METHOD OF CONSTRUCTING ZEBRAFISH notch1a MUTANTS

Abstract

A method of constructing a zebrafish notch1a mutant using CRISPR/Cas9 technique. The method includes: determining a target for knocking out notch1a; using primers T7-notch1a-sfd and tracr rev for PCR amplification with a pUC19-gRNA scaffold plasmid as a template; transcribing PCR product in vitro followed by purification to obtain gRNA; and microinjecting the gRNA and a Cas9 mRNA into a zebrafish embryo followed by culture to obtain an notch1a mutant of stable inheritance. The invention selects a specific target and utilizes CRISPR/Cas9 technique to knock out the notch1a in the zebrafish without destroying other genes, generating the zebrafish notch1a mutant. Moreover, the invention also discloses the phenotype of the zebrafish notch1a mutant, which plays a significant role in studying the effect of the Notch1a receptor in the Notch signaling pathway.

Claims

1. A method of preparing a zebrafish notch1a mutant, comprising: (1) determining a target for knocking out notch1a on the 16th exon of a sequence of the zebrafish notch1a; (2) designing a primer for amplification according to a sequence of the target determined in step 1; (3) using primers T7 -notch1a-sfd and tracr rev for PCR amplification with a pUC19-gRNA scaffold plasmid as a template; (4) transcribing PCR product obtained in step 3 in vitro followed by purification to obtain gRNA; (5) using a pXT7-hCas9 plasmid as a template to synthesize Cas9 mRNA by in-vitro transcription; (6) microinjecting the gRNA and the Cas9 mRNA into a one-cell stage zebrafish embryo; and (7) culturing the embryo obtained in step 6 to obtain a zebrafish notch1a mutant of stable inheritance.

2. The method of claim 1, wherein in step 2, the sequence of the target is shown as SEQ ID NO. 1.

3. The method of claim 1, wherein in step 3, a sequence of the primer T7-notch1a-sfd is shown as SEQ ID NO. 2.

4. The method of claim 1, wherein in step 3, a sequence of the primer tracr rev is shown as SEQ ID NO. 3.

5. The method of claim 1, wherein in step 5, the Cas9 mRNA is prepared by a method comprising: (i) linearizing the pXT7-hCas9 plasmid and digesting the linearized pXT7-hCas9 plasmid with Xba I endonuclease; (ii) purifying the digested product using a DNA Clean&Contentrator TM-5 purification kit; (iii) transcribing the Cas9 mRNA in vitro using an mMESSAGE mMACHINE T7 ULTRA transcription kit; and (iv) tailing the transcribed product and determining a concentration using Nanodrop 2000c followed by storage at 80 C. for use.

6. The method of claim 1, wherein step 6 further comprises: mixing the gRNA with the Cas9 mRNA to produce a mixture and microinjecting the mixture into the one-cell stage zebrafish embryo; wherein a final concentration of the gRNA is 100 ng/L and a final concentration of the Cas9 mRNA is 400 ng/L.

7. The method of claim 1, wherein step 7 further comprises: (i) performing a notch1a knockout detection on the zebrafish introduced with the gRNA and the Cas9 mRNA to determine mutation efficiency of the target of notch1a in F.sub.0 zebrafish; (ii) outcrossing a notch1a-knockout F.sub.0 adult zebrafish with a wild-type zebrafish to generate an F.sub.1 embryo and identifying a genotype of the F.sub.1 embryo; wherein the F.sub.1 embryo is identified to be an F.sub.1 zebrafish notch1a mutant; (iii) incrossing the same F.sub.1 notch1a zebrafish mutants to obtain an F.sub.2 notch1a zebrafish mutant; and (iv) identifying a genotype of the F.sub.2 notch1a zebrafish mutant; wherein a homozygous lethal phenomenon is observed in a homozygous F.sub.2 notch1a-knockout zebrafish mutant and the heterozygous F.sub.2 notch1a-knockout zebrafish mutant is the notch1a zebrafish mutant of stable inheritance.

8. The method of claim 7, wherein in step (i), primers used in the notch1a knockout detection have sequences shown as SEQ ID NO. 4 and SEQ ID NO. 5.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIGS. 1a-1c schematically show the detection of notch1a knockout in F.sub.0 zebrafish. (a) shows a PCR product of notch1a in F.sub.0 zebrafish embryo; (b) shows the identification results of T7E1 endonuclease digestion; and (c) shows the sequencing result of the PCR product.

[0040] FIG. 2 shows the four notch1a mutation types in F.sub.1 zebrafish.

[0041] FIG. 3 shows the phenotypic identification of a homozygous F.sub.2 notch1a mutant involving 31 bp deletion.

[0042] FIG. 4 shows the phenotypic identification of F.sub.2 homozygous mutants of four different notch1a mutation types;

[0043] FIG. 5 shows the phenotype of somite and intersegmental blood vessel disorders in the notch1a mutant.

DETAILED DESCRIPTION OF EMBODIMENTS

[0044] The invention is further described with reference to the following embodiments. The following embodiments may help those skilled in the art to further understand the invention, but are not intended to limit the invention. It should be noted that various adjustments and improvements made by those skilled in the art without departing from the spirit of the invention should still fall within the scope of the invention.

EXAMPLE

1. Materials and Instruments

[0045] 1.1 Zebrafish

[0046] The zebrafish used in this experiment were all AB strains and purchased from the Zebrafish Platform of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.

[0047] 1.2 Plasmid

[0048] pXT7-hCas9 plasmid and pUC19-gRNA scaffold plasmid were referred to a literature (Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos, Cell Res, 2013, 23 (4): 465-472).

[0049] 1.3 Reagents

[0050] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004); Ordinary DNA Purification Kit (TIANGEN BIOTECH CO., Ltd., DP204-03), MAXIscriptt T7 in vitro Transcription Kit (Ambion, AM1314); Anhydrous Ethanol (Sinopharm Chemical Reagent Co., Ltd., 10009218); GenCrispr NLS-Cas9-NLS (GenScript, 203389-25); Premix Taq (Ex Taq Version 2.0 plus dye) (TAKARA, RR902); DNA Marker I (TIANGEN BIOTECH CO., Ltd., MD101-02), T7 endonuclease 1 (NEW ENGLAND BioLab Inc., M0302L); Rapid Plasmid Miniprep Kit (TIANGEN BIOTECH CO., Ltd., DP105); DH5, Competent Cells (TIANGEN BIOTECH CO., Ltd., CB101-03), LB Broth (Sangon Biotech (Shanghai) Co., Ltd., D915KA6602); LB Broth agar (Sangon Biotech (Shanghai) Co., Ltd., D9111CAL6566); and pMDTM19-T Vector Cloning Kit (TAKARA, 6013).

[0051] 1.4 Instruments

[0052] PCR instrument (BIO-RAD, c1000 Touch Thermal Cycler); Centrifuge (Eppendorf, Centrifuge 5424); Vortex mixer (VORTEX-GENIE, G560E); Spectrophotometer (Thermo Scientific, Nanodrop 2000c); Electrophoresis instrument (BIO-RAD, PowerPac Basic); Gel imager (BIO-RAD, Gel Doc EZ Imager); Electronic balance (METTLER TOLEDO, AL 104); Glass capillary (WPI, TW100F-4); Pure water system (Millipore, Milli-Q Direct 8); Vertical puller (NARISHIGE, PC-10); Thermostatic shaker (Innova, 40R), Microgrinder (NARISHIGE, EG-400), Micromanipulator (Warner Instruments. PL1-100A Plus); Thermostatic water bath (Shanghai Jing Hong Laboratory Instrument Co., Ltd., H1401438, DK-8D); 4 C. Refrigerator (Haier, HYC-610); 40 C. Low-temperature refrigerator (Haier, DW-40L508); 80 C. Ultra-low temperature freezer (Panasonic, MDF-U53V); and High-pressure Steam Sterilization Pot (SANYO Electric Co., Ltd., MLS-3780).

2 Method

[0053] 2.1 Synthesis of gRNA

[0054] (1) Design of target

[0055] a. Searching of sequence

[0056] The Ensemb1 database was searched and the sequence of notch1a gene in the zebrafish was downloaded.

[0057] b. Design of target

[0058] The target was designed on the 16th exon sequence of the notch1a according to http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx, and was shown in Table 1. The sequence of the target was shown in GGAGTGTGTGAAAACCTGCG (SEQ ID NO.1).

TABLE-US-00001 TABLE1 Targetsitesequenceofnotch1 gene Gene mRNA Number Number Number length/ length/ ofamino of of Gene Chromosome bp bp acids/aa introns exons Targetsequence(5-3) Exon notch1 21 82812 7474 2438 32 33 GGAGTGTGTGAAAACCTGCG 16

[0059] c. Detection for specificity of target

[0060] The designed target sequence was verified for the specificity by blast alignment on the NCBI website.

[0061] d. Detection of parents

[0062] The tail of the wild-type zebrafish used for gene knockout was cut for extraction of genomic DNA. Then the genomic DNA was used to amplify the target and the sequence near the target by PCR.

[0063] e. Detection of digestion

[0064] The sequence near the target in the wild-type zebrafish for gene knockout was detected by T7E1 endonuclease digestion.

[0065] f. Identification by sequencing

[0066] The PCR products were sequenced, and the obtained peak maps and sequences were aligned. The wild-type zebrafish having consistent sequence in this region were used as parents.

[0067] (2) Design of Primers for Detection

[0068] The primers were more than 100 by away from both sides of the target. Moreover, the difference, between the distance, from the upstream primer to the target and the distance from the downstream primer to the target was more than 100 bp. The amplified fragment had a length of about 500 bp (Table 2).

TABLE-US-00002 TABLE2 Informationaboutprimersintheexperiment Length ofthe Fragment digested length/ fragment/ Primer Primersequence(5-3) bp bp T7- TAATACGACTCACTATAGGAGTGTGTGAAAACCTGCGGTTTTA 120 notch1- GAGCTAGAAATAGC(SEQIDNO.2) sfd tracrev AAAAAAAGCACCGACTCGGTGCCAC(SEQIDNO.3) notch1-F CGTGTGAGGTGGACATTA(SEQIDNO.4) 213 144+ 99 notch1-R CATTAGTTAAGTGAGGTGTGAG(SEQIDNO.5)

[0069] (3) Synthesis of gRNA Product

[0070] The pUC19-gRNA scaffold plasmid was used as a template, and the fragment was amplified using primers T7-notch1a-sfd, tract rev and 2EasyTaq PCR Super Mix (+dye), and purified using a kit.

[0071] (4) In Vitro Transcription

[0072] The reaction system was shown in Table 3.

TABLE-US-00003 TABLE 3 Reaction system Nuclease-free Water to 20 L DNA Template 1 g 10 Transcription Buffer 2 L 10 mM ATP 1 L 10 mM CTP 1 L 10 mM GTP 1 L 10 mM UTP 1 L T7 Enzyme Mix 2 L (It should be noted that 10 Transcription Buffer and T7Enzyme Mix were finally added.)

[0073] The reaction system was mixed uniformly, centrifuged for a short time and incubated at 37 C. for 80 minutes. The reaction system was further added with 1 L of TURBO DNase, mixed uniformly, centrifuged for a short time and incubated at 37 C. for 15 minutes.

[0074] (5) Purification of gRNA

[0075] a. To the in vitro transcription system (20 L) were added LiCl (2.5 L, 4 M) and absolute ethanol (100 L). The reaction system was mixed uniformly, centrifuged for a short time and stored in the 80 C. freezer for at least 1 hour.

[0076] b. Then the reaction system was transferred from the freezer and centrifuged at 4 C. and 12,000 rpm for 15 minutes. The supernatant was discarded, and the precipitate was washed with 70% ethanol and centrifuged at 4 C. and 8,000 rpm for 5 minutes. The supernatant was discarded and the centrifuge tube was transferred to a fume hood to allow the complete evaporation of the ethanol.

[0077] c. The gRNA precipitate was dissolved with 10 L of DEPC water.

[0078] d. Concentration of the gRNA was measured using Nanodrop 2000 c.

[0079] 2.2 Microinjection

[0080] The gRNA was mixed with the Cas9 mRNA and injected into the one-cell stage zebrafish embryos using a microinjector. A final concentration of the gRNA was 100 ng/L and a final concentration of the Cas9 mRNA was 40 ng/L.

[0081] 2.3 Detection of Knockout Efficiency by T7E1 Digestion

[0082] a. Extraction of embryo genome

[0083] 5 embryos per group were added with NaOH (35 L, 50 mM) and incubated at 95 C. for 20 minutes. During the incubation, the embryos were taken out and shaken. Then the embryos were added with TrisHCl (3.5 L, 1 M, pH8.0), shaken and centrifuged.

[0084] b. PCR amplification of the target fragment

[0085] The target fragment was amplified using, primers notch1a F (SEQ ID NO. 4) and notch1a R (SEQ ID NO. 5) presented in the table.

[0086] c. T7E1 endonuclease digestion detection

TABLE-US-00004 TABLE 4 T7E1 digestion system H.sub.2O to 10 L PCR product 5 L Buffer 1.1 L

[0087] The system was incubated at 95 C. for 5 minutes, cooled to room temperature, added with 0.25 L of T7E1 enzyme and incubated at 37 C. for 45 minutes.

[0088] d. Electrophoretic detection and knockout efficiency detection

[0089] After electrophoresis, the agarose gel was imaged using a gel electrophoresis imager, and the knockout efficiency was calculated.

[0090] 2.4 Detection of Phenotype of Homozygous F.sub.2 Zebrafish notch1a Mutant

[0091] The F.sub.2 zebrafish notch1a embryos were photographed and the number of embryos showing a phenotype was counted.

[0092] 2.5 Phenotype Counting of Different Mutation Types

[0093] Counting of phenotypes and identification of genotype were performed on F.sub.2 zebrafish embryos of different deletion types.

3 Experimental Results

[0094] 3.1 Construction of notch1a Mutant

[0095] 3.1.1 Results of notch1a Knockout Detection in F.sub.0 Zebrafish

[0096] The results showed that the notch1a gene was successfully knocked out, and the knockout efficiency calculated to be 40% or more by Image Lab 5.1 software. The sequencing peaks showed the presence of overlapping peaks at the 20 bp-length target site, demonstrating the successful knockout (FIGS. 1a-1c).

[0097] 3.1.2 Detection of F.sub.1 Zebrafish notch1a Mutant

[0098] Genotype detection of F.sub.1 zebrafish demonstrated that there was a total of four mutation types, consisting of 4 bp deletion, 10 bp deletion, 19 bp deletion and 31 bp deletion in the vicinity of the target. The early termination will occur when the mutated sequences were used as templates for the encoding of amino acid (FIG. 2). The notch1a can encode 2438 amino acids, while the translation termination occurred at the amino acid residue 947 in the 4 bp-deletion mutant, at the amino acid residue 945 in the 10 bp-deletion mutant, at the amino acid residue 942 in the 19 bp-deletion mutant and at the amino acid residue 938 in the 31 bp-deletion mutant.

[0099] 3.1.3 Detection of F.sub.2 Zebrafish notch1a Mutant

[0100] Statistical analysis of F.sub.2 zebrafish revealed that the notch1a mutation has homozygous lethality and the specific death time was 10-13 days post fertilization (dpf) (Table 5).

TABLE-US-00005 TABLE 5 Statistics of notch1a mutation death Total Number of Size number deaths Ratio 10 dpf 116 23 19.8% 11 dpf 116 33 28.4% 12 dpf 116 45 38.8% 13 dpf 116 15 13.0%

[0101] 3.1.4 Phenotypic Identification of F.sub.2 notch1a Mutant

[0102] The phenotypic identification showed that a phenotype of somite boundary disorder may appear after the 5.sup.th-7.sup.th somite in the homozygous notch1a mutant (FIG. 3). Moreover, the identification for the homozygotes of different mutation types demonstrated that the four different mutation types of homozygotes showed a consistent phenotype (FIG. 4). In addition, the homozygous notch1a mutant also had a phenotype involving growth disorder of the intersegmental blood vessel (FIG. 5).