in E. coli and partially purified by nickel-affinity chromatography as previously described in Tavis, et al. (2013). The enriched extracts were dialyzed into 50 mM HEPES pH 7.3, 300 mM NaCl, 20% glycerol, and 5 mM DTT and stored in liquid nitrogen.
[0236] Oligonucleotide-Directed RNA Cleavage Assay.
[0237] RNaseH activity was measured using an oligonucleotide-directed RNA cleavage assay as previously described in Hu, et al., Tavis, et al., and Cai, et al. (2013; 2013; and 2014, respectfully). Briefly, 6 L protein extract was mixed on ice with an internally .sup.32P-labeled 264 nt RNA derived from the Duck Hepatitis B Virus genome (DRF+ RNA) plus 3 g oligonucleotide D2507- or its inverse-complement oligonucleotide D2526+ as a negative control. This mixture was incubated with test compounds in 50 mM Tris pH 8.0, 190 mM NaCl, 5 mM MgCl.sub.2, 3.5 mM DTT, 0.05% NP40, 6% glycerol, and 1% DMSO at 42 C. for 90 minutes. Cleavage products were resolved by denaturing polyacrylamide gel electrophoresis, detected by autoradiography, and quantified using ImageJ. Non-specific background values were determined from the incorrect oligonucleotide negative control lane and subtracted from all experimental values. IC.sub.50 values were then calculated with GraphPad Prism using three-parameter log(inhibitor) vs. response non-linear curve fitting with the curve minimum set to zero to reflect background subtraction.
[0238] HBV Replication Assay.
[0239] Inhibition of HBV replication was measured in HepDES19 cells as previously described in Cai, et al. (2014). Cells were seeded into 6-well plates and incubated in DMEM/F12, 10% fetal bovine serum (FBS), 1% penicillin/streptomycin (P/S) with 1 g/mL tetracycline. Tetracycline was withdrawn after 24 hours. The test compound was applied to duplicate wells 48 hours later in medium containing a final DMSO concentration of 1%, and medium containing the compound was refreshed daily for the following two days. Cells were harvested and non-encapsidated nucleic acids were digested with micrococcal nuclease (New England Biolabs). HBV DNA was purified from capsids using QIAamp Cador Pathogen Mini Kit (Qiagen) with proteinase K incubation overnight at 37 C. TaqMan PCR was performed for 40 cycles at an annealing temperature of 60 C. Primers and probe (IDT Inc.) for the plus-polarity strand were: 5CATGAACAAGAGATGATTAGGCAGAG3 (SEQ ID NO: 1); 5GGAGGCTGTAGGCATAAATTGG3 (SEQ ID NO: 2); 5/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/3IABkFQ (SEQ ID NO: 3). Primers and probe for the minus-polarity strand were: 5GCAGATGAGAAGGCACAGA3 (SEQ ID NO: 4; 5CTTCTCCGTCTGCCGTT3 (SEQ ID NO: 5); 5/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3IABkFQ (SEQ ID NO: 6).
[0240] MTT Cytotoxicity Assays.
[0241] 1.010.sup.4 HepDES19 cells per well were seeded in 96-well plates and incubated in DMEM with 10% FBS plus 1% P/S, 1% non-essential amino acids, and 1% glutamine. Compounds were diluted in medium to the indicated concentrations plus 1% DMSO and added to cells 24 hours after plating, with each concentration tested in triplicate. Medium containing the compound was refreshed daily for the next two days. Thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich) was added to 0.25 mg/mL, the cultures were incubated for 60 minutes, metabolites were solubilized in acidic isopropanol, and absorbance was read at 570 nM.
[0242] 2. Results
[0243] Compound Selection Strategy.
[0244] This compound was selected based on its structural similarity to polyoxygenated heterocycle compounds with anti-microbial activity. Piroctone olamine (octopirox; #191) is an approved antifungal in Europe. Its structure is shown in
[0245] Primary Screening for Inhibition of HSV-1 and HSV-2 Replication.
[0246] Efficacy of this compound against both HSV-1 and HSV-2 was initially assessed at 50, 5 and 1 M in a semi-quantitative replication inhibition assay. Inhibition was categorized as negligible (<1 log.sub.10 at 50 M relative to the DMSO-treated control), intermediate (1 to 3 log.sub.10 suppression, which equals 10- to 1,000-fold reduction), or strong (3 to 6 log.sub.10 suppression, or 1,000- to 1,000,000-fold reduction). Compound #191 (piroctone olamine or octopirox) showed strong inhibitory activity at 50 and 5 M against HSV-1 and HSV-2 (Table 2). Compound #191 maintained intermediate inhibition of HSV-1 and HSV-2 even at 1 M (Table 2). Thus, it inhibited HSV-1 by 3.61 log.sub.10 (4,074-fold) and HSV-2 by 4.59 log.sub.10 (39,000-fold) at 5 M. For comparison, the approved anti-HSV drug acyclovir inhibited HSV-1 replication in this assay by 4.22 log.sub.10 (16,600-fold) and HSV-2 by only 3.6 log.sub.10 (3,980-fold) at 5 M. Therefore, this polyoxygenated heterocycle compound inhibits both HSV-1 and HSV-2 replication as well as or better than acyclovir.
TABLE-US-00003 TABLE 2 Compound HSV-1 HSV-2 Anti- Number and Log.sub.10 suppression Log.sub.10 suppression human Reference 50 M 5 M 1 M EC.sub.50 50 M 5 M 1 M EC.sub.50 RNase H1 CC.sub.50 #191 (Piroctone 3.85 3.53 2.71 1.57 M 4.25 4.53 1.70 1.53 M >100 olamine) #208 2.63 0.15 0.26 0.11 #211 1.6 0.08 1.81 0.04 Acyclovir 5.39 3.61 nd 0.16 M 5.25 3.91 nd 1.44 M nd >100 nd, not determined.
[0247] Compound Toxicity.
[0248] Visual inspection of the infected cells at the end of the 24 hour infection window through a phase-contrast microscope revealed substantially less cytopathic effect (CPE) than the DMSO-treated control wells without appearance of apoptosis or necrosis.
[0249] A quantitative toxicity measurement was conducted. Toxicity was assessed by measuring release of intracellular proteases into the culture medium due to cellular lysis. Cells were plated in 96-well plates at 1.010.sup.4 per well. The next day compound was added in concentrations ranging from 0.78 to 100 M in a final concentration of 1% (v/v) DMSO. The cells were incubated for 24 hours under conditions identical to those employed for the viral replication inhibition assays, and then mitochondrial activity was measured with the MTT assay (Sigma Aldrich) according to the manufacturer's instructions. Percent viability was determined for each compound concentration from the luminosity data, and then 50% cytotoxic concentration (CC.sub.50) value was calculated by non-linear curve fitting using GraphPad Prism. Consistent with the subjective assessments of toxicity, #191 had a CC.sub.50 value >100 M under these conditions (Table 1). #191 did not inhibit the activity of human RNaseH1 (Table 1), another indicator of low toxicity.
[0250] Quantitative HSV-1 and HSV-2 Replication Inhibition Assays.
[0251] To obtain a more quantitative evaluation of the inhibitory potential of compound #191, EC.sub.50 values were determined against HSV-1 and HSV-2. For HSV-1, the EC.sub.50 value was 0.27 M. For HSV-2, the value was 0.60 M. For comparison, acyclovir had an EC.sub.50 of 0.16 and 1.44 M versus HSV-1 and HSV-2, respectively (Table 1). Overall, these quantitative data confirmed the highly effective inhibition of HSV-1 and HSV-2 by compound #191 in the semi-quantitative assay. They also reinforce the observation that this compound can efficiently inhibit both HSV-1 and HSV-2, and they strengthen the conclusion that the strong inhibitor identified here has equivalent or superior activity against the herpes simplex viruses than the approved drug acyclovir.
[0252] Compound #191 suppressed replication of three primary clinical isolates of HSV-2 by >4.7 log.sub.10 at 5 M (
[0253] Inhibition of an Acyclovir-Resistant HSV-2 Mutant.
[0254] ACV is a nucleoside analog prodrug that must be phosphorylated by the viral thymidine kinase (TK) for it to become a substrate for the viral DNA polymerase (Elion, et al., 1977). HSV TK-deficient mutants are therefore insensitive to ACV. Because viral resistance to ACV and other nucleoside analogs is a significant medical problem (Field and Biron, 1994; Coen, 1991; Wang, et al, 2011; Duan, et al., 2009; Duan, et al., 2008; Pelosi, et al., 1992), especially in immunocompromised patients (Reyes, et al., 2013; Levin, et al., 2004; Gilbert, et al., 2002; Schmit and Boivin, 1999), the inventors considered whether defined TK-deficient mutants of HSV-2 would be sensitive to other compounds such as compound #191. Vero cells were infected with a laboratory strain of HSV-2 and an engineered TK-deficient mutant of the same strain. The cells were treated with 5 M ACV or compound #191 as was done in the primary screening assays, and viral yields 24 hours post-infection were measured by plaque assay. ACV 5 M inhibited wild-type HSV-2 replication 100-fold, but it had little effect on the TK-mutant (
[0255] Therapeutic Implications.
[0256] The high suppressive activities against the herpesviruses observed with this compound (as much as 4.59 log.sub.10 at 5 M) and its minimal short-term toxicity implies that it may be suitable for use as an anti-viral drug. This is especially true for the acute and/or topical therapies most commonly employed for the herpes simplex viruses.
[0257] The structure of this compound and its already proven drugability implies that further improvements in the inhibitory potential against the herpesviruses should be attainable by standard medicinal chemistry approaches.
[0258] Elimination in Mouse Liver Microsomes.
[0259] Table 3 below shows the elimination profile of compounds #191, #41, and #208. The table shows the half life, the intrinsic clearance, the hepatic clearance, extraction ratio, and methods of turnover. Several compounds tested in mouse liver microsomes had long half-lives, low extraction ratios, and no evidence of non-P450 turnover (Table 3), suggesting their capacity to resist rapid degradation and elimination by the liver.
TABLE-US-00004 TABLE 3 Polyoxygen heterocyclic compounds show favorable resistance to elimination in mouse liver microsomes. t CLint CL hep Non-P450 turn- Compound (min) (mL/min/kg) (mL/min/kg) ER over 208 >120 201 163 <0.1 No 41 >120 17 14 0.16 No 191 >120 9 8 0.09 No
[0260] Summary.
[0261] The inventors here demonstrate that a polyoxygenated heterocycle compound profoundly suppresses replication of HSV-1 and HSV-2 with no measurable toxicity in a short-term cell culture assay. Inhibition by this primary screening hit is equal or superior to the approved anti-herpesvirus drug acyclovir, particularly against HSV-2. Thus, the existing compound may already be superior to the drugs that are used for HSV-2 infection, and improved efficacy can readily be envisioned through standard medicinal chemistry approaches. Its structural dissimilarity to the nucleoside analogs implies a novel mode of action, suggesting it would be a good candidate for combination therapy with the existing anti-herpesvirus drugs to improve efficacy of antiviral therapy.
[0262] 3. HBV Activity
[0263] HBV activity of some of the compounds described herein is shown in Table 4 below.
TABLE-US-00005 TABLE 4 HBV Activity Qualitative HBV Compound EC.sub.50 CC.sub.50 replication Number Compound (M) (M) inhibition assay 151
[0264] 4. Synergistic Activity of HBV RNAseH with Nucleoside Analog Drug
[0265] Current nucleos(t)ide analog therapy for HBV has converted hepatitis type B from an implacably progressing illness to a controllable disease. However, patients are only very rarely cured, in part due to the incomplete inhibition of HBV replication. The inventors hypothesized that the novel RNaseH inhibitors would work synergistically with the existing nucleos(t)ide analogs because the two classes of drugs target physically distinct active sites on the viral polymerase protein. Therefore, potential synergy between the RNAseH inhibitors and the nucleoside analog Lamivudine was analyzed using the Chou-Talalay method (Chou 2010). RNAseH inhibitors from two different chemical classes were employed, compound #1 [2-hydroxyisoquinoline-1,3(2H,4H)-dione], an HID, and #46 (3-thujaplicinol), an -hydroxytropolone, were tested. Chou-Talaly analysis yields a combination index (CI). CI values <1.0 indicate synergy, CIs of approximately 1.0 indicate additive interactions, and CI values >1.0 indicate antagonism. CI values are calculated at various efficacy levels (EC.sub.50, EC.sub.75, EC.sub.90, and EC.sub.95), and a weighted CI value favoring higher efficacy levels is also generated.
[0266] 5. RNAseH Inhibitor Sensitivity is Insensitive to High Genetic Variation
[0267] HBV has 8 genotypes differing in sequence by 8%. Genetic diversity in the RNAseH domain is about 6%, which is easily high enough to modulate viral sensitivity to RNAseH inhibitors. Therefore, the inventors tested the RNAseH inhibitors #1 [2-hydroxyisoquinoline-1,3(2H,4H)-dione], an HID, and #46 (-thujaplicinol), an -hydroxytropolone, for the ability to inhibit variant RNAseHs. Twelve purified, patient-derived RNAseH enzymes (4 from each genotypes B, C and D) were tested with the compounds at their respective IC.sub.50 values in a biochemical RNAseH assay.
[0268] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods, and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.
F. REFERENCES
[0269] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference: [0270] Alba et al., Genome Res., 11:43-54, 2001. [0271] Andrei and Snoeck, Curr Opin Infect Dis. 26:551-560, 2013. [0272] Aoki et al., Antimicrob Agents Chemother. 39:846-849, 1995. [0273] Ariyoshi et al., Cell 78:1063-1072, 1994. [0274] Arvin & Gilden, Varicella-Zoster Virus, 2015-2057, 2013. [0275] Balzarini et al., PLoS Pathog. 9:e1003456, 2013. [0276] Bernstein et al., Antiviral Res 92:386-388, 2011. [0277] Billamboz et al., J. Med. Chem. 54:1812-1824, 2011. [0278] Bogner et al., J Virol., 72:2259-2264, 1998. [0279] Bogner, Rev Med Virol., 12:115-127, 2002. [0280] Bokesch et al., J. Nat. Prod. 71, 1634-1636, 2008. [0281] Bortner et al., J Mol Biol. 231:241-250, 1993. [0282] Budihas et al., Nucleic Acids Res. 33, 1249-1256, 2005. [0283] Cai, et al., Antiviral Res., 108:48-55, 2014. [0284] Chen et al., J. Neurovirology 8:204-210, 2002. [0285] Choi et al., Antiviral Res. 55: 279-290, 2002. [0286] Chono et al., J. Antimicrob. Chemother. 65:1733-1741, 2010. [0287] Chou, et al., Cancer Res., 70:440-446, 2010. [0288] Chung et al., J. Med. Chem. 54, 4462-4473, 2011. [0289] Chung et al., Antimicrob. Agents Chemother. 54, 3913-3921, 2010. [0290] Clement et al., Int J Cancer 100:491-498, 2002. [0291] Coen, Antiviral Res, 15:287-300, 1991. [0292] Coen, Viral DNA polymerases, p. 495-523, 1996. [0293] Cohen, The New England journal of medicine 369:255-263, 2013. [0294] Damania & Cesarman, Kaposi's Sarcoma-Associated Herpesvirus, 2080-2128, 2013. [0295] De et al., Curr. Opin. Infect. Dis., 28:589-595, 2015. [0296] Decaro et al., The Veterinary clinics of North America. Small animal practice 38:799-814, viii, 2008. [0297] Derse et al., J Biol Chem, 257:10251-10260, 1982. [0298] Di et al., Bioorg. Med. Chem. Lett. 20, 398-402, 2010. [0299] Didierjean et al., Antimicrob. Agents Chemother. 49, 4884-4894, 2005. [0300] Drew et al., Clin Diagn Virol. 1:179-185, 1993. [0301] Drew et al., J Infect Dis. 179:1352-1355, 1999. [0302] Drew et al., Am J Transplant 1:307-312, 2001. [0303] Dolan et al., J Virol 72:2010-2021, 1998. [0304] Duan et al., J Infect Dis, 200:1402-1414, 2009. [0305] Duan, et al. J Infect Dis, 198:659-663, 2008. [0306] Dyda et al., Science 266:1981-1986, 1994. [0307] Eberhard et al., Blood 114:3064-3073, 2009. [0308] Elion et al., Proc Natl Acad Sci USA, 74:5716-5720, 1977 [0309] Fenner et al., Veterinary Virology, 2 ed. Academic Press, 1993. [0310] Field and Biron, Clin Microbiol Rev, 7:1-13, 1994. [0311] Field and Vere Hodge, Br Med Bull. 106:213-249, 2013. [0312] Fortier et al., Veterinary J. 186:148-156, 2010. [0313] Frank et al., Biol. Chem. 379:1407-1412, 1998. [0314] Frank et al., Proc. Natl. Acad. Sci. USA 95:12872-12877, 1998. [0315] Freed et al., HIVs and their replication, in: Knipe, D. M., Howley, P. M., Griffin, D. E., Lamb, R. A., Martin, M. A., Roizman, B., Straus, S. E. (Eds.), FIELDS VIROLOGY. Lippincott Williams & Wilkins, Philadelphia, pp. 2107-2185, 2007. [0316] Fuji et al., J. Med. Chem. 52, 1380-1387, 2009. [0317] Gao et al., Virology 249:460-470, 1998. [0318] Gaskell et al., Feline herpesvirus. Veterinary research 38:337-354, 2007. [0319] Gerelsaikhan et al., J. Virol. 70, 4269-4274, 1996. [0320] Gilbert et al., Canadian journal of public health=Revue canadienne de sante publique, 2011. [0321] Gilbert, et al., Drug Resist Updat, 5:88-114, 2002. [0322] Gimeno, Vaccine 26 Suppl 3:C31-41, 2008. [0323] Goedken et al., J. Biol. Chem. 276, 7266-7271, 2001. [0324] Hanauske-Abel et al., PloS One 8:e74414. doi: 10.1371, 2013. [0325] Hanel et al., Mycoses 34 Suppl 1:91-93, 1991. [0326] Hanson et al., Viruses 3(11): 2160-2191, 2011. [0327] Higaki et al., Cornea 25(10 Suppl 1):S64-67, 2006. [0328] Himmel et al., ACS Chem. Biol. 1:702-712, 2006. [0329] Himmel et al., Structure 17: 1625-1635, 2009. [0330] Hirari, Current Topics in Microbiology and Immunology: Marek's Disease, 2001. [0331] Hoffman et al., Cytometry 12:26-32, 1991. [0332] Horowitz et al., Journal of American college health: J of ACH 59:69-74, 2011. [0333] Hostomsky et al., Nulceases, vol. 2, 1993b. [0334] Hostomsky et al., Ribonuclease H, in: Linn, S. M., Lloyd, R. S., Roberts, R. J. (Eds.), Nulceases. Cold Spring Harbor Laboratory Press, Plainview, N. Y., pp. 341-376, 1993a. [0335] Hostomsky et al., Structure 3:131-134, 1993c. [0336] Hu et al., Antiviral Res 99:221-229, 2013. [0337] Hwang and Bogner, J Biol Chem., 277:6943-6948, 2002. [0338] Imai et al., J Infect Dis. 189:611-615, 2004. [0339] James et al., Antiviral Res 83:207-213, 2009. [0340] Johnston et al., Lancet 379:641-647, 2012. [0341] Kamali et al., Sexually transmitted infections 75:98-102, 1999. [0342] Katayanagi et al., Nature 347: 306-309, 1990. [0343] Keck et al., J. Biol. Chem. 273, 34128-34133, 1998. [0344] Kim et al., In Vivo 25:887-893, 2011. [0345] Kimberlin, Seminars in perinatology 31:19-25, 2007. [0346] Kirschberg et al., J. Med. Chem. 52:5781-5784, 2009. [0347] Klarmann et al., AIDS Rev 4: 183-194, 2002. [0348] Klumpp et al., Nucleic Acids Res. 31, 6852-6859, 2004. [0349] Klumpp and Mirzadegan, Curr. Pharm. Des 12:1909-1922, 2006. [0350] Knipe and Spang J Virol, 43:314-324, 1982. [0351] Ko et al., PLoS One 6:e27844. doi: 10.1371, 2011. [0352] Komatsu et al., Antiviral Res 101:12-25, 2014. [0353] Korom et al., J Virol, 87:5882-5894, 2013. [0354] Kwun et al., J. Gen. Virol. 82, 2235-2241, 2001. [0355] Lai et al., Structure 8:897-904, 2000. [0356] Levin et al., Clin Infect Dis, 39 Suppl 5:S248-257, 2004. [0357] Li et al., Mol. Biol. Evol. 12:657-670, 1999. [0358] Lima et al., Methods Enzymol. 341:430-440, 2001. [0359] Linden et al., Faseb J., 17:761-763, 2003. [0360] Liu et al., J. Biol. Chem. 281:18193-18200, 2006. [0361] Longnecker et al., Epstein-Barr Virus, 1898-1959, 2013. [0362] Looker, et al., Bull. World Health Organ., 86:805-812, A, 2008. [0363] Lu, et al., Antimicrob. Agents Chemother., 59(2):1070-1079, 2015. [0364] Luzuriaga & Sullivan, N Eng J Med. 362:1993-2000, 2010. [0365] Manicklal et al., Clinical Microbiology Rev. 26:86-102, 2013. [0366] Marcellin et al., N. Engl. J. Med. 359: 2442-2455, 2008. [0367] Marchand, Tchesnokov, and Gotte. J Biol Chem 282: 3337-3346, 2007. [0368] Marfori et al., J Clin Virol. 38:120-5, 2007. [0369] Masaoka, et al., Biochemistry, 55(5):809-819, 2016. [0370] McDermott et al., J Virol, 51:747-753, 1984. [0371] Mettenleiter et al., Virus Res. 143:222-234, 2009. [0372] Mohni et al., J. Virol. 85:12241-12253, 2011. [0373] Morfin and Thouvenot, J Clin Virol., 26:29-37, 2003. [0374] Morrison and Knipe, Virology, 220:402-413, 1996. [0375] Nakagawa and Tayama, Chem Biol Interact, 116:45-60, 1998. [0376] Nandi et al., Animal health research reviews/Conference of Research Workers in Animal, 2009. [0377] Nauwynck et al., Veterinary Res. 38:229-241, 2007. [0378] Nimonkar and Boehmer, J Biol Chem. 278:9678-9682, 2003. [0379] Nowotny et al., Cell 121: 1005-1016, 2005. [0380] Nowotny, EMBO Rep. 10:144-151, 2009. [0381] Obasi et al., J. Infectious Dis. 179:16-24, 1999. [0382] Parker et al., EMBO J. 23: 4727-4737, 2004. [0383] Pellet & Roizman, Herpesviridae 1802-1822, 2013. [0384] Pelosi et al., Adv Exp Med Biol, 312:151-158, 1992. [0385] Pena et al., J. Clin. Microbiol. 48:150-153, 2010. [0386] Popovic et al., J. Thrombosis Thrombolysis 33:160-172, 2012. [0387] Potenza et al., Protein Expr. Purif 55: 93-99, 2007. [0388] Quenelle et al., Antivir Chem Chemother 22:131-137, 2011. [0389] Quinlan et al., Cell 36:857-868, 1984. [0390] Reyes et al., Arch Intern Med, 163:76-80, 2003. [0391] Roizman et al., Herpes Simplex Viruses, 1823-1897, 2013. [0392] Rosen et al., Int J Dermatol., 36:788-792, 1997. [0393] Scheffczik et al., Nucleic Acids Res., 30:1695-1703, 2002. [0394] Schmit and Boivin, J Infect Dis, 180:487-490, 1999. [0395] Scholz et al., Nucleic Acids Res., 31:1426-1433, 2003. [0396] Schumacher et al., PLoS Pathog. 8:e1002862, 2012. [0397] Sehgal, Br J Dermatol. 95:83-88, 1976. [0398] Selvarajan et al., J. Virol. 87:7140-7148, 2013. [0399] Semenova et al., Mol. Pharmacol. 69:1454-1460, 2006. [0400] Shaw-Reid et al., J. Biol. Chem. 278, 2777-2780, 2003. [0401] Smith & Roberts, J. ACH 57:389-394, 2009. [0402] Smith et al., J. Virol. 68, 5721-5729, 1994. [0403] Smith, Veterinary J. 153:253-268, 1997. [0404] Snydman, Clin Infect Dis. 47:883-884, 2008. [0405] Song et al., Science 305: 1434-1437, 2004. [0406] Su et al., J. Virol. 84:7625-7633, 2010. [0407] Takada et al., J. Nat. Prod. 70, 1647-1649, 2007. [0408] Tavis and Lomonosova, Antiviral Res., 118:132-138, 2015. [0409] Tavis et al., PLoS Pathogens 9:e1003125, 2013. [0410] Tavis, et al., Antimicrobial Agents and Chemotherapy, 58(12):7451-7461, 2014. [0411] Tyring et al., J. Infect. Dis. 205:1100-1110, 2012. [0412] Wald et al., N Engl J Med. 370:201-210, 2014. [0413] Wang et al., J. Virol. 79:14079-14087, 2005. [0414] Wang et al., J Clin Virol, 52:107-112, 2011. [0415] Weizman & Weller, Interactions between HSV-1 and the DNA damage response, p. 257-268, 2011. [0416] Weller & Coen, Cold Spring Harbor Perspectives in Biology 4:a013011, 2012. [0417] Weller and Kuchta, Expert Opin Ther Targets, 17:1119-1132, 2013. [0418] Wendeler et al., ACS Chem. Biol. 3, 635-644, 2008. [0419] Williams et al., Bioorg. Med. Chem. Lett. 20:6754-6757, 2010. [0420] Xu et al., JAMA 296:964-973, 2006. [0421] Yamanishi et al., Human Herpesviruses 6 and 7, p. 2058-2079, 2013. [0422] Yan et al., MBio 5:e01318-14, 2014. [0423] Yang et al., Science 249: 1398-1405, 1990. [0424] Yang and Steitz, Structure, 3, 131-134, 1995. [0425] Yao et al., Antimicrob Agents Chemother. 58:2807-2815, 2014. [0426] Zhou et al., Int J Cancer 127:2467-2477, 2010. [0427] Zhou et al., J Virol. 88:11121-11129, 2014. [0428] Zhu et al., J. Virol. 84:7459-7472, 2010.