Septoria Resistance in Celery

Abstract

The present invention relates to Apium graveolens plants being resistant to one or more genomically encoded resistances to the plant pathogen Septoria apiicola. Specifically the present invention relates to Apium graveolens plants wherein at least one genomically encoded resistance to the plant pathogen Septoria apiicola is the genomically encoded resistance to the plant pathogen Septoria apiicola as present in deposit NCIMB 42711. The present invention further relates to hybrids containing the present Septoria apiicola resistance and agents, as molecular markers, suitable for detecting the present invention.

Claims

1. An Apium graveolens plant comprising one or more genomically encoded resistances against the plant pathogen Septoria apiicola.

2. The Apium graveolens plant according to claim 1, wherein at least one genomically encoded resistance against the plant pathogen Septoria apiicola is the genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711.

3. The Apium graveolens plant according to claim 1, wherein said plant comprises in its genome at least one sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17.

4. The Apium graveolens plant according to claim 1, wherein said plant comprises in its genome at least one sequence selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.

5. The Apium graveolens plant according to claim 1, wherein said plant comprises in its genome at least one sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17 and at least one sequence selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.

6. The Apium graveolens plant according to claim 1, wherein at least one genomically encoded resistance against the plant pathogen Septoria apiicola is obtained, or derived, from deposit NCIMB 42711.

7. The Apium graveolens plant according to claim 1, wherein the plant is selected from the group consisting of A. graveolens var. secalinum, A. graveolens var. dulce, and Apium graveolens var. rapaceum.

8. The Apium graveolens plant according to claim 1, wherein the plant is cytoplasmic male sterile.

9. A hybrid celery or celeriac obtained by crossing Septoria apiicola susceptible celery or celeriac with an Apium graveolens plant according to claim 1.

10. A hybrid celery or celeriac obtained by crossing a Septoria apiicola susceptible celery or celeriac with deposit NCIMB 42711.

11. A method for identifying a genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711,14comprising the step of detecting the genomically encoded resistance using one or more molecular markers.

12. The method according to claim 11, wherein the one or more molecular markers are selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17.

13. The method according to claim 11, wherein the one or more molecular markers are selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.

14. The method according to claim 11, wherein the one or more molecular markers are two or more markers, and wherein a first marker of the one or more molecular markers is selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17 and a second marker of the one or more molecular markers is selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.

15. Seeds or plant parts of a plant according to claim 1.

16. Seeds capable of providing a hybrid plant according to claim 9.

17. (canceled)

Description

FIGURES

[0038] FIGS. 1 to 3: show photographs of representative plants according to the present invention. [0039] These photographs were taken on one test location with natural infection with Septoria apiicola. [0040] Specifically, FIG. 1 shows an overview of material grown from the deposit seeds, with affected susceptible plants in the background, FIG. 2 shows healthy unaffected leaf stalks of material grown from the deposit seeds and FIG. 3 shows healthy, unaffected leaves of material grown from the deposit seeds.

EXAMPLES

Example 1

General Protocol for Assessing Resistance

[0041] The pathogen Septoria apiicola is kept on dry, infected leaves at 4 C. To prepare an inoculum, a layer of leaves of about 3-4 cm thick is put on filter paper in a plastic container of 21*15*2.5 cm; these leaves are wetted by spraying water until they are completely wet (not soaked). These containers are closed and put under light for three days; after this period leaves are washed with 0.5 liter of water. Spore concentration is not determined since Septoria apiicola spores are too small; the presence of the spores is only confirmed by microscopy. The inoculum can be used directly but can be stored for up to 6 hours at 4 C.

[0042] Per genotype to be tested, 40 plants were assessed in two replicates. As susceptible control varieties Tango and/or Golden Spartan were used. For tests in the Netherlands, seeds were sown at the end of May or beginning of June; emerged plants are grown further in the field with a distance of 50*20 cm for celery or 50*35 cm for celeriac.

[0043] Inoculation is performed from the beginning of August; depending on conditions this inoculation has to be repeated, preferably under wet or drizzling conditions. To inoculate, infected leaves are spread in the crop or the spore suspension is dispersed using an ultra-low volume or droplet sprayer.

[0044] Tests in other parts of the world can also be performed provided the inoculation is done under circumstances with high relative humidity and moderate temperatures.

[0045] To assess the level of damage to the leaves, a score is made on a scale of 0 (completely affected) to 9 (no symptoms). When the plant stands longer, symptoms increase.

[0046] Damage is scored visually for leaves and stalks. For both celery and celeriac, a crop without any symptoms on leaves and/or leafstalks is highly preferred.

Example 2

As Second Example is Described how Disease Rresistance is Assessed Under Field Circumstances in Guatemala

[0047] In contrast to the Netherlands, the test location is on an altitude of 1300-1500 meters above sea level. This temperate area is characterized by a wet season (from mid-May until the end of October) where there is enough rainfall (total about 1100 mm) and, due to the low temperatures at night, relative humidity is high. Daytime temperature ranges from 15 to 25 C.; night temperature from 9 to 14 C. During the rainy season, this results every night in a long wet leaf period (WLP) which is important for development of S. apiicola on the crop. These favorable conditions are very predictable resulting in good annual disease tests.

Example 3

Results of Assessment for Resistance Against Septoria apiicola

[0048]

TABLE-US-00001 Score for S.a. in NL Score for S.a. in GT Cultivar Inoculated test Natural infection Any susceptible variety (e.g. 1-2 1-2 Tango, Golden Spartan) Deposit NCIMB 42711 6 6-8

[0049] The assessment of resistance is scored on a scale from 0 to 9, where 0 is completely susceptible and 9 is high resistant.

Example 4

Production of F1 Seed Applying CMS

[0050] One of the requisites for a modern hybrid variety is that inbreeding, resulting in off type plants, is minimized. In celery, a reliable system for hybrid production is available based on cytoplasmic male sterility. Applying this feature for seed production with male and female parent lines, hybrids essentially are resulting 100% from pure cross pollinations.

Example 5

Genomically Encoded Resistance Against Septoria apiicola in Apium graveolens Plant

[0051] The genomic analysis of the Septoria apiicola resistant Apium graveolens plants has shown QTLs on linkage group 1 (LG1) and/or linkage group 9 (LG9). These QTLs are defined by the SNP markers listed in the table below.

TABLE-US-00002 Sequence(SNPnucleotideishighlightedbold Geneticposition andunderlined,firstnucleotideisofthe SEQIDNo. (linkagegroup,cM) resistantalleleandsecondofthesusceptibleone) SEQIDNo.1/2 LG01,59.195 CGAACCCGAAACCTAAAGCTCAACAA[C/A]CACCAGTGCCAATGCCA CCATCAC SEQIDNo.3/4 LG01,60.618 CTTCCTTTCAGTTGAGCTGGATACAA[T/G]AGCATCTGGATTAACCAC ACCAAC SEQIDNo.5/6 LG01,60.861 TAAAAAAAGAAAAAGAAGAGGAACAA[C/T]AACACACAATTCTATCA TTAAACT SEQIDNo.7/8 LG01,61.580 AATGATCAATCGTAGGTTGTATTGCT[T/C]GAACATGCCCTTACATGC ATAGAA SEQIDNo.9/10 LG01,61.892 CGAACCTCCTCTAAACTCTCTCCGCC[T/A]ATCCCAACAACCCCAACAA ACTCC SEQIDNo.11/12 LG01,62.187 GCTGTAGCACTGATACTACACCATCA[G/T]GCTCTTGATAKAGAGAGT TCTTTG SEQIDNo.13/14 LG01,62.187 TCCATTCTTCCACTTCTCAACAATGC[C/A]GGATCAAGTTTCTCTACAT GATTA SEQIDNo.15/16 LG01,62.501 GATATTGGGTCAGGGTGAGAACAAGC[T/C]AGCCCAACCAGTAACAC TCTCCTC SEQIDNo.17/18 LG01,63.110 AGTTCTAGCCTGCTACTTGCTACTCT[G/C]CTACTCAGAAGCAGAGGC GTCCGA SEQIDNo.19/20 LG09,112.525 GATTTTTGAGCTAAAAGAATTGCTGT[T/C]TGTTTGAGATGTTACATA CAAAAA SEQIDNo.21/22 LG09,113.396 TGCATCCATTAGCAACGACAACCCTG[C/T]GCTAGTTTCATGTGTTGA TGATGA SEQIDNo.23/24 LG09,115.647 ATTTCTCCATACAGATGGCATTCTTT[T/C]GAGTTGATAMTATACAGT GCAGCC SEQIDNo.25/26 LG09,116.512 AAAGGTTATCGTCAAGTACTTCAAAT[G/C]TTTCCTCTCTTGACAAAA AGATYA
Example of Pedigree, Leading to the Described Hybrid with High Level of Resistance to Septoria Apiicola.

[0052] In intermediate years plants were field-tested for their level of resistance.

TABLE-US-00003 Year Parent 1 Parent 2 Harvested as Seedlot # 1987 Blevo Afina J7071 5 plants for selfing 1995 J7071-M V6747 =new backcross with source (mix of plants) 1987 Blevo Afina J7071 1989 J7071-M selfed n.a. L5987 1990 Summit L5687-2 P6 1992 P6-6 selfed n.a. R6352 1995 SumSepBlev R6352-7 V6729 1998 V6747 V6729 Y6779 2000 Y6779-18 selfed n.a. A15898 2002 A30599 A15898-6 E16504 2004 E16504 F2 n.a. G1209 2005 G46052 G1209 K50419 testcross made 2008 K50419 F1 n.a. N5092 087137 2010 N5092-2 selfed n.a. R16157 2014 S444 (=N5092-2) n.a. S444-3 renamed Gisep28 2015 S444-3 Retest in the field; fixed parentline 2016 PremA3-2 Gisep28-1 1520725 Hybrid, deposit

Deposit Information

[0053] A sample of A. graveolens 1520725 with resistance to Septoria apiicola as described herein was deposited at the NCIMB (National Collections of Industrial, Food and Marine Bacteria (NCIMB), NCIMB Limited, Ferguson Building; Craibstone Estate, Bucksburn Aberdeen, Scotland, AB21 9YA United Kingdom) on Jan. 6, 2017 under number NCIMB 42711.

REFERENCE

[0054] 1. Plant Cell, Tissue and Organ Culture: 39, (3) 203-210 (1994)