Maltooligosyl Trehalose Synthase Mutant with Improved Thermal Stability
20190367899 ยท 2019-12-05
Inventors
- Jing Wu (Wuxi, CN)
- Lingqia Su (Wuxi, CN)
- Chun Chen (Wuxi, CN)
- Zirui Wang (Wuxi, CN)
- Jinyun Feng (Wuxi, CN)
Cpc classification
C12Y204/01019
CHEMISTRY; METALLURGY
C12P19/24
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure discloses a maltooligosyl trehalose synthase mutant with improved thermal stability, and belongs to the technical fields of enzyme engineering and protein engineering. The residual enzyme activities of the MTSase mutants S361R, S444E, S361R/S444E, S361K/S444E, G415P/S361R/S444E and G415P consistent with the present disclosure after treatment at 60 C. for 10 min are respectively 70.3%, 50.1%, 83.5%, 65.9%, 100% and 80.7%, which are respectively 1.6, 1.1, 1.9, 1.5, 2.3 and 1.9 times of that of the wild type. The half-lives of the S361R/S444E and G415P/S361R/S444E at 60 C. are respectively 14.9 min and 90.8 min which are respectively 3.2 and 19.7 times of that of the wild type, indicating that the thermal stability of the MTSase mutant consistent with the present disclosure is significantly improved than that of the wild type.
Claims
1. A maltooligosyl trehalose synthase mutant, comprising an amino acid sequence with mutations of the 415.sup.th Glycine, or the 361.sup.st Serine, or the 444.sup.th Serine, or both the 361.sup.st Serine and the 444.sup.th Serine, or all three of the 361.sup.st Serine and the 444.sup.th Serine and the 415.sup.th Glycine; wherein the mutations are relative to a parent amino acid sequence set forth in SEQ ID NO:1.
2. The maltooligosyl trehalose synthase mutant of claim 1, comprising an amino acid sequence with mutations of the 415.sup.th Glycine to Proline, or the 361.sup.st Serine to Arginine, or the 444.sup.th Serine to Glutamic Acid, or both the 361.sup.st Serine to Arginine and the 444.sup.th Serine to Glutamic Acid, or both the 361.sup.st Serine to Lysine and the 444.sup.th Serine to Glutamic Acid, or all three of the 361.sup.st Serine to Arginine and the 444.sup.th Serine to Glutamic Acid and the 415.sup.th Glycine to Proline; wherein the mutations are relative to a parent amino acid sequence set forth in SEQ ID NO:1.
3. The maltooligosyl trehalose synthase mutant of claim 1, wherein the amino acid sequence of the maltooligosyl trehalose synthase mutant is set forth in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.30.
4. The maltooligosyl trehalose synthase mutant of claim 2, wherein the amino acid sequence of the maltooligosyl trehalose synthase mutant is set forth in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.30.
5. A gene for coding the maltooligosyl trehalose synthase mutant of claim 1.
6. A gene for coding the maltooligosyl trehalose synthase mutant of claim 2.
7. A gene for coding the maltooligosyl trehalose synthase mutant of claim 3.
8. A recombinant plasmid carrying the gene of claim 5.
9. A host cell carrying the gene of claim 5.
10. A host cell carrying the recombinant plasmid of claim 8.
11. A method comprising: inoculating a fermentation medium with the host cell of claim 9, carrying out fermentation, collecting bacteria obtained by fermentation after fermentation, crushing the bacteria, and after crushing, separating the maltooligosyl trehalose synthase mutant from the disrupted cell suspension obtained by crushing.
12. A method comprising adding an amount of the maltooligosyl trehalose synthase mutant of claim 1 as an enzyme to produce trehalose.
13. The method comprising inoculating a fermentation medium with the host cell of claim 9.
14. The method of claim 12, comprising: adding -amylase to a starch solution to carry out liquefaction to obtain enzymatic hydrolysate; and adding pullulanase, cyclodextrin glucosyltransferase, 4- glycosyltransferase and the maltooligosyl trehalose synthase mutant to the enzymatic hydrolysate to carry out a reaction to obtain the trehalose.
15. The method for producing trehalose of claim 14, wherein the addition amount of the maltooligosyl trehalose synthase mutant to the enzymatic hydrolysate is 2-8 U/mL.
Description
BRIEF DESCRIPTION OF FIGURES
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION
[0047] E. coli BL21 (DE3), E. coli JM109, and expression vectors pET-24a (+) involved in the following examples are purchased from Takara.
[0048] Media involved in the following examples are as follows:
[0049] LB liquid medium, containing tryptone 10 g/L, yeast extract 5 g/L, and NaCl 10 g/L.
[0050] LB solid medium, containing tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, and agar powder 20 g/L.
[0051] LB liquid medium, containing peptone 12 g/L, yeast extract 24 g/L, glycerin 5 g/L, KH.sub.2PO.sub.4 2.31 g/L, and K.sub.2HPO.sub.4 12.54 g/L.
[0052] Detection Methods Involved in the Following Examples are as Follows:
[0053] Detection Method of Enzyme Activity of Maltooligosyl Trehalose Synthase:
[0054] Preheating: 1.9 mL of a maltodextrin solution 0.2% in mass volume concentration (DE 9-13, pH 6.0 phosphate buffer) is taken in a stoppered test tube, and preheated in a 50 C. water bath for 10 min;
[0055] Reaction: After preheating, 0.1 mL of a dilution containing maltooligosyl trehalose synthase is added to the maltodextrin solution, the mixture is shaken uniformly, and the reaction is accurately counted for 10 min; after 10 min, 3 mL of DNS is added, uniform shaking is performed, and reaction is stopped; boiling is performed for 7 min for enzyme deactivation, and cooling is performed to obtain a reaction solution;
[0056] Measurement: Distilled water is added to the reaction solution, the volume is adjusted to 15 mL, and uniform mixing is performed; the absorbance is measured at a wavelength of 540 nm and the enzyme activity is calculated.
[0057] (Definition of enzyme activity: The unit enzyme activity is equivalent to the amount of enzyme required to convert one micromole of glucose per minute to non-reducing sugar.)
[0058] Detection Method of Conversion Rate of Trehalose:
[0059] The reaction solution is diluted and precipitated, and the content of trehalose is determined by high performance liquid chromatography (HPLC), and the conversion rate is calculated;
[0060] wherein conversion rate (%)=mass of trehalose/mass of rice starch 100%;
[0061] HPLC detection conditions: mobile phase (acetonitrile:water=80:20); flow rate: 0.8 mL/min, column temperature 40 C., NH2 column (APS-2 HYPERSIL, Thermo Scientific), refractive index detector (RID).
Example 1: Expression of Wild Type Maltooligosyl Trehalose Synthase
[0062] The target gene treY (NCBI number: BAB40765.1) encoding the maltooligosyl trehalose synthase with the nucleotide sequence as shown in SEQ ID NO.7 is synthesized by chemical synthesis. The target gene treY is double digested with Hind III and Nde I, ligated with the expression vector pET-24a (+), and transferred into E. coli BL21 (DE3) to obtain treY/pET24a/BL21 (DE3). The treY/pET24a/BL21 (DE3) is inoculated in the LB liquid medium (containing 100 mg/L kanamycin) and cultured at 37 C. for 10 h to obtain a seed solution. The seed solution is inoculated in the TB liquid medium (containing 100 mg/L kanamycin) at an inoculum concentration of 5%. After culturing at 37 C. for 2 h, IPTG (isopropylthio--D galactoside) with a final concentration of 0.01 mmol/L is added for performing induction, and the mixture is fermented at 25 C. on a shaker for 24 h to obtain a fermentation broth. The fermentation broth is centrifuged at 4 C. and 12000 rpm for 10 min, the supernatant is discarded, and the bacteria are collected. The bacteria are resuspended in a 20 mmol/L phosphate buffer (pH 6.0) and the suspension is uniformly mixed. The cell walls of the bacterial suspension are disrupted by an ultrasonic cell disruptor, then the bacterial suspension is centrifuged at 4 C. and 12000 rpm for 10 min, and the supernatant is collected to obtain a fermented intracellular crude enzyme solution;
[0063] Wherein, the working conditions of the ultrasonic cell disruptor is: a 6 working probe is used, the working time is 10 min, working is performed for 2 s every 3 s, and the working power is 20%.
Example 2: Preparation and Expression of Maltooligosyl Trehalose Synthase Mutant
[0064] (1) Construction of mutants S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P:
[0065] Site-directed mutation is carried out using a treY/pET-24a (+) plasmid as a template by PCR technology;
[0066] wherein, mutation primers are:
TABLE-US-00001 S361R: (SEQIDNO.8) S361R-F:CTGCTGCTCTGCGCGTGTATCGTAGCTACTTACC; (SEQIDNO.9) S361R-R:GGTAAGTAGCTACGATACACGCGCAGAGCAGCAG; S444E: (SEQIDNO.10) S444E-F:GCGGTGACCCTGAACTGTTTGCAATCGATGC; (SEQIDNO.11) S444E-R:GCATCGATTGCAAACAGTTCAGGGTCACCGC; S361R/S444E(furthermutationbasedonS361R): (SEQIDNO.10) S444E-F:GCGGTGACCCTGAACTGTTTGCAATCGATGC; (SEQIDNO.11) S444E-R:GCATCGATTGCAAACAGTTCAGGGTCACCGC; S361K/S444E(furthermutationbasedonS444E): (SEQIDNO.12) S361K-F:TGCTCTGAAAGTGTATCGTAGCTACTTACCAT; (SEQIDNO.13) S361K-R:ACACTTTCAGAGCAGCAGCAATTTCCA; S361Q/S444Q(acquisitionofS361Qfirst,and thenfurthermutationbasedonS361Q): (SEQIDNO.14) S361Q-F:GCTCTGCAAGTGTATCGTAGCTACTTACCA; (SEQIDNO.15) S361Q-R:CACTTGCAGAGCAGCAGCAATTTCCA; (SEQIDNO.16) S444Q-F:GACCCTCAACTGTTTGCAATCGATGCTGC; (SEQIDNO.17) S444Q-R:ACAGTTGAGGGTCACCGCCCACTTC; S361Q/S444L(acquisitionofS361Qfirst,and thenfurthermutationbasedon5361Q): (SEQIDNO.18) S5444L-F:CCTTTACTGTTTGCAATCGATGCTGC; (SEQIDNO.19) S444L-R:GCAAACAGTAAAGGGTCACCGCCCAC; G415P/S361R/S444E(furthermutationbasedon S361R/S444E): (SEQIDNO.20) G415P-F:CAGCAGACCTCACCGATGATCATGGCCAAAGGTGTG; (SEQIDNO.21) G415P-R:CACACCTTTGGCCATGATCATCGGTGAGGTCTGCTG; G415D: (SEQIDNO.22) G415D-F:CTTTCAGCAGACCTCAGATATGATCATGGC; (SEQIDNO.23) G415D-R:GCCATGATCATATCTGAGGTCTGCTGAAAG; L26F: (SEQIDNO.24) L26F-F:CAGCCCGTATTGTTCCATATTTTCATCGTTTAGGC; (SEQIDNO.25) L26F-R:GCCTAAACGATGAAAATATGGAACAATACGGGCTG; T413Y: (SEQIDNO.26) T413Y-F:CGCTTTCAGCAGTACTCAGGTATGATCATGGCC; (SEQIDNO.27) T413Y-F:GGCCATGATCATACCTGAGTACTGCTGAAAGCG; A277D: (SEQIDNO.28) A277D-F:CACCTCAGTGGCCAATTGATGGTACAACCGG; (SEQIDNO.29) A277D-R:CCGGTTGTACCATCAATTGGCCACTGAGGTG; G415P: (SEQIDNO.31) G415P-F:GCTTTCAGCAGACCTCACCGATGATCATGGC; (SEQIDNO.32) G415P-R:GCCATGATCATCGGTGAGGTCTGCTGAAAGC;
[0067] A PCR system consists of: 0.5 L of 20 M forward primer, 0.5 L of 20 M reverse primer, 4 L of dNTPMix, 10 L of 5PS Buffer, 0.5 L of 2.5 U/L PrimeStar polymerase, 0.5 L of template, and the balance of double distilled water to 50 L;
[0068] PCR conditions are: Pre-denaturation at 94 C. for 4 min, followed by 25 cycles (at 94 C. for 10 s, at 55 C. for 5 s, at 72 C. for 7 min 40 s) at 72 C. for 10 min, and finally, insulation at 4 C.
[0069] The PCR product is detected by 1% agarose gel electrophoresis. After detection, the correct PCR product is digested with Dpn I and transferred to E. coli JM109 competent cells. The transformed product is applied to the LB solid medium containing 100 mg/L of kanamycin and cultured at 37 C. for 12 h. 2 single grown colonies are picked and inoculated into the LB liquid medium, and cultured at 37 C. for 8 h, and then the plasmids are extracted and sequenced. The results are correct and transferred to E. coli BL21 (DE3) to obtain treY/pET24a/BL21 (DE3) after different mutations.
[0070] (2) Expression of Mutants
[0071] The treY/pET24a/BL21 (DE3) obtained in (1) is inoculated in the LB liquid medium (containing 100 mg/L kanamycin) and cultured at 37 C. for 10 h to obtain a seed solution. The seed solution is inoculated in the TB liquid medium (containing 100 mg/L kanamycin) at an inoculum concentration of 5%. After culturing at 37 C. for 2 h, IPTG (isopropylthio--D galactoside) with a final concentration of 0.01 mmol/L is added for performing induction, and the mixture is fermented at 25 C. on a shaker for 24 h to obtain a fermentation broth. The fermentation broth is centrifuged at 4 C. and 12000 rpm for 10 min, the supernatant is discarded, and the bacteria are collected. The bacteria are resuspended in a 20 mmol/L phosphate buffer (pH 6.0) and the suspension is uniformly mixed. The cell walls of the bacterial suspension are disrupted by an ultrasonic cell disruptor, then the bacterial suspension is centrifuged at 4 C. and 12000 rpm for 10 min, and the supernatant is collected to obtain a fermented intracellular crude enzyme solution;
[0072] Wherein, the working conditions of the ultrasonic cell disruptor is: a 6 working probe is used, the working time is 10 min, working is performed for 2 s every 3 s, and the working power is 20%.
Example 3: Detection of Residual Enzyme Activity of Maltooligosyl Trehalose Synthase after Heat Treatment
[0073] The fermented intracellular crude enzyme solution obtained in Example 1 is purified to obtain a pure enzyme, and the pure enzyme is the wild type. The fermented intracellular crude enzyme solutions obtained in Example 2 are purified to obtain pure enzymes, and the pure enzymes are respectively S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P.
[0074] The wild type, S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P are diluted with a 20 mM pH 6.0 phosphate buffer solution respectively until the protein concentration is 0.25 mg/mL. The enzyme activity of the dilutions containing the wild type, S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P is detected. The detection results are: the enzyme activity of the dilution containing the wild type is 200 U/mL, the enzyme activity of the dilution containing the S361R is 196 U/mL, the enzyme activity of the dilution containing the S444E is 187 U/mL, the enzyme activity of the dilution containing the S361R/S444E is 210 U/mL, the enzyme activity of the dilution containing the S361K/S444E is 203 U/mL, the enzyme activity of the dilution containing the S361Q/S444Q is 190 U/mL, the enzyme activity of the dilution containing the S361Q/S444L is 192 U/mL, the enzyme activity of the dilution containing the G415P/S361R/S444E is 198 U/mL, the enzyme activity of the dilution containing the G415D is 124 U/mL, the enzyme activity of the dilution containing the L26F is 203 U/mL, the enzyme activity of the dilution containing the T413Y is 200 U/mL, the enzyme activity of the dilution containing the A277D is 209 U/mL, and the enzyme activity of the dilution containing the G415P is 180 U/mL.
[0075] The wild type, S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P are diluted with a 20 mM pH 6.0 phosphate buffer solution respectively until the protein concentration is 0.25 mg/mL. The obtained diluents are subjected to heat treatment in 60 C. thermostatic waterbath for 10 min. After 10 min, the enzyme activity of the dilutions containing the wild type, S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E and G415P not subjected to the heat treatment is taken as 100%, the residual enzyme activity of the dilutions containing the wild type, S361R, S444E, S361R/S444E, S361K/S444E, S361Q/S444Q, S361Q/S444L, G415P/S361R/S444E, G415D, L26F, T413Y, A277D and G415P subjected to the heat treatment is detected, and the detection results are shown in
[0076] Seen from
Example 4: Analysis of Thermal Stability of Maltooligosyl Trehalose Synthase
[0077] The dilutions containing the wild type, G415D and G415P obtained in Example 3 are placed in a 50 C. thermostatic waterbath, and sampled once at set intervals to detect the residual enzyme activity and compare the thermal stability, and the detection results are shown in
[0078] See from
[0079] The dilutions containing the wild type, S361R/S444E and G415P/S361R/S444E obtained in Example 3 are placed in a 60 C. thermostatic waterbath, and sampled once at set intervals to detect the residual enzyme activity and compare the thermal stability, and the detection results are shown in
[0080] Seen from
Example 5: Analysis of Conversion Rate of Maltooligosyl Trehalose Synthase to Trehalose
[0081] A rice starch solution with a concentration of 150 g/L is used as a substrate, 0.5 U/mL -amylase (Termamyl SC, purchased from Novozymes) is added to the rice starch solution, the mixture is liquefied at pH 5.5 and temperature of 90 C. for 8-10 min until a DE value is 16 to obtain an enzymatic hydrolysate. After the temperature of the enzymatic hydrolysate reduces to 60 C., 5 U/g starch pullulanase (derived from Bacillus deramificans), 2 U/mL cyclodextrin glucosyltransferase (derived from Paenibacillus macerans), 0.5 U/mL 4- glycosyltransferase (derived from Thermus aquaticus), 5.0 U/mL maltooligosyl trehalose hydrolase (derived from A. ramosus) and the wild type or the mutant G415P with the gradient concentrations of 1.5 U/mL, 2.0 U/mL, 2.5 U/mL and 3.0 U/mL obtained in Example 3 are added to the enzymatic hydrolysate. The mixture reacts at 50 C. and 150 r/min for 36 h to obtain a reaction solution. The reaction solution is boiled for stopping the reaction to detect the conversion rate of the trehalose, and the detection results are shown in
[0082] Seen from
[0083] The wild type obtained in Example 3 is used as a control, a rice starch solution with a concentration of 150 g/L is used as a substrate, 0.5 U/mL -amylase (Termamyl SC, purchased from Novozymes) is added to the rice starch solution, the mixture is liquefied at pH 5.5 and temperature of 90 C. for 8-10 min until a DE value is 16 to obtain an enzymatic hydrolysate. After the temperature of the enzymatic hydrolysate reduces to 60 C., 5 U/g starch pullulanase (derived from B. deramificans), 2 U/mL cyclodextrin glucosyltransferase (derived from P. macerans), 0.5 U/mL 4- glycosyltransferase (derived from T. aquaticus), 5.0 U/mL maltooligosyl trehalose hydrolase (derived from A. ramosus) and 5.0 U/mL mutant G415P/S361R/S444E are added to the enzymatic hydrolysate. The mixture reacts at 60 C. and 150 r/min for 36 h to obtain a reaction solution. The reaction solution is boiled for stopping the reaction to detect the conversion rate of the trehalose, and the detection results are shown in
[0084] Seen from
[0085] Although the present disclosure has been disclosed above in the preferred examples, it is not intended to limit the present disclosure. Any person skilled in the art can make various alterations and modifications without departing from the spirit and scope of the present disclosure. Therefore, the scope of the present disclosure should be determined by the scope of the claims.