PRODUCTION OF CAROTENOIDS AND APOCAROTENOIDS
20190367928 ยท 2019-12-05
Inventors
Cpc classification
C12Y113/11063
CHEMISTRY; METALLURGY
C12Y113/11051
CHEMISTRY; METALLURGY
C12P23/00
CHEMISTRY; METALLURGY
C12P5/026
CHEMISTRY; METALLURGY
C12N9/0069
CHEMISTRY; METALLURGY
C12Y113/11068
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12P23/00
CHEMISTRY; METALLURGY
Abstract
A method for producing a carotenoid or apocarotenoid is disclosed. The method comprises the step of expressing in a host cell an expression module comprising an expression vector having a coding region encoding at least one optimised carotenoid or apocarotenoid generating enzyme, the coding region being operably linked to a promoter. A host cell comprising an expression vector having a coding region encoding at least one optimised carotenoid or apocarotenoid generating enzyme, the coding region being operably linked to a promoter is also provided together with a kit.
Claims
1.-53. (canceled)
54. A method for producing a carotenoid or apocarotenoid comprising the step of expressing in a host cell an expression module comprising an expression vector having a coding region encoding at least one optimized apocarotenoid or carotenoid generating enzyme, the coding region being operably linked to a promoter.
55. The method as claimed in claim 54, wherein the carotenoid is selected from phytoene, lycopene, -carotene, -carotene, -carotene, -carotene or -carotene and wherein the apocarotenoid is selected from -ionone, -ionone, pseudo-ionone (or psi-ionone), hydroxy-ionone, -cyclocitral, trans-geranylacetone, 6-methyl-5-hepten-2-one (MHO), retinal, retinol, 8,10-diapocarotene-8,10-dial (C17) or 10,6-diapocarotene-10,6-dial (C19).
56. The method as claimed in claim 54, wherein said at least one optimised carotenoid or apocarotenoid generating enzyme is selected from crtY, CCD1, CCD2, CCD4, BCDO, LcyE, blh or ybbO, optionally wherein said CCD2 is selected from CaCCD2 or CsCCD2; optionally wherein said CCD4 is selected from the group consisting of AtCCD4, BoCCD4b, CmCCD4, CsCCD4a, MaCCD4, MdCCD4, OfCCD4, PpCCD4, RdCCD4 and VvCCD4a.
57. The method as claimed in claim 54, wherein the apocarotenoid is -ionone and wherein said at least one optimized apocarotenoid generating enzyme is selected from LcyE and CCD1, and form an operon having the structure: LcyE-CCD1; optionally wherein said LcyE is derived from Lactuca sativa and is N-terminal truncated (ranging from 1 to 100 amino acids of LsLcyE, especially N50-LsLcyE); optionally wherein said CCD1 is expressed as a fusion protein selected from TrxA-CCD1, SUMO-CCD1 or MBP-CCD1; optionally wherein the fusion protein is TrxA-CCD1; optionally wherein the fusion protein is selected from TrxA-Osmanthus fragrans CCD1 or TrxA-Petunia hybrid CCD1; optionally wherein the CCD1 is derived from or Osmanthus fragrans (OfCCD1) and comprise one or more of the following mutations: N154Y, M152T, L151F; optionally comprising screening for an expression level of -ionone in an amount of up 100-1000 mg/L in a 24 hour period.
58. The method as claimed in claim 54, wherein the apocarotenoid is -ionone and wherein said at least one optimized apocarotenoid generating enzyme is selected from crtY and CCD1, and form an operon having the structure crtY-CCD1; optionally wherein said CCD1 is derived from Petunia hybrida (PhCCD1); optionally wherein said crtY is derived from Pantoea ananatis; optionally further comprising screening for an expression level of -ionone in an amount of up 10-1000 mg/L in a 24 hour period.
59. The method as claimed in claim 54, wherein the apocarotenoid is retinal and wherein said at least one optimized apocarotenoid generating enzyme is selected from crtY and blh, and form an operon having the structure crtY-blh; optionally wherein said crtY is derived from Pantoea ananatis; optionally wherein said blh is derived from Uncultured marine bacterium HF10_19P19; optionally further comprising screening for an expression level of retinal in an amount of up 10-1000 mg/L in a 24 hour period.
60. The method as claimed in claim 54, wherein the carotenoid is & carotene and wherein said at least one optimized carotenoid generating enzyme is LcyE; optionally wherein said LcyE is derived from Lactuca sativa and is N-terminal truncated (N50-LsLcyE); optionally further comprising screening for an expression level of -carotene in an amount of up 10-1000 mg/L in a 24 hour period.
61. The method as claimed in claim 54, wherein the carotenoid is phytoene; optionally further comprising screening for an expression level of phytoene in an amount of up 10-1000 mg/L in a 24 hour period.
62. The method of claim 54, further comprising expressing in said host cell: a first expression module comprising an expression vector having a first coding region encoding one or more optimized first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having second coding region encoding one or more optimized second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimized third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter; optionally wherein said one or more first gene products form an operon having the structure: atoB-hmgS-thmgR; optionally wherein said one or more first gene products form an operon having the structure: crtY-atoB-hmgS-thmgR; optionally wherein said one or more second gene products form an operon having the structure: mevK-pmk-pmd-idi; optionally wherein said one or more third gene products form an operon having the structure: crtE-crtB-ispA; optionally wherein said one or more third gene products form an operon having the structure: crtE-crtB-crtI-ispA.
63. The method of claim 54, wherein the host cell is Escherichia coli selected from BL21 DE3 or MG1655 DE3.
64. The method as claimed in claim 54, wherein the promoter is selected from one or more of TM1, TM2 or TM3, T7 RNA polymerase promoter, a T5 RNA polymerase promoter, a T3 RNA polymerase promoter, an SP6 RNA polymerase promoter or an inducible promoter.
65. The method as claimed in claim 54, wherein the optimization of the apocarotenoid generating enzymes and optimized gene products is achieved by codon optimisation or site-directed mutagenesis.
66. A host cell comprising an expression module comprising expression vector having a coding region encoding at least one optimized apocarotenoid or carotenoid generating enzyme, the coding region being operably linked to a promoter.
67. The host cell as claimed in claim 66, wherein said at least one optimized apocarotenoid generating enzyme is selected from crtY, CCD1, CCD2, CCD4, BCDO, LcyE, blh or ybbO.
68. The host cell as claimed in claim 67, wherein the optimized gene products are selected from the group consisting of N50-LsLcyE and TrxA-Osmanthus fragrans CCD1; crtY and phCCD1; N50-LsLcyE; crtY and blh, and crtY, blh and ybbO.
69. The host cell as claimed in claim 68, wherein the Osmanthus fragrans CCD1 comprises one or more of the following mutations: N154Y, M152T, L151F.
70. The host cell as claimed in claim 69, further comprising: a first expression module comprising an expression vector having a first coding region encoding one or more optimized first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having a second coding region encoding one or more optimized second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimized third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter.
71. The host cell as claimed in claim 70, wherein the host cell is Escherichia coli selected from BL21 DE3 or MG1655 DE3.
72. A system for producing a carotenoid or apocarotenoid comprising an expression module comprising an expression vector having a coding region encoding at least one optimized carotenoid or apocarotenoid generating enzyme, the coding region being operably linked to a promoter, wherein said at least one optimized carotenoid or apocarotenoid generating enzyme is selected from: a. N50-LsLcyE and TrxA-Osmanthus fragrans CCD1 for the production of -ionone; or b. crtY and phCCD1 for the production of -ionone; or c. N50-LsLcyE for the production of -carotene; or d. crtY and blh for the production of retinal; or e. crtY, blh and ybbO for the production of retinol.
73. The system as claimed in claim 72, further comprising: a first expression module comprising an expression vector having a first coding region encoding one or more optimized first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having second coding region encoding one or more optimized second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimized third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0039] In a first aspect the present invention refers to a method for producing a carotenoid or apocarotenoid. The method comprises the step of expressing in a host cell an expression module comprising an expression vector having a coding region encoding at least one optimised carotenoid or apocarotenoid generating enzyme, the coding region being operably linked to a promoter.
[0040] The carotenoid may be selected from phytoene, lycopene, -carotene, -carotene, -carotene, -carotene or -carotene and wherein the apocarotenoid may be selected from -ionone, -ionone, pseudo-ionone (or psi-ionone), hydroxy-ionone, -cyclocitral, trans-geranylacetone, 6-methyl-5-hepten-2-one (MHO), retinal, retinol, 8,10-diapocarotene-8,10-dial (C17) or 10,6-diapocarotene-10,6-dial (C19).
[0041] The lycopene cyclase may be selected from lycE or crtY or their truncated forms.
[0042] The at least one optimised apocarotenoid generating enzyme, as described herein, may be selected from crtY, CCD1, CCD2, CCD4, BCDO, LcyE, blh or ybbO.
[0043] The CCD2 may be selected from CaCCD2 or CsCCD2. The CCD4 may be selected from the group consisting of AtCCD4, BoCCD4b, CmCCD4, CsCCD4a, MaCCD4, MdCCD4, OfCCD4, PpCCD4, RdCCD4 and VvCCD4a.
[0044] In one embodiment, the apocarotenoid may be -ionone and the at least one optimised apocarotenoid generating enzyme may be selected from LcyE and CCD1, and may form an operon having the structure: LcyE-CCD1.
[0045] In some embodiments, the LcyE may be derived from Lactuca sativa and is N-terminal truncated (ranging from 1 to 100 amino acids of LsLcyE, especially N50-LsLcyE).
[0046] The CCD1 may be expressed as a fusion protein selected from TrxA-CCD1, SUMO-CCD1 or MBP-CCD1.
[0047] In some embodiments, the fusion protein is TrxA-CCD1. The fusion protein may be selected from TrxA-Osmanthus fragrans CCD1 or TrxA-Petunia hybrid CCD1.
[0048] In some embodiments, the CCD1 may be derived from or Osmanthus fragrans (OfCCD1). In some embodiments, the OfCCD1, as described herein, may be optimized between amino acid positions F148 to 1167. In particular, the OfCCD1 may comprise one or more of the following mutations: N154Y, M152T, L151F.
[0049] In some embodiments, the method may comprise screening for an expression level of -ionone in an amount of from 10 to 1000 mg/L; from 200 to 800 mg/L; from 300 to 700 mg/L; from 400 to 600 mg/L in a 24 hour period. In some embodiments, the amount of -ionone is about 500 mg/L in a 24 hour period.
[0050] In some embodiments, the apocarotenoid is -ionone. The at least one optimised apocarotenoid generating enzyme may be selected from crtY and CCD1, and may form an operon having the structure crtY-CCD1. In some embodiments, the crtY as described herein may be derived from Pantoea ananatis.
[0051] In some embodiments, the CCD1 as described herein may be derived from Petunia hybrida (PhCCD1).
[0052] In some embodiments, the method may further comprise screening for an expression level of -ionone in an amount of from 10 to 1000 mg/L; from 200 to 800 mg/L; from 300 to 700 mg/L; from 400 to 600 mg/L in a 24 hour period. In some embodiments, the amount of -ionone is about 500 mg/L in a 24 hour period.
[0053] The apocarotenoid may be retinal or retinol. In one embodiment, the apocarotenoid may be retinal. The at least one optimised apocarotenoid generating enzyme may be selected from crtY and blh, and may form an operon having the structure crtY-blh. In some embodiments, the apocarotenoid may be retinol. The at least one optimised apocarotenoid generating enzyme may be selected from crtY, blh or ybbO, and may form an operon having the structure crtY-blh-ybbO. In some embodiments, the crtY as described herein may be derived from Pantoea ananatis. In some embodiments, the blh as described herein may be derived from Uncultured marine bacterium HF10_19P19. In some embodiments, the method may further comprise screening for an expression level of retinal in an amount of from 10 to 1000 mg/L; from 200 to 800 mg/L; from 300 to 700 mg/L; from 400 to 600 mg/L in a 24 hour period. In some embodiments, the amount of -ionone is about 500 mg/L in a 24 hour period.
[0054] The carotenoid may be -carotene. The at least one optimised carotenoid generating enzyme may be LcyE. In some embodiments, the LcyE may be derived from Lactuca sativa (LsLcyE) and may be N-terminal truncated. In some embodiments, the LsLcyE may comprise an N-terminal truncation of from 1-100 amino acids; from 30-70 amino acids or from 40-60 amino acids. In some embodiments, the LsLcyE comprises an N-terminal truncation of 50 amino acids (N50-LsLcyE).
[0055] In some embodiments, the method may further comprise expressing in said host cell: a first expression module comprising an expression vector having a first coding region encoding one or more optimised first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having second coding region encoding one or more optimised second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimised third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter.
[0056] In some embodiments, the one or more first gene products may form an operon having the structure: atoB-hmgS-thmgR.
[0057] In some embodiments, the one or more first gene products may form an operon having the structure: crtY-atoB-hmgS-thmgR.
[0058] In some embodiments, the one or more second gene products may form an operon having the structure: mevK-pmk-pmd-idi.
[0059] In some embodiments, the one or more third gene products may form an operon having the structure: crtE-crtB-ispA.
[0060] In some embodiments, the one or more third gene products may form an operon having the structure: crtE-crtB-crtI-ispA.
[0061] The host cell as described herein may be Escherichia coli selected from BL21 DE3 or MG1655 DE3.
[0062] The promoter may be selected from one or more of TM1, TM2 or TM3, T7 RNA polymerase promoter, a T5 RNA polymerase promoter, a T3 RNA polymerase promoter, an SP6 RNA polymerase promoter or an inducible promoter.
[0063] In some embodiments, the optimisation of the apocarotenoid generating enzyme and optimised gene products is achieved by codon optimization or site-directed mutagenesis.
[0064] In another aspect, there is provided a host cell comprising an expression module comprising expression vector having a coding region encoding at least one optimised apocarotenoid or carotenoid generating enzyme, the coding region being operably linked to a promoter.
[0065] In some embodiments, the at least one optimised apocarotenoid generating enzyme may be selected from crtY, CCD1, CCD2, CCD4, BCDO, LcyE, blh or ybbO.
[0066] The host cell may further comprise a first expression module comprising an expression vector having a first coding region encoding one or more optimised first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having a second coding region encoding one or more optimised second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimised third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter.
[0067] In another aspect, there is provided a vector encoding one or more optimised gene products selected from atoB, hmgS, thmgR and optionally crtY operably linked to a promoter.
[0068] In another aspect, there is provided a vector encoding one or more optimised gene products selected from mevK, pmk, pmd or idi operably linked to a promoter.
[0069] In another aspect, there is provided a vector encoding one or more optimised gene products selected from ispA, crtE, crtB or crtI operably linked to a promoter.
[0070] In another aspect, there is provided a vector encoding one or more optimised gene products selected from crtY, CCD1, BCDO, LcyE, blh or ybbO operably linked to a promoter.
[0071] In some embodiments, the optimised gene products may be selected from the group consisting of N50-LsLcyE and TrxA-Osmanthus fragrans CCD1; crtY and phCCD1; N50-LsLcyE; crtY and blh, and crtY, blh and ybbO.
[0072] In another aspect, there is provided a system for producing an carotenoid or apocarotenoid comprising an expression module comprising an expression vector having a coding region encoding at least one optimised carotenoid or apocarotenoid generating enzyme, the coding region being operably linked to a promoter, wherein said at least one optimised carotenoid or apocarotenoid generating enzyme is selected from: a. N50-LsLcyE and TrxA-Osmanthus fragrans CCD1 for the production of -ionone; or b. crtY and phCCD1 for the production of -ionone; or c. N50-LsLcyE for the production of -carotene; or d. crtY and blh for the production of retinal or retinol; ore. crtY, blh and ybbO for the production of retinol.
[0073] In some embodiments, the system may further comprise: a first expression module comprising an expression vector having a first coding region encoding one or more optimised first gene products selected from atoB, hmgS, thmgR and optionally crtY, the first coding region being operably linked to a promoter; a second expression module comprising an expression vector having second coding region encoding one or more optimised second gene products selected from mevK, pmk, pmd or idi, the second coding region being operably linked to a promoter; a third expression module comprising an expression vector having a third coding region encoding one or more optimised third gene products selected from ispA, crtE, crtB or crtI, the third coding region being operably linked to a promoter.
[0074] In another aspect, there is provided a kit when used in the method as described herein, for the production of a carotenoid or apocarotenoid comprising one or more of: a first vector encoding one or more optimised first gene products selected from atoB, hmgS, thmgR; a second vector encoding one or more optimised second gene products selected from mevK, pmk, pmd or idi operably linked to a promoter; a third vector encoding one or more optimised third gene products selected from ispA, crtE or crtB, optionally crtI, operably linked to a promoter for the production of phytoene or lycopene.
[0075] In another aspect, there is provided a kit when used in the method as described herein, for the production of an apocarotenoid or carotenoid comprising one or more of: a first vector encoding one or more optimised first gene products selected from atoB, hmgS, thmgR and optionally crtY operably linked to a promoter; a second vector encoding one or more optimised second gene products selected from mevK, pmk, pmd or idi operably linked to a promoter; a third vector encoding one or more optimised third gene products selected from ispA, crtE, crtB or crtI operably linked to a promoter; and a fourth vector encoding one or more optimised gene products selected from: a. N50-LsLcyE and TrxA-Osmanthus fragrans CCD1 operably linked to a promoter for the production of -ionone; or b. crtY and phCCD1 operably linked to a promoter for the production of -ionone; or c. N50-LsLcyE operably linked to a promoter for the production of -carotene; or d. crtY and blh operably linked to a promoter for the production of retinal; or e. crtY, blh and ybbO for the production of retinol.
[0076] In another aspect, there is provided a method for producing an apocarotenoid or carotenoid comprising the steps of: a. contacting a host cell as described herein in a chemically defined media with a substrate for apocarotenoid or carotenoid production; b. incubating the host cell in said chemically defined media to produce one or more preselected apocarotenoids or carotenoids, and c. extracting the one or more preselected apocarotenoids or carotenoids from the chemically defined media using an organic layer.
[0077] In some embodiments, the organic layer may be coconut oil or soybean oil or other edible oils.
[0078] In some embodiments, the apocarotenoid may be selected from -ionone, -ionone, pseudo-ionone (or psi-ionone), hydroxy-ionone, trans-geranylacetone, 6-methyl-5-hepten-2-one (MHO), retinal, retinol, 8,10-diapocarotene-8,10-dial (C17) or 10,6-diapocarotene-10,6-dial (C19) and wherein the carotenoid may be selected from phytoene, lycopene, -carotene, -carotene, -carotene, -carotene or -carotene.
[0079] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0080] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0081] Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
Experimental Section
[0082] Non-limiting examples of the invention and comparative examples will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.
Materials and Methods
[0083] E. coli Bl21-Gold DE3 strain (Stratagene) was used in this study. The genes hmgS, hmgR, mevK, pmk and pmd (or MVD1) were amplified by PCR using the chromosomal DNA of Saccharomyces cerevisiae. The genes atoB and idi were amplified from E. coli genomic DNA. All the genes were cloned into two plasmids, p15A-spec-hmgS-atoB-hmgR (L2-8) and p15A-cam-mevK-pmk-pmd-idi (L2-5). The genes in the lycopene biosynthetic pathway (crtEBI) amplified from the pAC-LYC plasmid was introduced into p15A-kan-crtEBI-ispA plasmid. The LCYe gene from Lactuca sativa (LsLCYe enzyme), the crtY gene from Pantoea ananatis, the CCD1 gene from Arabidopsis thaliana, Osmanthus fragrans, Vitis vinifera and Petunia hybrid and the blh genes from Uncultured marine bacterium HF10_19P19 (blh1) and Uncultured marine bacterium 66A03 (blh2) were codon optimized and synthesized by Integrated DNA Technologies. The LsLCYe gene and crtY gene was first cloned into the plasmid p15A-amp-LsLCYe (L2-9), and p15A-amp-crtY (L2-9), respectively. OfCCD1 gene was inserted into p15A-amp-LsLCYe (L2-9) plasmid. Different CCD1 or blh genes were later inserted into p15A-amp-crtY (L2-9) strain. Site-directed mutagenesis was introduced from primers synthesized by Integrated DNA Technologies. Additional copy of crtY was inserted into p15A-spec-hmgS-atoB-hmgR (L2-8) plasmid. All the p15A plasmids were derived from pAC-LYC plasmid. The stem-loop structure of RNA I in the p15A plasmid origin was mutated to make the plasmids compatible to each other. The T7 promoter variants are TM1, TM2 and TM3 was summarized in Table 1. The information about plasmids and strains was summarized in Table 2 and 3.
[0084] Table 1 summarizes the promoter sequences used.
TABLE-US-00001 Promoter Name Sequence 17 TAATACGACTCACTATAGGGGAATTGTGAGCG TM1 TAATACGACTCACTAATGGGGAATTGTGAGCG TM2 TAATACGACTCACTCGAGGGGAATTGTGAGCG TM3 TAATACGACTCACTATAAAGGAATTGTGAGCG
[0085] Table 2 summarizes the strains and plasmids used.
TABLE-US-00002 Strains or plasmids Descriptions BL21 DE3 E. coli Bl21-Gold DE3 strain (Stratagene). p15A-spec-hmgS-atoB-hmgR P15A vector carrying atoB-hmgS-hmgR operon (L2-8) controlled by TM1 promoter, with p15A origin mutated p15A-crtY-spec-hmgS-atoB- P15A vector carrying crtY-atoB-hmgS-hmgR operon hmgR (L2-8) controlled by TM1 promoter, with p15A origin mutated p15A-cam-mevK-pmk-pmd-idi P15A vector carrying mevK-pmk-pmd-idi operon (L2-5) controlled by TM2 promoter, with p15A origin mutated p15A-kan-crtEBI-ispA P15A vector carrying crtEBI-ispA operon controlled by TM1 promoter p15A-amp-LsLCYe (L2-9) P15A vector carrying LsLCYe gene controlled by TM1 promoter, with p15A origin mutated p15A-amp-N25LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 25 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A-amp-N34LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 34 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A-amp-N50LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 50 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A-amp-N75LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 75 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A-amp-N92LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 92 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A-amp-N100LsLCYe (L2-9) P15A vector carrying LsLCYe gene, with the first 100 amino acid removed, controlled by TM1 promoter, with p15A origin mutated p15A- amp-LsLCYe-OfCCD1 p15A-amp-LsLCYe (L2-9) containing OfCCD1 gene (L2-9) p15A-amp-N50LsLCYe- p15A-amp-N50LsLCYe (L2-9) containing OfCCD1 OfCCD1 (L2-9) gene p15A-amp-N50LsLCYe- p15A-amp-N50LsLCYe (L2-9) containing OfCCD1 SUMO-OfCCD1 (L2-9) gene with SUMO fusion p15A-amp-N50LsLCYe-MBP- p15A-amp-N50LsLCYe (L2-9) containing OfCCD1 OfCCD1 (L2-9) gene with MBP fusion p15A-amp-N50LsLCYe-TrxA- p15A-amp-N50LsLCYe (L2-9) containing OfCCD1 OfCCD1 (L2-9) gene with trxA fusion p15A-amp-N50LsLCYe-TrxA- p15A-amp-N50LsLCYe (L2-9) containing OfCCD1 OfCCD1_I151F_M152T_N154Y gene with trxA fusion, and three mutations, namely (L2-9) I151F, M152T, N154Y p15A-amp-crtY (L2-9) P15A vector carrying crtY gene controlled by TM1 promoter, with p15A origin mutated p15A-amp-crtY-AtCCD1 (L2-9) p15A-amp-TM1-crtY (L2-9) containing AtCCD1 gene p15A-amp-crtY-OfCCD1 (L2-9) p15A-amp-TM1-crtY (L2-9) containing OfCCD1 gene p15A-amp-crtY-TrxA-OfCCD1 p15A-amp-TM1-crtY (L2-9) containing OfCCD1 gene (L2-9) with the trxA fusion p15A-amp-crtY-PhCCD1 (L2-9) p15A-amp-TM1-crtY (L2-9) containing PhCCD1 gene p15A-amp-crtY-TrxA-PhCCD1 p15A-amp-TM1-crtY (L2-9) containing PhCCD1 gene (L2-9) with the trxA fusion p15A-amp-crtY-blh1 (L2-9) p15A-amp-TM1-crtY (L2-9) containing blh gene from Uncultured marine bacterium HF10_19P19 p15A-amp-crtY-blh2 (L2-9) p15A-amp-TM1-crtY (L2-9) containing blh gene from Uncultured marine bacterium 66A03 pET11a-trxA-CaCCD2 pET11a vector containing trxA-fused CaCCD2 gene from Crocus angustifolius pET11a-trxA-CsCCD2 pET11a vector containing trxA-fused CsCCD2 gene from Crocus sativus pET11a-trxA-AtCCD4 pET11a vector containing trxA-fused AtCCD4 gene from Arabidopsis thaliana pET11a-trxA-BoCCD4b pET11a vector containing trxA-fused BoCCD4b gene from Bixa orellana pET11a-trxA-CmCCD4 pET11a vector containing trxA-fused CmCCD4 gene from Chrysanthemum morifolium pET11a-trxA-CsCCD4a pET11a vector containing trxA-fused CsCCD4a gene from Crocus sativus pET11a-trxA-MaCCD4 pET11a vector containing trxA-fused MaCCD4 gene from Musa acuminata AAA Group pET11a-trxA-MdCCD4 pET11a vector containing trxA-fused MdCCD4 gene from Malus domestica pET11a-trxA-OfCCD4 pET11a vector containing trxA-fused OfCCD4 gene from Osmanthus fragran pET11a-trxA-PpCCD4 pET11a vector containing trxA-fused PpCCD4 gene from Prunus persica pET11a-trxA-RdCCD4 pET11a vector containing trxA-fused RdCCD4 gene from Rosa damascena pET11a-trxA-VvCCD4a pET11a vector containing trxA-fused VvCCD4a gene from Vitis vinifera
[0086] Table 3 describes the strains used in the study.
TABLE-US-00003 No. Strains name Descriptions 1 121 Strain producing lycopene, with three plasmids p15A- spec-hmgS-atoB-hmgR (L2-8), p15A-cam-mevK-pmk- pmd-idi (L2-5) and p15A-kan-crtEBI-ispA. 2 121Y Strain producing -carotene, with three plasmids p15A- crtY-spec-hmgS-atoB-hmgR (L2-8), p15A-cam-mevK- pmk-pmd-idi (L2-5) and p15A-kan-crtEBI-ispA. 3 121 + LL Strain producing -carotene, Strain 121 with p15A-amp- LsLCYe (L2-9), expressing wildtype LCYe. 4 121 + L50 Strain producing -carotene, Strain 121 with p15A-amp- N50LsLCYe (L2-9), expressing LCYe with first 50 amino acid truncated. 5 121 + L100 Strain producing -carotene, Strain 121 with p15A-amp- N100LsLCYe (L2-9), expressing LCYe with first 100 amino acid truncated. 6 121-LO Strain producing -ionone, Strain 121 with p15A-amp- LsLCYe-OfCCD1 (L2-9), expressing wildtype LCYe and wildtype OfCCD1. 7 121-L50-O Strain producing -ionone, Strain 121 with p15A-amp- LsLCYe-OfCCD1 (L2-9), expressing LCYe with first 50 amino acid truncated and wildtype OfCCD1. 8 121-L50-SUMO-O Strain producing -ionone, Strain 121 with p15A-amp- N50LsLCYe-SUMO-OfCCD1 (L2-9), expressing LCYe with first 50 amino acid truncated and SUMO-fused OfCCD1. 9 121-L50-MBP-O Strain producing -ionone, Strain 121 with p15A-amp- N50LsLCYe-MBP-OfCCD1 (L2-9), expressing LCYe with first 50 amino acid truncated and MBP-fused OfCCD1. 10 121-L50-TrxA-O Strain producing -ionone, Strain 121 with p15A-amp- N50LsLCYe-TrxA-OfCCD1 (L2-9), expressing LCYe with first 50 amino acid truncated and TrxA-fused OfCCD1. 11 121-L50-TrxA-O- Strain producing -ionone, Strain 121 with p15A-amp- L151F_M152T_N154Y N50LsLCYe-TrxA-OfCCD1_L151F_M152T_N154Y (L2- 9), expressing LCYe with first 50 amino acid truncated and TrxA-fused OfCCD1 with three mutations. 12 Of Strain producing -ionone, Strain 121 with p15A-amp- crtY-OfCCD1 (L2-9), expressing crtY and wildtype OfCCD1. 13 TOf Strain producing -ionone, Strain 121 with p15A-amp- crtY-TrxA-OfCCD1 (L2-9), expressing crtY and TrxA-fused OfCCD1. 14 TOf + Y Strain producing -ionone, Strain 121Y with p15A-amp- crtY-TrxA-OfCCD1 (L2-9), expressing crtY and TrxA-fused OfCCD1. 15 crtY Strain producing -carotene, strain 121 with p15A-amp- crtY (L2-9). 16 Ph Strain producing -ionone, Strain 121 with p15A-amp- crtY-PhCCD1 (L2-9), expressing crtY and PhCCD1. 17 At Strain producing -ionone, Strain 121 with p15A-amp- crtY-AtCCD1 (L2-9), expressing crtY and PhCCD1. 18 Vv Strain producing -ionone, Strain 121 with p15A-amp- crtY-VvCCD1 (L2-9), expressing crtY and PhCCD1. 19 Ph + Y Strain producing -ionone, Strain 121Y with p15A-amp- crtY-PhCCD1 (L2-9), expressing crtY and PhCCD1. 20 TPh Strain producing -ionone, Strain 121 with p15A-amp- crtY-TrxA-PhCCD1 (L2-9), expressing crtY and TrxA- fused PhCCD1. 21 TPh + Y Strain producing -ionone, Strain 121Y with p15A-amp- crtY-TrxA-PhCCD1 (L2-9), expressing crtY and TrxA- fused PhCCD1. 22 Blh1 Strain producing retinoids, Strain 121 with p15A-amp- crtY-blh1 (L2-9), expressing crtY and blh1. 23 Blh2 Strain producing retinoids, Strain 121 with p15A-amp- crtY-blh1 (L2-9), expressing crtY and blh1. 24 Blh1 + Y Strain producing retinoids, Strain 121Y with p15A-amp- crtY-blh2 (L2-9), expressing crtY and blh2. 25 Blh2 + Y Strain producing retinoids, Strain 121Y with p15A-amp- crtY-blh2 (L2-9), expressing crtY and blh2.
Media and Culture Conditions
[0087] All the cells were grown in 2XPY media (20 g/L Peptone, 10 g/L Yeast extract and 10 g/L NaCl), supplemented with 10 g/L glycerol, 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES). For prolonged incubation (48 h), 5 mg/L Tween80 was also added into the media to prevent cell aggregation. Briefly, 104 fresh cell culture was inoculated into 1 mL fresh media in 14 mL BD Falcon tube. Cells were initially grown at 37 C. with the shaking speed of 300 rpm and were induced by a range of IPTG concentrations (as indicated in text) when OD.sub.600 reached around 0.6. After induction, 2004 of dodecane was supplemented onto the culture to extract ionone or retinoids, and the cells were incubated at 28 C. for another 20 h or 48 h before harvest. The media were supplemented with appropriate antibiotics (100 mg/L ampicillin, 34 mg/L chloramphenicol, 50 mg/L kanamycin and 50 mg/L spectinomycin) to maintain corresponding plasmids.
Quantification of Carotenoids and Retinoids
[0088] Intracellular carotenoids were extracted from cellular pellets according to the acetone extraction method. Briefly, 10-50 L bacterial culture (depending on the content of carotenoids in the cells) was collected and centrifuged. Cell pellets were washed with PBS and were resuspended in 20 L of water, followed by addition of 180 L of acetone. The HPLC method employed an Agilent 1260 Infinity LC System equipped with a ZORBAX, Eclipse Plus C18, 4.6 mm250 mm, 5 m column and diode array detector (DAD). Isocratic condition (50% methanol, 48% ethyl acetate and 2% water) was maintained at 1.5 mL/min for 5 min. The carotenoids were detected at wavelength of 450 nm. Standard curves were generated using commercial standards including -carotene, -carotene, lycopene, retinol and retinal. The extracellular retinoid samples were prepared by diluting 20-504 of organic layer into 1000 L hexane and analysed by the same HPLC system. Isocratic condition was used as follows. Mobile phase was 95% methanol and 5% acetonitrile and the flow rate was 1.5 ml/min. Retinoids were detected at wavelength of 340 nm.
Quantification of ,-Ionone and Psi-Ionone
[0089] The , or -ionone samples were prepared by diluting 20-504 of organic layer into 10004 hexane. The samples were analysed on an Agilent 7980B gas chromatography equipped with Agilent VF-WAXms column and an Agilent 7200 Accurate-Mass Quadrupole Time-of-Flight (GC/MS). Injection of samples was performed in splitless mode at 240 C. The oven program started at 100 C. for 2 min, then the temperature was raised up at 30 C./min until 240 C. and maintained at 240 C. for another 2 min. The ionone concentrations were calculated by interpolating with a standard curve prepared by commercial standards. Mass spectrometer was operated in EI mode with full scan analysis (m/z 30-300, 1 spetra/s).
Chirality Analysis
[0090] The chirality of -ionone from the samples was analyzed with Agilent 7980B gas chromatography equipped with Agilent Cyclosil-B GC Column and an Agilent 7200 Accurate-Mass Quadrupole Time-of-Flight (GC/MS). The oven program started at 80 C. for 2 min, then the temperature was raised up at 5 C./min until 210 C. and to 250 C. at 20 C./min and finally maintained at 250 C. for another 2 min. The ionone concentrations were calculated by interpolating with a standard curve prepared by commercial standards. Mass spectrometer was operated in EI mode with full scan analysis (m/z 30-300, 2 spetra/s).
Fed-Batch Fermentation
[0091] Starting medium was a chemically defined medium modified which contained 15 g/L glucose, 2 g/L (NH.sub.4).sub.2SO.sub.4, 4.2 g/L KH.sub.2PO.sub.4 and 11.24 g/L K.sub.2HPO.sub.4, 1.7 g/L citric acid, 0.5 g/L MgSO.sub.4 and 10 mL/L trace element solution. The trace element solution (100) contained 0.25 g/L CoCl.sub.2.6H.sub.2O, 1.5 g/L MnSO.sub.4.4H.sub.2O, 0.15 g/L CuSO.sub.4.2H.sub.2O, 0.3 g/L H.sub.3BO.sub.3, 0.25 g/L Na.sub.2MoO.sub.4.2H.sub.2O, 0.8 g/L Zn(CH.sub.3COO).sub.2, 5 g/L Fe(III) citrate, and 0.84 g/L EDTA, pH 8.0. Feed medium (500 g/L glucose and 5 g/L MgSO.sub.4) was pumped into the 250 mL Mini Bioreactor (Applikon Biotechnology) at an initial rate of 0.6 mL/h and approximately exponentially increased to at 1.8 mL/h within 12 h and maintained at 1.5 mL/h for another 24 h. Cells were induced by 0.03 mM IPTG when OD reached about 40. After induction, 30 mL of isopropyl myristate was supplemented into the bioreactor to extract ionones.
EXAMPLES
Production of Carotenes by Plug-n-Play
Example 1. Optimization of Phytoene Production
[0092] The plug-n-play as described herein platform produces carotenes and apocarotenoids from inexpensive feedstock (
Example 2. Optimization of Lycopene Production
[0093] Lycopene is another valuable carotenoid that has potent anti-oxidant effect. The biosynthetic pathway is extremely long and challenging to optimize in heterologous microbial production strain. Here, the pathway was divided into three different modules (
Example 3. Optimization of Carotene Production
[0094] A fourth biosynthetic expression module can be introduced based on the parental lycopene-overproducing strain (
[0095] Structural prediction by Phobius showed a likely membrane interaction region (104.sup.th-128.sup.th amino acids) in the LsLCYe enzyme and a weak signal peptide region (1.sup.st-30.sup.th amino acids). Modifications of N-terminal residues involved in membrane interactions and signal peptide coding regions have previously been reported to enhance solubility and activity of recombinant protein. Therefore, the truncation of the N-terminus sequences involved in anchoring to membrane was examined to determine if it would increase the catalytic efficiency of LsLCYe. A series of N-terminal truncated LsLCYe was constructed by systematically removing 50 residues at a time using the truncate cross-lapping in vitro assembly method. The enzymatic expression level was increased by 40% when the first 50 amino acids (
[0096] In order to demonstrate the broader utility of this modular approach, other apocarotenoids were produced by replacing the LCYe enzyme with the expression of lycopene beta cyclase (or crtY) from Pantoea ananatis. Unlike LsLCYe, the native lycopene beta cyclase was highly active and converted greater than 70% of lycopene into -carotene (65 mg/L), with residual amount of lycopene (24 mg/L) (crtY strain in
Production of Apocarotenoids by Plug-n-Play
Example 4. Optimization of -Ionone Production
[0097] By modular approach, carotenoid cleavage oxygenase(s) can be added to the fourth expression module to produce various apocarotenoids (
[0098] Literature suggested that fusion with glutathione-S-transferase (GST) would significantly increase expression and solubility of CCD1 in E. coli. Thus, the fusion partners were examined for improvements in the functional expression of OfCCD1. Three commonly used N-terminal fusion partners, small ubiquitin-like modifier (SUMO) protein, maltose binding protein (MBP) and thioredoxin (TrxA) were tested. OfCCD1 when fused with the three fusion partners significantly increased the titers of -ionone (
[0099] To further improve the -ionone yield, homology modelling was used to predict the 3D structure of OfCCD1 (
[0100] Next, the performance in fed-batch fermentation was tested using the best -ionone producing strain (121-L50-TrxA-O strain). As -ionone is volatile, isopropyl myristate was used to entrap the compound during fermentation. As shown in
[0101] Furthermore, the produced -ionone was subjected to chirality check and found to be 100% R-enantiomer of -ionone (
Example 5. Optimization of -Ionone Production
[0102] To demonstrate the broader utility of this modular approach, other apocarotenoids were produced by co-expressing carotenoids cleavage dioxygenase with lycopene beta cyclase (or crtY) from Pantoea ananatis. The -ionone production with wild-type OfCCD1 expressing strain (Of strain) was 140 g/L, corresponding to merely less than 1% conversion yield from -carotene (
[0103] As large amount of lycopene and lycopene-derived psi-ionone were produced in the TOf strain, it was hypothesized that increasing the gene dosage of crtY (TOf+Y strain) may have two potential benefits. Firstly, it may increase the carbon fluxes from lycopene to -carotene and hence increase -ionone production. Secondly, the production of psi-ionone may be reduced by the decrease in the availability of intracellular lycopene. To test the hypothesis, crtY was firstly inserted into the first expression module of our system, atoB-hmgS-hmgR, resulting in a new operon, crtY-atoB-hmgS-hmgR (illustrated in
[0104] Although supplementation of crtY markedly improved -ionone production, there was still 4.4 mg/L of psi-ionone produced. To maximize the -ionone production and minimize by-product/intermediates formation, CCD with higher selectivity for -carotene was screened. Another three CCD1 enzymes, from Arabidopsis thaliana (AtCCD1), Vitis vinifera (VvCCD1) and Petunia hybrid (PhCCD1) were tested (
[0105] Nevertheless, there were still 13.3 mg/L -carotene and 13.8 mg/L lycopene accumulated in the PhCCD1 expressing strain (
[0106] Table 4 summarizes the CCD1 enzymes in this study.
TABLE-US-00004 Entry Enzymes Organisms O65572 AtCCD1 Arabidopsis thaliana (Mouse-ear cress) U3M7F6 VvCCD1 Vitis vinifera (Grape) D4QE74 OfCCD1 Osmanthus fragrans Q6E4P3 PhCCD1 Petunia hybrida (Petunia)
[0107] The organic phase from the bioreactor was yellow in color. To identify the yellow compound(s), ultra performance liquid chromatography coupled with time-of-flight mass spectrometry analysis was carried out. A few dialdehydes (C17 and C19) and alcohols were identified (
[0108] Table 5 summarizes the CCD2 and CCD4 enzymes in this study.
TABLE-US-00005 CCD enzymes Organisms CaCCD2 Crocus angustifolius CsCCD2 Crocus sativus AtCCD4 Arabidopsis thaliana BoCCD4b Bixa orellana CmCCD4 Chrysanthemum morifolium CsCCD4a Crocus sativus MaCCD4 Musa acuminata AAA Group MdCCD4 Malus domestica OfCCD4 Osmanthus fragran PpCCD4 Prunus persica RdCCD4 Rosa damascena VvCCD4a Vitis vinifera
Example 6. Optimization of Retinoids Production
[0109] Retinoids are biosynthesized by cleaving -carotene at C15-C15 position. To further illustrate the utility of the plug-n-play system to produce other apocarotenoids, CCD1 gene was replaced with two blh genes (BCDO enzyme,
DISCUSSION
[0110] Modular metabolic engineering has been successfully applied to rationally improve small molecule production by microbial cell factories. It is a powerful approach to reduce the parameter optimization space and allow sequential optimization of subsets of expression modules before amalgamating with the full pathway. Generally, as expression module number increases, the accuracy of pathway optimization will improve but the full combination will also increase exponentially. Thus, a balanced expression module number has to be decided. As described herein, the multi-gene pathway containing 13 genes was cast into 4 different expression modules: upstream mevalonate pathway (expression module 1), downstream mevalonate pathway (expression module 2), lycopene biosynthetic pathway (expression module 3) and apocarotenoids biosynthetic pathway (expression module 4). By optimizing the first three metabolic expression modules with EDASPO approach, a stable parental strain that accumulated high content of lycopene was obtained (strain 121 in
[0111] Collectively, these results demonstrate that modulating key protein expression is essential for the heterologous biosynthesis of apocarotenoids in E. coli. Broadly, this highlights the benefits of combining protein engineering and modular pathway design for the overproduction of valuable chemicals.
[0112] The recent changes in the regulation of natural ingredient labelling have resulted in the increase in demand of natural flavours and fragrances. Consequently, there are growing interests in engineering microbes to produce the ingredients from renewable resources. However, the complex metabolic characteristics of apocarotenoid pathway have hampered the development of highly efficient microbial processes. Advantageously, the present disclosure provides modular metabolic engineering and enzyme engineering strategies that were systematically applied to effectively minimize the metabolic burden imposed by overexpression of 13 enzymes to overcome the challenge from critical enzymes of low activities. This strategy has enabled the development of a robust E. coli strain capable of producing unprecedented yields of -ionone and -ionone, demonstrating the great potential of using microbes in production of natural flavours and fragrances.