Bacteriophage recombination followed by blockage of non-recombinant bacteriophage replication
10494638 ยท 2019-12-03
Assignee
Inventors
- Jason Holder (Swampscott, MA, US)
- Connor McBrine (Somerville, MA, US)
- Miles Rogers (Boston, MA, US)
- Nicole Billings (Framingham, MA, US)
- Sarah Gruska (Cambridge, MA, US)
- Lucas Tilley (Medford, MA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2795/10221
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2795/10243
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N9/0069
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N9/96
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides methods and kits for generating recombinant bacteriophage genomes. Specifically, the present technology provides methods of integrating a heterologous nucleic acid sequence into a bacteriophage DNA genome, and isolating recombinant bacteriophages that express the heterologous nucleic acid sequence.
Claims
1. A method for making a recombinant bacteriophage DNA genome in a first bacterial host cell comprising (a) contacting a first bacteriophage DNA genome with a first sgRNA-CRISPR enzyme complex and a second sgRNA-CRISPR enzyme complex in vivo under conditions where (i) the first sgRNA-CRISPR enzyme complex cleaves a first protospacer sequence within the first bacteriophage DNA genome; and (ii) the second sgRNA-CRISPR enzyme complex cleaves a second protospacer sequence within the first bacteriophage DNA genome to produce a cleaved first bacteriophage DNA genome; and (b) recombining in vivo the cleaved first bacteriophage DNA genome with a heterologous nucleic acid sequence under conditions to produce the recombinant bacteriophage DNA genome, wherein the first bacterial host cell is infected with the first bacteriophage DNA genome, wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof, wherein the first bacterial host cell comprises a first non-endogenous expression vector comprising a nucleic acid sequence that encodes a first sgRNA, a second sgRNA, and a first CRISPR enzyme, and a second non-endogenous expression vector comprising: lambda Red proteins Gam, Exo, and Beta operably linked to an inducible promoter; or Exo, RecA, and Gam proteins operably linked to an inducible promoter.
2. The method of claim 1, wherein the first bacterial host cell may be a non-natural bacterial host cell or a natural bacterial host cell for the recombinant bacteriophage DNA genome.
3. The method of claim 1, wherein the first bacteriophage DNA genome corresponds to a bacteriophage family or order selected from the group consisting of Myoviridae, Siphoviridae, Podoviridae, Lipothrixviridae, Rudiviridae, Ampullaviridae, Bucaudaviridae, Clavaviridae, Corticoviridae, Cystoviridae, Fuselloviridae, Globuloviriade, Guttaviridae, Inoviridae, Leviviridae, Mircoviridae, Plasmaviridae, and Tectiviridae.
4. The method of claim 1, wherein the first bacteriophage DNA genome corresponds to T3, T7, M6, K11, F92, K1-5, or K1F.
5. The method of claim 1, wherein the cleaved first bacteriophage DNA genome comprises a first cleaved bacteriophage genomic fragment and a second cleaved bacteriophage genomic fragment.
6. The method of claim 5, wherein the heterologous nucleic acid sequence comprises a 5 flanking region that is homologous to the 3 end of the first cleaved bacteriophage genomic fragment, and a 3 flanking region that is homologous to the 5 end of the second cleaved bacteriophage genomic fragment.
7. The method of claim 1, wherein the first sgRNA and the second sgRNA are operably linked to a constitutive promoter.
8. The method of claim 1, wherein the first CRISPR enzyme is a Cas protein selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4, and optionally wherein the first CRISPR enzyme is operably linked to an inducible promoter.
9. The method of claim 1, wherein the bioluminescent protein is Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, or nanoluciferase.
10. The method of claim 1, wherein the chemiluminescent protein is -galactosidase, horseradish peroxidase (HRP), or alkaline phosphatase.
11. The method of claim 1, wherein the fluorescent protein is TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOK, mKO2, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKate1, LSS-mKate2, PA-GFP, PAmCherry1, PATagRFP, Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, or Dronpa.
12. The method of claim 1, wherein the open reading frame of the heterologous nucleic acid is operably linked to an expression control sequence that is capable of directing expression of the bioluminescent protein, the fluorescent protein, the chemiluminescent protein, or any combination thereof.
13. The method of claim 12, wherein the expression control sequence is an inducible promoter or a constitutive promoter.
14. The method of claim 1, wherein the heterologous nucleic acid is about 100-500 base pairs in length or about 500-1500 base pairs in length.
15. The method of claim 1, further comprising propagating the recombinant bacteriophage DNA genome in the first bacterial host cell.
16. The method of claim 1, further comprising propagating the recombinant bacteriophage DNA genome in a second bacterial host cell.
17. A method for making a recombinant bacteriophage DNA genome in bacterial host cells comprising (a) contacting a first bacteriophage DNA genome with a first sgRNA-CRISPR enzyme complex and a second sgRNA-CRISPR enzyme complex in vivo under conditions where (i) the first sgRNA-CRISPR enzyme complex cleaves a first protospacer sequence within the first bacteriophage DNA genome; and (ii) the second sgRNA-CRISPR enzyme complex cleaves a second protospacer sequence within the first bacteriophage DNA genome to produce a cleaved first bacteriophage DNA genome, wherein a first bacterial host cell is infected with the first bacteriophage DNA genome; and (b) recombining in vivo the cleaved first bacteriophage DNA genome with a heterologous nucleic acid sequence under conditions to produce the recombinant bacteriophage DNA genome, wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof wherein the first bacterial host cell comprises a first non-endogenous expression vector comprising a nucleic acid sequence that encodes a first sgRNA, a second sgRNA, and a first CRISPR enzyme, and a second non-endogenous expression vector comprising: lambda Red proteins Gam, Exo, and Beta operably linked to an inducible promoter; or Exo, RecA, and Gam proteins operably linked to an inducible promoter; and (c) propagating the recombinant bacteriophage DNA genome in a second bacterial host cell, wherein the second bacterial host cell comprises a third non-endogenous expression vector comprising a nucleic acid sequence that encodes a second CRISPR enzyme, a third sgRNA, and a fourth sgRNA, wherein the third sgRNA and the fourth sgRNA are operably linked to a constitutive promoter, wherein the second CRISPR enzyme is operably linked to an inducible promoter, and wherein expression of the second CRISPR enzyme is induced prior to propagating the recombinant bacteriophage DNA genome in the second bacterial host cell.
18. The method of claim 17, wherein the third sgRNA binds to the second CRISPR enzyme to form a third sgRNA-CRISPR enzyme complex, and the fourth sgRNA binds to the second CRISPR enzyme to form a fourth sgRNA-CRISPR enzyme complex.
19. The method of claim 18, wherein the third sgRNA-CRISPR enzyme complex and the fourth sgRNA-CRISPR enzyme complex (a) do not cleave the recombinant bacteriophage DNA genome and (b) cleave the first bacteriophage DNA genome.
20. The method of claim 17, wherein the second CRISPR enzyme is Cas9.
21. A method for making a recombinant bacteriophage DNA genome in bacterial host cells comprising (a) contacting a first bacteriophage DNA genome with a first sgRNA-CRISPR enzyme complex and a second sgRNA-CRISPR enzyme complex in vivo under conditions where (i) the first sgRNA-CRISPR enzyme complex cleaves a first protospacer sequence within the first bacteriophage DNA genome; and (ii) the second sgRNA-CRISPR enzyme complex cleaves a second protospacer sequence within the first bacteriophage DNA genome to produce a cleaved first bacteriophage DNA genome, wherein a first bacterial host cell is infected with the first bacteriophage DNA genome; and (b) recombining in vivo the cleaved first bacteriophage DNA genome with a heterologous nucleic acid sequence under conditions to produce the recombinant bacteriophage DNA genome, wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof wherein the first bacterial host cell comprises a first non-endogenous expression vector comprising a nucleic acid sequence that encodes a first sgRNA, a second sgRNA, and a first CRISPR enzyme, and a second non-endogenous expression vector comprising: lambda Red proteins Gam, Exo, and Beta operably linked to an inducible promoter; or Exo, RecA, and Gam proteins operably linked to an inducible promoter; and (c) propagating the recombinant bacteriophage DNA genome in a second bacterial host cell, wherein the second bacterial host cell comprises a non-endogenous Cascade complex expression vector comprising a nucleic acid sequence that encodes a casABCDE operon, and Cas3 nuclease.
22. The method of claim 21, wherein the casABCDE operon and Cas3 nuclease are operably linked to an inducible promoter or a constitutive promoter.
23. The method of claim 21, wherein the second bacterial host cell comprises a non-endogenous CRISPR RNA (crRNA) spacer array comprising one or more spacers that (a) induce cleavage in the first bacteriophage DNA genome and (b) do not induce cleavage in the recombinant bacteriophage DNA genome.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
DETAILED DESCRIPTION
(20) It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.
(21) Manipulating phage genomes is more difficult compared to manipulating bacterial hosts. In vitro synthesis and assembly of phage genomes is inefficient and relies on the delivery of large DNA molecules across the cell membranes of a bacterial host. Some bacterial strains are recalcitrant to large DNA transformation across the membrane. Classic in vivo recombination strategies are also inefficient and are complicated by the fact that lytic phage genomes have a comparatively short residence time in a host before lysis.
(22) One of the most commonly used and well-established methods for engineering phage genomes is homologous recombination in their bacterial hosts, which can occur between two homologous DNA sequences as short as 23 bp (Alberts B et al., M
(23) The present disclosure provides methods for integrating a heterologous nucleic acid sequence into a bacteriophage DNA genome, and isolating recombinant bacteriophages that express the heterologous nucleic acid sequence. The methods disclosed herein permit higher recovery of recombinant bacteriophage genomes that express the phenotypic properties associated with the heterologous nucleic acid sequence relative to that observed with other phage engineering methods, such as bacteriophage recombineering of electroporated DNA (BRED) (Marinelli L J et al., PLoS One 3:e3957 (2008)).
(24) In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology.
Definitions
(25) Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms a, an and the include plural referents unless the content clearly dictates otherwise. For example, reference to a cell includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.
(26) As used herein, the term about in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
(27) As used herein, bacteriophage or phage refers to a virus that infects bacteria. Bacteriophages are obligate intracellular parasites that multiply inside bacteria by co-opting some or all of the host biosynthetic machinery (i.e., viruses that infect bacteria). Though different bacteriophages may contain different materials, they all contain nucleic acid and protein, and can under certain circumstances be encapsulated in a lipid membrane. Depending upon the phage, the nucleic acid can be either DNA or RNA (but not both) and can exist in various forms.
(28) As used herein, expression includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
(29) As used herein, an expression control sequence refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operably linked. Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. The term control sequences is intended to encompass, at a minimum, any component whose presence is essential for expression, and can also encompass an additional component whose presence is advantageous, for example, leader sequences.
(30) As used herein, heterologous nucleic acid sequence is any sequence placed at a location in the genome where it does not normally occur. A heterologous nucleic acid sequence may comprise a sequence that does not naturally occur in a bacteriophage, or it may comprise only sequences naturally found in the bacteriophage, but placed at a non-normally occurring location in the genome. In some embodiments, the heterologous nucleic acid sequence is not a natural phage sequence. In certain embodiments, the heterologous nucleic acid sequence is a natural phage sequence that is derived from a different phage. In other embodiments, the heterologous nucleic acid sequence is a sequence that occurs naturally in the genome of a wild-type phage but is then relocated to another site where it does not naturally occur, rendering it a heterologous sequence at that new site.
(31) Homology or identity or similarity refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleobase or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of sequence identity to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity. Two sequences are deemed unrelated or non-homologous if they share less than 40% identity, or less than 25% identity, with each other.
(32) As used herein, a host cell is a bacterial cell that can be infected by a phage to yield progeny phage particles. A host cell can form phage particles from a particular type of phage genomic DNA. In some embodiments, the phage genomic DNA is introduced into the host cell by infecting the host cell with a phage. In some embodiments, the phage genomic DNA is introduced into the host cell using transformation, electroporation, or any other suitable technique. In some embodiments, the phage genomic DNA is substantially pure when introduced into the host cell. In some embodiments, the phage genomic DNA is present in a vector when introduced into the host cell. The definition of host cell can vary from one phage to another. For example, E. coli may be the natural host cell for a particular type of phage, but Klebsiella pneumoniae is not.
(33) As used herein, the term isolated refers to a substance or entity that has been separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting). Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated substances and/or entities are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is pure if it is substantially free of other components.
(34) As used herein, operably linked means that expression control sequences are positioned relative to the nucleic acid of interest to initiate, regulate or otherwise control transcription of the nucleic acid of interest.
(35) As used herein, a phage genome includes naturally occurring phage genomes and derivatives thereof. Generally, the derivatives possess the ability to propagate in the same hosts as the naturally occurring phage. In some embodiments, the only difference between a naturally occurring phage genome and a derivative phage genome is at least one of a deletion and an addition of nucleotides from at least one end of the phage genome (if the genome is linear) or at least one point in the genome (if the genome is circular).
(36) As used herein, the term polynucleotide or nucleic acid means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
(37) As used herein, the term recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the material is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
(38) As used herein, an endogenous nucleic acid sequence in the genome of an organism (or the encoded protein product of that sequence) is deemed recombinant herein if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered. In this context, a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous to the organism (originating from the same organism or progeny thereof) or exogenous (originating from a different organism or progeny thereof). By way of example, a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of an organism, such that this gene has an altered expression pattern. This gene would be recombinant because it is separated from at least some of the sequences that naturally flank it. A nucleic acid is also considered recombinant if it contains any modifications that do not naturally occur in the corresponding nucleic acid in a genome. For instance, an endogenous coding sequence is considered recombinant if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention. A recombinant nucleic acid also includes a nucleic acid integrated into a host cell chromosome at a heterologous site and a nucleic acid construct present as an episome.
(39) As used herein, a recombinant bacteriophage genome is a bacteriophage genome that has been genetically modified by the insertion of a heterologous nucleic acid sequence into the bacteriophage genome. A recombinant bacteriophage means a bacteriophage that comprises a recombinant bacteriophage genome. In some embodiments, the bacteriophage genome is modified by recombinant DNA technology to introduce a heterologous nucleic acid sequence into the genome at a defined site. In some embodiments, the heterologous nucleic acid sequence is introduced with no corresponding loss of endogenous phage genomic nucleotides. In other words, if bases N1 and N2 are adjacent in the wild-type bacteriophage genome, the heterologous nucleic acid sequence is inserted between N1 and N2. Thus, in the resulting recombinant bacteriophage genome, the heterologous nucleic acid sequence is flanked by nucleotides N1 and N2. In some embodiments, endogenous phage nucleotides are removed or replaced during the insertion of the heterologous nucleic acid sequence. For example, in some embodiments, the heterologous nucleic acid sequence is inserted in place of some or all of the endogenous phage sequence which is removed. In some embodiments, endogenous phage sequences are removed from a position in the phage genome distant from the site(s) of insertion of the heterologous nucleic acid sequences.
(40) As used herein, the term sample refers to clinical samples obtained from a subject or isolated microorganisms. In certain embodiments, a sample is obtained from a biological source (i.e., a biological sample), such as tissue, bodily fluid, or microorganisms collected from a subject. Sample sources include, but are not limited to, mucus, sputum, bronchial alveolar lavage (BAL), bronchial wash (BW), whole blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue.
(41) Bacteriophage
(42) Bacteriophage are obligate intracellular parasites that multiply inside bacteria by co-opting some or all of the host biosynthetic machinery. Phages contain nucleic acid and protein, and may be enveloped by a lipid membrane. Depending upon the phage, the nucleic acid genome can be either DNA or RNA but not both, and can exist in either circular or linear forms. The size of the phage genome varies depending upon the phage. The simplest phages have genomes that are only a few thousand nucleotides in size, while the more complex phages may contain more than 100,000 nucleotides in their genome, and in rare instances no more than 500,000 bp. The number and amount of individual types of protein in phage particles will vary depending upon the phage. The proteins function in infection and to protect the nucleic acid genome from environmental nucleases.
(43) Phage genomes come in a variety of sizes and shapes (e.g., linear or circular). Most phages range in size from 24-200 nm in diameter. The capsid is composed of many copies of one or more phage proteins, and acts as a protective envelope around the phage genome. Many phages have tails attached to the phage capsid. The tail is a hollow tube through which the phage nucleic acid passes during infection. The size of the tail can vary and some phages do not even have a tail structure. In the more complex phages, the tail is surrounded by a contractile sheath which contracts during infection of the bacterial host cell. At the end of the tail, phages have a base plate and one or more tail fibers attached to it. The base plate and tail fibers are involved in the binding of the phage to the host cell.
(44) Lytic or virulent phages are phages which can only multiply in bacteria and lyse the bacterial host cell at the end of the life cycle of the phage. The lifecycle of a lytic phage begins with an eclipse period. During the eclipse phase, no infectious phage particles can be found either inside or outside the host cell. The phage nucleic acid takes over the host biosynthetic machinery and phage specific mRNAs and proteins are produced. Early phage mRNAs code for early proteins that are needed for phage DNA synthesis and for shutting off host DNA, RNA and protein biosynthesis. In some cases, the early proteins actually degrade the host chromosome. After phage DNA is made late mRNAs and late proteins are made. The late proteins are the structural proteins that comprise the phage as well as the proteins needed for lysis of the bacterial cell. In the next phase, the phage nucleic acid and structural proteins are assembled and infectious phage particles accumulate within the cell. The bacteria begin to lyse due to the accumulation of the phage lysis protein, leading to the release of intracellular phage particles. The number of particles released per infected cell can be as high as 1000 or more. Lytic phage may be enumerated by a plaque assay. The assay is performed at a low enough concentration of phage such that each plaque arises from a single infectious phage. The infectious particle that gives rise to a plaque is called a PFU (plaque forming unit).
(45) Lysogenic phages are those that can either multiply via the lytic cycle or enter a quiescent state in the host cell. In the quiescent state, the phage genome exists as a prophage (i.e., it has the potential to produce phage). In most cases, the phage DNA actually integrates into the host chromosome and is replicated along with the host chromosome and passed on to the daughter cells. The host cell harboring a prophage is not adversely affected by the presence of the prophage and the lysogenic state may persist indefinitely. The lysogenic state can be terminated upon exposure to adverse conditions. Conditions which favor the termination of the lysogenic state include: desiccation, exposure to UV or ionizing radiation, exposure to mutagenic chemicals, etc. Adverse conditions lead to the production of proteases (rec A protein), the expression of the phage genes, reversal of the integration process, and lytic multiplication.
(46) In some embodiments, a phage genome comprises at least 5 kilobases (kb), at least 10 kb, at least 15 kb, at least 20 kb, at least 25 kb, at least 30 kb, at least 35 kb, at least 40 kb, at least 45 kb, at least 50 kb, at least 55 kb, at least 60 kb, at least 65 kb, at least 70 kb, at least 75 kb, at least 80 kb, at least 85 kb, at least 90 kb, at least 95 kb, at least 100 kb, at least 105 kb, at least 110 kb, at least 115 kb, at least 120 kb, at least 125 kb, at least 130 kb, at least 135 kb, at least 140 kb, at least 145 kb, at least 150 kb, at least 175 kb, at least 200 kb, at least 225 kb, at least 250 kb, at least 275 kb, at least 300 kb, at least 325 kb, at least 350 kb, at least 375 kb, at least 400 kb, at least 425 kb, at least 450 kb, at least 475 kb, or at least 500 kb of nucleic acids.
(47) Phage Engineering Methods of the Present Technology
(48) In one aspect, the present disclosure provides sgRNAs that are useful for making the recombinant bacteriophages. In some embodiments, the sgRNA sequence is selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19.
(49) In another aspect, the present disclosure provides a method for making a recombinant bacteriophage DNA genome in a first bacterial host cell. The first bacterial host cell may be a non-natural bacterial host cell or a natural bacterial host cell for the recombinant bacteriophage. The resulting phage lysate of the first bacterial host cell comprises the recombinant bacteriophage DNA genome.
(50) In some embodiments, the method comprises (a) contacting a first bacteriophage DNA genome with a first sgRNA-CRISPR enzyme complex and a second sgRNA-CRISPR enzyme complex in vivo under conditions where (i) the first sgRNA-CRISPR enzyme complex cleaves a first protospacer sequence within the first bacteriophage DNA genome; and (ii) the second sgRNA-CRISPR enzyme complex cleaves a second protospacer sequence within the first bacteriophage DNA genome to produce a cleaved first bacteriophage DNA genome; and (b) recombining in vivo the cleaved first bacteriophage DNA genome with a heterologous nucleic acid sequence in the presence of a recombination system under conditions to produce the recombinant bacteriophage DNA genome, wherein the first bacterial host cell is infected with the first bacteriophage DNA genome, and wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof. The first bacteriophage DNA genome may be non-recombinant or may contain an alternate recombinant sequence. In any of the above embodiments, the recombination system may be endogenous or non-endogenous to the first bacterial host cell.
(51) The cleaved first bacteriophage DNA genome comprises a first cleaved bacteriophage genomic fragment and a second cleaved bacteriophage genomic fragment (
(52) Additionally or alternatively, in some embodiments of the methods disclosed herein, the homologous 5 flanking region of the heterologous nucleic acid sequence has a length of about 20-30 base pairs (bps), 30-40 bps, 40-50 bps, 50-60 bps, 60-70 bps, 70-80 bps, 80-90 bps, 90-100 bps, 100-110 bps, 110-120 bps, 120-130 bps, 130-140 bps, 140-150 bps, 150-160 bps, 160-170 bps, 170-180 bps, 180-190 bps, 190-200 bps, 200-210 bps, 210-220 bps, 220-230 bps, 230-240 bps, 240-250 bps, 250-260 bps, 260-270 bps, 270-280 bps, 280-290 bps, 290-300 bps, 300-310 bps, 310-320 bps, 320-330 bps, 330-340 bps, 340-350 bps, 350-360 bps, 360-370 bps, 370-380 bps, 380-390 bps, 390-400 bps, 400-410 bps, 410-420 bps, 420-430 bps, 430-440 bps, 440-450 bps, 450-460 bps, 460-470 bps, 470-480 bps, 480-490 bps, 490-500 bps, 500-510 bps, 510-520 bps, 520-530 bps, 530-540 bps, 540-550 bps, 550-560 bps, 560-570 bps, 570-580 bps, 580-590 bps, or 590-600 bps.
(53) Additionally or alternatively, in some embodiments of the methods disclosed herein, the homologous 3 flanking region of the heterologous nucleic acid sequence has a length of about 20-30 base pairs (bps), 30-40 bps, 40-50 bps, 50-60 bps, 60-70 bps, 70-80 bps, 80-90 bps, 90-100 bps, 100-110 bps, 110-120 bps, 120-130 bps, 130-140 bps, 140-150 bps, 150-160 bps, 160-170 bps, 170-180 bps, 180-190 bps, 190-200 bps, 200-210 bps, 210-220 bps, 220-230 bps, 230-240 bps, 240-250 bps, 250-260 bps, 260-270 bps, 270-280 bps, 280-290 bps, 290-300 bps, 300-310 bps, 310-320 bps, 320-330 bps, 330-340 bps, 340-350 bps, 350-360 bps, 360-370 bps, 370-380 bps, 380-390 bps, 390-400 bps, 400-410 bps, 410-420 bps, 420-430 bps, 430-440 bps, 440-450 bps, 450-460 bps, 460-470 bps, 470-480 bps, 480-490 bps, 490-500 bps, 500-510 bps, 510-520 bps, 520-530 bps, 530-540 bps, 540-550 bps, 550-560 bps, 560-570 bps, 570-580 bps, 580-590 bps, or 590-600 bps.
(54) Additionally or alternatively, in some embodiments of the methods disclosed herein, the recombination system is a non-endogenous recombination system that is induced in the first bacterial host cell. The non-endogenous recombination system may include a recombination expression vector that comprises lambda Red proteins Gam, Exo, and Beta operably linked to an inducible promoter. In some embodiments of the methods disclosed herein, the inducible promoter is araB and the non-endogenous recombination system is induced by the addition of arabinose. In some embodiments, the recombination expression vector further comprises the heterologous nucleic acid sequence. In other embodiments, the expression vector comprising the heterologous nucleic acid sequence is separate and distinct from the recombination expression vector comprising lambda Red proteins.
(55) In other embodiments of the methods disclosed herein, the recombination system is a non-endogenous recombination system that includes a recombination expression vector comprising RecET (RecE, RecT) operons operably linked to an inducible promoter, and optionally the heterologous nucleic acid sequence. In some embodiments, the inducible promoter is araB and the non-endogenous recombination system is induced by the addition of arabinose. In other embodiments, the expression vector comprising the heterologous nucleic acid sequence is separate and distinct from the recombination expression vector comprising RecET.
(56) In another embodiment of the methods disclosed herein, the recombination system is a non-endogenous recombination system that includes a recombination expression vector comprising RecA recombinase or a RecA gain-of-function variant operably linked to an inducible promoter and optionally the heterologous nucleic acid sequence. In some embodiments, the recombination system comprises Exo, RecA, and Gam operably linked to an inducible promoter and optionally the heterologous nucleic acid sequence. In some embodiments, the inducible promoter is araB and the non-endogenous recombination system is induced by the addition of arabinose. In other embodiments, the expression vector comprising the heterologous nucleic acid sequence is separate and distinct from the recombination expression vector comprising RecA recombinase or the RecA gain-of-function variant.
(57) Additionally or alternatively, in some embodiments of the methods disclosed herein, the first bacterial host cell comprises a first non-endogenous CRISPR expression vector comprising a nucleic acid sequence that encodes a first sgRNA, a second sgRNA, and a first CRISPR enzyme. In some embodiments, the first sgRNA and the second sgRNA are operably linked to a constitutive promoter. In some embodiments, the sequence of the first sgRNA and the second sgRNA is SEQ ID NO: 16 and SEQ ID NO: 17. In other embodiments, the sequence of the first sgRNA and the second sgRNA is SEQ ID NO: 18 and SEQ ID NO: 19. Additionally or alternatively, in some embodiments, the method further comprises propagating the recombinant bacteriophage DNA genome in the first bacterial host cell, wherein the first bacterial host cell comprises the first non-endogenous CRISPR expression vector. The first CRISPR enzyme may be operably linked to an inducible promoter, such as a tetracycline-inducible promoter.
(58) A variety of CRISPR enzymes are available for use in conjunction with any of the methods of the present disclosure. In some embodiments, the CRISPR enzyme is a Type II or Type I CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DNA cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas9 protein, for instance any naturally-occurring bacterial Cas9 as well as any variants, homologs or orthologs thereof. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologues thereof, or variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at the Protospacer Adjacent Motif (PAM) site.
(59) In some embodiments of the methods disclosed herein, the first protospacer sequence is 5 ACTAAATGAGGATTAAATCA 3 (SEQ ID NO: 6) and the second protospacer sequence is 5 TTACTCTGATGCACTACATG 3 (SEQ ID NO: 7). Additionally or alternatively, in some embodiments, the first sgRNA-CRISPR enzyme complex comprises Cas9 and a first sgRNA having the sequence of SEQ ID NO: 16. Additionally or alternatively, in certain embodiments, the second sgRNA-CRISPR enzyme complex comprises Cas9 and a second sgRNA having the sequence of SEQ ID NO: 17.
(60) In certain embodiments of the methods disclosed herein, the first protospacer sequence is 5 TATATTATACCAGAGAGGCG 3 (SEQ ID NO: 8) and the second protospacer sequence is 5 GAAGTTCTAAGGAGATAACA 3 (SEQ ID NO: 9). Additionally or alternatively, in some embodiments, the first sgRNA-CRISPR enzyme complex comprises Cas9 and a first sgRNA having the sequence of SEQ ID NO: 18. Additionally or alternatively, in certain embodiments, the second sgRNA-CRISPR enzyme complex comprises Cas9 and a second sgRNA having the sequence of SEQ ID NO: 19.
(61) Additionally or alternatively, in some embodiments of the methods disclosed herein, the first bacteriophage DNA genome corresponds to a family or an order selected from the group consisting of Myoviridae, Siphoviridae, Podoviridae, Lipothrixviridae, Rudiviridae, Ampullaviridae, Bucaudaviridae, Clavaviridae, Corticoviridae, Cystoviridae, Fuselloviridae, Globuloviriade, Guttaviridae, Inoviridae, Leviviridae, Mircoviridae, Plasmaviridae, and Tectiviridae. Additionally or alternatively, in some embodiments of the methods disclosed herein, the first bacteriophage DNA genome corresponds to T3, T7, M6, K11, F92, K1-5, or K1F. In some embodiments, the first bacteriophage DNA genome corresponds to K1-5 bacteriophage.
(62) Additionally or alternatively, in some embodiments, the method further comprises enriching for the recombinant bacteriophage DNA genome by causing infected bacterial host cells to block the replication of the first bacteriophage DNA genome, while permitting replication of recombinant bacteriophage DNA genome.
(63) In some embodiments, the method entails propagating the recombinant bacteriophage DNA genome in a second bacterial host cell. In some embodiments of the method, the second bacterial host cell comprises a second non-endogenous CRISPR expression vector comprising a nucleic acid sequence that encodes a second CRISPR enzyme, a third sgRNA, and a fourth sgRNA. In certain embodiments, the third sgRNA and the fourth sgRNA are operably linked to a constitutive promoter. Additionally or alternatively, in some embodiments, the second CRISPR enzyme is operably linked to an inducible promoter (e.g., tetracycline). In some embodiments, the third sgRNA binds to the second CRISPR enzyme to form a third sgRNA-CRISPR enzyme complex, and the fourth sgRNA binds to the second CRISPR enzyme to form a fourth sgRNA-CRISPR enzyme complex. Additionally or alternatively, in some embodiments, the second CRISPR enzyme is Cas9. In any of the above embodiments of the method, the third sgRNA-CRISPR enzyme complex and the fourth sgRNA-CRISPR enzyme complex (a) do not cleave the recombinant bacteriophage DNA genome and (b) cleave the first bacteriophage DNA genome. In certain embodiments, the sequence of the third sgRNA is identical to the sequence of the first sgRNA, and/or the sequence of the fourth sgRNA is identical to the sequence of the second sgRNA.
(64) In some embodiments of the method, the second bacterial host cell comprises a non-endogenous Cascade complex expression vector comprising a nucleic acid sequence that encodes a casABCDE operon, and Cas3 nuclease. Cas3 is an HD-nuclease fused to DEAD-box helicase, and exhibits ssDNA endonuclease and exonuclease activity and helicase activity. In some embodiments, the casABCDE operon and Cas3 nuclease are operably linked to an inducible promoter (e.g., tetracycline) or a constitutive promoter (T7 promoter).
(65) Additionally or alternatively, in some embodiments, the second bacterial host cell comprises a non-endogenous CRISPR RNA (crRNA) spacer array comprising one or more crRNA spacers that (a) induce cleavage in the first bacteriophage DNA genome and (b) do not induce cleavage in the recombinant bacteriophage DNA genome. In some embodiments, the crRNA spacer array is operably linked to a constitutive promoter (e.g., T7 promoter). Each crRNA spacer is complementary to a target sequence that is present within the first bacteriophage DNA genome, and is flanked by direct repeat sequences that serve as recognition/cleavage sites for CasE. The CasE-processed crRNA spacer serves as guide RNAs for Cas3 nuclease and specifies which genome sequence is targeted for endonucleolytic and/or exonucleolytic DNA cleavage by Cas3, thereby blocking the replication of the first bacteriophage DNA genome. The crRNAs do not induce cleavage in the recombinant bacteriophage DNA genome because these cleavage sites were restored in the recombinant bacteriophage DNA genome with codon reassigned equivalents. Codon-reassigned equivalents are sufficiently different so as to prevent them from being recognized by crRNAs.
(66) Accurate identification of bacterial species within a biological sample informs the selection of suitable therapies for treating bacterial infections. Recombinant bacteriophage generated using the methods disclosed herein, may be used to identify bacteria present within a biological sample (e.g., whole blood, plasma, serum). Such methods entail contacting the biological sample with a recombinant bacteriophage generated using the methods disclosed herein, and detecting the presence of bacterial host cells infected by the recombinant phage, wherein the recombinant phage comprises a heterologous nucleic acid that encodes a detectable gene product, thereby leading to the identification of bacteria present within the biological sample.
(67) Additionally or alternatively, recombinant bacteriophage generated using the methods disclosed herein, may be used in methods for profiling antibiotic susceptibility of bacteria present within a biological sample (e.g., whole blood, plasma, serum). These methods include (a) contacting the biological sample with an antibiotic and a recombinant bacteriophage generated using the methods disclosed herein, (b) detecting the presence of bacterial host cells infected by the recombinant phage, wherein the recombinant phage comprises a heterologous nucleic acid that encodes a detectable gene product, and (c) determining that the antibiotic is effective in inhibiting the bacteria present in the biological sample when the number of recombinant phage infected bacterial host cells is reduced relative to that observed in an untreated control sample.
(68) Heterologous Nucleic Acids
(69) In any of the above embodiments of the methods disclosed herein, the heterologous nucleic acid comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof. In some embodiments, the encoded gene product(s) produces a detectable signal upon exposure to the appropriate stimuli, and the resulting signal permits detection of bacterial host cells infected by the recombinant phage. In certain embodiments, the open reading frame encodes a protein that serves as a marker that can be identified by screening bacterial host cells infected by a recombinant phage comprising a heterologous nucleic acid sequence comprising the open reading frame. Examples of such markers include by way of example and without limitation: a fluorescent label, a luminescent label, a chemiluminescence label, or an enzymatic label. In some embodiments, the heterologous nucleic acid sequence further comprises sequences naturally found in the bacteriophage, but placed at a non-normally occurring location in the genome.
(70) In some embodiments of the methods disclosed herein, the length of the heterologous nucleic acid sequence is at least 100 bases, at least 200 bases, at least 300 bases, at least 400 bases, at least 500 bases, at least 600 bases, at least 700 bases, at least 800 bases, at least 900 bases, at least 1 kilobase (kb), at least 1.1 kb, at least 1.2 kb, at least 1.3 kb, at least 1.4 kb, at least 1.5 kb, at least 1.6 kb, at least 1.7 kb, at least 1.8 kb, at least 1.9 kb, at least 2.0 kb, at least 2.1 kb, at least 2.2 kb, at least 2.3 kb, at least 2.4 kb, at least 2.5 kb, at least 2.6 kb, at least 2.7 kb, at least 2.8 kb, at least 2.9 kb, at least 3.0 kb, at least 3.1 kb, at least 3.2 kb, at least 3.3 kb, at least 3.4 kb, at least 3.5 kb, at least 3.6 kb, at least 3.7 kb, at least 3.8 kb, at least 3.9 kb, at least 4.0 kb, at least 4.5 kb, at least 5.0 kb, at least 5.5 kb, at least 6.0 kb, at least 6.5 kb, at least 7.0 kb, at least 7.5 kb, at least 8.0 kb, at least 8.5 kb, at least 9.0 kb, at least 9.5 kb, at least 10 kb, or more. In certain embodiments, the heterologous nucleic acid sequence comprises a length that is less than or equal to a length selected from the group consisting of 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, and 10 kb. In some embodiments, the heterologous nucleic acid sequence comprises a length that is less than or equal to the maximum length of heterologous nucleic acid sequence that can be packaged into a phage particle comprising the phage genome.
(71) In some embodiments, the length of the heterologous nucleic acid sequence is from 100 to 500 bases, from 200 to 1,000 bases, from 500 to 1,000 bases, from 500 to 1,500 bases, from 1 kb to 2 kb, from 1.5 kb to 2.5 kb, from 2.0 kb to 3.0 kb, from 2.5 kb to 3.5 kb, from 3.0 kb to 4.0 kb, from 3.5 kb to 4.5 kb, from 4.0 kb to 5.0 kb, from 4.5 kb to 5.5 kb, from 5.0 kb to 6.0 kb, from 5.5 kb to 6.5 kb, from 6.0 kb to 7.0 kb, from 6.5 kb to 7.5 kb, from 7.0 kb to 8.0 kb, from 7.5 kb to 8.5 kb, from 8.0 kb to 9.0 kb, from 8.5 kb to 9.5 kb, or from 9.0 kb to 10.0 kb.
(72) In some embodiments, the heterologous nucleic acid sequence is inserted into the phage genome with no loss of endogenous phage genomic sequence. In some embodiments, the heterologous nucleic acid sequence replaces an endogenous phage genomic sequence. In some embodiments, the heterologous nucleic acid sequence includes an endogenous phage genomic sequence that was previously excised from the phage genome.
(73) In certain embodiments, the heterologous nucleic acid sequence replaces an endogenous phage genomic sequence that is less than the length of the heterologous nucleic acid sequence. Accordingly, in some embodiments, the length of the recombinant phage genome is longer than the length of the wild-type phage genome. In some embodiments, the heterologous nucleic acid sequence replaces an endogenous phage genomic sequence that is greater than the length of the heterologous nucleic acid sequence. Thus, in some embodiments, the length of the recombinant phage genome is shorter than the length of the wild-type phage genome. In certain embodiments, the heterologous nucleic acid sequence replaces an endogenous phage genomic sequence that is equal to the length of the heterologous nucleic acid sequence.
(74) In certain embodiments, the open reading frame of the heterologous nucleic acid encodes a protein that confers a phenotype of interest on a host cell infected by a recombinant phage expressing the heterologous nucleic acid. In some embodiments, the phenotype of interest is the expression of the gene product encoded by the open reading frame of the heterologous nucleic acid.
(75) In certain embodiments, the open reading frame of the heterologous nucleic acid is operably linked to an expression control sequence that is capable of directing expression of the open reading frame, wherein the open reading frame encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof. In some embodiments, the expression control sequence is located within the heterologous nucleic acid sequence. In other embodiments, the expression control sequence is located in the endogenous phage genome sequence. For example, the open reading frame may be inserted into the phage genome downstream of or in the place of an endogenous phage open reading frame sequence. In some embodiments, the expression control sequence is an inducible promoter or a constitutive promoter (e.g., sarA promoter or 1pp promoter). See e.g., Djordjevic & Klaenhammer, Methods in Cell Science 20(1):119-126 (1998). The inducible promoter or constitutive promoter may be an endogenous phage promoter sequence, a non-endogenous phage promoter sequence, or a bacterial host promoter sequence. Additionally or alternatively, in some embodiments, the inducible promoter is a pH-sensitive promoter, or a temperature sensitive promoter.
(76) In some embodiments, the heterologous nucleic acid sequence comprises a first open reading frame and at least one supplemental open reading frame. In certain embodiments, the first and the at least one supplemental open reading frames are operably linked to the same expression control sequences. In some embodiments, the first and the at least one supplemental open reading frames are operably linked to different expression control sequences.
(77) Fluorescent proteins include but are not limited to blue/UV fluorescent proteins (for example, TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, and T-Sapphire), cyan fluorescent proteins (for example, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, and mTFP1), green fluorescent proteins (for example, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, and mWasabi), yellow fluorescent proteins (for example, EYFP, Citrine, Venus, SYFP2, and TagYFP), orange fluorescent proteins (for example, Monomeric Kusabira-Orange, mKOK, mKO2, mOrange, and mOrange2), red fluorescent proteins (for example, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, and mRuby), far-red fluorescent proteins (for example, mPlum, HcRed-Tandem, mKate2, mNeptune, and NirFP), near-IR fluorescent proteins (for example, TagRFP657, IFP1.4, and iRFP), long stokes-shift proteins (for example, mKeima Red, LSS-mKate1, and LSS-mKate2), photoactivatable fluorescent proteins (for example, PA-GFP, PAmCherry1, and PATagRFP), photoconvertible fluorescent proteins (for example, Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, and PSmOrange), fluorescein, rhodamine, and photoswitchable fluorescent proteins (for example, Dronpa).
(78) Examples of bioluminescent proteins are aequorin (derived from the jellyfish Aequorea victoria) and luciferases (including luciferases derived from firefly and Renilla, nanoluciferase, red luciferase, luxAB, and the like). These proteins have also been genetically separated into two distinct functional domains that will generate light only when the protein domains are closely co-localized. A variety of emission spectrum-shifted mutant derivatives of both of these proteins have been generated over the past decade and have been used for multi-color imaging and co-localization within a living cell.
(79) Examples of chemiluminescent protein include -galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase. Peroxidases generate peroxide that oxidizes luminol in a reaction that generates light, whereas alkaline phosphatases remove a phosphate from a substrate molecule, destabilizing it and initiating a cascade that results in the emission of light.
(80) In some embodiments, the open reading frame of the heterologous nucleic acid comprises an epitope that can be detected with an antibody or other binding molecule. For example, an antibody that recognizes the epitope may be directly linked to a signal generating moiety (such as by covalent attachment of a chemiluminescent or fluorescent protein), or can be detected using at least one additional binding reagent such as a secondary antibody, directly linked to a signal generating moiety. In some embodiments, the epitope is absent in wild-type bacteriophage and the bacterial host cell. Accordingly, detection of the epitope in a sample demonstrates the presence of a bacterial host cell infected by a recombinant phage comprising a heterologous nucleic acid, wherein the open reading frame of the heterologous nucleic acid comprises the epitope. In other embodiments, the open reading frame of the heterologous nucleic acid comprises a polypeptide tag sequence, such that the expression product of the open reading frame comprises the tag fused to a polypeptide or protein encoded by the open reading frame (e.g., poly-histidine, FLAG, Glutathione S-transferase (GST) etc.).
(81) In some embodiments, the open reading frame of the heterologous nucleic acid sequence comprises a biotin binding protein such as avidin, streptavidin, or neutrAvidin that can be detected with a biotin molecule conjugated to an enzyme (e.g., -galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase) or an antibody. In some embodiments, the antibody conjugated to a biotin molecule may be directly linked to a signal generating moiety (such as by covalent attachment of a chemiluminescent or fluorescent protein), or can be detected using at least one additional binding reagent such as a secondary antibody, directly linked to a signal generating moiety.
(82) Kits
(83) The present technology provides kits for integrating a heterologous nucleic acid sequence into a bacteriophage DNA genome.
(84) In one aspect, the kits of the present technology comprise (a) one or more coded/labeled vials that contain a plurality of bacteriophage DNA genomes, and (b) at least one CRISPR expression vector. The kits may optionally comprise a non-endogenous recombination system, a non-endogenous Cascade complex expression vector, a non-endogenous crRNA spacer array, and/or a heterologous nucleic acid.
(85) Additionally or alternatively, in some embodiments, the kits further comprise vials containing natural or non-natural bacterial host cells that can be, or are transformed with the CRISPR expression vector, the Cascade complex expression vector, the crRNA spacer array, the heterologous nucleic acid, and/or the non-endogenous recombination system disclosed herein. In some embodiments, the bacterial host cells are E. coli. In certain embodiments, the bacterial host cells are E. coli strain DH10.
(86) In some embodiments, each coded/labeled vial containing a plurality of bacteriophage DNA genomes corresponds to a different bacteriophage type. In other embodiments, each coded/labeled vial containing a plurality of bacteriophage DNA genomes corresponds to the same bacteriophage type. In some embodiments, each phage vial is assigned a unique code that identifies the bacteriophage in the phage vial, or the types of bacteria that the bacteriophage strain infects. The unique code can be encoded by a machine discernible pattern, such as a bar code, a QR code, an alphanumeric string, or any other pattern that can be discerned by a reader. Each unique code may be shown as, for example, a bar code sticker on a vial or container storing a corresponding phage sample. In some embodiments, the kit is stored under conditions that permit the preservation of the bacteriophage DNA genomes for extended periods, such as under bacteriophage-specific, controlled temperature, moisture, and pH conditions.
(87) Additionally or alternatively, in some embodiments, the at least one CRISPR expression vector of the kits of the present technology comprises a nucleic acid sequence that encodes one or more sgRNAs, and a CRISPR enzyme. The CRISPR enzyme may be selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4, and may be operably linked to an inducible promoter. In some embodiments, the at least one CRISPR expression vector of the kits of the present technology comprises a first sgRNA comprising the sequence of SEQ ID NO: 16 and a second sgRNA comprising the sequence of SEQ ID NO: 17. In other embodiments, the at least one CRISPR expression vector of the kits of the present technology comprises a first sgRNA comprising the sequence of SEQ ID NO: 18 and a second sgRNA comprising the sequence of SEQ ID NO: 19.
(88) Additionally or alternatively, in some embodiments, the non-endogenous recombination system of the kits of the present technology may include a recombination expression vector that comprises (a) lambda Red proteins Gam, Exo, and Beta operably linked to an inducible promoter, and (b) optionally the heterologous nucleic acid sequence. In certain embodiments, the non-endogenous recombination system may include a recombination expression vector that comprises (a) RecA (e.g., Exo, RecA, and Gam) or a RecA gain-of-function variant operably linked to an inducible promoter, and (b) optionally the heterologous nucleic acid sequence. In other embodiments, the non-endogenous recombination system may include a recombination expression vector that comprises (a) RecET (RecE, RecT) operons operably linked to an inducible promoter, and (b) optionally the heterologous nucleic acid sequence. In any of the above embodiments of the non-endogenous recombination system, the inducible promoter is araB and the non-endogenous recombination system is induced by the addition of arabinose. Additionally or alternatively, in some embodiment, the expression vector comprising the heterologous nucleic acid sequence is separate and distinct from the recombination expression vector comprising lambda Red proteins, RecET, or RecA or a RecA gain-of-function variant.
(89) Additionally or alternatively, in some embodiments, the non-endogenous Cascade complex expression vector of the kits disclosed herein comprises a nucleic acid sequence that encodes a casABCDE operon, and Cas3 nuclease. In some embodiments, the casABCDE operon and Cas3 nuclease are operably linked to an inducible promoter or a constitutive promoter.
(90) Additionally or alternatively, in some embodiments, the non-endogenous crRNA spacer array of the kits disclosed herein comprise one or more spacers that (a) induce cleavage in the first bacteriophage DNA genome (e.g., wild-type bacteriophage genome) and (b) do not induce cleavage in the recombinant bacteriophage DNA genome. In some embodiments, the crRNA spacer array is operably linked to a constitutive promoter.
(91) In some embodiments, the kits further comprise positive control heterologous nucleic acid sequences to correct for any variability in the recombination systems between experimental runs. The kits may also comprise instructions for use, software for automated analysis, containers, packages such as packaging intended for commercial sale and the like.
(92) The kit may further comprise one or more of: wash buffers and/or reagents, hybridization buffers and/or reagents, labeling buffers and/or reagents, and detection means. The buffers and/or reagents are usually optimized for the particular detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit. Further optional components of the kits may include expression media for gene products encoded by the heterologous nucleic acids disclosed herein, such as a medium containing nutrients and cofactors for bioluminescence, devices such as a lamp configured to illuminate at specific wavelengths of light to detect biofluorescence, and devices for measuring the extent of heterologous nucleic acid expression, such as a photometer or photodetector.
(93) Additionally or alternatively, in some embodiments, the kits comprise one or more sgRNA sequences selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19.
EXAMPLES
Example 1: Generation of Recombinant K1-5 Bacteriophages Using the Methods of the Present Technology
(94) This Example demonstrates that the methods of the present technology are useful for making recombinant bacteriophages in a bacterial host cell.
(95) Experimental Design.
(96) When designing the donor template, it was necessary to eliminate the protospacer sites via codon reassignment to prevent Cas9 cleavage of recombinant K1-5 phage. Codon reassignment was used in the donor template to obviate sgRNA recognition, but still encode the same protein (
(97) TABLE-US-00001 sgRNA86 ACTAAATGAGGATTAAATCATGG(SEQIDNO:12) sgRNA89 TTACTCTGATGCACTACATGAGG(SEQIDNO:13) sgRNA1112 TATATTATACCAGAGAGGCGAGG(SEQIDNO:14) sgRNA1122 GAAGTTCTAAGGAGATAACATGG(SEQIDNO:15)
(98) The complete sequences of sgRNA 86, sgRNA 89, sgRNA 1112 and sgRNA 1122 are provided below:
(99) TABLE-US-00002 sgRNA86sequence: (SEQIDNO:16) ACUAAAUGAGGAUUAAAUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU UUUUU sgRNA89sequence: (SEQIDNO:17) UUACUCUGAUGCACUACAUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU UUUUU sgRNA1112sequence: (SEQIDNO:18) UAUAUUAUACCAGAGGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUA AGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU sgRNA1122sequence: (SEQIDNO:19) GAAGUUCUAAGGAGAUAACAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU UUUUU
(100) To ensure that the 5 and 3 flanking regions of the donor template were in fact perfectly homologous to the regions adjacent to the cleavage sites, codon reassignment was only done on sequences located to the right of the upstream cut site or to the left of the downstream cut site.
(101)
(102) The CRISPR expression vector and recombination expression vector were designed to cleave a non-recombinant phage genome at two locations after the bacterial host cell containing both these expression vectors had been infected with a non-recombinant K1-5 bacteriophage. Once cleaved, the ends were acted upon by recombination proteins that facilitated recombination between the phage genome and the donor template region present on the recombination plasmid. This process repaired the double strand breaks, while simultaneously inserting the nanoluciferase gene into the K1-5 phage genome. The recombinant K1-5 phage was not susceptible to Cas9 cleavage.
(103) Experimental Conditions. K1 E. coli strains were generated for cleaving and recombining at locations specified by either sgRNAs 86+89 or sgRNAs 1112+1122. Cells were maintained with 50 g/mL kanamycin (for the CRISPR expression vector) and 10 pg/mL gentamicin (for the recombination expression vector). Cells were grown while shaking at 37 C. to OD.sub.6000.6 and were then subjected to various induction treatments. Cultures were either (1) not induced, (2) induced with 100 ng/mL anhydrotetracycline (aTc) to activate Cas9 expression, (3) induced with 0.2% arabinose to activate lambda red operon expression, or (4) induced with both 100 ng/mL anhydrotetracycline and 0.2% arabinose to activate expression of Cas9 and lambda red genes. Induction was carried out for 2 hours while shaking at 37 C.
(104) K1-5 lysate was then used to infect 200 L cultures of each bacterial strain/induction condition at 10.sup.6, 10.sup.4, and 10.sup.2 PFU. This infection was given 10 minutes for the phage to adsorb before being added to 3 mL of 0.65% LB top agar. The appropriate inducer was spiked into each top agar tube to maintain induction. The top agar was then spread over an LB agar plate containing the appropriate antibiotics to maintain the CRISPR and recombination expression vectors. The agar plates were incubated in an airtight container for approximately 16 hours at 37 C. Plates with top agar containing phage were washed in LB broth to collect the phage. These plate lysates were used as templates for PCR reactions that assayed for a recombinant junction (spanning from an internal site within the nanoluciferase insertion to a site in the phage genome) and a flanking product (primed from 2 sites flanking the insertion site).
(105) Genotypic Analysis. Without wishing to be bound by theory, it is believed that continual replication of recombinant K1-5 phage through a bacterial strain that only contained an inducible CRISPR expression vector (but no recombination expression vector) would enrich for the recombinant K1-5 phage because recombinant K1-5 phage would have used the donor template for repairing double-stranded breaks (the donor template utilized altered protospacers that do not exactly match the sgRNAs used for cleaving non-recombinant K1-5 phage genomic DNA) and is thus not susceptible to Cas9 cleavage, whereas wild-type phage would be targeted by the sgRNAs without a means to repair the double-stranded breaks.
(106) A lysate containing a mixed population of recombinant and wild-type K1-5 bacteriophage was collected following the BAR (Break and Recombine) experiment described above, which was not 100% efficient.
(107) A 5 mL culture of strain K1 E. coli containing the inducible Cas9 endonuclease and constitutively expressed sgRNAs (86+89) or sgRNAs (1112+1122) were grown under kanamycin selection (50 g/mL) to OD.sub.6000.6. The culture was then induced with 100 ng/mL anhydrotetracycline for 1 hour at 37 C. while shaking to induce Cas9 expression. Next, 50 L of the previously collected mixed-population lysates (i.e., Cas9 induced, lambda red induced, or Cas9+lambda red induced plate lysates) were used to infect the pre-induced cutting strain for three hours. During the infection step, the Cas9-sgRNA complexes were expected to cleave the locations specified by sgRNAs 86+89 or sgRNAs 1112+1122 that are present in wild-type phage, but are not present in recombinants. A lysate from this culture was then clarified and used as a template for junctional and flanking PCR. The phage population after this enrichment step was assessed by PCR. The relative abundance of recombinant phage increased after this treatment.
(108) Results.
(109) As shown in
(110) As shown in
(111) After passage through an ampicillin-resistant K1 E. coli culture, a lysate for both the recombinant NanoLuc K1-5 phage modified at sgRNA sites 86+89 and recombinant NanoLuc K1-5 phage modified at sgRNA sites 1112+1122 was used to infect wild-type K1 E. coli which was plated in a bacterial overlay on LB. Single plaques were isolated and a region spanning the recombination site was amplified via PCR and submitted for Sanger sequencing.
(112) These results demonstrate that the methods of the present technology are useful for making the recombinant bacteriophages disclosed herein in a bacterial host cell. Accordingly, the methods disclosed herein are useful for generating recombinant bacteriophages that can be used in the identification and/or antibiotic susceptibility profiling of specific bacterial strains/species present in a sample.
Example 2: Generation of Recombinant K1-5 Bacteriophages Using the Methods of the Present Technology
(113) Variants of the in vivo phage engineering methodology described in Example 1 was evaluated by attempting to insert the NanoLuc luciferase gene into a non-recombinant K1-5 phage genome at the insertion sites specified by sgRNAs 86 and 89 using different recombination proteins. The exact same CRISPR expression vector and donor template region described in Example 1 were used in this variant systems.
(114) The CRISPR expression vector comprised a S. pyogenes Cas9 endonuclease operably linked to an anhydrotetracycline-inducible promoter, and two sgRNAs (sgRNA86 and sgRNA 89) operably linked to the constitutive J23119 promoter. The recombination expression vectors included a donor template region comprising the NanoLuc luciferase gene along with 5 and 3 homologous flanking regions of approximately 300 bp.
(115) The recombination expression vectors contained (1) an arabinose-inducible lambda red operon (Exo, Beta, Gam), (2) an arabinose-inducible Exo, RecA, Gam operon, or (3) no exogenous recombination protein sequences. Bacterial strains containing both the CRISPR expression vector and one of the three recombination expression vectors were grown in 5 mL cultures with 10 mM MgSO.sub.4 under antibiotic selection to OD.sub.600 of 0.4. These cultures were then split into 1 mL cultures which were induced with 100 ng/mL anhydrotetracycline (aTc), 0.2% arabinose, both, or neither. All cultures were then infected with 10.sup.5 PFU of non-recombinant K1-5 phage overnight at 37 C. while shaking. The following day, cells and debris were removed by centrifugation to obtain 1 L of phage lysate that could be assayed via flanking PCR. The relative abundance of wild-type and recombinant K1-5 phage could be determined by assessing the differences in the amplicon size: 864 bp for wild-type K1-5 phage and 1406 bp for recombinant K1-5 phage.
(116)
(117) These results demonstrate that the methods of the present technology are useful for making the recombinant bacteriophages disclosed herein in a bacterial host cell. Accordingly, the methods disclosed herein are useful for generating recombinant bacteriophages that can be used in the identification and/or antibiotic susceptibility profiling of specific bacterial strains/species present in a sample.
Example 3: Functional Activity of the Recombinant Bacteriophages
(118) To ensure that the genotypically recombinant K1-5 phage described herein are capable of expressing nanoluciferase during active infection, plate lysates were used infect 5 mL cultures of K1 E. coli housing the ampicillin-resistant pUC19 plasmid. The kanamycin and gentamicin resistant strains harboring the CRISPR expression vector and recombination expression vectors would therefore be killed off, or at least strongly selected against, such that any background nanoluciferase expression attributable to the donor template would be minimized. After three hours of infection under ampicillin selection, the lysate was subjected to limiting dilutions to ensure that any residual NanoLuc protein or NanoLue-expressing cells were diluted out, and that any luminescence detected during a subsequent infection was due to active infection by the recombinant K1-5 phages of the present technology.
(119) Briefly, a tenfold dilution series of lysates were used to infect K1 E. coli maintained under ampicillin selection for one hour. In round one, the cutoff for recombinant K1-5 phage being present was observed at 1.0 E-8. See
(120) Plaques containing the recombinant K1-5 bacteriophages disclosed herein were used to infect a host population of K1 E. coli for one-hour. The infected bacterial host cells exhibited luminescence that was at least four-five orders of magnitude above the background level. See
(121) As shown in
Example 4: Enrichment of Recombinant Bacteriophages Using Cas3/Cascade Complex
(122) This Example provides a counter-selection process to enrich for recombinant K1-5 bacteriophage, and utilizes a CRISPR Type I-E counter-selection system. This counter-selection process requires a K1 E. coli strain containing a plasmid containing the CRISPR-Cascade proteins (Cascade complex) and a plasmid containing site-specific crRNA-spacer elements (targeting plasmid). See
(123) It is anticipated that the methods of the present technology will enrich for recombinant bacteriophage. These results demonstrate that the methods of the present technology are useful for making the recombinant bacteriophages disclosed herein in a bacterial host cell.
EQUIVALENTS
(124) The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
(125) In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
(126) As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as up to, at least, greater than, less than, and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.
(127) All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.