METHOD FOR TREATMENT OF LIVER STEATOSIS OR NON-ALCOHOLIC FATTY LIVER BY USING 2-MONOACYLGLYCEROL CLEAVING ENZYME
20190351030 ยท 2019-11-21
Assignee
Inventors
Cpc classification
A61K38/465
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
International classification
A61P1/16
HUMAN NECESSITIES
Abstract
The present invention relates to a method for treating liver steatosis or non-alcoholic fatty liver by using a 2-monoacylglycerol degrading enzyme. More particularly, the present invention provides a method for treating metabolic syndrome such as liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity by using a 2-monoacylglycerol degrading enzyme, in which the 2-monoacylglycerol degrading enzyme completely degrades triglyceride into fatty acids and glycerol in a digestive tract such that fat absorption is delayed and blood absorption of triglyceride is decreased, and in which, in a case where monoacylglycerol is degraded by a monoacylglycerol lipase in a digestive tract, although degraded products of the monoacylglycerol are absorbed into digestive epithelial cells, recombination thereof into triglyceride in the digestive epithelial cells is delayed or energy consumption is promoted during this process.
Claims
1. A method for treating liver steatosis or non-alcoholic fatty liver, comprising: administering a 2-monoacylglycerol degrading enzyme to an individual in need thereof.
2. The method according to claim 1, wherein the enzyme is a lipase that specifically degrades 2-monoacylglycerol.
3. The method according to claim 2, wherein the lipase that specifically degrades 2-monoacylglycerol is a 2-position specific lipase derived from any one selected from the group consisting of human, mouse, yeast, fungi, and bacteria.
4. The method according to claim 3, wherein the 2-position specific lipase consists of the amino acid sequence of SEQ ID NO: 7 or 8.
5. The method according to claim 4, wherein the 2-position specific lipase is expressed by a recombinant vector that contains the base sequence of SEQ ID NO: 5 or 6.
6. The method according to claim 5, wherein the 2-position specific lipase is produced by a strain transformed with the recombinant vector.
7. (canceled)
8. The method according to claim 1, wherein the 2-monoacylglycerol degrading enzyme completely degrades 2-monoacylglycerol into a fatty acid and glycerol such that an amount of 2-monoacylglycerol to be absorbed into digestive epithelial cells is decreased.
9. (canceled)
10. A method for treating hyperlipidemia or type 2 diabetes, comprising: administering a 2-monoacylglycerol degrading enzyme to an individual in need thereof.
11. The method according to claim 10, wherein the enzyme is a lipase that specifically or non-specifically degrades 2-monoacylglycerol.
12. The method according to claim 11, wherein the lipase that specifically degrades 2-monoacylglycerol is a 2-position specific lipase derived from any one selected from the group consisting of human, mouse, yeast, fungi, and bacteria.
13. The method according to claim 12, wherein the 2-position specific lipase consists of the amino acid sequence of SEQ ID NO: 7 or 8.
14. The method according to claim 13, wherein the 2-position specific lipase is expressed by a recombinant vector that contains the base sequence of SEQ ID NO: 5 or 6.
15. The method according to claim 14, wherein the 2-position specific lipase is produced by a strain transformed with the recombinant vector.
16-18. (canceled)
19. A method for treating obesity comprising: administering a 2-monoacylglycerol degrading enzyme to an individual in need thereof.
20. The method according to claim 19, wherein the enzyme is a lipase that specifically or non-specifically degrades 2-monoacylglycerol.
21. The method according to claim 20, wherein the lipase that specifically degrades 2-monoacylglycerol is a 2-position specific lipase derived from any one selected from the group consisting of human, mouse, yeast, fungi, and bacteria.
22. The method according to claim 21, wherein the 2-position specific lipase consists of the amino acid sequence of SEQ ID NO: 7 or 8.
23. The method according to claim 22, wherein the 2-position specific lipase is expressed by a recombinant vector that contains the base sequence of SEQ ID NO: 5 or 6.
24. The method according to claim 23, wherein the 2-position specific lipase is produced by a strain transformed with the recombinant vector.
25. (canceled)
26. The method according to claim 19, wherein the 2-monoacylglycerol degrading enzyme completely degrades 2-monoacylglycerol into a fatty acid and glycerol, energy consumption increases due to a process by which the degraded fatty acid and glycerol are absorbed into digestive epithelial cells and re-synthesized into triglyceride, and the increase in energy consumption is caused by consumption of three or four more ATPs as compared with a process by which monoacylglycerol and fatty acids are re-synthesized into triglyceride in the digestive epithelial cells.
27. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
DETAILED DESCRIPTION OF THE INVENTION
[0071] Hereinafter, the present invention will be described in more detail. As described above, drugs used as therapeutic agents for liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity have problems of causing side effects such as a heart disease, a respiratory disease, an increase in blood pressure, and insomnia, and exhibiting short efficacy duration. Therefore, there is an urgent need to develop a high value-added, multi-functional product which has no side effects at a later time, and not only has prophylactic and therapeutic effects on metabolic syndrome but also has prophylactic effects on various diseases due to decreased oxidative stress.
[0072] Accordingly, in the present invention, a solution to the above-mentioned problems has been sought by providing a composition for prevention, amelioration, and/or treatment of liver steatosis or non-alcoholic fatty liver, comprising a 2-monoacylglycerol degrading enzyme, and a method for treating liver steatosis or non-alcoholic fatty liver by using the 2-monoacylglycerol degrading enzyme. The composition provided in the present invention has effects of delaying fat absorption and decreasing blood absorption of triglyceride by completely degrading triglyceride into fatty acids and glycerol in a digestive tract. Thus, the composition can be utilized for medical products and functional health foods for preventing, ameliorating, or treating liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity.
[0073] Obesity increases blood pressure and blood glucose, increases blood triglyceride, and decreases HDL cholesterol. As a result, obesity can lead to increased risk of metabolic syndrome, and ultimately to increased risk of a cardiovascular disease. The metabolic syndrome refers to simultaneous occurrence of abdominal obesity, diabetes, dyslipidemia (increased triglyceride and decreased high-density cholesterol), hypertension, and the like in one person. That is, the composition of the present invention comprising a 2-monoacylglycerol degrading enzyme can be used as a prophylactic or therapeutic agent for liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity. Thus, the composition can be used as a therapeutic agent for lipid-related metabolic syndrome diseases.
[0074] The monoacylglycerol lipase can decrease blood triglyceride. In a case where the monoacylglycerol lipase is present in intestines, 2-monoacylglycerol is completely degraded into a fatty acid and glycerol, which makes it possible to delay a process by which monoacylglycerol and fatty acids are absorbed into digestive epithelial cells and re-synthesized into triglyceride.
[0075] In addition, 2-monoacylglycerol is completely degraded into a fatty acid and glycerol by the 2-monoacylglycerol degrading enzyme, energy consumption increases due to a process by which the degraded fatty acid and glycerol are absorbed into digestive epithelial cells and re-synthesized into triglyceride, and the increase in energy consumption may be caused by consumption of three or four more ATPs as compared with a process by which monoacylglycerol and fatty acids are re-synthesized into triglyceride in the digestive epithelial cells.
[0076] The present invention is drawn from a paradoxical idea that focuses on characteristics of a nutrient absorption and metabolic pathway in a digestive tract, and is based on a mechanism that further promotes digestion of triglyceride in the digestive tract, thereby decreasing fat absorption and promoting energy consumption.
[0077] As illustrated in
[0078]
[0079] An enzyme called MGAT2, which is present in the digestive epithelial cells, acts in a process by which the two fatty acid and monoacylglycerol are combined into triglyceride. As illustrated in the upper part of
[0080] As illustrated in the lower part of
[0081] That is, in the present invention, the 2-monoacylglycerol degrading enzyme is intended to be used for treatment of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity, in which the 2-monoacylglycerol degrading enzyme is orally taken to completely degrade triglyceride into fatty acids and glycerol in a digestive tract, thereby delaying fat absorption and re-formation, and promoting energy consumption.
[0082] Accordingly, the present invention provides a method for treating liver steatosis or non-alcoholic fatty liver by using the 2-monoacylglycerol degrading enzyme; a pharmaceutical composition for prevention or treatment of liver steatosis or non-alcoholic fatty liver, comprising the 2-monoacylglycerol degrading enzyme; or a functional health food composition for prevention or amelioration of liver steatosis or non-alcoholic fatty liver, comprising the 2-monoacylglycerol degrading enzyme.
[0083] In addition, the present invention provides a method for treating hyperlipidemia or type 2 diabetes by using the 2-monoacylglycerol degrading enzyme; a pharmaceutical composition for prevention or treatment of hyperlipidemia or type 2 diabetes, comprising the 2-monoacylglycerol degrading enzyme; or a functional health food composition for prevention or amelioration of hyperlipidemia or type 2 diabetes, comprising the 2-monoacylglycerol degrading enzyme.
[0084] In addition, the present invention provides a method for treating obesity by using the 2-monoacylglycerol degrading enzyme; a pharmaceutical composition for prevention or treatment of obesity, comprising the 2-monoacylglycerol degrading enzyme; or a functional health food composition for prevention or amelioration of obesity, comprising the 2-monoacylglycerol degrading enzyme.
[0085] In the method or composition of the present invention, the 2-monoacylglycerol degrading enzyme can be used without limitation as long as the 2-monoacylglycerol degrading enzyme can completely degrade 2-monoacylglycerol into a fatty acid and glycerol. Preferably, the 2-monoacylglycerol degrading enzyme may be a lipase that specifically degrades 2-monoacylglycerol.
[0086] An origin of the lipase that specifically degrades 2-monoacylglycerol is not particularly limited, and may be, for example, a 2-position-specific lipase derived from any one selected from the group consisting of human, mouse, yeast, fungi, and bacteria.
[0087] As used herein, the term 2-position specific lipase refers to a lipase that exhibits reaction specificity only to a fatty acyl group at 2-position of triglyceride.
[0088] In a preferred embodiment of the present invention, in order to produce the 2-position specific lipase, a human- or mouse-derived monoacylglycerol lipase (MGL) gene sequence was introduced into a recombinant vector, and a monoacylglycerol lipase protein was caused to be expressed using an E. coli system capable of expressing a large amount of the protein. The protein was partially purified. A His-tag was used to facilitate purification of the target protein. However, in addition to the human- or mouse-derived gene sequence, any gene sequence encoding a 2-position specific lipase can be used without limitation.
[0089]
[0090]
[0091] In the composition of the present invention, an origin of the enzyme that non-specifically degrades 2-monoacylglycerol is not particularly limited, and may be, for example, a positional non-specific lipase derived from any one selected from the group consisting of yeast, fungi, and bacteria.
[0092] As used herein, the term positional non-specific lipase refers to a lipase that reacts with all three fatty acyl groups in triglycerides.
[0093] In another embodiment of the present invention, as the positional non-specific lipase, a Candida rugosa-derived lipase was used. However, in addition to the Candida rugosa-derived lipase, other non-specific lipases derived from microorganisms such as yeast, fungi, and bacteria can be used.
[0094]
[0095]
[0096]
[0097]
[0098] From the above experimental results, it was possible to identify a decrease in body weight, a decrease in fatty liver as seen in a liver size, and a decrease in epididymal fat which are caused by administration of MGL. Therefore, it can be seen that long-term administration of the monoacylglycerol lipase is effective in alleviating liver steatosis or non-alcoholic fatty liver and decreasing a body weight, which suggests that the monoacylglycerol lipase can be utilized as a therapeutic agent for liver steatosis or non-alcoholic fatty liver, and a therapeutic agent for obesity.
[0099] In addition, it was identified that administration of the monoacylglycerol lipase does not cause changes in dietary amount and exhibits no side effects such as fatty stool. The fatty stool is a severe side effect of Xenical which is one of conventional therapeutic agents for obesity. The monoacylglycerol lipase of the present invention exhibits an effect of decreasing a total body weight by 15% without exhibiting such a side effect. Thus, it was identified that the monoacylglycerol lipase of the present invention exerts superior efficacy as a therapeutic agent for obesity.
[0100] Upon making a direct comparison between results of
[0101] In addition, obesity-induced ob/ob mice were administered the monoacylglycerol lipase of the present invention for 4 weeks, and then a glucose loading test was performed. As a result, obesity was alleviated due to administration of the monoacylglycerol lipase. Therefore, as illustrated in
[0102]
[0103]
[0104]
[0105]
[0106] From the above results, it was possible to identify that administration of MGL of the present invention exhibits a superior anti-obesity effect and a therapeutic effect on fatty liver. In particular, MGL of the present invention exhibits a body weight-decreasing effect which corresponds to a 15% body weight decrease in a total body weight in a case of being administered for 4 weeks. An anti-obesity agent which has been developed and is currently used is considered to be a good drug in a case where the anti-obesity agent exhibits an 8% to 11% body weight-decreasing effect when administered for 1 year. In consideration of this, it is determined that the result which has been demonstrated in the mouse experiment of the present invention is nearly the maximum effect and exhibits a very excellent body weight-decreasing effect. Additionally, in a case where a comparison is made in terms of effects with Xenical which is currently used as a therapeutic agent for obesity, due to the fact that MGL and Xenical are drugs having different properties and optimal doses thereof cannot be defined, it is not possible to determine a comparative advantage for a body-weight decreasing effect. However, MGL of the present invention exhibits no fatty stool and gallbladder lesion which are fatal disadvantages of Xenical, suggesting that MGL is an excellent drug which can substitute for a conventional therapeutic agent for obesity.
[0107] The pharmaceutical composition according to the present invention for prevention or treatment of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity, comprising a 2-monoacylglycerol degrading enzyme can be administered orally to a mammal such as a rat, a mouse, a domesticated animal, and a human. In addition, the pharmaceutical composition according to the present invention can be made into various formulations. In a case of being made into formulations, the formulations can be made using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants which are commonly used in a range which does not inhibit activity of the 2-monoacylglycerol degrading enzyme. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid formulations can be prepared by mixing the monoacylglycerol lipase with at least one excipient (for example, starch, sucrose, lactose, and gelatin) and the like. Preferably, a coating agent may be used to prevent activity of the 2-monoacylglycerol degrading enzyme from being destroyed by gastric acid and gastric juice. In addition to simple excipients, lubricants can also be used. Liquid formulations for oral administration can include suspensions, solutions, emulsions, syrups, and the like. The liquid formulations can contain various excipients, for example wetting agents, sweeteners, fragrances, and preservatives, in addition to water and liquid paraffin which are commonly used simple diluents. Formulations for parenteral administration can include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. For the non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As bases for the suppositories, glycerol, gelatin, and the like can be used.
[0108] A dosage of the pharmaceutical composition according to the present invention, comprising a 2-monoacylglycerol degrading enzyme may vary depending on a patient's age, sex, and body weight. However, for the pharmaceutical composition, in general, an amount of 1 to 500 unit/kg may be administered once a day or divided into several doses, in which 1 unit means an amount such that 1 mole of monoacylglycerol is completely degraded for 1 hour at a condition of pH 7.4 and 37 C. In addition, a dosage of the composition comprising a monoacylglycerol lipase can be increased or decreased depending on a route of administration, severity of disease, sex, body weight, age, and the like. Accordingly, the above dosage is not intended to limit the scope of the present invention in any way.
[0109] In addition, types of a functional health food, which contains the functional health food composition of the present invention for prevention or amelioration of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity, comprising a 2-monoacylglycerol degrading enzyme, are not particularly limited, and examples thereof can include meats, sausages, bread, chocolates, candies, snacks, confections, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes.
[0110] The health food may be used together with another food or other food additives in addition to the monoacylglycerol lipase, and may be suitably used according to a conventional method. For example, a beverage for prevention of non-alcoholic fatty liver, comprising the 2-monoacylglycerol degrading enzyme, may be prepared by adding, to the 2-monoacylglycerol degrading enzyme, calcium, an Acanthopanax senticosus concentrate, liquid fructose, purified water, and the like, performing mixing, filling the mixture into a bottle for drinks, performing sterilization, and then cooling the bottle to room temperature. In addition, a health supplement for prevention of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity, comprising the 2-monoacylglycerol degrading enzyme, may be prepared as tablets or powders by adding, to the monoacylglycerol lipase, nutritional supplement ingredients (vitamins B1, B2, B5, B6, and E, acetic acid ester, and nicotinic acid amide), oligosaccharide, 50% ethanol, and purified water, performing mixing, performing forming into granules, performing drying in a vacuum dryer, allowing the granules to pass through a 12 to 14 mesh such that uniform granules are prepared, and performing extrusion forming in an appropriate amount, or may be prepared as hard capsule products by filling the granules into hard capsules.
[0111] An effective dose of the 2-monoacylglycerol degrading enzyme contained in the health food can be used in accordance with an effective dose of the pharmaceutical composition. An amount mixed of an active ingredient may be suitably determined depending on an intended purpose such as prophylactic or therapeutic treatment. In a case of long-term ingestion intended for health and hygiene purposes or for health control purposes, the amount mixed may be equal to or less than the above-mentioned range.
[0112] In the present invention, an individual may be an animal, preferably a mammal, in particular, an animal including a human, and may be animal-derived cells, tissue, organ, or the like. The individual may be a patient in need of treatment.
[0113] The present invention provides a use of the 2-monoacylglycerol degrading enzyme for the manufacture of a medicament for treatment of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity.
[0114] Hereinafter, the present invention will be described in detail with reference to preferred examples in such a manner that those skilled in the art can easily carry out the present invention. However, the present invention may be embodied in many different modes and is not limited to examples as set forth herein.
EXAMPLES
Example 1
[0115] Production and Purification of Monoacylglycerol Lipase Protein
[0116] 1-1: Production of Recombinant Vector and Recombinant Microorganism
[0117] In the present invention, in order to produce a monoacylglycerol lipase protein, an E. coli system capable of expressing a large amount of protein, and a His-tag were used, in which open reading frame (ORF) portions of the human-derived monoacylglycerol lipase mRNA (Genebank Number: NM 001003794) and the mouse monoacylglycerol lipase mRNA (Genebank Number: NM 011844) were cloned into the pT7-HMT (His-Myc-TEVprotease) vector (Geisbrecht BV et al., Protein Expression Purif 46: 23-32, 2006).
[0118] The pT7-HMT vector is a vector which fuses a six-His tag and a target protein, and allows the resultant to be expressed in bacteria. The pT7-HMT vector has a feature that an expressed protein can be easily purified, and has an advantage that the tag can be removed, as necessary, using a TEV protease.
[0119] First, primers capable of amplifying the ORF portion (except ATG start codon) of the human or mouse-derived monoacylglycerol lipase mRNA were constructed as shown in Table 1, and construction of the primers was done by including a restriction enzyme site therein such that an amplified gene can be inserted into a vector.
TABLE-US-00001 TABLE1 Primersequence Restriction Gene Primersequence enzyme SEQIDNO Human forward 5-GCCATATGccagaggaaagttccccagg-3 NdeI SEQIDNO:1 MGL reverse 5-CGCTCGAGtcagggtggggacgcagttc-3 XhoI SEQIDNO:2 Mouse forward 5-GCGTCGACcctgaggcaagttcacccagg-3 SalI SEQIDNO:3 MGL reverse 5-CGCTCGAGtcagggtggacacccagctc-3 XhoI SEQIDNO:4 (An underlined part indicates a site where a restriction enzyme acts)
[0120] A human- or mouse-derived total RNA was extracted from fat tissue, and a polymerase chain reaction (PCR) was carried out with the extracted total RNA as a template using each of the primer pairs as shown in Table 1. As a result of identifying sequences of PCR amplification products, it was identified that the human monoacylglycerol lipase gene is represented by SEQ ID NO: 5 and the mouse-derived monoacylglycerol lipase gene is represented by SEQ ID NO: 6 (Table 2).
TABLE-US-00002 TABLE2 Sequenceinformationforgenes Gene Basesequenceforgene SEQIDNO Human GCCATATGccagaggaaagttcccccaggcggaccccgcagagcattccctaccaggacctccct SEQIDNO:5 MGL cacctggtcaatgcagacggacagtacctcttctgcaggtactggaaacccacaggcacacccaaggccc tcatctttgtgtcccatggagccggagagcacagtggccgctatgaagagctggctcggatgctgatgggg ctggacctgctggtgttcgcccacgaccatgttggccacggacagagcgaaggggagaggatggtagtg tctgacttccacgttttcgtcagggatgtgttgcagcatgtggattccatgcagaaagactaccctgggcttcc tgtcttccttctgggccactccatgggaggcgccatcgccatcctcacggccgcagagaggccgggccac ttcgccggcatggtactcatttcgcctctggttcttgccaatcctgaatctgcaacaactttcaaggtccttgct gcgaaagtgctcaaccttgtgctgccaaacttgtccctcgggcccatcgactccagcgtgctctctcggaat aagacagaggtcgacatttataactcagaccccctgatctgccgggcagggctgaaggtgtgcttcggcat ccaactgctgaatgccgtctcacgggtggagcgcgccctccccaagctgactgtgcccttcctgctgctcc agggctctgccgatcgcctatgtgacagcaaaggggcctacctgctcatggagttagccaagagccagga caagactctcaagatttatgaaggtgcctaccatgttctccacaaggagcttcctgaagtcaccaactccgtc ttccatgaaataaacatgtgggtctctcaaaggacagccacggcaggaactgcgtccccaccctgaCTC GAGCG Mouse GCGTCGACcctgaggcaagttcacccaggcgaactccacagaatgttccctaccaggacctgcctc SEQIDNO:6 MGL acctggtcaatgcagacggacagtacctcttttgtagatactggaagcccagtggcacacccaaggccctc atctttgtgtcccatggagctggggaacactgtggccgttatgatgagctggctcatatgttgaaggggctg gacatgctggtatttgcccatgaccatgttggccatgggcagagtgagggagagaggatggtggtgtcgg acttccaagtttttgtcagagatgtgctgcaacacgtggacaccatccagaaggactaccccgacgtcccca tcttcctcctgggccactccatgggcggtgccatctccatcctagtggctgcagagaggccaacctacttttc tggcatggtcctgatttcacctctggtccttgccaatccggaatctgcatcgactttgaaggtccttgctgcca aactgctcaattttgtcctgccaaatatgaccttggggcgcattgactccagcgtgctgtctcggaacaagtc ggaggttgacctgtacaactctgacccactcgtctgccgagcagggctgaaggtgtgctttggcatacagc tgctgaatgccgtcgcaagagtggagcgagcaatgcccaggctgacactgccattcctgctgctgcaggg ttctgctgaccggctttgcgacagcaaaggtgcctacctgctcatggaatcatcccggagtcaggacaaaa cactcaagatgtatgaaggtgcctatcacgtcctccacagggagcttccggaagtgaccaactccgtcctc catgaagtaaactcgtgggtgtctcacaggatagcagcagcaggagctgggtgtccaccctgaCTCG AGCG
[0121] The amplified human- or mouse-derived monoacylglycerol lipase gene was cleaved with Ndel (Cat. No. R0111S; New England BioLabs, USA) or Sall (Cat. No. R0138S; New England BioLabs, USA), and Xhol (Cat. No. R0146S; New England BioLabs, USA), and then introduced into the pT7-HMT vector, in which the same restriction sites have been cleaved, to produce a recombinant vector. In this case, a six-His tag was made available for protein purification, and a Myc-tag was made available for protein detection using Western analysis at a later time. In addition, a design was made such that the His-Myc tags can be removed, as necessary, by applying a TEV protease.
[0122] 1-2: Production and Purification of Monoacylglycerol Lipase Protein
[0123] Next, E. coli strain BL21 (DE3) pCodon plus (Cat. No. 230245; Agilent, USA) was transformed with the recombinant vector. The strain was inoculated into 500 ml of an LB medium containing kanamycin, chloramphenicol, and 2% ethanol, and grown until an absorbance at 600 nm reaches 0.5 to 0.6. Then, for protein expression, IPTG was added at 1 mM, and additional culture was performed at 16 C. for 16 hours.
[0124] Bacteria were harvested by centrifugation from the culture, and suspended in a lysis buffer (50 mM Tris-Cl, pH 8.0, 500 mM NaCl, 5 mM imidazole, pH 8.0). Triton X-100 was added thereto at 1%, and then the bacteria were broken by a freezing-thawing method involving lysozyme, such that a protein homogenate was obtained. Nucleic acids were degraded by ultrasonication and centrifugation was performed. Then, His-Myc-MGL fusion proteins were allowed to be bound to a column using Ni-NTA agarose beads (Cat. No. 30210, Qiagen, USA). In order to remove endotoxins generated by lysis of bacteria, the column was washed with a 50 column volume of a washing buffer that contains Triton X-114 at 0.1%, and then washed with a 10 column volume of a washing buffer that does not contain Triton X-114.
[0125] As a result of performing several tests, elution of the protein attached to the column was carried out using EDTA rather than imidazole. The protein harvested using an elution solution (150 mM EDTA, pH 8.0, 150 mM NaCl, 50 mM Tris-Cl, pH 8.0) was then subjected to dialysis with a 200-fold volume of 50 mM Tris-Cl, pH 8.0. The resulting protein was designated crude MGL and used for experiments.
[0126]
[0127] A monoacylglycerol lipase to be administered into an animal was more purely purified by sequentially applying the crude MGL to HiTrap Phenyl HP, HiTrap SP, and HiTrapQ columns through a process as illustrated in
Example 2
Measurement of Activity of Monoacylglycerol Lipase Protein
[0128] In the present invention, in order to measure activity of the mouse-derived monoacylglycerol lipase purified in Example 1, the isolated protein and oleoyl-rac-glycerol (Cat. No. M7765, Sigma, USA) which is a substrate of the isolated protein were reacted with each other, and glycerol liberated thereby was measured using the Glycerol assay kit (Cat. No. MAK117, Sigma, USA) with reference to a manual attached to the kit. 1 unit was defined as an amount such that 1 mole of monoacylglycerol is completely degraded for 1 hour at a condition of pH 7.4 and 37 C. In this method of measuring activity, an amount of activity was calculated with reference to a glycerol standard.
[0129] In addition, a protein concentration was measured using the PierceTM BCA assay kit (Cat. No. 23225, ThermoFisher Scientific, USA). From this, activity per mg was calculated.
[0130] Endotoxins that may remain in the protein were measured using the Pierce LAL Chromogenic Endotoxin Quantitation Kit (Cat. No. 88282, ThermoFisher Scientific, USA).
[0131] The mouse-derived monoacylglycerol lipase, for which the above measurements were performed, showed the following results.
[0132] Concentration: 3 to 5 mg/ml, total 300 to 500 mg/40-liter culture
[0133] Activity: 30 to 100 units/mg protein
[0134] Endotoxin: <10 EU/ml (*EU, endotoxin unit)
Example 3
Degradation of 2-Monoacylglycerol and Obesity-Decreasing Effect
[0135] In the present example, an obesity-decreasing effect caused by a 2-monoacylglycerol degradation enzyme was identified. Specifically, a porcine pancreatic lipase (L3126, Sigma, USA) which is a 1,3-specific lipase was used as a control group and a Candida rugosa lipase (L1756, Sigma, USA) was selected as a non-specific lipase. Such lipases were administered into ob/ob mice (Central Lab. Animal Inc., Korea) by gavage for 7 weeks. As a result, as illustrated in
Example 4
Blood Triglyceride-Decreasing Effect Due to Administration of Monoacylglycerol Lipase
[0136] In the present invention, in order to identify whether blood triglyceride is actually decreased by the mouse monoacylglycerol lipase produced in Example 1, the monoacylglycerol lipase was orally administered into mice, in which the administration into the mice was made at a unit based on the measurement results for activity in Example 2.
[0137] First, C57BL6/J mice were fasted for 4 hours or longer, and then 250 l of olive oil was administered by a gavage method using a tube. At the same time, the control group was administered 250 l of saline, and the experimental group was administered 250 l of the monoacylglycerol lipase protein. After 2 hours, mice were sacrificed and blood was collected. Then, an amount of blood triglyceride was analyzed, and measurement was performed at an absorbance of 500 nm using the Triglyceride Colorimetric Assay Kit (Cat No 10010303, Cayman, USA) according to a manual included in the kit. As a result, as illustrated in
[0138] In addition, in the experiment as described above, measurement was performed on an hourly basis. As a result, as illustrated in
Example 5
Measurement of Activity of Monoacylglycerol Lipase in Small Intestine
[0139] In the present example, in order to prove that the fat absorption-decreasing effect demonstrated in Example 4 is actually a result caused by action of a monoacylglycerol lipase, activity of a mouse monoacylglycerol lipase which had been orally administered was measured in the small intestine.
[0140] Mice were sacrificed 1 hour or 2 hours after administration of physiological saline or the monoacylglycerol lipase, and dissection was performed by dividing a jejunum site in the small intestine into proximal and distal portions. The dissected portions were immersed in PBS such that materials in the small intestine were allowed to elute in PBS. Activity of the monoacylglycerol lipase present therein was measured using the method as in Example 2.
[0141] As a result, as illustrated in
Example 6
Effects of Delaying Triglyceride Recombination in Small Intestine Cells, Caused by Monoacylglycerol Lipase
[0142] In the present example, in order to prove that the effects of delaying triglyceride absorption identified in Examples 4 and 5 actually resulted from delaying a process by which triglyceride is recombined in small intestinal cells and liberated into blood, an experiment was performed using Caco-2 cells (Cat No. HTB37, ATCC, USA) which are a human small intestine cell line. As illustrated in
[0143] As a result, as illustrated in the right graph of
Example 7
Effects Obtained by Administration of Monoacylglycerol Lipase in Obesity-Induced Mice
[0144] 7-1. Identification of Changes in Body Weight and Dietary Amount, and Fatty Stool Following Administration of Monoacylglycerol Lipase
[0145] In the present example, it was identified whether an effect of decreasing a body weight or delaying a body weight increase is exhibited in obese ob/ob mice into which the mouse monoacylglycerol lipase produced in Example 1 has been administered for 4 weeks. For ob/ob mice (Central Lab. Animal Inc., Korea) which have slowed appetite suppression due to a mutation in a leptin gene and exhibit an obesity trait, 8-week-old mice were administered about 100 units/day of the monoacylglycerol lipase by oral gavage on a daily basis for 4 weeks. In order to synchronize feed intake with time of action of the monoacylglycerol lipase, the mice were fasted in a light cycle and then administered MGL before beginning a diet in a dark cycle (
[0146] As a result, as illustrated in
[0147] In a case where monoacylglycerol is degraded in the small intestine and fat absorption is delayed, it is possible to think about possibilities that a dietary amount can be changed, and fatty stool can be caused due to over-excretion of fat in feces. In order to examine such possibilities, a dietary amount was measured during administration of the monoacylglycerol lipase, and stool was randomly collected to examine a fat content. As a result, similar dietary amount and fecal fat content were exhibited between the MGL-administered group and the BSA-administered group (
[0148] In a case of being taken together with the results of Examples 4 to 6, the above results show that administration of the monoacylglycerol lipase into mice delays or decreases triglyceride recombination in small intestinal epithelial cells, and thus results in a decreased amount of fat which is liberated into blood and accumulated in fat tissue, thereby leading to a body weight decrease. This means that monoacylglycerol absorption is inhibited by this enzyme, and thus the monoacylglycerol lipase can be used as a therapeutic agent for obesity.
[0149] 7-2. Glucose Loading Test
[0150] A glucose loading test was performed on the mice into which BSA or a monoacylglycerol lipase had been administered in Example 7-1. The mice into which the monoacylglycerol lipase had been administered were administered 1.5 mg glucose/g body weight by intraperitoneal injection. Blood was collected at 15 minutes, 30 minutes, 60 minutes, and 120 minutes before and after loading, and a blood glucose level was measured.
[0151] As a result, as illustrated in
[0152] 7-3. Effects of Ameliorating Fatty Liver and Decreasing Fat Following Administration of Monoacylglycerol Lipase
[0153] The mice into which BSA or a monoacylglycerol lipase had been administered in Example 7-1 were anesthetized with ether, and the abdomen was opened. Liver and epididymal fat tissue were extracted and observed.
[0154] As a result, it was identified that a liver weight and a fat tissue weight are considerably decreased in the MGL-administered group (
[0155] 7-4. Changes in Gene Expression in Inguinal Fat
[0156] Inguinal fat, which can be considered subcutaneous fat tissue, was isolated from the mice of Example 7-3, and observation was made for changes in expression of genes for triglyceride synthesis (DGAT1, GPAT2, MGAT1, Lipin2, and Lipin3), genes for fatty acid synthesis (SCD1, FAS, and MEI), genes for fatty acid transport (CD36 and FATP1), genes for fatty acid transcription (PPAR2, PPAR, and PGC1), and genes for fatty acid oxidation (L-CPT1, ACOX1, and UCP1).
[0157] Specifically, the mice were sacrificed, and then the inguinal fat was isolated. 100 mg of the tissue was ground and added to 1 ml of Trizol reagent (Cat. No. 15596, Invitrogen, USA), and centrifuged to remove an oil layer. A supernatant was taken, and then RNA was extracted therefrom. From 2 ug of the isolated RNA, cDNA was synthesized using SuperScript III reverse transcriptase (Cat. No. 18-080-044, Invitrogen, USA), and real-time qPCR was performed based on the synthesized cDNA using SYBR Green Master mix (Cat. No. 4309155, Applied Biosystems, USA). Expression of each gene was corrected by expression of rRNA and graphically represented. Primer sequences for detection of gene expression are as shown in Table 3 below.
TABLE-US-00003 TABLE3 Gene Sequence SEQIDNO rRNA forward 5-GCAGGTGTTTGACAACGGCA-3 SEQIDNO:9 reverse 5-GATGATGGAGTGTGGCACCG-3 SEQIDNO:10 PPAR forward 5-GTGTACGACAAGTGTGATCG-3 SEQIDNO:11 reverse 5-GATTTGAGGTCTGCAGTTTC-3 SEQIDNO:12 ACOX1 forward 5-CCACATATGACCCCAAGACC-3 SEQIDNO:13 reverse 5-AGGCATGTAACCCGTAGCAC-3 SEQIDNO:14 Me1 forward 5-AGAGGTGTTTGCCCATGAAC-3 SEQIDNO:15 reverse 5-GAAGGCAGCCATATCCTTGA-3 SEQIDNO:16 L-CPT1a forward 5-CTCAGTGGGAGCGACTCTTC-3 SEQIDNO:17 reverse 5-GGCCTCTGTGGTACACGACA-3 SEQIDNO:18 FATP1 forward 5-CAGTGCCACCAACAAGAAGA-3 SEQIDNO:19 reverse 5-CTGCGGTCACGGAAATACAT-3 SEQIDNO:20 CD36 forward 5-TGCACCACATATCTACCAAA-3 SEQIDNO:21 reverse 5-TTGTAACCCCACAAGAGTTC-3 SEQIDNO:22 FAS forward 5-AAGCCGTTGGGAGTGAAAGT-3 SEQIDNO:23 reverse 5-CAATCTGGATGGCAGTGAGG-3 SEQIDNO:24 MGAT1 forward 5-CTGGTTCTGTTTCCCGTTGT-3 SEQIDNO:25 reverse 5-TGGGTCAAGGCCATCTTAAC-3 SEQIDNO:26 DGAT1 forward 5-TTCCGCCTCTGGGCATT-3 SEQIDNO:27 reverse 5-AGAATCGGCCCACAATCCA-3 SEQIDNO:28 SCD1 forward 5-TTCTCAGAAACACACGCCGA-3 SEQIDNO:29 reverse 5-AGCTTCTCGGCTTTCAGGTC-3 SEQIDNO:30 AGPAT2 forward 5-AGCGGACAGAAGAAACTGGA-3 SEQIDNO:31 reverse 5-TGAAGTAGACACCCCCAAGG-3 SEQIDNO:32 LIPIN2 forward 5-CCGTTGAGTCCTGGGTTAAA-3 SEQIDNO:33 reverse 5-CATTGGAAGGCAGGTCATTT-3 SEQIDNO:34 LIPIN3 forward 5-GCCCATGATTCTTTCTCTGC-3 SEQIDNO:35 reverse 5-TCTCCAGGAAAACCACCATC-3 SEQIDNO:36 PPAR2 forward 5-CTCTGGGAGATTCTCCTGTT-3 SEQIDNO:37 reverse 5-GGTGGGCCAGAATGGCATCT-3 SEQIDNO:38 PGC1a forward 5-TTTTTGGTGAAATTGAGGAAT-3 SEQIDNO:39 reverse 5-CGGTAGGTGATGAAACCATA-3 SEQIDNO:40 UCP1 forward 5-GGTATAAAGGTGTCCTAGGG-3 SEQIDNO:41 reverse 5-CAAGCTTTCTGTGGTGGCTA-3 SEQIDNO:42
[0158] As a result, as illustrated in
Example 8
Effects Obtained by Administration of Monoacylglycerol Lipase in Mice Fed High-Fat Diet
[0159] 8-1. Identification of Changes in Body Weight and Dietary Amount, and Fatty Stool Following Administration of Monoacylglycerol Lipase
[0160] 5-week-old C57BL/6 mice (Central Lab. Animal Inc., Korea) were fed a high-fat diet with a fat level of 45% for a total of 13 weeks. Starting from around 7 weeks after beginning the high-fat diet, the monoacylglycerol lipase produced in Example 1 was administered to identify whether an effect of decreasing a body weight or delaying a body weight increase is exhibited (
[0161] In addition, as illustrated in
[0162] 8-2. Glucose Loading Test
[0163] A glucose loading test was performed on the mice into which BSA or a monoacylglycerol lipase had been administered in Example 8-1. The mice into which the monoacylglycerol lipase had been administered were administered 1.5 mg glucose/g body weight by intraperitoneal injection. Blood was collected at 15 minutes, 30 minutes, 60 minutes, and 120 minutes before and after loading, and a blood glucose level was measured.
[0164] As a result, as illustrated in
[0165] 8-3. Effects of Ameliorating Fatty Liver and Decreasing Fat Following Administration of Monoacylglycerol Lipase
[0166] The mice into which BSA or a monoacylglycerol lipase had been administered in Example 8-1 were anesthetized with ether, and the abdomen was opened. Liver and epididymal fat tissue were extracted and observed.
[0167] As a result, it was identified that a liver weight and a fat tissue weight are considerably decreased in the MGL-administered group (
[0168] 8-4. Identification of Changes in Blood Triglyceride and Cholesterol Levels, Changes in Numerical Value for Liver, and Changes in GLP Following Administration of Monoacylglycerol Lipase
[0169] Blood was collected from the mice into which BSA or a monoacylglycerol lipase had been administered in Example 8-1, and levels of triglyceride and cholesterol levels in blood were analyzed. As a result, as illustrated in
[0170] In addition, in view of the fact that ALT and AST which are numerical values for liver are considerably decreased in the MGL-administered group, it was found that MGL contributes to recovery of liver function (
Example 9
Comparison of Effects Between MGL of Present Invention and Xenical
[0171] In order to make a comparison for effects between MGL of the present invention and Xenical which is currently used as a therapeutic agent for obesity, C57BL/6 mice were administered 100 units of the human MGL produced in Example 1 or 100 nmol of Xenical (orlistat, ORL, Sigma) by gavage on a daily basis for 3 weeks, and a body weight, and fecal fat and cholesterol levels were measured.
[0172] As a result, as illustrated in
[0173] ORL-administered group also exhibited remarkably increased fecal cholesterol. One unusual thing is that 4 out of 5 mice in the ORL-administered group died during the 3-week administration experiment, and autopsy showed a finding that gallbladder had turned black as illustrated in
INDUSTRIAL APPLICABILITY
[0174] The composition of the present invention comprising a 2-monoacylglycerol degrading enzyme has effects of delaying fat absorption and decreasing blood absorption of triglyceride by completely degrading triglyceride into fatty acids and glycerol in a digestive tract. In a case where 2-monoacylglycerol is degraded by a 2-monoacylglycerol degrading enzyme in the digestive tract, although degraded products of the 2-monoacylglycerol are absorbed into the digestive epithelial cells, recombination thereof into triglyceride in the digestive epithelial cells can be delayed or energy consumption can be promoted during this process. Therefore, such a composition can be utilized for medical products and functional health foods for prevention, amelioration, or treatment of liver steatosis, non-alcoholic fatty liver, hyperlipidemia, type 2 diabetes, and/or obesity, and the like.