CHEMICAL ENTITIES SUITABLE FOR THERAPY

20190352642 ยท 2019-11-21

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are artificial chemical entities, pharmaceutical compositions comprising such chemical entities and methods using the chemical entities. In some embodiments, the artificial chemical entity comprises a biomarker-bonding portion that selectively binds to a specified biomarker and an immune-response trigger that under in vivo conditions leads to positioning of an antibody Fc region in proximity of the biomarker to which the biomarker-binding portion is bound.

    Claims

    1-50. (canceled)

    51. An artificial chemical entity, comprising: a. a biomarker-bonding portion that selectively binds to a specified biomarker; and b. an immune-response trigger that under in vivo conditions leads to positioning of an antibody Fc region in proximity of said biomarker to which said biomarker-binding portion is bound wherein said immune-response trigger comprises an oligonucleotide aptamer strand that selectively binds to an antibody under in vivo conditions.

    52. The chemical entity of claim 51, wherein said specified biomarker is on the surface of a cell or virus envelope, and under in vivo conditions said immune-response trigger leads to positioning of an antibody Fc region in proximity of said surface.

    53. The chemical entity of claim 51, wherein said biomarker-bonding portion comprises a chemical group selected from the group consisting of: an oligonucleotide that constitutes an oligonucleotide aptamer strand, an oligopeptide that constitutes a peptide aptamer strand, a ligand to said specified biomarker, a receptor ligand, a growth factor and a small molecule residue.

    54. The chemical entity of claim 51, wherein: said cell is selected from the group consisting of a pathogen, a pathological cell and a memory autoimmune cell; and said biomarker is an antigen selected from the group consisting of a cancer marker, an immunoglobulin idiotope on autoimmune memory cell, a viral antigen, a bacteria antigen, a parasite antigen, a protozoa antigen and a prion.

    55. The chemical entity of claim 51, wherein said biomarker is selected from the group consisting of: an antigen; and an entity expressed on the surface of said cell, said entity selected from the group consisting of a protein, a polypeptide, an oligopeptide, a peptide, a glycopeptide, a ganglioside, a lipid, a phospholipid, a carbohydrate and a small molecule.

    56. The chemical entity of claim 51, wherein said biomarker-bonding portion is bonded to said immune-response trigger with a non-covalent associative bond.

    57. The chemical entity of claim 51, wherein said biomarker-bonding portion is directly covalently bonded with a covalent bond to said immune-response trigger.

    58. The chemical entity of claim 57, wherein said covalent bond is through a residue of a reactive group selected from the group consisting of NH2, SH, COOH, PO4, Tosyl, thiol, a photo-reactive group, a click-chemistry group and a member of an affinity couple.

    59. The chemical entity of claim 51, further comprising a linker bonded to said biomarker-bonding portion.

    60. The chemical entity of claim 59, wherein said immune-response trigger is bonded to said linker.

    61. The chemical entity of claim 59, wherein said linker is a chain comprising individual monomer residues selected from the group consisting of monosaccharide residues, nucleotide residues and combinations thereof.

    62. The chemical entity of claim 1, wherein said immune-response trigger oligonucleotide aptamer strand is selected from the group consisting of a DNA strand, an RNA strand, a strand including both RNA and DNA, and a strand including a modified nucleic acid.

    63. The chemical entity of claim 1, wherein said antibody to which said immune-response trigger oligonucleotide aptamer strand selectively binds to under in vivo conditions is selected from the group consisting of IgG, IgA, IgE, IgD and IgM.

    64. A pharmaceutical composition comprising: a chemical entity of claim 1; and a pharmaceutically-acceptable carrier,

    65. A method of treatment, comprising administering a pharmaceutically-effective amount of a chemical entity of claim 1 to a subject in need thereof.

    66. The method of claim 65, wherein said need is that said subject, suffers from a pathological condition.

    67. The method of claim 66, wherein said pathological condition is selected from the group consisting of cancer, an autoimmune disease, an allergy and infectious diseases.

    68. The method of claim 66, wherein said pathological condition is cancer and wherein said biomarker-bonding portion is for selectively binding to a specified biomarker on the surface of a cancerous cell.

    69. The method of claim 66, wherein said pathological condition is selected from the group consisting of an autoimmune disease and an allergy and wherein said biomarker-bonding portion is for selectively binding to a target binding idiotope of a membrane immunoglobulin molecule on the surface of a memory B-cell.

    70. The method of claim 66, wherein said pathological condition is an infectious disease caused by a pathogen, and wherein said biomarker-bonding portion is for selectively binding to a specified biomarker on the surface of the pathogen cell.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0094] Some embodiments of the invention are described herein with reference to the accompanying figures. The description, together with the figures, makes apparent to a person having ordinary skill in the art how some embodiments of the invention may be practiced. The figures are for the purpose of illustrative discussion and no attempt is made to show structural details of an embodiment in more detail than is necessary for a fundamental understanding of the invention. For the sake of clarity, some objects depicted in the figures are not to scale.

    In the Figures:

    [0095] FIG. 1A schematically depicts an embodiment 10 of a chemical entity according to the teachings herein in which: [0096] the biomarker-binding portion is an oligonucleotide aptamer strand 12, and [0097] the immune-response trigger consist of an IgG antibody 14, [0098] wherein the biomarker-bonding portion 12 is bonded to the immune-response trigger 14 with a covalent bond;

    [0099] FIG. 1B schematically depicts an embodiment 16 of a chemical entity according to the teachings herein in which: [0100] the biomarker-binding portion is an oligonucleotide aptamer strand 12, and [0101] the immune-response trigger consists of an Fc region 18 of an IgG antibody,
    wherein the biomarker-bonding portion 12 is bonded to the immune-response trigger 18 with a covalent bond;

    [0102] FIG. 1C schematically depicts an embodiment 20 of a chemical entity according to the teachings herein in which: [0103] the biomarker-binding portion is a first oligonucleotide aptamer strand 12a, and [0104] the immune-response trigger is a second oligonucleotide aptamer strand 12b,
    wherein the biomarker-bonding portion 12a is bonded to the immune-response trigger 12b with a linker 22, where the immune-response trigger 12b is depicted bonded to an IgG antibody 24;

    [0105] FIG. 1D schematically depicts an embodiment 26 of a chemical entity according to the teachings herein in which: [0106] the biomarker-binding portion is a first oligonucleotide aptamer strand 12a (e.g., biomarker on a cell surface, or a biomarker on cancer cell or immunoglobulin idiotope of autoimmune cell), and [0107] the immune-response trigger is a second oligonucleotide aptamer strand 12b (e.g., to bond to h-IgG, complement C1q),
    wherein the biomarker-bonding portion 12a is bonded to the immune-response trigger 12b with a linker 22 made up of either 2 or 3 Sp18 sublinkers, each Sp18 sublinker being a DNA skeleton of 18 sugar residues and phosphates, about 3.5-5.0 nm long.
    wherein: [0108] the 5 terminus of second oligonucleotide aptamer strand 12b is free, [0109] the 3 terminus of second oligonucleotide aptamer strand 12b is covalently bonded to [0110] the 5 terminus of linker 22, [0111] the 3 terminus of linker 22 is covalently bonded to the 5 terminus of first oligonucleotide aptamer strand 12a, and [0112] the 3 terminus of second oligonucleotide aptamer strand 12b is free and
    where the entire chemical entity 26 has an average molecular weight of 35000 Dalton;

    [0113] FIG. 2A graphically depict a hypothetical mechanism by which a chemical entity according to the teachings herein triggers the complement system:

    [0114] FIG. 2A-1 depicts how two different types of chemical entity according to the teachings herein, [0115] a chemical entity 10 (in the depicted embodiment, comprising an oligonucleotide aptamer strand 12 as a biomarker-bonding portion and an IgG antibody 14 as an immune-response trigger) and [0116] a chemical entity 16 (in the depicted embodiment, comprising an oligonucleotide aptamer strand 12 as a biomarker-bonding portion and a Fc portion of an IgG antibody 18 as an immune-response trigger)
    bind with the biomarkers on the cell wall 36 of a cell 38 which has a low density of biomarkers: due to the low density of biomarkers, the number of chemical entities 10 or 16 is insufficient to activate the complement system against cell 38,

    [0117] In contrast, FIG. 2A-2 depicts how multiple chemical entities 10 or 16 bind with the biomarkers on the cell wall 36 of a cell 40 which has a high density of biomarkers: due to the high density of biomarkers, a number of chemical entities 10 or 16 that is sufficient to activate the complement system against cell 40, binds to the biomarkers on cell wall 36 of cell 40, leading to the death of cell 40;

    [0118] FIG. 2B graphically depicts a hypothetical mechanism by which a chemical entity according to the teachings herein triggers the complement system;

    [0119] FIG. 2B-1a depicts chemical entities according to the teachings herein 26 (as depicted in FIG. 1D) bonding to biomarkers 42 on cell wall 36 of a cell through a biomarker-binding portion thereof and bonding to IgG antibodies 34 from the blood stream through an immune-response trigger portion thereof in sufficient density to activate the complement system via Complement C1q 44;

    [0120] FIG. 2B-1b depicts a chemical entity according to the teachings herein 46 (substantially similar to 26, but with an oligonucleotide aptamer strand configured to selectively bind complement C1q as an immune-response trigger) bonding to a biomarker 42 on cell wall 36 of a cell through a biomarker-binding portion thereof and bonding to a Complement C1q 44 from the blood stream through an immune-response trigger portion thereof, thereby activating the complement system by directly bonding to a Complement C1q 44 from the blood stream;

    [0121] FIG. 2B-2 depicts treatment of an autoimmune disease by two chemical entities according to the teachings herein 26 (as depicted in FIG. 1D) bonding to biomarkers 42 (memory immunoglobulin) on cell wall 36 of a cell (a memory B cell) through a biomarker-binding portion thereof, and bonding to IgG antibodies 34 from the blood stream through an immune-response trigger portion thereof in sufficient density to activate the complement system via Complement C1q 44;

    and a chemical entity according to the teachings herein 46 (with an oligonucleotide aptamer strand configured to selectively bind complement C1q as an immune-response trigger) bonding to a biomarker 42 (memory immunoglobulin element) on cell wall 36 of a cell (a memory B cell) through a biomarker-binding portion thereof, and bonding to a Complement C1q 44 from the blood stream through an immune-response trigger portion thereof thereby activating the complement system by directly bonding to a Complement C1q 44 from the blood stream.

    [0122] FIGS. 3A-3D are reproductions of photographs showing modified RBCs bound to Protein-A/Sepharose beads;

    [0123] FIG. 4 graphically depicts experimental results showing complement-induced hemolysis of IgG/Fc coupled RBCs;

    [0124] FIGS. 5A-5F are reproductions of photographs showing that embodiments of a chemical entity according to the teachings herein (called AptuBodies) induced agglutination of modified RBCs;

    [0125] FIG. 6 graphically depicts experimental results showing that an embodiment of a chemical entity according to the teachings herein (called aLys-IgG) induces hemolysis of Lysozyme-RBC;

    [0126] FIG. 7 graphically depicts experimental results showing that an embodiment of a chemical entity according to the teachings herein (called aLys-IgG) induces hemolysis of Lysozyme-RBC;

    [0127] FIG. 8 graphically depicts experimental results showing that an embodiment of a chemical entity according to the teachings herein (called Aptubodies) induces cultured cell death;

    [0128] FIG. 9 graphically depicts experimental results showing that an embodiment of a chemical entity according to the teachings herein (called DAC particles) induces cultured cell death; and

    [0129] FIG. 10 graphically depicts experimental results showing that an embodiment of a chemical entity according to the teachings herein (called DAC particles) induces cultured cell death.

    DESCRIPTION OF SOME EMBODIMENTS OF THE INVENTION

    [0130] Some embodiments of the teachings herein relate to artificial chemical entities, pharmaceutical compositions comprising such chemical entities, uses of such chemical entities and methods using the chemical entities. In some embodiments, aspects of the invention may be used for therapy of pathologies such as cancer, autoimmune diseases, allergies and infectious diseases. More particularly, in some embodiments the artificial chemical entities comprise two portions. A first portion is a biomarker-bonding portion that selectively binds to a specified biomarker. A second portion is an immune-response trigger that under in vivo conditions leads to positioning of an antibody Fc region in proximity of the biomarker to which the biomarker-binding portion is bound.

    [0131] The principal object of some embodiments of the teachings herein is the construction of a novel chemical entities called AptuBodies, for the therapy of cancer, autoimmune disease, allergies and infectious diseases, by activating the immune system.

    [0132] An additional object of some embodiments of the teachings herein is to provide a general method for the construction and preparation of AptuBodies as a chimeric IgG/IgG-Fc which are bound to nucleic acid aptamers that acts as cell surface markers binding elements.

    [0133] Another object of some embodiments of the teachings herein is to provide a new approach in the treatment of autoimmune disease and allergies, by specific eliminating the abnormal memory B-cells.

    [0134] Another object of some embodiments of the teachings herein is to provide a tool for performing personalized medicine.

    [0135] Methods and techniques for achieving these and other objects of the different embodiments of the teachings herein, are readily apparent to a person having ordinary skill in the art upon perusal of the specification.

    Construction of Assay Components

    [0136] Some embodiments of the teachings herein relate to a novel approach for the therapy of cancer, autoimmune disease, allergies and infectious diseases, by triggering the immune system, employing biomarker-bonding entities such as nucleic acid aptamers as biomarker binding elements and antibodies such as IgG as an element for triggering the immune-response system.

    [0137] Some such antibody\aptamer complexes (AptuBodies) comprise h-IgG or h-IgG-Fc, bound to a specific nucleic acid aptamer strand, directed against a biomarker such as an antigen on the target cells surface.

    [0138] In some such embodiments, the nucleic acid aptamer strand can be selected to recognize and bind different cell surface antigens, such as cancer markers, the idiotypes of membrane immunoglobins presented on the surface of memory B-cells (for autoimmune disease and allergies), infectious substance surface proteins (such as bacteria and viruses) and others. As the single strand nucleic acid aptamers have poor immunity, a low immune response is expected.

    [0139] Depending on the embodiment, the antibody can be an h-IgG (or other human Ab that can activate the complement), or Fc region of the IgG, eliminating the IgG binding region idiotope. In some embodiments, preferably, the IgG or FC source is from human source, to avoid species-directed immunity. The IgG can also come from the patient himself (Personalized medicine), or as a human mAb directed against a target that cannot be found normally in the human system.

    [0140] Binding of an aptamer strand to a protein can be induced in several ways, such as chemical binding or association binding. An example to chemical binding, employing cross linkers, but not limited to, is a 5 or 3 thiol (SH) modified oligonucleotide aptamer can be covalently binds to maleimide modified protein. Any other chemistry that will not affect the Ab or Fc ability to bind and activate the complement can be used, see FIGS. 1A and 1B.

    [0141] The use of linkers, such as PEG or others, between the Ab and the oligonucleotide aptamer is possible. An example to association binding, but not limited to, is the use of fused two aptamers, which one is directed against the chosen cell surface antigen and the other against the antigen binding site of a human mAb (such as mAb against Ricin-A). This will eliminate any potential steric interference for C1q binding to the Fc, see FIG. 1C.

    [0142] The fused aptamers can also be achieved by synthesis of what is called a Dual Aptamers Complex (DAC) particle (see FIG. 1D). The use of such DAC particles has the advantage of, inter alia: a) eliminating the needs for reagents and cross-linking procedure between the drug (such as an antibody) and the targeting element (i.e., biomarker-bonding portion); b) uses circulating natural serum elements (e.g., antibodies) as drugs, activating the body natural defense system, c) possess low immunity and relatively stable in the circulation and d) DAC particles are prepared chemically (e.g., solid state oligonucleotide synthesis), and therefore can easily be manufacture as a reagent for drug use, at low cost.

    [0143] In some embodiments, the biomarker-bonding portions (the AptuBodies target binding element) are any ligand to a specific cell surface target, such as, but not limited to, oligopeptide (amino acid) aptamer strands, growth factors, small molecule and others, as long as that target binding element is relatively inerratic to the immune system.

    Performing the Assay

    [0144] A hypothesized mechanism of an embodiment of an AptuBody triggering the complement system is pictorially described in FIGS. 2A-1, 2A-2 and FIGS. 2B-1a, 2B-1b, and 2B-2. According to our preliminary results, complement activation will occur only when there will be high amount of biomarkers such as antigens on the cell surface. This avoids the death of normal body tissue expressing low level of the biomarker, in contrast to pathological cancer cells that over express the biomarker. Similarly, only memory B-cells expressing the aptamer-directed immunoglobin idiotope bind the AptuBodies and trigger the complement system. In the case of infectious diseases, complement activation occurs after the AptuBodies bind to the bacteria or virus surface, or to human cells expressing the attacker proteins on their surface.

    [0145] This yields the destruction of the target membrane and death of the target cells, leading to reduce in tumor size or circulating tumor cells, the elimination of viruses, bacteria and infected cell from circulation, and to the destruction of autoimmune memory B-cells.

    EXPERIMENTAL EXAMPLES

    Abbreviations

    [0146] Unless otherwise noted, all abbreviations herein have the accepted meaning known in the relevant art field. Such abbreviations include: IgG: Immune globulin G; h\m-IgG: human\mouse IgG; Ab: antibody; mAb: monoclonal antibodies; MIP: Molecularly imprinted polymer; MI: maleimide; PEG: polyethylene glycol; RBC: Red Blood Cell; sSMCC: Sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate); PBS: Phosphate-buffered saline; DMSO: Dimethyl sulfoxide; DTT: Dithiothreitol; BSA: Bovine serum albumin; EDTA: Ethylenediaminetetraacetic acid; RPM: Round per minute; PDGF-BB: Platelet-Derived Growth Factor BB (E. Coli); Lys: Lysozyme; MUC-1: Human Mucin-1 Protein; TNFa: Tumor necrosis factor a; HCV: Hepatitis C virus and HIV: human immunodeficiency virus
    All materials were purchased from known commercial sources and include: from Thermo Scientific, sSMCC; from Sigma-Aldrich: PBS, DMSO, DTT, h-IgG, h-IgG Fc fragment, EDTA, BSA, CaCl2, MgCl2, N-Acetyl-Cys, Tween-20, Lysozyme, MTT reagent, medium DMEM, from ABCAM: Hamster complement, Muc1 antigen, Mud 1 Antibodies; from Invitrogen: Protein-A Sepharose beads; from GE: MiniTrap G-25; from Ella Biotech GmbH: oligonucleotide aptamer strands; from Prospec bio: PDGF-BB: Platelet-Derived Growth Factor B; from ATTC: MCF7 breast adenocarcinoma cells, MDCK cells, EMEM medium; from Peproteck ASIA: Rabbit anti PDGFBB Abs, Recombinant Human PDGF-BB.

    A. Example-1: Chemical Coupling of h-IgG/Fc or BSA to Human Red Blood Cells (RBC)

    [0147] This experiment tests the ability of the complement system to induce hemolysis of red blood cells (RBC) which carries IgG or Fc fragment artificially attached to their cell membrane.

    I. Materials:

    [0148] 1). RBC (from human donor) washed 3 with PBS (Sigma-Aldrich, St. Louis, Mo., USA), re-suspend to 40% v:v. in PBS (Sigma Aldrich).
    2). sSMCC cross linker (Thermo Scientific), 10 mg/ml in PBS 10% (Sigma Aldrich), DMSO (Sigma Aldrich)

    3). DTT 1M (Sigma Aldrich)

    [0149] 4a). h-IgG (Sigma Aldrich), 4.8 mg/ml=0.032 umole/ml
    4b). h-Fc (Sigma Aldrich), 3.2 mg/ml, 0.032 umole/ml
    4c). BSA (Sigma Aldrich), 2.0 mg/ml=0.032 umole/ml
    5). G-25 column (GE Healthcare Life Sciences, Marlborough, Mass., USA) of 10 ml (GE MiniTrap G-25)

    6). PBS (Sigma Aldrich)

    [0150] 7). PBS/BSA1 mg/ml (Sigma Aldrich)

    8). PBS/EDTA 1 mM (Sigma Aldrich)

    [0151] 9). Complement buffer PBS/BSA (1 mg/ml)/CaCl2 (2 mM)/MgCl2 (2 mM) (all Sigma Aldrich) [0152] 10). Hamster complement (Abcham, Ab155111), 1:10 diluted in complement buffer. [0153] 11). Protein-A Sepharose beads (Invitrogen) [0154] 12). N-Acetyl-Cys (Sigma Aldrich)

    II. Protein Activation:

    [0155] 1). Use a molar ratio of about 1:5 protein to sSMCC. Add 2.50 ul sSMCC (Freshly made) into 0.3 ml of protein preparation.
    2). Incubate 90 minute at room temperature (RT).
    4). Load onto dry G-25 column, and spin 2 min at 3500 RPM
    5). Collect sup. Bring to 400 ul with PBS/EDTA 1 mM. Use immediately.
    Concentrations of Protein-Maleimide (MI) activated post G-25 column:

    [0156] h-IgG-MI3.8 mg/ml, 8 mn in 400 ul PBS

    [0157] Fc-MI2.6 mg/ml, 8 mn in 400 ul PBS

    [0158] BSA-MI1.6 mg/ml, 8 mn in 400 ul PBS

    III. RBC Reduction

    1). To 1.0 ml RBC 40% v:v in PBS add 25 ul DTT of 1M

    2). Incubated for 45 min. at RT

    [0159] 3). Wash Cells 2 with 20 ml of PBS/BSA and 3 with 20 ml of PBS.
    4). Re-suspend cells in 1.0 ml PBS/EDTA 1 mM to 40% v:v, (510.sup.9 cells/ml)

    IV. Protein/RBC Binding

    [0160] 1). Mix cells and proteins as directed in the table below:

    TABLE-US-00001 Proteins amounts RBC: ul Tube protein ul (nmol) (7 10.sup.8) 1 IgG 300 (6.0) 150 2 IgG 60 (1.2) 150 3 Fc 300 (6.0) 150 4 Fc 60 (1.2) 150 5 BSA 300 (6.0) 150 6 BSA 60 (1.2) 150

    2). Incubate 120 min at RT

    [0161] 3). Add N-Acetyl-Cys (Sigma)100 ul 10 mg/ml in PBS (For MI blocking)

    4). Incubate 120 min at RT

    [0162] 5). Wash Cells 2 with 10 ml of PBS/BSA and 2 with PBS.

    6). Store at 4 C.

    V. Part-I: Binding of Modified RBC to Protein-A/Sepharose Beads.

    [0163] 10 ul of stock Protein-A/Sepharose beads were added into 100 ul of 5% RBC in PBS and let 60 min at RT rolling. Samples were observed under the microscope (magnification 40). Reproductions of these photographs are depicted in FIG. 3: FIG. 3A is of non-treated RBC, FIG. 3B is of BSA bound RBC, FIG. 3C is of h-IgG bound RBC. and FIG. 4D is of Fc-bound RBC.

    Results and Discussion

    [0164] As can be seen, when about 510.sup.6 activated IgG or Fc molecules (6 nm protein) were introduced per one activated RBC, a massive binding of the cells to the Protein-A Sepharose beads was observed. Less binding was observed when 10.sup.6 activated IgG or Fc molecules were added per cell (not shown). No binding of native RBC or BSA-coated RBC to the beads was observed.

    [0165] Employing I.sup.125 labeled IgG we have shown that under the above conditions, when about 510.sup.6 activated IgG molecules were introduced per one activated RBC, about 510.sup.4 IgG molecules were bound per one RBC (not shown). These results indicate that the chemically attached IgG or Fc can act as a bridge between the cells and the Protein-A beads, indicating that the cross linkers do not interfere with the Fc ability to bind to Protein-A.

    VI. Part-II: Complement Induced Hemolysis of Modified RBC

    [0166] 1) In microtube, add 50 ul of Complement preperation into 100 ul of RBC 5% in complement buffer.

    2). Incubate 60 min at 37 C.

    [0167] 3). Centrifuge cells 7000 RPM and collect sup.
    4). Estimate hemolysis by the optical dencity of hemoglobin at 540 nm, in compare to 100% hemolysis by Tween-20.

    Results and Discussion

    [0168] The results of this set of experiments are graphically depicted in FIG. 4 and show the complement-induced hemolysis of IgG/Fc coupled RBCs.

    [0169] As can be seen, when 6 nm activated IgG or Fc (about 510.sup.6 molecules) were introduced per one activated RBC, lysis of about 90% or 80% respectfully was observed. Only 30%-40% RBC lysis was observed when 1.2 nm activated IgG or Fc (about 110.sup.6 molecules) were added. About 5% RBC lysis was observed with native RBC or BSA-bound RBC.

    [0170] These results indicate that IgG-Fc which chemically bound to RBC surface can bind the complement C1q and activate the complement cascade, leading to the RBC hemolysis. This C1q binding and activation is depended upon the IgG-Fc density (number of molecules on the cell surface), and not depended a conformational change of the IgG upon binding to the antigen. Our results (not shown) indicates that when about 1-210.sup.4 IgG molecules were bound per one RBC, hemolysis of about 85% to 95% were obtained.

    B. Example-2: AptuBodies Construction

    I. Materials:

    [0171] 1. sSMCC cross linker (Thermo Scientific), 10 mg/ml in PBS 10% (Sigma Aldrich) DMSO (Sigma Aldrich) (23 nmole/ul)

    2. DTT 1M (Sigma Aldrich)

    [0172] 3a). h-IgG (Sigma Aldrich), 3.7 mg/ml (24 pmol/ul)
    3b). h-Fc (Sigma Aldrich), 2.4 mg/ml (24 pmol/ul)
    3c). BSA (Sigma Aldrich), 1.5 mg/ml (24 pmol/ul)
    4). G-25 column of 10 ml (GE MiniTrap G-25)

    5). PBS (Sigma Aldrich)

    [0173] 6). PBS/BSA 1 mg/ml (Sigma Aldrich)

    7). PBS/EDTA 1 mM (Sigma Aldrich)

    8). PBS/EDTA 5 mM (Sigma Aldrich)

    [0174] 9). Anti-Lysozyme DNA aptamer (aLys) (23), 200 pmol/ul (Ella Biotech GmbH).

    TABLE-US-00002 SEQIDNO:1-Thiol-C.sub.12-5-ATCTACGAATTCATC AGGGCTAAAGAGTGCAGAGTTACTTAG-3
    10). Anti-PDGF DNA aptamer (aPDGF) (24), 200 pmol/ul (Ella Biotech GmbH).

    TABLE-US-00003 SEQIDNO:2-Thiol-C.sub.12-5-GCGATACTCCACAGG CTACGGCACGTAGAGCATCACCATGATCCTG-3

    II. DNA Aptamers-Thiol Activation

    [0175] 1). 100 ul Aptamer (20 nm) were incubated in 100 mM DTT for 1 h at RT.
    2). DNA-SH was loaded onto G-25 column saturated with PBS 5 mM EDTA and centrifuge for 2 min at 1000g.
    3). Aptamers-SH (aLys-SH and aPDGF-SH) were used imminently.

    III. Protein-MI Formation

    [0176] 1). h-IgG, h-Fc or BSA, (500 ul, 12 nm), were incubated with 10 ul of sSMCC in PBS/1 mM EDTA 10% DMSO, for 2 h at RT (20:1 m:m).
    2). Protein-MI was loaded onto G-25 column saturated with PBS 5 mM EDTA and centrifuge for 2 min at 1000g.
    3). Protein-MI was used imminently.

    IV. AptuBodies Construction

    [0177] 1). Protein-MI preparations, 500 ul (8 nmol) each, were mixed with 100 ul (16 nmol) of aptamers-SH preparations, at a molar ratio of 1:2.
    2). Mixtures were incubated Over Night at RT.
    3). Add N-Acetyl-Cys (Sigma)10 ul 2 mg/ml in PBS (For MI blocking)
    4). Store at 4 C. Aptubodies concentration is about 13 nmol/ul by protein: [0178] a). anti Lysozyme aptamer h-IGg AptuBodies (aLys-IgG)2 mg/ml [0179] b). anti Lysozyme aptamer Fc AptuBodies (aLys-Fc)1.3 m,g/ml [0180] c). anti Lysozyme aptamer BSA AptuBodies (aLys-BSA)0.8 mg/ml [0181] d). anti PDGF aptamer h-IGg AptuBodies (aPDGF-IgG)2 mg/ml

    C. Example-3: AptuBodies Induced Complement Activation

    [0182] These experiments demonstrate the hemolysis of RBC induced by the complement system, being activated by AptuBodies directed against proteins that were artificially attached to the cell membrane. We have chosen the lysozyme antigen as a target, to be bound to the RBC surface. It is noted that the protein lysozyme has no enzymatic activity against RBC.

    I. Materials:

    [0183] 1a). Lysozyme (Sigma Aldrich), 0.5 mg/ml=0.032 umole/ml
    1b). BSA (Sigma Aldrich), 2.0 mg/ml=0.032 umole/ml
    2a). anti Lysozyme aptamer h-IGg AptuBodies (aLys-IgG) from above
    2b). anti Lysozyme aptamer Fc AptuBodies (aLys-Fc) from above
    2c). anti Lysozyme aptamer BSA AptuBodies (aLys-BSA) from above
    2d). anti PDGF aptamer h-IGg AptuBodies (aPDGF-IgG) from above
    3). Rabbit anti lysozyme Abs (polyclonal, Abcham) 1 mg/ml
    4). Complement buffer PBS/BSA (1 mg/ml)/CaCl2 (2 mM)/MgCl2 (2 mM) (all Sigma Aldrich)
    All other materials are as describe in sample-1 at section A and in sample-2 at section B.

    II. Lysozyme and BSA Coupling to RBC

    [0184] Protein activation, human RBC reduction and Protein/RBC binding were performed as describe in sample-1 at section A, employing 6.0 nm and 0.6 nm of lysozyme and 6.0 nm of BSA.

    III. Aptubodies Preparation

    [0185] Aptubodies were prepared as described in sample-2 at section B.

    IV. AptuBodies Induced Hemolysis of Lysozyme=RBC

    Part-I: Agglutination of Modified RBC by AptuBodies

    [0186] 50 ul of 1:10 dilution of anti Lysozyme Ab or AptuBodies preparation were incubated with 50 ul of 5% modified RBC in PBS for 1 h at RT with gentle shack. Samples were observed under the microscope (magnification 40).
    The results of this set of experiments are depicted in FIG. 5 that are reproductions of photographs showing that the AptuBodies described above induced agglutination of modified RBCs:

    [0187] FIG. 5A non-modified cells with Lys-IgG Aptubodies;

    [0188] FIG. 5B lysozyme-modified cells without a chemical entity according to the teachings herein;

    [0189] FIG. 5C: BSA-modified cells with Lys-IgG Aptubodies;

    [0190] FIG. 5D: lysozyme-modified cells with Anti-lysozyme-IgG;

    [0191] FIG. 5E: lysozyme-modified cells with Lys-IgG Aptubodies; and

    [0192] FIG. 5F: lysozyme-modified cells with Lys-Fc Aptubodies.

    Results and Discussion

    [0193] As can be seen, modification of the RBC by itself did not cause cell Agglutination, nor did the introducing of the AptuBodies to non-modified RBC or BSA modified RBC.

    [0194] On the other hand, when anti Lysozyme Abs or aLys-AptuBodies (IgG or Fc base) were introduce to the RBC, cell Agglutination was observed. This indicates that under the conditions used, there were at least two aptamers per IgG/Fc molecule.

    Part-2: aLys-IgG Induced Hemolysis of Modified RBC
    1). To 40 ul of 20% RBC preparations in complement buffer add 20 ul aLys-IgG AptuBodies; Incubate for 1 hr. at room temperature.
    2). Add 20 ul of Guinea Pig Complement or PBS and incubate for 20 minutes at 37 C.
    3). Add 100 ul PBS, centrifuge the cells, collect the sup and read 540 nm.

    Results and Discussion

    [0195] The results of this set of experiments are graphically depicted in FIG. 6 and show the aLys-IgG described above induced hemolysis of Lysozyme-RBC.

    [0196] These results demonstrate the ability of aLys-IgG AptuBodies and anti lysozyme Abs to lysozyme associate RBC, but not to BSA associate RBC and to trigger complement activation, leading to the RBC hemolysis. The RBC hemolysis was found to be depended on the amount of target antigen presence on the cells surface, showing more hemolysis when more antigen is presence on the cells surface. Similar results were obtained with native, un-modified, anti target (Lysozyme) Abs.

    [0197] The results also indicate that the Aptamer part of the AptuBodies does not interfere with the Fc ability to bind and activate the complement system, similarly to native Abs.

    Part-3: AptuBodies Specificity Test

    [0198] All experimental methods were as describe in Part-2 above.
    The results of this set of experiments are graphically depicted in FIG. 7 that show how the aLys-IgG described above induced.

    Results and Discussion

    [0199] The results described in FIG. 14 further demonstrate the ability of antigen specific IgG/Fc AptuBodies to trigger complement activation, leading to its target RBC hemolysis.

    D. Example-4: AptuBodies Induced Complement Killing of Cultured Cells Expressing the Muc1 Antigen

    [0200] We have shown that Aptubodies directed against cell surface antigen trigger complement activity and causes the hemolysis of RBC. To test whether Aptubodies may be directed in the same manner to pathological cell surface markers of living cells, we have chosen the MCF7 breast adenocarcinoma cells, which express the Muc1 antigen on their surface (ref 25), an antigen that have a related Aptamer, describe in the literature (ref 26). Working with these cells gives and advance in future studies as these cells are used in a mouse model for breast adenocarcinoma, employing anti Muc1 antibodies as a treatment (ref. 27). MDCK cells were used as a negative control cells. Estimation of MTT reagent incorporation was used as a tool for determinant the viability of the cell. In parallel, Methyl Blue staining was used as tool for determinant the cell membrane damaging and cell death.

    I). Materials:

    [0201] 1). Anti-Muc1 DNA aptamer (aMuc) (Ella Biotech GmbH), 200 pmol/ul were a 1:1 mixture of 2 aptamers against the Muc1 antigen: 5TR1 and 5TRG2 (26):

    TABLE-US-00004 5TR1: SEQIDNO:3-Thiol-C.sub.12-5-GAGACAAGAATAAAC GCTCAAGAAGTGAAAATGACAGAACACAACATTCGACAGG AGGCTCACAACAGGC-3 5TRG2: SEQIDNO:4-Thiol-C.sub.12-5-GAGACAAGAATAAAC GCTCAAGGCTATAGCACATGGGTAAAACGACTTCGACAGG AGGCTCACAACAGGC-3
    2a). anti Muc1 aptamer h-IGg AptuBodies (aMuc-IgG) 2 mg/ml by protein, from above.
    2b). anti Muc1 aptamer Fc AptuBodies (aMuc-Fc) 1.3 mg/ml by protein, from above.
    2c). anti Muc1 aptamer BSA AptuBodies (aMuc-BSA) 0.8 mg/ml by protein, from above.
    2d). anti Lysozyme aptamer h-IGg AptuBodies (aLys-IgG) 2 mg/ml by protein, from above.
    2e). anti Lysozyme aptamer Fc AptuBodies (aLys-Fc) 2 mg/ml by protein, from above.
    3). Rabbit anti Muc1 Abs (polyclonal, Abcham ab1548) 0.2 mg/ml, from above.
    4). MCF7 breast adenocarcinoma cells (ATCC HTB-22), grown in medium ATCC formulated EMEM [cat 30-2003] with insulin, in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    5). MDCK cells (ATCC CCL-34) cells, grown in medium DMEM (Sigma D5796), in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    6). MTT reagent (Sigma-Aldrich M5655)

    [0202] All other materials, and AptuBodies construction, are as describe in sample-2 at section B and in sample-3 at section C.

    II). AptuBodies Induced Cultured Cell Death

    [0203] 1) MCF7 cells and MDCK cells were grown in 96-well plate to 60-80% confluence, in their optimal growth medium and conditions.
    2) Medium was removed, 50 ul of treatment mix 2.1-2.8 was applied in triplicates and cells were incubated 37 C. with 5% CO.sub.2, for 2 h. [0204] 2.1) 10% PBS+10% complement in related buffer. (Control cells) [0205] 2.2) 10% PBS contains 1.0 ug (7 pmol) of Anti MUC1 antibodies+10% complement in related sera free medium. [0206] 2.3) 10% PBS contains 1.0 ug (7 pmol) of aMuc-IgG AptuBodies+10% complement in related sera free medium. [0207] 2.4) 10% PBS contains 1.5 ug (7 pmol) of aMuc-Fc AptuBodies+10% complement in related sera free medium. 2.5) 10% PBS contains 2.5 ug (7 pmol) of aMuc-BSA AptuBodies+10% complement in related sera free medium. [0208] 2.6) 10% PBS contains 1.0 ug (7 pmol) of aLys-IgG AptuBodies+10% complement in related sera free medium. [0209] 2.7) 10% PBS contains 1.5 ug (7 pmol) of aLys-Fc AptuBodies+10% complement in related sera free medium. [0210] 2.8) 10% PBS and 1% Tween20 in related buffer. (dead cells control).
    3) After incubation 50 ul of 1 mg/ml MTT in PBS was added and incubated for 1 h at 37 C. with 5% CO.sub.2.
    5) Medium was removed, cells were washed with PBS and 100 ul of DMSO was added and mixed till complete dissolve of the dye.
    6) The optical density of the dye was estimated at 493 nm.

    [0211] The results below are summarizing several experiments

    Results and Discussion

    [0212] The results of this set of experiments are graphically depicted in FIG. 8 that show that the Aptubodies described above induced cultured cell death.

    [0213] The results demonstrate that cultured cell death was induced by the complement system, being activated by AptuBodies directed against a target protein on the cells surface. No effect of the AptuBodies on control cells (MDCK) was observed.

    [0214] Cell death was observed only when the AptuBodies contains IgG or Fc, but not when the aptamer was conjugated to BSA protein. Furthermore, Cell death was depended on the target related aptamer of the AptuBodiesaMuc1, and cell death was not observed when unrelated aptamer, aLys, were presence in the AptuBodies contract.

    t-Test result (P values) showed significance as shown in FIG. 15.

    E. Example-5a: DAC Particles Induced Complement Killing of Cultured Cells Expressing the Muc1 Antigen

    [0215] We have shown that Aptubodies, together with IgG/Fc can trigger complement activity and causes cultured cell death. To test whether the DAC particles can do the same, the following system was developed. MCF7 and MDCK cultured cells were chosen as target and control cells as describe above (example-4).

    [0216] At the time that this experiment was conduct, the development of DAC that connect directly with Abs was not completed. For this reason, we have used a surrogate system, we interact an aptamer with the Ab via sandwich structure. We have both aptamer and Ab against the protein PDGFBB, this protein served as a non-covalent linker between the anti-PDGFBB-aptamer on one hand and the anti-PDGFBB-Ab on the other.

    [0217] DAC particles were constructed to carry the anti MUC1aptameranti hPDGFBB aptamer. DAC particles composed of anti MUC1aptameranti hTNFa aptamer was used as negative control.

    [0218] In order to promote IgG-DAC binding, h-PDGFBB antigen was incubated for 1 h at RT with affinity pure poly clonal Rabbit anti h-PDGFBB IgG at molar ratio of 20:1 of Ag to Ab. The high Ag execs meant to prevent the formation of immuno-complexes which can induce complement activity.

    [0219] Estimation of MTT reagent incorporation was used as a tool for determinant the viability of the cell. In parallel, Methyl Blue staining was used as tool for determinant the cell membrane damaging and cell death.

    I. Materials:

    [0220] 1). Anti-Muc1\anti-hPDGFBB or anti-hTNFa DAC particles (200 pmol/ul) were a 1:1 mixture of 2 DAC particles compos of 2 aptamers against the Muc1 antigen: 5TR1 and 5TRG2 (26)

    Anti-hPDGFBB Aptamer (Ella Biotech GmbH):

    [0221]

    TABLE-US-00005 SEQIDNO:2-5-GCGATACTCCACAGGCTACGGCACG TAGAGCATCACCATGATCCTG-3

    Anti-hTNFa Aptamer, (Ella Biotech GmbH):

    [0222]

    TABLE-US-00006 SEQIDNO:5-5-TGGTGGATGGCGCAGTCGGCGACAA-3

    5TR1-PDGF DAC Particle (Ella Biotech GmbH):

    [0223]

    TABLE-US-00007 SEQIDNO:6-5-GAGACAAGAATAAACGCTCAAGAAG TGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAA CAGGC-SP18-GCGATACTCCACAGGCTACGGCACGTAGAG CATCACCATGATCCTG-3

    5TRG2-PDGF DAC Particle (Ella Biotech GmbH):

    [0224]

    TABLE-US-00008 SEQIDNO:7-5-GAGACAAGAATAAACGCTCAAGGCT ATAGCACATGGGTAAAACGACTTCGACAGGAGGCTCACAA CAGGC-SP18-GCGATACTCCACAGGCTACGGCACGTAGAG CATCACCATGATCCTG-3
    Anti-hTNFa based DAC: as above, but anti-TNFa aptamer is located at the DAC 3.
    2). Rabbit anti Muc1 Abs (polyclonal, Abcham ab1548) 0.2 mg/ml
    3). Rabbit anti PDGFBB Abs (polyclonal, PeproTech 500-P47) 0.2 mg/ml
    4). Recombinant Human PDGF-BB (PeproTech 100-14B) 0.5 mg/ml
    5). MCF7 breast adenocarcinoma cells (ATCC HTB-22), grown in medium ATCC formulated EMEM [cat 30-2003] with insulin, in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    6). MDCK cells (ATCC CCL-34) cells, grown in medium DMEM (Sigma D5796), in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    7). MTT reagent (Sigma-Aldrich M5655)
    All other materials, and methods, are as describe above

    II. AptuBodies Induced Cultured Cell Death

    [0225] 1) MCF7 cells and MDCK cells were grown in 96-well plate to 60-80% confluence, in their optimal growth medium and conditions.
    2) Medium was removed, 75 ul of treatment mix 2.1-2.9 was applied in triplicates and cells were incubated 37 C. with 5% CO.sub.2, for 2 h.
    2.1) 10% PBS+10% complement in related sera free medium. (Control cells)
    2.2) 10% PBS contains 1.5 ug (10 pmol) of Anti MUC1 antibodies+10% complement in related sera free medium.
    2.3) 10% PBS contains 1.5 ug (10 pmol) of Anti h-PDGFBB antibodies+10% complement in related sera free medium.
    2.4) 10% PBS contains 200 pmol of aMuc-aPDGF DAC particles+10% complement in related sera free medium.
    2.5) 10% PBS contains 200 pmol of aMuc-aPDGF DAC particles and 1.5 ug (10 pmol) Anti h-PDGFBB antibodies+10% complement in related sera free medium.
    2.6) 10% PBS contains 200 pmol of aMuc-aPDGF DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies complex (1.5 ug Ab, 10 pmol)+10% complement in related sera free medium.
    2.7) 10% PBS contains h-PDGFBB\Anti h-PDGFBB antibodies complex (1.5 ug Ab, 10 pmol)+10% complement in related sera free medium.
    2.8) 10% PBS contains 200 pmol of aMuc-aTNFa DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies complex (1.5 ug Ab, 10 pmol)+10% complement in related sera free medium.
    2.9) 10% PBS and 1% Tween20 in related sera free medium. (dead cells control).
    (The access of OCA particles are needed as the PDGF Ag is in 20 then the Abs)
    3) After incubation 75 ul of 1 mg/ml MTT in PBS was added and incubated for 1 h at 37 C. with 5% CO.sub.2.
    4) Medium was removed, cells were washed with PBS and 100 ul of DMSO was added and mixed till complete dissolve of the dye.
    5) The optical density of the dye was estimated at 493 nm.
    The results below are summarizing several experiments

    Results and Discussion

    [0226] The results of this set of experiments are graphically depicted in FIG. 9 that show how the DAC particles described above induced cultured cell death.

    [0227] The results demonstrate that cultured cell death was induced by the complement system, only after being activated by either:

    a). anti-NUC Abs on MCF-7 cellsabout 53%, but not on MDCK cellsabout 7%.
    b). Immune-complex elements (anti-PFGDBB\PDGFBB complex).
    c). DAC particles directed against a target protein on the cells surface and PDGFBB, together with the anti-PDGFBB\PDGFBB complex.

    [0228] The immune-complex elements prompted also death of the control MDCK cells (about 25% for MDCK cells and about 29% for MCF-7 cells), but increase in cell death was occurred only with MCF-7 cells, in the present of the MUC-PDGF DAC particles (about 48%), but not with the MUC-TNFa DAC particles.

    [0229] No effect of the DAC particles or unrelated Abs was observed with both cell types. t-Test result (P values) showed significance as shown in FIG. 16.

    Example-5b: DAC Particles Induced Complement Killing of Cultured Cells Expressing the Muc1 Antigen

    [0230] Using polyclonal Abs (Rabbit anti-PDGFBB) in the previous DAC experiment yield high background in killing both MCF7 and MDCK cells. This was probably due to complement activation by Immuno-Complexes, formed when more than one Ab was bound to same Antigen. This also effect and reduce the specific binding of the related aptamer to the Ab\Ag complex (steric effect and site competition).

    [0231] To eliminate that effect, the same system was tested employing monoclonal Abs to PDGFBB.

    [0232] DAC particles were constructed to carry the anti MUC1aptameranti hPDGFBB aptamer. DAC particles composed of anti MUC1aptameranti hTNFa aptamer was used as negative control. MCF7 was used as target cells and MDCK cells were used as negative control cells.

    [0233] In order to promote IgG-DAC binding, h-PDGFBB antigen was incubated for 1 h at RT with mouse monoclonal anti h-PDGFBB IgG at molar ratio of 1:2, to maintain nearly no free Ag in the system (most of the Ag will bound to the IgG).

    [0234] Estimation of MTT reagent incorporation was used as a tool for determinant the viability of the cell. In parallel, Methyl Blue staining was used as tool for determinant the cell membrane damaging and cell death.

    I. Materials:

    [0235] 1). Anti-Muc1\anti-hPDGFBB or anti-hTNFa DAC particles (200 pmol/ul) were a 1:1 mixture of 2 DAC particles composed of 2 aptamers against the Muc1 antigen: 5TR1 and 5TRG2 (ref. 26)

    Anti-hPDGFBB Aptamer (Ella Biotech GmbH):

    [0236]

    TABLE-US-00009 SEQIDNO:2-5-GCGATACTCCACAGGCTACGGCACG TAGAGCATCACCATGATCCTG-3

    Anti-hTNFa Aptamer (Ella Biotech GmbH):

    [0237]

    TABLE-US-00010 SEQIDNO:5-5-TGGTGGATGGCGCAGTCGGCGACAA-3

    5TR1-PDGF DAC Particle (Ella Biotech GmbH):

    [0238]

    TABLE-US-00011 SEQIDNO:6-5-GAGACAAGAATAAACGCTCAAGAAG TGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAA CAGGC-SP18-GCGATACTCCACAGGCTACGGCACGTAGAG CATCACCATGATCCTG-3

    5TRG2-PDGF DAC Particle (Ella Biotech GmbH):

    [0239]

    TABLE-US-00012 SEQIDNO:7-5-GAGACAAGAATAAACGCTCAAGGCT ATAGCACATGGGTAAAACGACTTCGACAGGAGGCTCACAA CAGGC-SP18-GCGATACTCCACAGGCTACGGCACGTAGAG CATCACCATGATCCTG-3
    Anti-hTNFa based DAC: as above, but anti-TNFa aptamer is located at the DAC 3.
    2). Rabbit anti Muc1 Abs (polyclonal, Abcham ab1548) 0.2 mg/ml
    3). Mouse Monoclonal (IgG1) to Human PDGF-BB (LsBio, LS-C38273) 0.5 mg/ml. 4). Mouse anti-Human PDGF-BB Monoclonal Antibody (MyBioSource, MBS690977) 100 ug.
    5). Recombinant Human PDGF-BB (PeproTech 100-14B) 0.5 mg/ml
    6). MCF7 breast adenocarcinoma cells (ATCC HTB-22), grown in medium ATCC formulated EMEM [cat 30-2003] with insulin, in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    7). MDCK cells (ATCC CCL-34) cells, grown in medium DMEM (Sigma D5796), in 96 well plates to 60%-80% confluences, at 37 C., 5% CO.sub.2.
    8). MTT reagent (Sigma-Aldrich M5655)

    II. AptuBodies Induced Cultured Cell Death

    [0240] 1) MCF7 cells and MDCK cells were grown in 96-well plate to 60-80% confluence, in their optimal growth medium and conditions.
    2) Medium was removed. 75 ul of treatment mix (see below) was applied in triplicates and cells were incubated 37 C. with 5% CO.sub.2, for 2 h.
    I) 10% PBS+10% complement in related sera free medium. (Control cells)
    II) 10% PBS contains 1.5 ug (10 pmol) of Anti MUC1 antibodies+10% complement in related sera free medium.
    III) 10% PBS contains 3.0 ug (20 pmol) of Anti h-PDGFBB antibodies LS-C38273+10% complement in related sera free medium.
    IV) 10% PBS contains 3.0 ug (20 pmol) of Anti h-PDGFBB antibodies MBS690977+10% complement in related sera free medium.
    V) 10% PBS contains 100 pmol of aMuc-aPDGF DAC particles+10% complement in related sera free medium.
    VI) 10% PBS contains 100 pmol of aMuc-aPDGF DAC particles and 3.0 ug (20 pmol) Anti h-PDGFBB antibodies LS-C38273+10% complement in related sera free medium.
    VII) 10% PBS contains 100 pmol of aMuc-aPDGF DAC particles and 3.0 ug (20 pmol) Anti h-PDGFBB antibodies MBS690977+10% complement in related sera free medium.
    IIX) 10% PBS contains 100 pmol of aMuc-aPDGF DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies LS-C38273 complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    IX) 10% PBS contains 200 pmol of aMuc-aPDGF DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies MBS690977complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    X) 10% PBS contains h-PDGFBB\Anti h-PDGFBB antibodies LS-C38273 complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    XI) 10% PBS contains h-PDGFBB\Anti h-PDGFBB antibodies MBS690977 complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    XII) 10% PBS contains 200 pmol of aMuc-aTNFa DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies LS-C38273 complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    XIII) 10% PBS contains 200 pmol of aMuc-aTNFa DAC particles and h-PDGFBB\Anti h-PDGFBB antibodies MBS690977 complex (50 pmol Abs and 25 pmol Ag)+10% complement in related sera free medium.
    XIV) 10% PBS and 1% Tween20 in related sera free medium. (dead cells control).
    3) After incubation 75 ul of 1 mg/ml MTT in PBS was added and incubated for 1 h at 37 C. with 5% CO.sub.2.
    4) Medium was removed, cells were washed with PBS and 100 ul of DMSO was added and mixed till complete dissolve of the dye.
    5) The optical density of the dye was estimated at 493 nm. Results were calculated as percent of 100% death (sample XIV).

    Results and Discussion

    [0241] All experiments perform with Anti h-PDGFBB antibodies LS-C38273 gave negative results.
    This might suggest that the anti PDGFBB aptamer sequence used bind the same or nearby epitope on the Ag surface.
    The results of this set of experiments are graphically depicted in FIG. 10 that show how the DAC particles described above induced cultured cell death.
    The results demonstrate that cultured cell death was induced by the complement system, only after being activated by either:
    a). anti-NUC Abs on MCF-7 cellsabout 63%, but not on MDCK cellsabout 7%.
    b). DAC particles directed against a target protein on the cells surface and PDGFBB, together with the anti-PDGFBB\PDGFBB complex.
    No immune-complex was formed when mono-clonal Abs are used.
    No effect was observed with specific and non-specific DAC particles by themselves on both cell types. No effect was observed also when non-specific DAC particles
    Were used together with the Ab/Ag complex or when unrelated Abs were used.
    t-Test result (P values) indicates the significance of the results.
    This experiment proved that fully synthetic DAC particles can specifically induce cell-death of cells presenting cancerous bio-marker.

    F. Example-6: The Use of AptuBodies for the Treatment of Autoimmune Disease and Allergies

    [0242] In autoimmune disease (and allergies), memory B-cell in the circulation is responsible for the secondary, rapid immune respond. Eliminating this memory B-cell will lead to the cure of the disease. Amanda S. Lakamp and Miche M. Ouellette have described a ssDNA aptamer that binds selectively to the anti-FLAG M2 antibody and blocks its function (ref 28). In their paper they suggest to use such function blocking technique, as a therapeutic method for patients with systemic lupus erythematosus, rheumatoid arthritis, and other autoimmune diseases. We suggest using such aptamers to construct AptuBodies for the elimination of memory B-cells related to the disease.

    [0243] For example, The CCP positive rheumatoid arthritis is an autoimmune disease. These patients carry Abs against an antigen of their arthritis, which similar to the cyclic oligopeptide CCP (ref 29). Being relatively small molecule, there is only few Abs antigen binding sites which directed against the numbers of IgG oligopeptide. Developing aptamers against these idiotopes, will lead to the construction of AptuBodies directed against memory B-cells presenting the related membrane immunoglobulin, leading to the killing of the B-cells and eliminating the disease.

    [0244] Another example is Bullous Pemphigoid (BP). BP is chronic itchy blistering disorder found mainly in aged person, characterized by frequent occurring of tense blister and erythema. Target antigens of the autoantibodies in BP patient serum are BP180 and BP2301), also called BPAG1 and BPAG2 (30). Developing aptamers to the idiotopes of Abs directed against these antigens, will lead to the construction of AptuBodies directed against memory B-cells presenting these related membrane immunoglobulins, leading to the killing of the B-cells and relief/eliminating the disease.

    [0245] Similarly, to above, selecting anti allergens IgG idiotopes and construing the related AptuBodies will lead to new therapeutic for allergies.

    G. Example-7: The Use of AptuBodies for the Treatment of Infectious Diseases

    [0246] In many infectious diseases, mainly in viral diseases, the pathogens infect the host cells and multiply in them. As part of this route, the pathogen surface proteins are expressed on the host cell surface. These proteins can be used as target for Aptamers, introducing the AptuBodies a useful tool the trigger complement induce infected cell death, fighting the disease.

    [0247] One example for this approach is Hepatitis C virus (HCV), which attacks the liver cells, causing the distraction of the liver. It has been found that HCV patients do not carry anti HCV Abs against their intrinsic virus's quasispecies (ref. 31). A conserved HCV-surface glycoprotein sequence and mAbs against that protein, which recognizing most virus subtypes has been reported (ref. 31). Another example is the expression of the HIV gp70 on the surface of infected cells. Aptamers for the HIV gp70 and for the HCV surface proteins has been repotted (ref 32).

    H. Example-8: The Use of AptuBodies as Passive Immunity

    [0248] Passive immunity is the transition of active immunity in the form of ready-made antibodies.

    [0249] AptuBodies can be widely used as Passive immunity, having target specific aptamers for specific binding the AptuBodies, and h-IgG or h-Fc for triggering the immune and particularly the complement system, eliminating the pathogen. The pathogen can be, but not limited to, Bacteria, Virus, and others. Aptamers directed against surface elements of such invaders were described (ref. 20, 33).

    [0250] The low immunity and low cost of the DAC particles place them as a useful tool for Passive immunity.

    I. Example-9: In-Vivo Experiment with DAC AptuBodies (Prophetic Example)

    [0251] This experiment evaluates the potential anti-tumor activity of AptuBodies and compare it with other treatments in the mouse MCF-7 metastatic breast tumor model in ICR-SCID mice

    Species & Gender:

    [0252] C.B-17/IcrHsd-Prkdcscid mice, female, 10-11 weeks of age at tumor induction.

    Group Size:

    [0253] n=7

    No. of Groups:

    [0254] 1 Vehicle Control group; 5 Test Items groups: (i) Anti-MUC1 Ab. (ii) Non-specific Ab. (iii) Anti-MUC1 Aptubody (iv) Non-specific Aptubody (v) Aptamer. Total n=42

    Acclimation:

    [0255] At least 5 days.

    Tumor Induction:

    [0256] By a single IV injection of 1105 cells/animal at a dose volume of maximum 200 l/Animal on day 0. On the day of tumor cell injection animals will be subjected to subcutaneous implantation of 17.sub.-Estradiol pellet under general anesthesia.

    Treatment:

    [0257] The various Test Items are injected 1-day post tumor cells injection, by IV injection at a volume dosage of maximum 10 ml/kg

    Examinations:

    [0258] Body Weight and Detailed Clinical SignsOnce a week. Daily cage side observations and survival check.

    Study Period:

    [0259] 60 days

    Study Termination:

    [0260] Full detailed macroscopic examination of moribund, dead and all survivors, including collection of abnormalities (i.e. suspected metastases). All collected tumors/organs/tissues will be fixed in 4% formaldehyde solution for histopathological evaluation.

    Results:

    [0261] The effect of the treatments will be evaluated by body weight, survival, tumor size and pathology as well as metastasis.

    [0262] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. In case of conflict, the specification, including definitions, takes precedence.

    [0263] As used herein, the terms comprising, including, having and grammatical variants thereof are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof.

    [0264] As used herein, the indefinite articles a and an mean at least one or one or more unless the context clearly dictates otherwise.

    [0265] As used herein, when a numerical value is preceded by the term about, the term about is intended to indicate +/10%.

    [0266] As used herein, a phrase in the form A and/or B means a selection from the group consisting of (A), (B) or (A and B). As used herein, a phrase in the form at least one of A, B and C means a selection from the group consisting of (A), (B), (C), (A and B), (A and C), (B and C) or (A and B and C).

    [0267] In some instances herein, the term aptamer is used as a synonym for oligonucleotide aptamer strand.

    [0268] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

    [0269] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the scope of the appended claims.

    [0270] Citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the invention.

    [0271] Section headings are used herein to ease understanding of the specification and should not be construed as necessarily limiting.

    REFERENCES

    [0272] 1. Parkin J, Cohen B. An overview of the immune system Lancet 2001, 2, 357 (9270), 1777-1789. [0273] 2. Autoimmune Diseases, Acute and Complex Situations in Khamashta, Munther A.; Ramos-Casals, Manuel (Ed), 1st Edition., 2011, XII, 416 p. [0274] 3. Sridhar Rao P N., B cell activation and Humoral Immunity http://www.microrao.com/micronotes/pg/humoral_immunity.pdf [0275] 4. Stuart A, Tangyel G, Tarlinton D M Memory B cells: Effectors of long-lived immune Responses Eur. J. Immunol. 2009, 39, 2065-2075. [0276] 5. Shivan and Pandey, Hybridoma technology for production of monoclonal antibodies International Journal of Pharmaceutical Sciences Review and Research 2010, 1(2), 88-94. [0277] 6. Queen C, Schneider W P, Selick H E, Payne P W, Landolfi N F, Duncan J F, Avdalovic N M, Levitt M, Junghans R P, Waldmann T A. A humanized antibody that binds to the interleukin 2 receptor Proc Natl Acad Sci USA. 1989, 86 (24), 10029-10033. [0278] 7. Fiona A Harding, Marcia M Stickler, Jennifer Razo, and Robert B DuBridge The immunogenicity of humanized and fully human antibodies MAbs. 2010, 2(3), 256-265. [0279] 8. Andrew M. Scott, Jedd D. Wolchok and Lloyd J. Old Antibody therapy of cancer in Nature Reviews Cancer 2012, 12, 278-287. [0280] 9. Reggie E. Duerst, Daniel H. Ryan and Christopher N. Frantz. Variables Affecting the Killing of Cultured Human Neuroblastoma Cells with Monoclonal Antibody and Complement Cancer Res 1986, 46, 3420-3425. [0281] 10. Hakulinen J, Meri S Complement-mediated killing of microtumors in vitro Am J Pathol 1998, 153(3), 845-855. [0282] 11. Goronzy J J, Weyand C M. The innate and adaptive immune systems in Goldman L, Ausiello D, eds. Cecil Medicine. 23rd ed. Philadelphia, Pa.: Saunders Elsevier; 2007: chapter 42. [0283] 12. Grimm D, Bauer J, Pietsch J, Infanger M, Eucker J, Eilles C, Schoenberger J., Diagnostic and therapeutic use of membrane proteins in cancer cells Med Chem 2011, 18(2), 176-190. [0284] 13. Nathan O. Stitziel, Brenton G. Mar, Jie Liang and Carol A. Westbrook Membrane-Associated and Secreted Genes in Breast Cancer Cancer Research 2004, 64, 8682-8687. [0285] 14. Membrane Rettig, W. J. & Old, L. J. Immunogenetics of human cell surface differentiation Annu. Rev. Immunol. 1989, 7, 481-511. [0286] 15. Weiner, L. M., Surana, R. & Wang, S. Monoclonal antibodies: versatile platforms for cancer immunotherapy Nature Rev. Immunol. 2010, 10, 317. [0287] 16. Qu Z, Griffiths G L, Wegener W A, Chang C H, Govindan S V, Horak I D, Hansen H J, Goldenberg D M. Development of humanized antibodies as cancer therapeutics Methods 2005, 36(1), 84-95. [0288] 17. William James. Aptamers. In Encyclopedia of Analytical Chemistry. R. A. Meyers (Ed.) pp. 4848-4871, John Wiley & Sons Ltd, Chichester, 2000. [0289] 18. Pai S S, Ellington A D. Using RNA aptamers and the proximity ligation assay for the detection of cell surface antigens Methods Mol Biol. 2009, 504, 385-98. [0290] 19. Agnes Cibiel, Daniel Miotto Dupont and Frdric Ducong. Methods To Identify Aptamers against Cell Surface Biomarkers, Pharmaceuticals 2011, 4, 1216-1235 [0291] 20. Met Tombelli S, Minunni M, Mascini M. Aptamers-based assays for diagnostics, environmental and food analysis Biomol Eng. 2007 June; 24(2):191-200. Epub 2007 Mar. 23. Review. [0292] 21. Weihong Tan, Hui Wang, Yan Chen, Xiaobing Zhang, Haizhen Zhu, Chaoyong Yang, Ronghua Yang and Chen Liu Molecular aptamers for drug delivery Trends in Biotechnology 2011, 29(12), 634-640. [0293] 22. Ferreira, C. S.; Cheung, M. C.; Missailidis, S.; Bisland, S.; Gariepy, J. Phototoxic aptamers selectively enter and kill epithelial cancer cells Nucleic Acids Res 2009, 37(3), 866-876. [0294] 23. Dinh T. Tran, Kris P. F. Janssen, Jeroen Pollet, Elke Lammertyn, Jozef Ann, Ann Van Schepdael and Jeroen Lammertyn Selection and Characterization of DNA Aptamers for Egg White Lysozyme Molecules 2010, 15, 1127-1140. [0295] 24. Yong Huang, Xin-Min Ni, Shao-Long Gan, Jian-Hui Jiang, Guo-Li Shen and Ru-Qin Yu Electrochemical immunosensor of platelet-derived growth factor with aptamer-primed polymerase amplification Analytical Biochemistry 2008, 382, 22. [0296] 25. Brayman M, Thathiah A, Carson D D MUC1: a multifunctional cell surface component of reproductive tissue epithelia Reprod Biol Endocrinol 2004, 2, 4. [0297] 26. Ctia S. M. Ferreira, Melissa C. Cheung, Sotiris Missailidis, Stuart Bisland, and Jean Garipy Phototoxic aptamers selectively enter and kill epithelial cancer cells Nucleic Acids Res 2009, 37(3), 866-876. [0298] 27. Gerald J. Rowse, Richard M. Tempero, Michelle L. VanLith, Michael A. Hollingsworth and Sandra J. Gendler Tolerance and Immunity to MUC1 in a Human MUC1 Transgenic Murine Model Cancer Res 1998, 58, 315. [0299] 28. Amanda S. Lakamp and Michel M. Ouellette A ssDNA Aptamer That Blocks the Function of the Anti-FLAG M2 Antibody Journal of Nucleic Acids 2011, 1-11. [0300] 29. I. G. Silveira, R. W. Burlingame, C. A. von Mhlen, A. L. Bender, H. L. Staub Anti-CCP antibodies have more diagnostic impact than rheumatoid factor (RF) in a population tested for RF Clinical Rheumatology 2007, 26(11), 1883-1889. [0301] 30. Zhi Liu, Are Anti-BP180 IgG1 or IgG4 Autoantibodies Pathogenic? Journal of Investigative Dermatology 2002, 119, 989-990 [0302] 31. Negba Hanuka, Emanuel Sikuler, David Tovbin, Lewis Neville, Ofer Nussbaum, Marcos Mostoslaysky, Mordechai Orgel, Arie Yaari, Sigal Manor, Shlomo Dagan, Nir Hilzenrat, Yonat Shemer-Avni Hepatitis C virus infection in dialysis and chronic liver patients: Viraemia dependent anti-E2-antibody response Journal of Medical Virology 2004, 73(4), 529-535. [0303] 32. Zhou J, Li H, Zhang J, Piotr S, Rossi J Development of cell-type specific anti-HIV gp120 aptamers for siRNA delivery J Vis Exp 2011, 23(52), 2954. [0304] 33. Bruno J G A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches Pharmaceuticals 2013, 6, 340-357.