VIRUS-LIKE PARTICLE OF SENECAVIRUS A

20190350990 ยท 2019-11-21

    Inventors

    Cpc classification

    International classification

    Abstract

    A virus-like particle of Senecavirus A, the particle including a structural protein VP0, a structural protein VP1 and a structural protein VP3. The structural protein VP0 is encoded by a gene sequence represented by SEQ ID NO: 1. The structural protein VP1 is encoded by a gene sequence represented by SEQ ID NO: 2. The structural protein VP3 is encoded by a gene sequence represented by SEQ ID NO: 3.

    Claims

    1. A virus-like particle, comprising: a structural protein VP0 of Senecavirus A encoded by a gene sequence represented by SEQ ID NO: 1; a structural protein VP1 of the Senecavirus A encoded by a gene sequence represented by SEQ ID NO: 2; and a structural protein VP3 of the Senecavirus A encoded by a gene sequence represented by SEQ ID NO: 3.

    2. A method, comprising: 1) amplifying a smt3 gene using genomic DNA of Saccharomyces cerevisiae as a template and smt3F and smt3R as primers, the smt3F having a sequence of SEQ ID NO: 4, the smt3R having a sequence of SEQ ID NO: 5, and the smt3 gene having a sequence of SEQ ID NO: 6; 2) digesting the smt3 gene and a vector pET-28a using restriction enzymes Nco I and BamH I, inserting the digested smt3 gene into the digested pET-28a vector, to yield a vector pSMK; amplifying an AmpR gene using a pUC19 plasmid as a template and AmpRKpnI and AmpRNheI as primers, amplifying a DNA fragment from the pSMK using PSMKKpnI and PSMKNheI as primers, digesting the DNA fragment and the AmpR gene with restriction enzymes KpnI and NheI, and inserting the digested AmpR gene into the digested DNA fragment, to yield a vector pSMA; amplifying a CmR gene using the pACYC plasmid as a template and CmRKpnI and CmRNheI as primers, amplifying a DNA fragment from the pSMK using PSMKKpnI and PSMKNheI as primers, digesting the DNA fragment and the CmR gene with restriction enzymes KpnI and NheI, and inserting the digested CmR gene into the digested DNA fragment, to yield a vector pSMC; wherein the AmpRKpnI has a sequence of SEQ ID NO: 7, the AmpRNheI has a sequence of SEQ ID NO: 8, the PSMKKpnI has a sequence of SEQ ID NO: 9, the PSMKNheI has a sequence of SEQ ID NO: 10, the CmRKpnI has a sequence of SEQ ID NO: 11, and the CmRNheI has a sequence of SEQ ID NO: 12: 3) synthesizing coding genes of the structural proteins VP0, VP1 and VP3; amplifying the coding genes of the structural proteins VP0, VP1, and VP3 using the synthesized coding genes of the structural proteins VP0, VP1, and VP3 as templates and VP0F/VP0R, VP1F/VP1R, and VP3F/VP3R as primers, respectively; wherein a coding gene of the structural protein VP0 is represented by SEQ ID NO: 1, a coding gene of the structural protein VP1 is represented by SEQ ID NO: 2, and a coding gene of the structural protein VP3 is represented by SEQ ID NO: 3; the VP0F has a sequence of SEQ ID NO: 13, the VP0R has a sequence of SEQ ID NO: 14, the VP1F has a sequence of SEQ ID NO: 15, the VP1R has a sequence of SEQ ID NO: 16, the VP3F has a sequence of SEQ ID NO: 17, the VP3R has a sequence of SEQ ID NO: 18; 4) digesting the amplified coding genes of the structural proteins VP0, VP1, and VP3 using the restriction enzymes BsmBI/BamH I, digesting the vector pSMK, pSMA or pSMC using the restriction enzyme BsaI, inserting the digested coding genes of the structural proteins VP0, VP1, and VP3 into the digested pSMK, pSMA or pSMC, to yield recombinant expression vectors pSMK/VP0, pSMA/VP1, and pSMC/VP3, respectively; 5) amplifying DNA fragments containing VP0, VP1 or VP3 using pSMK/VP0, pSMA/VP1 and pSMC/VP3 as templates and GSTF/VP0GSTR, GSTF/VP1GSTR and GSTF/VP3GSTR as primers, respectively; digesting the DNA fragments and the vector pGEX4T-1 using restriction enzymes BamBII/XhoI, and inserting the digested DNA fragments into the vector pGEX4T-1, to yield recombinant expression vectors pGSTVP0, pGSTVP1 and pGSTVP3, respectively; wherein the GSTF has a sequence of SEQ ID NO: 19; the VP0GSTR has a sequence of SEQ ID NO: 20; the VP1GSTR has a sequence of SEQ ID NO: 21; the VP3GSTR has a sequence of SEQ ID NO: 22; 6) co-transforming the recombinant expression vectors pSMK/VP0, pSMA/VP1, pSMC/VP3, pGSTVP0, pGSTVP1 and pGSTVP3 in different combinations to an expression strain BL21 (DE3), each combination of the recombinant expression vector comprising the VP0, VP1 and VP3 genes; selecting for positive clones containing VP0, VP1 and VP3 genes by kanamycin, ampicillin and chloramphenicol combined with PCR amplification; 7) transferring the selected positive clones to an LB medium and culturing overnight at 180-220 rpm and 37 C.; inoculating a resulting bacterial solution on the LB medium at a ratio of 1:100 and continuing culturing at 180-220 rpm and 37 C. until the OD600 value of the bacterial solution reaches 0.6-1.2; inducing bacterial expression using IPTG at a concentration of 0.01-0.5 mM at 16-25 C. overnight; collecting cell pellets by centrifugation at 5000 rpm for 30 min, and storing at 20 C.; 8) resuspending the bacterial pellets with a buffer A in an ice bath; ultrasonicating the bacterial pellets and centrifuging at 12,000g for 30 min; collecting a resulting supernatant and mixing with Ni-NTA His.Bind Resins at 4 C. for 30-60 min; removing heteroproteins with the buffer A and eluting target proteins with a buffer B; storing at -70 C.; wherein the buffer A contains 20 mM Tris-HCl, 500 mM NaCl, 5 mM Imidazol, pH=8.5; the buffer B contains 20 mM Tris-HCl, 500 mM NaCl, 300 mM Imidazol, pH=8.5; and 9) digesting the target proteins using small ubiquitination-modified proteases, splicing resulting products to yield virus-like particles of SVA.

    3. The method of claim 2, wherein in 6), the recombinant expression vectors pSMK/VP0, pGST/VP1 and pSMC/VP3 are co-transformed into the expression strain BL21 (DE3).

    4. The method of claim 2, wherein 9) is implemented as follows: 20 g of the target proteins, 200 L of a digestion buffer, and 10 L of the small ubiquitin-modified proteases are incubated at 37 C. for 30 min; and the digestion buffer contains 50 mM Tris-HCl, 150 mM NaCl, and 1 mM CaCl2, and has a pH of 8.0.

    5. A method comprising mixing the virus-like particle of claim 1 with an adjuvant to yield a vaccine.

    6. A method comprising using the virus-like particle of claim 1 as an antigen.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0027] FIG. 1 shows SDS-PAGE and immunoblotting detection of SVA recombinant protein; M: quality standard of protein molecules; 1, 2: SDS-PAGE of purified SVA recombinant proteins; 3: immunoblotting of recombinant proteins;

    [0028] FIG. 2 is an image of SVA VLPs under transmission electron microscopy;

    [0029] FIG. 3 shows the detection results of antibodies in serum of SVA VLPs immunized animals using ELISA; and

    [0030] FIG. 4 shows the detection results of neutralizing antibodies in serum of SVA VLPs immunized animals.

    DETAILED DESCRIPTION

    [0031] To further illustrate, embodiments detailing a virus-like particle of Senecavirus A and a method for preparing the same are described below. It should be noted that the following embodiments are intended to describe and not to limit the disclosure.

    EXAMPLE 1

    Preparation of Virus-Like Particles of SVA

    [0032] 1. Construction of fusion expression vectors pSMA, pSMK and pSMC of small ubiquitin-like modified proteins:

    [0033] (1) amplifying the smt3 gene by employing the genomic DNA of Saccharomyces cerevisiae as a template and smt3F and smt3R as primers, where the sequence of smt3F and smt3R are as follows:

    TABLE-US-00001 smt3F: (SEQIDNO:4) 5GCCATGGGTCATCACCATCATCATCACGGGTCGGACTCAGAAGT CAATCAA3 smt3R: (SEQIDNO:5) 5GGATCCGAGACCTTAAGGTCTCAACCTCCAATCTGTTCGCGGTG3;

    [0034] (2) Digesting the smt3 gene and a vector pET-28a using restriction enzymes Nco I and BamH I, inserting the digested smt3 gene into the digested pET-28a vector, to yield a vector pSMK;

    [0035] Employing the pUC19 plasmid as a template, and using AmpRKpnI and AmpRNheI as primers to amplify a pSMK gene. Using PSMKKpnI and PSMKNheI as primers to amplify a DNA fragment from the pSMK, digesting the DNA fragment and the AmpR gene with restriction enzymes KpnI and NheI, and inserting the digested AmpR gene into the digested DNA fragment, to yield a vector pSMA. Employing the pACYC plasmid as a template, and using CmRKpnI and CmRNheI as primers to amplify a pSMK gene. Using PSMKKpnI and PSMKNheI as primers to amplify the DNA fragment from the pSMK, digesting the DNA fragment and the CmR gene with restriction enzymes KpnI and NheI, and inserting the digested CmR gene into the digested DNA fragment, to yield a vector pSMC. The sequence of AmpRKpnI is SEQ ID NO: 7, the sequence of AmpRNheI is SEQ ID NO: 8, the sequence of PSMKKpnI is SEQ ID NO: 9, the sequence of PSMKNheI is SEQ ID NO: 10, the sequence of CmRKpnI is SEQ ID NO: 11 and the sequence of CmRNheI is SEQ ID NO: 12. The sequences of these genes are as follows:

    TABLE-US-00002 AmpRKpnI: (SEQIDNO:7) 5GGCGGTACCAATAACCCTGATAAATGC3 AmpRNheI: (SEQIDNO:8) 5CCGCGCTAGCATGAGATTATCAAAAAGG3 PSMKKpnI: (SEQIDNO:9) 5GTCGGTACCGAATTAATTCATGAGCGG3 PSMKNheI: (SEQIDNO:10) 5'TCAGCTAGCGACCAAAATCCCTTAACG3 CmRKpnI: (SEQIDNO:11) 5 AATGGTACCAAAAAATTACGCCCCGCCCT3 CmRNheI: (SEQIDNO:12) 5CTGGACGCTAGCCACCATCATACACTA-3

    [0036] 2. Construction of a recombinant expression vector of SVA structural protein gene

    [0037] Optimizing the codons and synthesizing the gene sequences encoding structural proteins VP0, VP1 and VP3 according to the SVA sequences (GenBank Number: NC_011349).

    [0038] Using the synthetic gene as a template, the VP0, VP1 and VP3 gene fragments were amplified using the following primer pairs:

    TABLE-US-00003 VP0F: (SEQIDNO:13) 5GGTCTCTAGGTGGCAACGTTCAAACCACC3; VP0R: (SEQIDNO:14) 5CGCGGATCCTCACTGTTCCTCATCGGTACC3; VP1F: (SEQIDNO:15) 5GGTCTCTAGGTAGCACCGACAACGCGGAG3; VP1R: (SEQIDNO:16) 5CGCGGATCCTCATTGCATCAGCATTTTCTG3; VP3F: (SEQIDNO:17) 5GGTCTCTAGGTGGTCCGATTCCGACCGCG3; VP3R: (SEQIDNO:18) 5CGCGGATCCTCAGTGAAAAACATAGCTCGG3;

    [0039] Using the polymerase chain reaction (PCR) method, the gene fragments encoding the structural proteins VP0, VP1 and VP3 were amplified by primers VP0F/VP0R, VP1F/VP1R and VP3F/VP3R, respectively. The gene sequence encoding structural protein VP0 was SEQ ID NO: 1, the gene sequence encoding structural protein VP1 was SEQ ID NO: 2, and the gene sequence encoding structural protein VP3 was SEQ ID NO: 3.

    [0040] Digesting the amplified coding genes of the structural proteins VP0, VP1, and VP3 using the restriction enzymes BsmBI/BamH I, digesting the vector pSMK and pSMA using the restriction enzyme BsaI, inserting the digested coding genes of the structural proteins VP0, VP1, and VP3 into the digested pSMK or pSMA, to yield recombinant expression vectors pSMK/VP0, pSMK/VP1, and pSMA/VP3, respectively.

    [0041] Using pSMK/VP0, pSMA/VP1 and pSMC/VP3 as templates, DNA fragments containing VP0, VP1 or VP3 were amplified with GSTF/VP0GSTR, GSTF/VP1GST and GSTF/VP3GSTR primer pairs, respectively. Digesting the DNA fragments and the vector pGEX4T-1 using restriction enzymes BamHI/XhoI, to yield the recombinant expression vector pGSTVP0, pGSTVP1 and pGSTVP3, respectively; where the gene sequences of the primers GSTF/VP0GSTR GSTF/VP1GST and GSTF/VP3GSTR are as follows:

    TABLE-US-00004 GSTF: (SEQIDNO:19) 5GGCAATGGATCCATGGGTCATCACCATCATCATCAC; VP0GSTR: (SEQIDNO:20) 5GGTAATCTCGAGTTACTGTTCCTCATCGGTACCGG; VP1GSTR: (SEQIDNO:21) 5GGCCGTCTCGAGTTATTGCATCAGCATTTTCTGC; VP3GSTR: (SEQIDNO:22) 5GGCCTTCTCGAGTTAGTGAAAAACATAGCTCGGG.

    [0042] 3. Expression, purification and immunoblotting of SVA recombinant protein

    [0043] (1) Expression of recombinant protein

    [0044] The recombinant expression vectors pSMK/VP0, pSMA/VP1, pSMC/VP3, pGSTVP0, pGSTVP1 and pGSTVP3 were grouped in different combinations where each combination contains VP0, VP1 and VP3 genes, the combinations were co-transformed to the expression strain BL21 (DE3). For example, pSMK/VP0, pSMA/VP1, and pSMC/VP3 were grouped into a combination, pSMK/VP0, pSMA/VP1, and pGSTVP3 were grouped into a combination, or pSMK/VP0, pGSTVP1, and pSMC/VP3 were grouped into a combination and so on.

    [0045] Selecting for positive clones containing VP0, VP1 and VP3 genes by kanamycin, ampicillin and chloramphenicol combined with PCR amplification. Transferring the selected positive clones to the LB medium and scale-up culturing them overnight at 180-220 rpm and 37 C. Inoculating the cultured bacterial solution on the LB medium at a ratio of 1:100 and culturing at 37 C. at 180-220 rpm until the OD600 value of the bacterial solution reached 0.6-1.2.

    [0046] Inducing bacterial expression using IPTG at a concentration of 0.01-0.5 mM at 16-25 C. overnight. Finally, the cell pellets were collected by centrifugation at 5000 rpm for 30 min, and stored at 20 C.

    [0047] (2) Purification of expressed proteins

    [0048] Resuspending the bacterial pellets with a buffer A (20 mM Tris-HCl, 500mM NaCl, 5 mM Imidazol, pH=8.5) in an ice bath. Ultrasonicating the bacterial pellets and centrifuging for 30 min at 12,000g. Collecting the resulting supernatant and mixing with Ni-NTA His.Bind Resins at 4 C. for 30-60 min; removing heteroproteins with the buffer A and eluting the target proteins with a buffer B; storing at 70 C. The results of SDS-PAGE showed that the proteins with expected molecular sizes were obtained and the combination of different vectors has a significant effect on the expression and purification of the target proteins. The protein expressed by the expression plasmid transfected with pSMK/VP0, pGST/VP1 and pSMC/VP3 was the most ideal, and the ratio of the expression levels of VP0, VP1 and VP3 was closest to 1:1:1.

    [0049] (3) Immunoblotting experiment

    [0050] Subjecting the eluted recombinant protein to 10% SDS-PAGE electrophoresis, and electrotransferring the recombinant protein to a polyvinylidene fluoride hybrid membrane (PVDF membrane) by wet transfer. Thereafter, the recombinant protein was blocked with a blocking solution (PBST, 5% skim milk powder, pH 7.0) at 37 C. for 1 h. SVA positive serum was diluted with PBST 1:200, rested at 37 C. for 1 hour, and washed. The rabbit anti-swine IgG labeled with horseradish peroxidase was diluted with PBST 1:3000, rested at 37 C. for 1 h, and washed with PBST; the luminescent substrate was added to a dark chamber for 3 min and exposed to Kozak film. After the development and fixation, the bands of the protein were observed and had the expected size, indicating that the obtained protein was a specific target protein capable of reacting with the SVA-positive serum (FIG. 1).

    [0051] 4. In-vitro assembly of SVA virus-like particles

    [0052] The fusion proteins were digested with small ubiquitin-like modifier proteases, and then spliced to form virus-like particles, following Invitrogn's reagent instructions. The procedure was as follows: 20 g of the above purified fusion proteins, 200 L of digestion buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 1 mM CaCl.sub.2), and 10 L of small ubiquitin-like modifier protease (1 U/L) were incubated at 37 C. for 30 min.

    [0053] Observation by transmission electron microscopy: 10 L of the liquid containing VLPs was added to a 200-mesh copper mesh, holding for 2-3 minutes at room temperature. The excess liquid on the copper mesh was removed with filter paper and then the VLPs were stained with 3% phosphotungstic acid, and observed under Hitachi, H-7100FA transmission electron microscopy. As shown in FIG. 2, the diameter of the assembled virus-like particles was between 20-30 nm, and its morphology and size were similar to those of natural virions.

    [0054] 5. Determination of purification and assembly rate of virus-like particles

    [0055] Purifying virus-like particles by sucrose density gradient centrifugation: 1 mL of virus-containing particles were placed over a sucrose gradient of 20%-45% and centrifuged at 35,000 rpm and 4 C. for 3 h. The absorbances at OD280 nm of the sample were measured to calculate the assembly efficiency of the VLPs. The results showed that the assembly rate of the VLPs expressed by the expression plasmids transfected with pSMK/VP0, pGST/VP1 and pSMC/VP3 was the highest.

    EXAMPLE 2

    Immunogenicity of SVA Virus-Like Particles

    [0056] The antigen for immunization was emulsified with Freund's adjuvant. Fifteen guinea pigs of about 300 g were randomly divided into 3 groups, the first group was immunized with the VLPs (prepared in Example 1), the second group was immunized with unassembled protein, and the third group was injected with PBS as a control. Blood was collected on the 28th day after immunization and serum was separated to detect antibody titers and neutralizing antibodies in the antibody.

    [0057] (1) ELISA detection of antibody titer

    [0058] The 96-well microtiter plate was coated with the SVA hyper-immune serum diluted with 100 L of 0.05 M sodium carbonate buffer (pH 9.6) overnight at 4 C. After being washed 3 times with PBST, the microtiter plate was incubated with SVA virus solution at 37 C. for 1 h, then washed 3 times with PBST. The well plate was blocked with PBST (100 L) containing 5% skim milk powder at 37 C. for 1 h. After being washed 3 times with PBST, the serum to be detected was diluted 1:100 with PBST containing 1% skim milk powder. 100 L per well was added to the closed well plate and incubated at 37 C. for 1 h. After being washed 3 times with PBST, HRP-labeled rabbit anti-guinea pig IgG antibody (Sigma) was diluted 1:3000 with PBST containing 1% skim milk and added to a closed well plate at 100 L per well, and incubated at 37 C. for 1 h. After being washed 3 times with PBST, 50 L of a substrate solution (TMB, Sigma) was added to each well and incubated at 37 C. for 15 min. Then 50 L of 2N H.sub.2SO.sub.4 was added to each well and the optical density (OD value) at 450 nm was detected.

    [0059] The results showed that the antibody levels of the serum of the VLPs immunized group were significantly higher than those of the immunized group containing no VLPs and the PBS control group, and the difference was significant (P<0.01) (FIG. 3).

    [0060] (2) Detection of neutralizing antibodies in serum

    [0061] The titer of neutralizing antibodies in the serum was measured by a microneutralization test. The physiologically diluted serum was inactivated at 56 C. for 30 min, and then diluted twice with DMEM nutrient solution on a 96-well microplate. Each dilution was provided with four wells, and 50 L of virus solution (100 TCID50) was added to each well. After being incubated in a 37 C. incubator for 1 h, each well was added with 100 L of cell suspension (110.sup.5 cells/mL), and cultured in a 5% CO.sub.2 incubator at 37 C. for 48 h to 144 h. Positive and negative serum controls, virus regression tests, serum toxicity controls and normal cell controls were set up. According to the Spearman-Karber method, a serum dilution capable of protecting 50% of the cell well from cytopathic effect is calculated, which is the titer of the neutralizing antibodies in the serum.

    [0062] The results showed that the titer of the neutralizing antibodies in the serum of the VLPs immunized group was 1: 32-1: 256, and the titer of the neutralizing antibodies in the serum of the group containing no immune proteins was 1: 16-1: 45, which testified the immune advantages of VLPs (FIG. 4).

    [0063] It will be obvious to those skilled in the art that changes and modifications may be made, and therefore, the aim in the appended claims is to cover all such changes and modifications.