METHOD FOR PRODUCING GENOME-EDITED PLANT UTILIZING PLANT VIRUS VECTORS
20190359993 ยท 2019-11-28
Assignee
Inventors
- Kazuhiro ISHIBASHI (Tsukuba-shi, JP)
- Hirotaka ARIGA (Tsukuba-shi, JP)
- Seiichi TOKI (Tsukuba-shi, JP)
- Hidetaka KAYA (Tsukuba-shi, JP)
Cpc classification
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
A combination of virus vectors for genome editing is formed by arranging a polynucleotide encoding a split genome editing enzyme in each of a Tobamovirus vector and a Potexvirus vector and arranging a polynucleotide encoding a guide RNA in one of the vectors. It is found that when these virus vectors are introduced into a plant cell, a complex of a functional Cas9 protein and the guide RNA is formed in the plant cell, and a genome is edited in a target site-specific manner.
Claims
1. A method for producing a plant cell in which a genome is edited in a site-specific manner, comprising: introducing a combination of a plurality of types of plant positive-sense single-stranded RNA virus vectors having characteristics (a) and (b) into a plant cell, where (a) each of the virus vectors contains a polynucleotide encoding a split genome editing enzyme, and (b) at least one of the virus vectors contains a polynucleotide encoding a guide RNA; and allowing a complex containing an assembly of the split genome editing enzymes and the guide RNA to be formed in the plant cell and allowing the complex to edit the genome in a site-specific manner.
2. A method for producing a plant in which a genome is edited in a site-specific manner, comprising: introducing a combination of a plurality of types of plant positive-sense single-stranded RNA virus vectors having characteristics (a) and (b) into a plant cell, where (a) each of the virus vectors contains a polynucleotide encoding a split genome editing enzyme, and (b) at least one of the virus vectors contains a polynucleotide encoding a guide RNA; and allowing a complex containing an assembly of the split genome editing enzymes and a guide RNA to be formed in a plant cell, allowing the complex to edit the genome in a site-specific manner, and regenerating a plant from the plant cell.
3. The method according to claim 1, wherein the combination of plant positive-sense single-stranded RNA virus vectors includes a combination of a Tobamovirus vector and a Potexvirus vector.
4. The method according to claim 1, wherein the genome editing enzyme is a Cas9 protein or a Cpf1 protein.
5. The method according to claim 1, wherein a polynucleotide encoding a self-cleaving ribozyme is bound to a 5 terminal of the polynucleotide encoding a guide RNA.
6. The method according to claim 1, wherein a polynucleotide encoding a self-cleaving ribozyme is bound to a 3 terminal of the polynucleotide encoding a guide RNA.
7. A kit for use in the method according to claim 1, comprising: a combination of a plurality of types of plant positive-sense single-stranded RNA virus vectors having characteristics (a) and (b), where (a) each of the virus vectors contains a polynucleotide encoding a split genome editing enzyme, and (b) at least one of the virus vectors contains a polynucleotide encoding a guide RNA or a portion for inserting the polynucleotide.
8. The kit according to claim 7, wherein the combination of plant positive-sense single-stranded RNA virus vectors includes a combination of a Tobamovirus vector and a Potexvirus vector.
9. The kit according to claim 7, wherein the genome editing enzyme is a Cas9 protein or a Cpf1 protein.
10. The kit according to claim 7, wherein a polynucleotide encoding a self-cleaving ribozyme is bound to a 5 terminal of the polynucleotide encoding a guide RNA.
11. The kit according to claim 7, wherein a polynucleotide encoding a self-cleaving ribozyme is bound to a 3 terminal of the polynucleotide encoding a guide RNA.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
DESCRIPTION OF EMBODIMENTS
[0056] The present invention provides a method for producing a plant cell in which a genome is edited in a site-specific manner.
[0057] In the method of the present invention, a plurality of types of plant positive-sense single-stranded RNA virus vectors are introduced into a plant cell.
[0058] Herein, the plant positive-sense single-stranded RNA virus vector means a vector derived from a plant virus that is a virus having a positive-sense single-stranded RNA as a genome. The positive-sense RNA is different from a negative-sense RNA in that the positive-sense RNA itself functions as an mRNA. The plant positive-sense single-stranded RNA virus vector in the present invention is a polynucleotide that has a gene derived from a virus genome and an exogenous gene in an expressible form, and may be either in the form of an RNA (for example, a transcription product of an expression construct in which an exogenous gene is inserted in a cDNA for a viral genome RNA) or in the form of a DNA (for example, an expression construct in which an exogenous gene is inserted in a cDNA for a viral genome RNA). The combination of plant positive-sense single-stranded RNA virus vectors used in the present invention is preferably such that the host ranges of the virus vectors overlap each other, have a low pathogenicity, and are capable of stably expressing split genome editing enzymes. In addition, to avoid interference with each other, the combination is preferably a combination of virus vectors derived from plant viruses belonging to different genera. The virus vectors derived from plant viruses belonging to different genera include, for example, a plurality of types of virus vectors selected from the group consisting of Tobamovirus vectors, Potexvirus vectors, Potyvirus vectors, Tobravirus vectors, Tombusvirus vectors, Cucumovirus vectors, Bromovirus vectors, Carmovirus vectors, and Alfamovirus vectors. Herein, the plurality of types means two types or more (for example, two types, three types, four types, or the like). The combination is preferably a combination of two types that are a Tobamovirus vector and a Potexvirus vector.
[0059] The Tobamovirus vectors include, for example, a tomato mosaic virus (ToMV) vector, a tobacco mosaic virus (TMV) vector, a tobacco mild green mosaic virus (TMGMV) vector, a pepper mild mottle virus (PMMoV) vector, a paprika mild mottle virus (PaMMV) vector, a cucumber green mottle mosaic virus (CGMMV) vector, a kyuri green mottle mosaic virus (KGMMV) vector, a hibiscus latent fort pierce virus (HLFPV) vector, an odontoglossum ringspot virus (ORSV) vector, a rehmannia mosaic virus (ReMV) vector, a Sammon's opuntia virus (SOV) vector, a wasabi mottle virus (WMoV) vector, a youcai mosaic virus (YoMV) vector, a sunn-hemp mosaic virus (SHMV) vector, and the like. The Potexvirus vectors include, for example, a potato virus X (PVX) vector, apotatoaucubamosaicvirus (PAMV) vector, an Alstroemeria virus X (AlsVX) vector, a cactus virus X (CVX) vector, a Cymbidium mosaic virus (CymMV) vector, a hosta virus X (HVX) vector, a lily virus X (LVX) vector, a Narcissus mosaic virus (NMV) vector, a Nerine virus X (NVX) vector, a Plantago asiatica mosaic virus (PlAMV) vector, a strawberry mild yellow edge virus (SMYEV) vector, a tulip virus X (TVX) vector, a white clover mosaic virus (WClMV) vector, a bamboo mosaic virus (BaMV) vector, and the like. The Potyvirus vectors include, for example, a potato virus Y (PVY) vector, a bean common mosaic virus (BCMV) vector, a clover yellow vein virus (ClYVV) vector, an East Asian Passiflora virus (EAPV) vector, a Freesia mosaic virus (FreMV) vector, a Japanese yam mosaic virus (JYMV) vector, a lettuce mosaic virus (LMV) vector, a Maize dwarf mosaic virus (MDMV) vector, an onion yellow dwarf virus (OYDV) vector, a papaya ringspot virus (PRSV) vector, a pepper mottle virus (PepMoV) vector, a Perilla mottle virus (PerMoV) vector, a plum pox virus (PPV) vector, a potato virus A (PVA) vector, a sorghum mosaic virus (SrMV) vector, a soybean mosaic virus (SMV) vector, a sugarcane mosaic virus (SCMV) vector, a tulip mosaic virus (TulMV) vector, a turnip mosaic virus (TuMV) vector, a watermelon mosaic virus (WMV) vector, a zucchini yellow mosaic virus (ZYMV) vector, a tobacco etch virus (TEV) vector, and the like. The Tobravirus vectors include, for example, a tobacco rattle virus (TRV) vector and the like. The Tombusvirus vectors include, for example, a tomato bushy stunt virus (TBSV) vector, an eggplant mottled crinkle virus (EMCV) vector, a grapevine Algerian latent virus (GALV) vector, and the like. The Cucumovirus vectors include, for example, a cucumber mosaic virus (CMV) vector, a peanut stunt virus (PSV) vector, a tomato aspermy virus (TAV) vector, and the like. The Bromovirus vectors include, for example, a brome mosaic virus (BMV) vector, a cowpea chlorotic mottle virus (CCMV) vector, and the like. The Carmovirus vectors include, for example, a carnation mottle virus (CarMV) vector, a melon necrotic spot virus (MNSV) vector, a pea stem necrotic virus (PSNV) vector, a turnip crinkle virus (TCV) vector, and the like. The Alfamovirus vectors include, for example, an alfalfa mosaic virus (AMV) vector, and the like.
[0060] The combination of a plurality of types of plant positive-sense single-stranded RNA virus vectors in the present invention has characteristics (a) and (b) described below.
[0061] (a) each of the virus vectors contains a polynucleotide encoding a split genome editing enzyme
[0062] (b) at least one of the virus vectors contains a polynucleotide encoding a guide RNA
[0063] The genome editing enzyme in the present invention is not particularly limited as long as the genome editing enzyme is an enzyme capable of forming a complex together with the guide RNA and editing a genome in a site-specific manner, but is represented by a nuclease (typically an endonuclease). The endonuclease includes, but is not limited to, for example, Cas9 proteins and Cpf1 proteins. Alternatively, it can also be considered to utilize, for example, a fusion protein of a Cas9 protein the nuclease activity of which is partly or completely eliminated and a deaminase. Hence, the editing of genomes in the present invention includes not only cleaving but also other modifications of genomes such as deamination as well as alteration (for example, mutagenesis) of genomes via these modifications
[0064] As the Cas9 proteins, those derived from various sources are known (for example, U.S. Pat. Nos. 8,697,359, 8,865,406, International Publication No. 2013/176772, and the like), and any of these may be utilized. From the viewpoint of the limitation in length of genes that can be expressed from virus vectors, a Cas9 protein having a relatively small molecular weight is preferable. Such a Cas9 protein includes a Cas9 protein derived from Staphylococcus aureus (SaCas9). The amino acid sequences and the base sequences of the Cas9 proteins are registered in a public database, for example, GenBank (http://www.ncbi.nlm.nih.gov) (for example, accession number: J7RUA5, WP_010922251, and the like, SEQ ID NO: 1, 5).
[0065] It is preferable that in the present invention, as the Cas9 protein, a protein comprising an amino acid sequence of SEQ ID NO: 2 OR 6 or consisting of the amino acid sequence be utilized. In addition, as the Cas9 protein in the present invention, a mutant comprising an amino acid sequence obtained by deleting, substituting, adding, or inserting one or a plurality of amino acids in a natural amino acid sequence may be used. Here, the plurality of is 1 to 50, preferably 1 to 30, and further preferably 1 to 10. Moreover, the Cas9 protein in the present invention also includes a polypeptide comprising an amino acid sequence having a sequence identity of 80% or more, more preferably 90% or more, further preferably 95% or more, and most preferably 99% or more with the amino acid sequence of SEQ ID NO: 2 OR 6 or consisting of the amino acid sequence as long as the original protein activity is maintained. The comparison between amino acid sequences can be conducted by a publicly-known approach, and can be conducted using, for example, BLAST (Basic Local Alignment Search Tool) at the National Center for Biological Information of the United States or the like with the default settings, for example.
[0066] As the Cpf1 protein, various types are known. Those described in documents (Zetsche, B. et al. Cell 163 (3), 759-71 (2015), Endo et al. Sci. Rep. 6, 38169 (2016)) can be utilized. Preferably used is a Cpf1 protein (LbCpf1, AsCpf1, FnCpf1) derived from Lachnospiraceae bacterium, Acidaminococcus sp., or Francisella novicida. The amino acid sequences of these Cpf1 proteins are registered in a public database, for example, GenBank (http://www.ncbi.nlm.nih.gov) (for example, accession number: WP_021736722, WP_035635841, and the like). In addition, as in the case of the Cas9 protein, it is possible to use a mutant comprising an amino acid sequence obtained by deleting, substituting, adding, or inserting one or a plurality of amino acids in a natural amino acid sequence. As a result of cutting the target double-stranded DNA, the Cas9 proteins generate blunt ends while the Cpf1 proteins generate staggered ends.
[0067] The split genome editing enzymes in the present invention are not particularly limited as long as the split genome editing enzymes can be expressed by the virus vectors and can reproduce the function as a genome editing enzyme when assembled in a cell. A genome editing enzyme is usually split into two fragments, but may be split into three fragments. An SaCas9 protein can be split into two fragments, an N-terminal side (amino acid residue 739) and a C-terminal side (amino acid residue 314) by a publicly-known method, for example, a method described in a document (Nishimasu et al. Cell, 162: 1113-1126 (2015)). In addition, for a Cas9 protein derived from Streptococcus pyogenes (SpCas9), for example, there are reported methods, that is, a method for splitting the SpCas9 into two fragments, a N-terminal side (amino acid residue 714) and a C-terminal side (amino acid residue 654) (Zetsche et al. Nat Biotechnol, 33: 139-142 (2015)), and a method for splitting the SpCas9 into a nuclease lobe (positions 1 to 57+GSS+positions 729 to 1368) containing the N-terminal and the C-terminal and a DNA recognition lobe (positions 56 to 714) therebetween (Wright et al. Proc Natl Acad Sci USA, 112, 2984-2989 (2015)). To the split genome editing enzyme, a nuclear localization signal and a tag, for example, may be attached.
[0068] The guide RNA in the present invention comprises: a base sequence complementally with a base sequence in the target DNA region; and a base sequence interacting with the above-described genome editing enzyme. The target DNA region in the present invention means a region containing a site where a target gene alteration occurs on a genome DNA of a living organism and is a region consisting of normally 17 to 30 bases, and preferably 17 to 20 bases.
[0069] When the genome editing enzyme is a Cas9 protein or a Cpf1 protein, the above region is preferably selected from regions adjacent to a PAM (proto-spacer adjacent motif) sequence. Typically, the cleavage of the target DNA in a site-specific manner occurs at a position determined by both of the complementarity of the base-pair formation between the guide RNA and the target DNA and the adjacent PAM. Although this depends on the type and origin of a nuclease, PAM typically is 5-NNGRRT (N is any base)-3 or 5-NNGRR (N is any base)-3 in the case of the SaCas9 protein, is 5-NGG (N is any base)-3 in the case of the SpCas9 protein, and is 5-TTN (N is any base)-3 or 5-TTTN (N is any base)-3 in the case of the Cpf1 protein. Note that it is also possible to alter the PAM recognition by alteration of a protein (for example, introduction of mutation) (Benjamin, P. et al., Nature 523, 481-485 (2015), Hirano, S. et al., Molecular Cell 61, 886-894 (2016)). This makes it possible to increase the options for the target DNA.
[0070] The guide RNA forms a complex together with a genome editing enzyme because the guide RNA comprises the base sequence (protein-binding segment) interacting with the genome editing enzyme (that is, bound to the genome editing enzyme by non-covalent bonding interaction). In addition, the guide RNA provides target specificity to the complex because the guide RNA comprises the base sequence (DNA-targeting segment) complementary with the base sequence of the target DNA region. As described above, the genome editing enzyme itself binds to the protein-binding segment of the guide RNA to be introduced to the target DNA region and edits (for example, in a case where the genome editing enzyme is a nuclease, cleaves) the target DNA owing to its activity.
[0071] In the case of the CRISPR/Cas9 system, the guide RNA is a combination of a crRNA fragment and a tracrRNA fragment. The crRNA fragment at least comprises a base sequence complementary with the base sequence of the target DNA region and a base sequence capable of interacting with the tracrRNA fragment in this order from the 5 side. The tracrRNA fragment comprises, on the 5 side, a base sequence capable of binding to (hybridizing with) a base sequence of part of the crRNA fragment. The crRNA fragment forms a double-stranded RNA together with the tracrRNA fragment at the base sequence capable of interacting with the tracrRNA fragment. The double-stranded RNA thus formed interacts with the Cas9 protein. In this way, the Cas9 protein is guided to the target DNA region. The crRNA fragment and the tracrRNA fragment can be fused to be expressed as a single molecule. On the other hand, in the case of the CRISPR/Cpf1 system, the guide RNA means the crRNA fragment and the tracrRNA fragment is unnecessary. The Cpf1 protein is guided to the target DNA region by interaction of the crRNA fragment with the Cpf1 protein.
[0072] To target a plurality of DNA regions and to target a plurality of portions in the same DNA region, a plurality of types of guide RNAs may be used. When an nCas9 protein is utilized, for example, it is possible to use a plurality of types of guide RNAs targeting one portion (two portions in total) of each of the strands in the double-strands of the target DNA region.
[0073] A plant positive-sense single-stranded RNA virus vector basically comprises: a replicase necessary for proliferation of the virus; a movement protein necessary for the virus to move from one cell to another in an infected plant; and a polynucleotide encoding an envelope protein, which protects the virus gene from attack from the surroundings. In the plant positive-sense single-stranded RNA virus vector used in the present invention, the polynucleotide encoding a split genome editing enzyme can be inserted into various positions as long as the replication and intercellular movement of the virus genome are not inhibited, and for example, can be inserted downstream of a polynucleotide encoding a movement protein. The polynucleotide may be inserted by substitution with a polynucleotide encoding a protein (for example, envelope protein) of the virus itself.
[0074] In the combination of plant positive-sense single-stranded RNA virus vectors used in the present invention, the guide RNA is arranged in at least one of the virus vectors. The guide RNA may be arranged in a plurality of virus vectors or may be arranged all the virus vectors.
[0075] The guide RNA may be arranged, for example, downstream of a polynucleotide encoding the split genome editing enzyme. A polynucleotide encoding a self-cleaving ribozyme is preferably bound to the 5 terminal of a polynucleotide encoding the guide RNA, and in the transcription product, cleavage occurs on the 5 side of the guide RNA due to the action of the ribozyme. The self-cleaving ribozyme is preferably a hammerhead ribozyme (Hamman et al. RNA 18: 871-885 (2011)). In the hammerhead ribozyme, a polynucleotide encoding an RNA complementary with the 5-terminal region of the guide RNA is bound to the 5 terminal of the polynucleotide encoding the ribozyme. Employing this structure allows the RNA added to the 5 side of the self-cleaving ribozyme and the 5 terminal of the guide RNA to be hybridized in the transcription product and cleavage occurs on the 5 side of the guide RNA due to the action of the ribozyme. In addition, a polynucleotide encoding a self-cleaving ribozyme is preferably bound to the 3 terminal of the polynucleotide encoding the guide RNA, and in the transcription product, cleavage occurs on the 3 side of the guide RNA due to the action of the ribozyme. The self-cleaving ribozyme is preferably a hammerhead ribozyme or a hepatitis delta virus ribozyme (Webb and Luptak RNA biology 8: 5, 719-727). In the hammerhead ribozyme, a polynucleotide encoding an RNA complementary with the 3-terminal region of the guide RNA is bound to the 3 terminal of the polynucleotide encoding the ribozyme. Employing this structure allows the RNA added to the 3 side of the self-cleaving ribozyme and the 3 terminal of the guide RNA to be hybridized in the transcription product and cleavage occurs on the 3 side of the guide RNA due to the action of the ribozyme. When a hepatitis delta virus ribozyme is employed, the RNA complementary with the 3-terminal region of the guide RNA is unnecessary, and cleavage occurs at the 5 terminal of the ribozyme. As a result of the actions of these ribozymes, unnecessary sequences are removed from the 5 side and/or 3 side of the guide RNA, allowing the guide RNA to efficiently function.
[0076] When a hammerhead ribozyme is used in the present invention, the RNA comlementary with the 5-terminal region of the guide RNA or the RNA comlementary with the 3-terminal region of the guide RNA to be arranged in a portion to be cleaved each has length and sequence sufficient for the self-cleaving ribozyme to be cleaved at the 5 side and the 3 side of the guide RNA in the transcription product. However, since the transcription product in which cleavage has occurred cannot be replicated to be a genome RNA of the virus, it is not preferable that all the transcription products be cleaved, and it is preferable to leave some transcription products uncleaned. In other words, it is preferable that the lengths and sequences of the RNA comlementary with the 5-terminal region of the guide RNA and the RNA comlementary with the 3-terminal region of the guide RNA be selected so as to generate both of a transcription product which has been cleaved by the self-cleaving ribozyme and a transcription product which has not been cleaved. The ratio of transcription products cleaved on the 5 side and/or 3 side of the guide RNA to the total transcription products is preferably 1 to 70%, and more preferably 5 to 30%. The length is normally 3 to 10 bases but is not limited thereto. It is also possible for a person skilled in the art to adjust the ratio between cleaved transcription products and uncleaned transcription products by introducing a non-complementary base as necessary. Also when a hepatitis delta virus ribozyme is used, it is preferable to employ a hepatitis delta virus ribozyme having an appropriate sequence so as to make the ratio of cleaved transcription products to the total transcription products equal to the above-described ratio.
[0077] When the plant positive-sense single-stranded RNA virus vector is in the form of an RNA, it is possible to use, for example, an RNA product obtained by preparing an expression construct obtained by inserting the above-described exogenous gene into a cDNA corresponding to the viral genome RNA, followed by in vitro transcription. When the plant positive-sense single-stranded RNA virus vector is in the form of a DNA, it is possible to use, for example, an expression construct obtained by inserting the exogenous gene into a cDNA corresponding to the viral genome RNA.
[0078] When the plant positive-sense single-stranded RNA virus vector is used as a DNA vector (expression construct), the virus gene and the exogenous gene are usually bound to the downstream of an appropriate promoter that can be expressed in a plant. As the promoter, a publicly-known promoter such as a CaMV 35S promoter, a rice actin promoter, and an ubiquitin promoter can be used, for example. A terminator is usually bound to the downstream of these genes. The protein encoded by the exogenous gene may also be expressed as a fusion protein with a protein encoded by the virus gene via a recognition sequence of a sequence-specific protease, for example. In this case the fusion protein is cleaved to generate the protein encoded by the exogenous gene owing to the action of the protease.
[0079] In the present invention, the plant positive-sense single-stranded RNA virus vectors prepared as described above are introduced into a plant cell. The plant cell may be selected from host plant cells that the virus vector can infect, and includes cells of various plants such as vegetables, fruits, and horticultural crops. The plant includes, but is not limited to, the Solanaceae (for example, tobacco, eggplant, potato, bell pepper, tomato, pepper, and petunia), the Poaceae (rice, barley, rye, Japanese millet, sorghum, and corn), the Brassicaceae (for example, daikon radish, turnip rape, cabbage, Arabidopsis thaliana, Japanese horse-radish, and shepherd's-purse), the Rosaceae (for example, Japanese apricot, peach, apple, pear, strawberries, and rose), the Fabaceae (for example, soybean, adzuki bean, common bean, green pea, broad bean, peanut, clover, and burr medic), the Cucurbitaceae (for example, sponge gourd, squash, cucumber, watermelon, melon, and zucchini), the Lamiaceae (for example, lavender, Japanese mint, and Japanese basil), the Liliaceae (for example, green onion, garlic, lily, and tulip), the Chenopodiaceae (for example, spinach), the Apiaceae (for example, wild celery, carrot, mitsuba, and celery), the Asteraceae (for example, chrysanthemum, lettuce, and artichoke), the Orchidaceae (for example, moth orchids and cattleya orchids), the Convolvulaceae (for example, sweet potato), the Araceae (for example, Colocasia esculenta, taro, and konjac), and the like. In addition, the plant cell includes cells inside the plant besides culture cells. Further, the plant cell includes various forms of plant cells, for example, suspended culture cells, protoplasts, leaf sections, calli, immature embryos, pollens, and the like.
[0080] As the method for introducing the plant positive-sense single-stranded RNA virus vectors into a plant cell, a publicly-known method such as a rubbing inoculation method and a particle gun method, for example, may be utilized.
[0081] In the plant cell in which the combination of plant positive-sense single-stranded RNA virus vectors has been introduced, the split genome editing enzymes are expressed and assembled to form a functional genome editing enzyme. The functional genome editing enzyme and the guide RNA form a complex, and the genome is edited (for example, cleaved when the genome editing enzyme is a nuclease) in a site-specific manner by the complex.
[0082] In the present invention, it is possible to produce a plant in which a genome is edited in a site-specific manner by regenerating the plant from a plant cell in which the combination of plant positive-sense single-stranded RNA virus vectors has been introduced. As the method for obtaining individuals by redifferentiating the tissue of the plant in tissue cultures, a method established in the art can be utilized (Tabei Y. Ed., Protocols of Plant Transformation, Kagaku-Dojin Publishing Company, INC pp. 340-347, 2012). Once a plant is obtained as described above, it is also possible to obtain a progeny from the plant by sexual reproduction or asexual reproduction. In addition, it is also possible to obtain propagation materials (for example, seeds, fruits, spikes, stubs, calli, protoplasts, and the like) from the plant or a progeny or a clone thereof, and to produce the plant in mass from these propagation materials. The present invention encompasses plants obtained by the method of the present invention, progenies and clones of the plants, as well as propagation materials of the plants, the progenies and clones of the plants.
[0083] The present invention also provides a kit for use in the above-described method of the present invention.
[0084] The kit comprises a combination of a plurality of types of plant positive-sense single-stranded RNA virus vectors having the following characteristics (a) and (b).
[0085] (a) each of the virus vectors contains a polynucleotide encoding a split genome editing enzyme
[0086] (b) at least one of the virus vectors contains a polynucleotide encoding a guide RNA or a portion for inserting the polynucleotide
[0087] The kit may further comprise one or a plurality of additional elements. The additional elements include, but are not limited to, for example, reagents for introducing vectors into cells, diluted buffer solutions, wash buffers, growth media, control reagents (for example, control vectors), and the like. The kit comprises an instruction manual in general.
EXAMPLES
[0088] Hereinafter, the present invention will be described in more detail based on Examples; however, the present invention is not limited to Examples described below.
[0089] Note that materials used in Examples are as described below. [0090] In Vitro Synthesis of Virus RNA: pTLW3 (Kubota et al. J Virol. 77: 11016-11026 (2013), ToMV, plasmid DNA), pP2C2S (Chanpman et al., Plant J. 2: 549-557 (1992), PVX, plasmid DNA), Mlu1 (Takara Bio Inc.), Spe1 (NEB), BstNI (NEB), AmpliCap-Max T7 High Yield Message Maker Kit (CELLSCRIPT), DNAiso (Takara Bio Inc.) [0091] Plants Under Test: Nicotiana benthamiana, Nicotiana tabacum [0092] Others: Carborundum (Nacalai Tesque), KOD plus neo (TOYOBO), DNA Ligation Kit <Mighty Mix> (Takara Bio Inc.)
Example 1
[0093] ToMV vectors in each of which a gRNA was bound to the 3 side of a self-cleaving ribozyme was constructed such that the 5 side of a guide RNA (gRNA) was cleaved by the action of the self-cleaving ribozyme (
[0094] The above-described ToMV vectors were inoculated into leaves of Nicotiana benthamiana in which pDe-CAS9, which expresses SpCas9 (Fauser et al. Plant J. 79 (2): 348-359 (2014)), and a target sequence (SEQ ID NO: 4) were transiently introduced, by the agroinfiltration method. If the target sequence is cleaved and repaired by a complex of SpCas9 and gRNA, the LUC gene is expressed. When the LUC activity after 6 days was detected, a strong LUC activity was detected in a case where Rz3 was used (
Example 2
[0095] A gRNA targeting a PDS gene of tobacco was inserted into the ToMV vectors. On the 5 side of the self-cleaving ribozyme HamRz, sequences of various lengths that were complementary with the 5 side of the gRNA were arranged (
[0096] The above-described ToMV vectors were inoculated into leaves of Nicotiana benthamiana in which a plasmid based on pRI201-AN, which expresses SaCas9 (Kaya et al. Sci Rep 6: 26871 (2016)), were transiently introduced, by the agroinfiltration method. The genome DNAs were extracted after 7 days, and whether the editing occurred or not was examined by the CAPS method. It was found that genome editing occurred efficiently in Rz5a and Rz5b having appropriate cleavage efficiencies (
Example 3
[0097] From Examples 1 and 2 described above, it was revealed that the genome editing efficiency was significantly improved by adjusting the length and type of a sequence in sequences complementary with the gRNA arranged on the 5 side of HamRz to appropriately maintain the base pair formation efficiency with the gRNA (
[0098] (1) Cloning of Cas9
[0099] The SaCas9 gene (3159 bp) isolated from Staphylococcus aureus was split into the N-terminal side (2217 bp, referred to as N739) and the C-terminal side (942 bp, referred to as C740). These were cloned using KOD plus neo, and the resultants were introduced to the downstream of each of subgenomic promoters pTLW3 and pP2C2S to create pTL-739N, pTL-740C, pPVX-739N, and pPVX-740C. Moreover, a gRNA sequence targeting the above-described tobacco PDS gene was bound to the downstream of the split Cas9 in each of pTL-739N and pTL-740C via HamRz, which is a self-cleaving ribozyme (pTL-739N-Rz5a and pTL-740C-Rz5a).
[0100] (2) Virus Infection
[0101] Virus RNAs were synthesized using AmpliCap-Max T7 High Yield Message Maker Kit with plasmid DNAs, which were opened by restriction enzymes (MluI for ToMV and SpeI for PVX), as templates. The RNAs thus synthesized were mixed in two combinations of [TL-739N-Rz5a and PVX-740C] and [TL-740C-Rz5a, PVX-739N], followed by rubbing together with Carborundum to infect tobacco (Nicotiana benthamiana or Nicotiana tabacum) leaves (about 4 weeks old, fifth leaves).
[0102] (3) Extraction of Genome of Tobacco, CAPS Analysis
[0103] Leaves of Nicotiana benthamiana 12 days after the inoculation were recovered as samples, which were frozen and crushed with liquid nitrogen, and then genomes were extracted using 500 L of DNAiso. About 250 bp fragment containing a gRNA target portion was amplified through PCR using the genomes as templates. Subsequently, 2 L of the PCR reaction solution was digested with a restriction enzyme BstNI, followed by CAPS analysis. As a result of the CAPS analysis, the genome editing of the target portion was observed in any combination of the viruses (
[0104] In addition, the infected leaves of Nicotiana tabacum were differentiated (callus formation) in accordance with the reported method (Ohshima et al. Plant Cell 2: 95-106 (1990)), and then shoot regeneration was attempted. As a result of the attempt, white shoot indicating that the PDS gene was knocked out was observed (
Example 4
[0105] When the genome editing was conducted by expressing split SaCas9 from the virus vector in Example 3, the ribozyme inserted in the virus genome cleaves the 5 side of the gRNA to supply the gRNA. However, even in this case, a sequence derived from the virus is attached to the 3 side of the supplied gRNA. In view of this, in the present Example, a ribozyme that causes cleavage at a low efficiency on the 3 side of a gRNA was further arranged to study whether the genome editing efficiency was changed.
[0106] Specifically, a gRNA targeting a tobacco TOM1 gene was inserted into the ToMV vector. Ribozymes were arranged on either side of the gRNA. At this time, the ribozyme that cleaves the 5 side of the gRNA was fixed (5Rz) while ribozymes having various cleavage efficiencies were arranged on the 3 side (
[0107] As a result, the genome editing efficiency was significantly improved by arranging an appropriate ribozyme on the 3 side as well (
Example 5
[0108] In Example 3, split SaCas9 was used as a genome editing enzyme that was expressed from the virus vectors. In the present Example, examination was similarly conducted but using split SpCas9 in order to confirm the versatility of this technique.
[0109] Specifically, SpCas9 isolated from Streptococcus pyogenes was split into the N-terminal side (positions 1 to 714; 2280 bp; Sp_N714) and the C-terminal side (positions 715 to 1368; 1998 bp; Sp_C715) by referring to an example using animal cells (Zetsche et al. Nat Biotechnol, 33: 139-142 (2015)). In addition, a method for splitting SpCas9 into a nucleic acid recognition domain (positions 56 to 714; 1977 bp; Sp_-Helical) and a nucleic acid degradation domain (positions 1 to 57+GSS+positions 730 to 1368; 2100 bp; Sp_Nuclease) (partially modified version of Wright et al. Proc Natl Acad Sci USA, 112, 2984-2989 (2015)) was also examined. A nuclear localization signal code sequence was added to each of the 5 sides of Sp_N714 and Sp_-Helical and to each of the 3 sides of Sp_C715 and Sp_Nuclease. All of the SpCas9s were amplified through PCR using KOD plus neo. Sp_N714 and Sp_-Helical were each substituted with an envelope protein gene of pTLW3 (ToMV) while Sp_C715 and Sp_Nuclease were each introduced into SalI and EcoRV cleaved portions of pP2C2S (PVX). Furthermore, a guide RNA sequence targeting a tobacco RTS3 gene was coupled to the downstream of each of Sp_C715 and Sp_Nuclease via HamRz (CTGATGAGGCCGAAAGGCCGAAACTCCGTAAGGAGTC/SEQ ID NO: 3), which is a self-cleaving ribozyme.
[0110] Both virus vectors were co-inoculated in Nicotiana benthamiana, and whether genome editing occurred or not was examined by the CAPS method. As a result, the genome editing of the target portion was able to be observed in any combination of viruses (
INDUSTRIAL APPLICABILITY
[0111] As described above, the present invention makes it possible to conduct genome editing of a plant using plant virus vectors without integrating a genome editing enzyme gene into a plant genome. According to the present invention, since it is possible to efficiently produce agricultural crops having useful characters, for example, the present invention can be industrially utilized mainly in the field of agriculture.
[Sequence Listing Free Text]
SEQ ID NO: 3
[0112] artificially synthesized ribozyme sequence (HamRz)
SEQ ID NO: 4
[0113] Luc gene in which a Cas9 target sequence is inserted
[0114] inserted sequence
[0115] Cas9 target sequence
[Sequence Listing] IBPF17-539WO-seq-fin.txt
[0116]