VACCINE AGAINST TRYPANOSOMA CRUZI INFECTION

Abstract

A vaccine composition against infection by Trypanosoma cruzi comprising at least one Trypanosoma cruzi trans-sialidase mutant protein (SEQ 1) and, as adjuvant, a mixture of a highly purified mineral oil and mannide monooleate.

Claims

1. A vaccine composition against infection by Trypanosoma cruzi comprising: at least one Trypanosoma cruzi trans-sialidase mutant protein and, as adjuvant, a mixture of a purified mineral oil and mannide monooleate.

2. A vaccine composition against infection by Trypanosoma cruzi according to claim 1, wherein said Trypanosoma cruzi trans-sialidase mutant protein has a sequence SEQID NO:1.

3. A vaccine composition against infection by Trypanosoma cruzi according to claim 1, wherein said purified mineral oil is the one marketed as Drakeol 6VR.

4. A vaccine composition against infection by Trypanosoma cruzi according to claim 1, wherein said Trypanosoma cruzi trans-sialidase mutant protein has a sequence SEQID NO:1 and wherein said mixture of a highly purified mineral oil and mannide monooleate is the one marketed as Montanide ISA 51 VG.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0020] FIG. 1. Results obtained in terms of survival. Three groups of 12, 60 days of age male BALB/ci mice were used. The animals received three doses of 15 ug of TS (Group A: TS wild (WT), Group B: TS mut (SEQID NO:1) and group C: control). The first dose was emulsified in CFA (1:1 vol:vol) and the other two in IFA (1:1, vol:vol) and administered via subcutaneous (s.c) at two week intervals. Control means saline solution in adjuvant. The animals were infected with a virulent strain of T. cruzi DTU TCVI (RA), 500 blood trypomastigotes intraperitoneally (ip). Parasitaemia and mortality were monitored for 60 days was. A fourth group of animals (n=7) was immunized with TS obtained in E. coli (TScoli).

[0021] FIG. 2. Parasitemia values obtained in mice pertaining to the groups of FIG. 1. The parasitemia was determined by counting the parasites in a hemocytometer (Neubauer). Values are expressed as parasites/ml.

[0022] FIG. 3. Summary of results (number of equivalents of parasites/ng DNA) obtained by RT PCR in the tissues of the following study groups. GI: TS mut (SEQID NO:1); G2: TS WT; G3: TS coli; G: Control.

[0023] FIG. 4. Quantification of IL2, IL4 and IFNg by ELISA. (A, C, E) Each point represents quadruplicate values for each supernatant. (B, D, F) Each point represents the average of quadruplicate. Cultures were harvested 24 hours after adding 5 ug/ml of TSmut (SEQID NO:1). Control: Animals immunized with PBS/ISA51. TSmut: Animals immunized with TSmut/ISA51. By ex-vivo restimulation the specific response to the antigen was characterized as a clear Th1 response by significant production of IFNg from treated animals compared to control animals (FIGS. 4E and 4F).

[0024] FIG. 5. Evaluation of specific anti-TS antibodies, induced by immunization with TS mut. Groups of 12 male Balb/ci mice were immunized with TS mut/ISA51. Three s.c. doses were administered according to the scheme above and 15 days after the last dose specific IgG1 and IgG2a induction was tested through ELISA.

[0025] FIG. 6. Results obtained in terms of parasitemia of mice immunized with WT and TS mut using Freund's adjuvant or ISA 51. The animals were challenged 45 days after the first immunization with a T. cruzi DTU TcVI (RA) virulent strain, 500 ip blood trypomastigotes. Parasitemia and mortality were monitored for 60 days. Parasitemia was determined by counting the parasites in a hemocytometer (Neubauer). Values are expressed as parasites/ml.

DETAILED DESCRIPTION OF THE INVENTION

[0026] The present inventors have found that, surprisingly, it is possible to obtain a vaccine against infection by Trypanosoma cruzi (T. Cruzi) having an immunogenic activity and an adequate efficacy for the treatment of humans and animals, comprising at least one trans-sialidase (TS mut) mutant protein of Trypanosoma cruzi and, as adjuvant, a mixture of a highly purified mineral oil and mannide monooleate.

[0027] In a preferred embodiment of the invention, said highly purified mineral oil is marketed as Drakeol 6VR. In another preferred embodiment of the invention, the adjuvant is Montanide ISA 51 VG (Seppic, France).

[0028] In an especially preferred embodiment of the invention, the vaccine composition comprises a trans-sialidase mutant protein of Trypanosoma cruzi of the sequence identified as SEQID NO:1 and, as adjuvant, Montanide ISA 51 VG.

[0029] The vaccine composition according to the invention can be used against parasitemia and at the same time, to protect tissue from damage caused by parasites.

[0030] In particular, the vaccine composition according to the invention comprises, preferably a transsialidase mutant protein from Trypanosoma cruzi comprising SEQID NO:1.

EXAMPLES

[0031] Test 1

[0032] All studies were conducted according to the standards set by CICUAE (Institutional Committee for the Care and Use of Experimental Animals), National University of San Martin (UNSAM). The animals were confined in a facility contained BSL3 at the Biotechnology Research Institute Dr. Rodolfo A. Ugalde (IIB), UNSAM, Buenos Aires, Argentina, where they were housed in individual cages, ventilated for two weeks before immunization. Each animal was labeled separately.

[0033] Three groups, each of them containing 12, 60 days of age male BALB/cJ mice were used. The animals received three doses of 15 ug of TS (Group A: TS wild (WT), Group B: TS mut and group C: control). The first dose was emulsified in CFA it (1:1 vol:vol) and the other two in IFA (1:1, vol:vol) and administered s.c. in two week intervals. Control means saline solution in adjuvant.

[0034] Animals were infected with a virulent strain of T. cruzi DTU TcVI (RA), 500 i.p. blood trypomastigotes. Parasitemia and mortality were monitored for 60 days. The parasitemia was determined by counting the parasites in a hemocytometer (Neubauer). Values are expressed in parasites/ml.

TABLE-US-00001 Group A n = 12 Days 1 14 28 42 102 WT/CFA WT/IFA WT/IFA Challenge Parasitemia/Mortality

TABLE-US-00002 Group B n = 11 Days 1 14 28 42 102 TSmut/ TSmut/ TSmut/ Challenge Parasitemia/Mortality CFA IFA IFA

TABLE-US-00003 Group C n = 12 Days 1 14 28 42 102 Saline/CFA Saline/ Saline/ Challenge Parasitemia/Mortality IFA IFA

[0035] A fourth group of animals (n=7) was immunized with TS obtained in E. coli.

[0036] The results obtained in terms of survival and parasitemia are shown in FIGS. 1 and 2 respectively.

[0037] Extension of Test 1: TS mut Protective Capacity

[0038] Those mice that survived this test were challenged again 102 days after being infected. This time, the challenge was performed with the same strain of T. cruzi parasites but with 10,000 r i.p. blood trypomastigotes. All animals survived for 60 days after the second challenge, and at that time they were sacrificed. No parasitemia was observed in any of the animals when evaluated by the fresh drop test.

[0039] Histopathology Tests:

[0040] Firstly, the level of inflammation on cuts stained with hematoxylin/Eosin (HE) were evaluated. For this, skeletal muscle and heart of animals infected with T. cruzi were obtained and were fixed in 10% formaldehyde in PBS and embedded in paraffin. 5 um cuts were made, which were stained with HE. Then single-blind observations by light microscopy on coded preparations were made. The presence or absence of parasitized cells and inflammatory infiltrates in tissues was recorded Inflammation was qualitatively evaluated according to the presence or absence of necrosis of muscle cells and polymorphonuclear leukocyte in infiltrates (active or chronic inflammation, respectively) and semiquantitatively evaluated at low-power examination according to the distribution (focal confluent or diffuse and amount of inflammatory cells (1+for only one inflammatory focus, 2+non-confluent multiple inflammatory infiltrates, 3+confluent inflammation and 4+diffuse inflammation spread throughout the cut). The values of two cuts were summed to obtain an average inflammatory value.

[0041] Subsequently the development of fibrosis was assessed using Masson's trichrome staining. For this purpose, the presence and the distribution pattern of collagen fibers was determined, awarding a value of 1+to the increase of interstitial fibrous tissue surrounding bundles of muscle fibers and a value of 2+to the presence of fibrous tissue surrounding and isolating atrophic individual muscle fibers or patches of dense fibrous tissue occupying a space suggesting that it has corresponded to a missing muscle fiber. The results are summarized in Tables 1 and 2.

TABLE-US-00004 TABLE 1 Heart Muscle Mouse Inflammation Fibrosis Total PCR Inflammation Calcium PCR Control 123-1 0.043 2 0 3.01 VI 2 1 3 T 2 2 4 Average 2 1.5 3.5 123-3 neg 2 2 neg VI 2 2 4 T 2 2 4 Average 2 2 4 TS mut 125-1 neg 3 0 8.86 VI 2 2 4 T 0 0 0 Average 1 1 2 125-4 neg 0 1 0.064 VI 2 2 4 T 0 1 1 Average 1 1.5 2.5 125-5 neg 2 0 0.53 VI 1 2 3 T 1 2 3 Average 1 2 3 126-1 neg 2 0 neg VI 2 1 3 T 2 2 4 Average 2 1.5 3.5 126-2 neg 1 0 neg VI 2 2 4 T 2 1 3 Average 2 1.5 3.5 126-3 neg 0 1 ND VI 2 2 4 T 1 1 2 Average 1.5 1.5 3 126-4 0.035 0 2 ND VI 2 2 4 T 2 2 4 Average 2 2 4 127-11 neg 0 1 ND VI 2 1 3 T 1 0 1 Average 1.5 0.5 2 127-12 neg 1 0 neg VI 3 2 5 T 2 0 2 Average 2.5 1 3.5 TS E Coli 130-3 neg 2 0 neg VI 2 1 3 T 2 1 3 Average 2 1 3 130-6 neg 2 0 ND VI 2 1 3 T 2 1 2 Average 2 1 2.5 131-7 neg 2 0 neg VI 2 0 2 T 2 2 4 Average 2 1 3 TS WT 128-1 0.114 3 0 0.103 VI 2 2 4 T 2 2 4 Average 2 2 4 128-2 0.056 3 1 24.03 VI 2 1 3 T 1 1 2 Average 1.5 1 2.5 128-4 neg 1 0 neg VI 2 0 2 T 2 1 3 Average 2 0.5 2.5 129-9 neg 0 1 0.063 VI 2 1 3 T 2 1 3 Average 2 1 3 127 neg 2 0 2.31 VI 1 1 1 T 1 1 1 Average 1 1 1 PCR: parasitic equivalents/ng; VI: left ventricle; T: Septum

[0042] Spleen histopathologic evaluation was performed based on the distribution, size and morphology of the white pulp and characteristics of the population of cells in red pulp. Morphological findings in the spleen are indicative of an immune activation state.

TABLE-US-00005 TABLE 2 Mouse Heart Skeletal muscle Spleen 123-1 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 123-3 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 125-1 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 125-4 Unspecified active Non-significant Reactive unspecified chronic myocarditis histopathological changes follicular lymphoid of musculoskeletal system hyperplasia 125-5 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 126-1 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 126-2 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 126-3 Unspecified chronic Non-significant Reactive unspecified myocarditis histopathological changes follicular lymphoid of musculoskeletal system hyperplasia 126-4 Unspecified chronic Skeletal Muscle with Reactive unspecified myocarditis multifocal calcifications follicular lymphoid of muscular fibers hyperplasia 127 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 127-11 Unspecified chronic Non-significant myocarditis histopathological changes of musculoskeletal system 127-12 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis miocarditis follicular lymphoid hyperplasia 128-1 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 128-2 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 128-4 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myocarditis follicular lymphoid hyperplasia 129-9 Unspecified chronic Non-significant Reactive unspecified myocarditis histopathological changes follicular lymphoid of musculoskeletal system hyperplasia 130-3 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myositis follicular lymphoid hyperplasia 130-6 Unspecified chronic Non-significant Reactive unspecified myocarditis histopathological changes follicular lymphoid of musculoskeletal system hyperplasia 131-7 Unspecified chronic Unspecified active chronic Reactive unspecified myocarditis myositis follicular lymphoid hyperplasia Control Myocardial tissue Non-significant Splenic parenchyma N-1 without histopathological changes without significant histopathological of musculoskeletal system histopathological alterations signs alterations Control Myocardial tissue Non-significant Splenic parenchyma N-2 without histopathological changes without significant histopathological of musculoskeletal system histopathological alterations signs alterations

[0043] Tissue Parasitic Charge Determined by PCR in Real Time

[0044] It was conducted with approximately 50 mg of tissue (heart and skeletal muscle). The sample was kept in DNAzol (Invitrogen) and was processed by mechanical disintegration by TissueRuptor. DNA precipitated with isopropanol, was washed with 70% ethanol and resuspended in NaOH and HEPES, according to the manufacturer's specifications.

[0045] Quantification by Real-Time PCR

[0046] The protocol published by Cummings and Tarleton in Molecular and Biochemical Parasitology 129 (2003) 53-59 was followed.

BRIEF DESCRIPTION

[0047] Detection and quantification of parasites in the sample were established by amplification of parasite DNA, using satellite region (SAT) of the T. cruzi genome as target for the reaction. Oligonucleotides TCZ-F (GCTCTTGCCCACAMGGGTGC) (SEQID NO:2) and TCZ-R (CCAAGCAGCGGATAGTTCAGG) (SEQID NO:3) were used, which amplify a fragment of 182 pb. This region is in thousands of copies per genome, which increases the detection sensitivity.

[0048] For quantification of genomic DNA of mice, a fragment of the TNF gene (oligonucleotides TNF-5241 (5-TCCCTCTCATCAGTTCTATGGCCCA-3) (SEQID NO:4) and TN F-5411 (5-CAGCAAGCATCTATGCACTTAGACCCC-3) (SEQID NO:5) was amplified. This is a single copy gene, which allows its use as normalizer of the loading and amplification process during the reaction.

[0049] Calibration curves for both sequences were performed. The TNF curve was performed using mixtures of DNA from the samples to be analyzed (and subsequent serial dilutions). This allowed quantitation in the range of 200-0.02 ng DNA. The SAT curve was performed using DNA from healthy tissue (uninfected animals), contaminated with known amounts of parasites (and subsequent serial dilutions). This allowed quantitation in the range of 400 to 0.04 parasitic equivalents. Quantification was expressed in parasite equivalents/DNA mass. To this effect, it was normalized to long and 50 ng for skeletal muscle and heart, respectively.

[0050] The results (number of parasite equivalents/ng DNA) obtained by RT PCR in four groups of study are presented in FIG. 3.

[0051] Test 2

[0052] Cytokine Profile Determination in Animals Immunized with TSmut (SEQID NO:1)

[0053] Male, 60 days of age BALB/cj mice were used. Five (5) animals received 15 ug of TSmut (SEQID NO:1) per mouse via s.c., diluted in PBS and emulsified 1:1 with adjuvant ISA51 (Seppic, France) (100 ul emulsion/mouse). Another group of five (5) animals received only PBS emulsified in the same adjuvant. Mice were sacrificed at day +5 post-immunization. Splenocyte cultures were performed (510 .sup.6 cells/ml) in RPMI 1640 supplemented with 10% fetal bovine serum at 37 C. and 5% CO.sub.2. The cultures were stimulated for 72 hours with the same antigen (5 ug/ml) and supernatants were harvested 24 hours later. For each mouse cultures were performed in quadruplicate. The concentration of IL2, IL4 and IFNg in the culture supernatants was measured by sandwich ELISA with monoclonal antibody pairs for capture and detection Biolegend (CA, USA).

[0054] In FIG. 4 the results of quantitation of IL2, IL4 and IFNg were observed by ELISA. (A, C, E) Each point represents quadruplicate values for each supernatant. (B, D, F) Each point represents the average of quadruplicate. Cultures were harvested 24 hours after adding 5 ug/ml of TSmut. Control: Animals immunized with PBS/ISA51. TSmut (SEQID NO:1) Animals immunized with TSmut/ISA51.

[0055] By ex vivo restimulation it was possible to characterize the specific response to antigen as a clear response Th1 by significant production of IFNg of treated animals compared to control animals (FIGS. 4E and 4F).

[0056] There is strong evidence supporting the importance of Th1 response as crucial to the survival of T. cruzi infection. However, when this cell response is triggered, it is very detrimental to the host, due to damage that can result in tissue. Currently, there is an amount of evidence that indicate that the actual protective response should add balanced phenotypes of Th1/Th2 CD4 T cells to restrict the spread of parasites, but avoiding substantial damage to infected tissue (Ruiz Diaz, 2015). (FIG. 5)

[0057] Test 3

[0058] An assay to compare Freund's adjuvant and Montanide ISA 51VG (Seppic, France), an adjuvant approved for human and tested in Test 2 was carried out. It was assessed by parasitemia and mortality.

[0059] Mice 60 days of age received three doses of 15 ug of TS-mut (SEQID NO:1) administered s.c. with two week intervals. Freund's adjuvant (CFA/IFA) was emulsified in CFA (1:1 vol:vol) in the first dose and IFA (1:1, vol:vol) the other two. Montanide ISA 51VG emulsified 1:1 with the antigen.

TABLE-US-00006 Group A n = 11 Days 1 15 30 45 105 MUT/CFA MUT/IFA MUT/IFA Challenge Parasitemia/Mortality

TABLE-US-00007 Group B n = 11 Days 1 15 30 45 105 CFA IFA IFA Challenge Parasitemia/Mortality

TABLE-US-00008 Group C n = 10 Days 1 15 30 45 105 MUT/ISA MUT/ISA MUT/ISA Challenge Parasitemia/Mortality

TABLE-US-00009 Group D n = 10 Days 1 15 30 45 105 ISA ISA ISA Challenge Parasitemia/Mortality

[0060] Animals were challenged a day 45 after the first immunization with a virulent strain T. cruzi DTU TCVI (RA), by administering blood trypomastigotes 500 via i.p. Parasitemia and mortality were monitored for 60 days. Parasitemia was determined by counting the parasites in a hemocytometer (Neubauer). Values are expressed as parasites/ml.

[0061] The results obtained in terms of survival and parasitemia are shown in FIG. 6 and Table 3, respectively:

TABLE-US-00010 TABLE 3 Parasitemia Values TSmut Control Group CFA/IFA CFA/IFA TSmut ISA Control ISA Mouse n.sup.o (10.sup.6) (10.sup.6) (10.sup.6) (10.sup.6) 1 0.5 0.2 0.65 4.1 2 0.5 0.2 0.5 4.9 3 0.4 0.3 0.35 3.4 4 1 0.2 0.45 6.9 5 1.5 1.4 0.4 0.5 6 0.35 1.85 0.3 1.1 7 ND 2.9 0.1 0.55 8 0.5 1.25 0.35 2 9 7.5 0.35 0.3 2.15 10 0.3 1.25 0.1 8.5 11 0.4 2.85

[0062] Parasitemia values are expressed as number of parasites/ml and correspond to the 17 pi (RI to R5) and 20 pi (R6 RLL) days.

[0063] The results were obtained using male BALB/c mouse model and Fontanella et al. (2008). Three doses of immunogen were used. In our tests, mice were infected with the RA strain of parasite (TcVI) instead of the Tulahuen strain. Survivals with TSmut were consistent in both studies. In our assays, histological analysis and the parasite load animals were performed after re-challenging animals with a higher number of parasites, therefore they are not comparable with those reported previously.

[0064] Referring to article Bontempi et al. (2015), the authors used female BALB/c mice and reduced doses of antigens to 10 ug each.

[0065] We also found a predominant Th1 immune response, which was raised immediately after a single dose of immunogen.

[0066] When a comparison test was performed between adjuvants, the TSmut significantly reduced parasitemia vs. control adjuvant Montanide ISA 51. Replacing CFA by ISA 51 offered a better overall protection in terms of parasitemia and survival. A 100% survival was recorded in the TSmut/ISA group vs 63-82% in TSmut CFA/IFA immunization test.