INHIBITION OF MITOCHONDRIAL HYPOXIC STRESS INDUCED RNA EDITING BY APOBEC3G CYTIDINE DEAMINASE
20190352644 ยท 2019-11-21
Inventors
- Bora E. Baysal (Orchard Park, NY, US)
- Shraddha Sharma (Williamsville, NY, US)
- Santosh K. Patnaik (Buffalo, NY, US)
Cpc classification
A61K31/7105
HUMAN NECESSITIES
C12N15/1135
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
Provided are methods for inhibiting cancer cell growth comprising contacting the cancer cell with an agent which inhibits the expression of the gene, or the activity of, apolipoprotein B editing catalytic 3G (APOBEC3G). Also provided are methods for identifying agents which can induce or inhibit C>U deamination in RNA driven by apolipoprotein B editing catalytic proteins. The method comprises contacting APOBEC3G with a suitable RNA substrate and determining the extent of C>U deamination under conditions which induce APOBEC driven C>U deamination.
Claims
1. A method of inhibiting the growth of cancer cells comprising contacting the cancer cell with an agent which inhibits the expression of the gene, or the activity of, apolipoprotein B editing catalytic 3G (APOBEC3G).
2. The method of claim 1, wherein the agent is a polynucleotide.
3. The method of claim 2, wherein the polynucleotide is siRNA or shRNA.
4. The method of claim 1, wherein the cancer is a lymphoma.
5. A method for identifying agents that enhance or inhibit C>U deamination in a RNA molecule comprising: a) providing a RNA substrate which contains a motif that contains a C that can undergo deamination to U; b) contacting the RNA substrate with a apolipoprotein B editing catalytic (APOBEC) protein in the presence or absence of test agents; c) determining the extent of C>U deamination and identifying agents in the presence of which either an increase or decrease of deamination is observed as compared to deamination in the absence of the agent, wherein, the APOBEC protein is APOBEC3G.
6. The method of claim 5, wherein the motif is CCACCG.
7. The method of claim 5, wherein APOBEC3G is a purified protein.
8. The method of claim 5, wherein APOBEC3G is a recombinant protein.
9. The method of claim 5, wherein APOBEC3G is in a cell lysate.
10. A method for identifying agents that enhance or inhibit C>U deamination in a RNA substrate comprising: a) providing cells which express apolipoprotein B editing catalytic 3G (APOBEC3G); b) in the presence or absence of test agents, exposing the cells to conditions under which the cells can carry out APOBEC3G driven C>U deamination of RNA; and c) determining the extent of C>U deamination in RNA to identify agents that induce or inhibit C>U deamination in RNA, wherein an increase in C>U deamination as compared to deamination in the absence of the agent identifies an agent that enhances C>U deamination, and a decrease in C>U deamination as compared to deamination in the absence of the agent identifies an agent that inhibits C>U deamination.
11. The method of claim 10, wherein the cells are monocytes, and the condition under which the cells carry out APOBEC3G driven C>U deamination of RNA comprise hypoxia, exposure to interferon or both.
12. The method of claim 11, wherein the interferon in type 1 interferon or interferon gamma.
13. The method of claim 9, wherein the cells are macrophages, and the condition under which the cells carry out APOBEC3G driven C>U deamination of RNA comprises exposure to interferon.
14. The method of claim 13, wherein the interferon in type 1 interferon or interferon gamma.
15. A method for identifying agents that enhance or inhibit C>U deamination in a RNA substrate comprising: a) providing cells which have been transfected to overexpress apolipoprotein B editing catalytic 3G (APOBEC3G); b) in the presence or absence of test agents, determining the extent of C>U deamination in RNA to identify agents that enhance or inhibit C>U deamination in RNA.
16. The method of claim 15, wherein the cells are 293T cells.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
DETAILED DESCRIPTION OF THE INVENTION
[0051] The present disclosure is based on our identification of an enzyme and conditions which can induce C>U deamination. This disclosure provides methods and compositions to identify agents which can affect C>U deamination. Such agents may be useful for inhibition of C>U deamination or enhancing C>U deamination.
[0052] The term treatment as used herein refers to reduction in one or more symptoms or features associated with the presence of the particular condition being treated. Treatment does not necessarily mean complete remission, nor does it preclude recurrence or relapses. For example, treatment of cancer, such as lymphoma, can refer to reduction of one or symptoms associated with the cancer.
[0053] The term therapeutically effective amount as used herein in reference to a single agent is the amount sufficient to achieve, in a single or multiple doses, the intended purpose of treatment.
[0054] Where a range of values is provided in this disclosure, it should be understood that each intervening value, to the tenth of the unit of the lower limit between the upper and lower limit of that range, and any other intervening value in that stated range is encompassed within the invention, unless clearly indicated otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges encompassed within the disclosure.
[0055] The singular form used in this disclosure includes the plural form and vice versa, unless indicated otherwise.
[0056] In the present disclosure, we analyzed the cell type specific expression of APOBEC3G (A3G), and have identified widespread RNA editing mediated by A3G, induced by high cell density and hypoxia in NK, CD8+ T cells and in the representative lymphoma cell line (Hut78 T). Our findings reveal that under hypoxic stress, A3G-mediated RNA editing converges at targets involved in mRNA translation, likely to reorganize the cellular translation apparatus. Furthermore, we show that A3G promotes adaptation to hypoxic stress by suppressing cell proliferation and by promoting glycolysis over mitochondrial respiration. Thus, A3G is a novel endogenous RNA editing enzyme which can facilitate cellular adaptation to mitochondrial hypoxic cell stress in cytotoxic lymphocytes.
[0057] The disclosure provides a method for inhibiting the growth of cancer cells by inhibiting the expression or activity of A3G. The method comprises contacting the cancer cells with an agent that will inhibit the expression or activity of A3G. The agent may be a polynucleotide, a peptide, polypeptide or protein, or a small molecule. In one embodiment, the disclosure provides a method for treatment of cancer comprising administering to a subject in need of treatment a composition comprising, or consisting essentially of, an agent that can inhibit the A3G gene, or that can inhibit the activity of the A3G protein. Examples of cancers that can be treated by the method of this disclosure include, but are not limited to: hematologic neoplasms including but not limited to B cell leukemia/lymphomas, myelomas, and acute and chronic myeloid neoplasms as well as melanoma, kidney cancers, gliomas, pancreatic cancer, mesotheliomas, urinary tract and thyroid cancers.
[0058] We have found that hypoxia (such as 1% O.sub.2) enhances the C>U editing of an exemplary RNA, e.g., SDHB RNA at c.136 in monocytes, with an editing level of 18% observed for monocyte-enriched PBMCs (MEPs) after 48 hours of hypoxia. Monocytes infiltrate tumors, atheromatous plaques, and sites of infection and inflammation, which are characterized by micro-environmental hypoxia. C>U RNA editing of SDHB m ay therefore represent a hypoxia-adaptive mechanism that may have implications for the pathogenesis of chronic inflammatory diseases.
[0059] To identify additional C>U RNA editing events in monocytes and monocyte-derived macrophages, we analyzed their whole transcriptome RNA sequences. We show that transcripts of hundreds of genes including those implicated in viral pathogenesis and Alzheimer's disease are targets of editing in monocytes and macrophages. We show that such editing is regulated by oxygen, interferons (IFN) and also during macrophage polarization. Most importantly, we demonstrate that APOBEC3A, which belongs to the APOBEC3 family of cytidine deaminases, is an RNA editing enzyme. These findings significantly expand our understanding of C>U RNA editing and open new avenues of inquiry on the role of APOBEC3 genes in viral and chronic diseases.
[0060] The subject treated with the compositions and methods of this disclosure can be a human subject or a non-human animal subject. The subject can be of any gender or age.
[0061] In one embodiment, the agent is a siRNA for use in RNA interference (RNAi) mediated silencing or downregulation of A3G mRNA. RNAi agents are commonly expressed in cells as short hairpin RNAs (shRNA). shRNA is a RNA molecule that contains a sense strand, antisense strand, and a short loop sequence between the sense and antisense fragments. shRNA is exported into the cytoplasm where it is processed by dicer into short interfering RNA (siRNA). siRNA are typically 21-23 nucleotide double-stranded RNA molecules that are recognized by the RNA-induced silencing complex (RISC). Once incorporated into RISC, siRNA facilitate cleavage and degradation of targeted mRNA. Thus, for use in RNAi mediated silencing or downregulation of A3G expression, the polynucleotide agent can be either a siRNA or a shRNA. Representative but non-limiting shRNAs for use in various aspects of the instant disclosure are provided in Example 1.
[0062] shRNA can be expressed from any suitable vector such as a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. In this regard, any viral vector capable of accepting the coding sequences for the shRNA molecule(s) to be expressed can be used. Examples of suitable vectors include but are not limited to vectors derived from adenovirus, adeno-associated virus, retroviruses (e.g, lentiviruses), rhabdoviruses, murine leukemia virus, herpes virus, and the like. A preferred virus is a lentivirus. The tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses. As an alternative to expression of shRNA in cells from a recombinant vector, chemically stabilized shRNA or siRNAs may also be used administered as the agent in the method of the invention. Vectors for expressing shRNA which in turn produces siRNA once introduced into a cell are commercially available. Further, shRNAs or siRNAs targeted to virtually every known human gene are also known and are commercially available. For example, we used clone ID V2LHS-80786 from Dharmacon to reduce the expression of A3G. In embodiments specific shRNAs are those which comprise polynucleotide sequences, such as described in Example 1, wherein those sequences are targeted to A3G.
[0063] In an embodiment, the agent may be an antibody that recognizes an A3G protein (an A3G protein). The antibodies used in the invention may bind to an A3G protein such that the binding of the antibody interferes with the activity of the A3G protein. Antibodies that recognize A3G protein for use in the invention can be polyclonal or monoclonal, or synthetic or hybrids. Methods for making polyclonal and monoclonal antibodies are well known in the art. It is expected that antigen-binding fragments of antibodies may be used in the method of the invention. Examples of suitable antibody fragments include Fab, Fab', F(ab').sub.2, and Fv fragments. Various techniques have been developed for the production of antibody fragments and are well known in the art. The antibodies or antigen binding fragments thereof may be humanized. Thus, the antibodies useful for the present disclosure may be chimeric, humanized or human. The term antibodies, as used herein, also includes nanobodies, diabodies and the like.
[0064] In one embodiment, AG3 inhibitors may be used as adjuvants or as agents in combination therapy to treat cancer.
[0065] Compositions comprising an agent that can suppress A3G for use in therapeutic purposes may be prepared by mixing with any suitable pharmaceutically acceptable carriers, excipients and/or stabilizers. Some examples of compositions suitable for mixing with the agent can be found in: Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins.
[0066] If the agent is a polynucleotide, it can be administered to the individual as a naked polynucleotide, in combination with a delivery reagent, or as a recombinant plasmid or viral vector which either comprises or expresses the polynucleotide agent. Suitable delivery reagents for administration include the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes.
[0067] In general, a formulation for therapeutic use according to the method of the invention comprises an amount of agent effective to suppress expression of A3G. Those skilled in the art will recognize how to formulate dosing regimens for the agents of the invention, taking into account such factors as the molecular makeup of the agent, the size and age of the individual to be treated, and the type and location of the cancer to be treated.
[0068] In an aspect, the present disclosure provides a method for identifying agents that enhance or inhibit C>U deamination in a RNA molecule comprising providing a RNA substrate which contains a motif that contains a C that can undergo deamination to U; contacting the RNA substrate with a apolipoprotein B editing catalytic (APOBEC) protein in the presence or absence of test agents; and determining the extent of C>U deamination and identifying agents in the presence of which either an increase or decrease of deamination is observed as compared to deamination in the absence of the agent, wherein the APOBEC protein is APOBEC3A or APOBEC3G. In an embodiment, the motif that comprises a C that undergoes RNA deamination to U is UC or CC where the deaminated C (underlined) is located at the 3-end of a RNA stem-loop structure. In an embodiment, the motif is CCAUCG or CCACCG. In another embodiment, the APOBEC3A or APOBEC3G protein is a purified and/or recombinant protein. In an embodiment, the APOBEC3A or APOBEC3G protein is in a cell lysate.
[0069] In an aspect, the present disclosure provides a method for identifying agents that enhance or inhibit C>U deamination in a RNA substrate comprising providing cells which express apolipoprotein B editing catalytic 3A (APOBEC3A) or 3G (APOBEC3G); in the presence or absence of test agents, exposing the cells to conditions under which the cells can carry out APOBEC3A or APOBEC3G driven C>U deamination of RNA; and determining the extent of C>U deamination in RNA to identify agents that induce or inhibit C>U deamination in RNA, wherein an increase in C>U deamination as compared to deamination in the absence of the agent identifies an agent that enhances C>U deamination, and a decrease in C>U deamination as compared to deamination in the absence of the agent identifies an agent that inhibits C>U deamination.
[0070] In an embodiment, the cells are monocytes and/or macrophages, and the condition under which the cells carry out APOBEC3A or APOBEC3G driven C>U deamination of RNA comprises exposure to hypoxia, interferon, which can be type 1 interferon or interferon gamma, or both hypoxia and interferon.
[0071] In an aspect, this disclosure provides a method for identifying agents that enhance or inhibit C>U deamination in a RNA substrate comprising a method for identifying agents that enhance or inhibit C>U deamination in a RNA substrate comprising providing cells which have been transfected to overexpress apolipoprotein B editing catalytic3A (APOBEC3A) or apolipoprotein B editing catalytic 3G (APOBEC3G); in the presence or absence of test agents, determining the extent of C>U deamination in RNA to identify agents that enhance or inhibit C>U deamination in RNA. In an embodiment the cells are 293T cells.
[0072] By transcriptome sequencing and analysis, we show here that transient overexpression of APOBEC3G in 293T cells causes site-specific C-to-U (C>U) RNA editing in 712 sites resulting in protein recoding of 217 cellular genes. APOBEC3G-mediated RNA editing causes recoding in CHMP4B, SIN3A, subunits of mediator complex MED (MED1, MED28), NFAT5, NMT1, RBM14 and MAPK1 that are known to be involved in HIV-1 replication. Site-directed mutagenesis studies show that conserved catalytic residues in both cytidine deaminase domains of APOBEC3G are required for RNA cytosine deamination. Purified C3G enzyme catalyzes site-specific RNA editing in vitro. These results demonstrate that APOBEC3G is a C>U RNA editing enzyme that may antagonize retroviral infection by mutating the transcripts of accessory host genes.
[0073] In one embodiment, the disclosure provides a method of identifying compounds which can induce or inhibit the C>U deamination of RNA comprising providing a substrate (RNA molecule) for the deamination and an enzyme that is capable of C>U deamination under conditions such that the enzyme will catalyze the C>U deamination of the RNA. The enzyme can be APOBEC3 or APOBEC3G. The enzyme may be provided in a purified or recombinant form such that the reaction can be carried out in a cell-free system. In one embodiment, the enzyme may be provided as a component of a cell lysate. In one embodiment, the enzyme may be provided in vivo. These enzymes are available commercially (such as from Origene).
[0074] The disclosure provides a method for screening a plurality of compounds or agents for their ability to induce or inhibit APOBEC3A and/or APOBEC3G driven C>U deamination in RNA substrate comprising the motif for the C>U deamination. The method can comprise contacting purified or recombinant APOBEC3A and/or APOBEC3G protein with the RNA substrate in an in vitro system in the presence or absence of the test compounds and determining C>U deamination. The method can comprise contacting cell lysates comprising APOBEC3A and/or APOBEC3G with the RNA substrate in the presence or absence of the test compounds or agents and determining C>U deamination. Increased C>U deamination identifies compounds or agents that enhance C>U deamination. Decreased C>U deamination identifies compounds or agents that inhibit C>U deamination. Identification of increased or decreased C>U deamination can be done relative to a control, which may be run in the absence of the enzyme, substrate or in the presence of enzymes or substrates that do not support C>U deamination.
[0075] In one embodiment, the disclosure provides a method for screening a plurality of compounds for their ability to induce or inhibit APOBEC3A driven C>U deamination in RNA comprising exposing whole cells, which express APOBEC3A and which comprise an RNA substrate, to conditions that induce APOBEC3A driven C>U deamination in the presence or absence of the test compounds and determining C>U deamination. Conditions that induce APOBEC3A driven C>U deamination can be hypoxia and/or interferons. For example, for monocytes, both hypoxia and/or interferons induce APOBEC3A driven C>U deamination. For macrophoages, interferons induces APOBEC3A driven C>U deamination.
[0076] In one embodiment, the method can comprise exposing whole cells, in which APOBEC3A and/or APOBEC3G has/have been overexpressed, and which comprise an RNA substrate, to test compounds and determining C>U deamination. Overexpression of APOBEC3A and/or APOBEC3G can be carried out in any cells, such as cell lines, such as 293T cells. The cells can then be processed for determining the level of C>U deamination. Increased C>U deamination identifies compounds or agents that enhance C>U deamination. Decreased C>U deamination identifies compounds or agents that inhibit C>U deamination.
[0077] In one embodiment, the disclosure provides a method for screening a plurality of compounds for their ability to induce APOBEC3A or APOBEC3G driven C>U deamination in a RNA molecule in the presence or absence of hypoxia and/or interferons comprising one or more of the following: i) testing the plurality of compounds for increasing deamination of C in isolated DNA molecule (such as a single stranded DNA molecule); ii) testing the positive compounds from i) for an enhancing effect on C>U deamination in isolated RNA molecule (such as, for example, SDHB); and iii) testing the positive compounds for enhancing effect on C>U RNA deamination from ii) in cell based assays, and then optionally in vivo systems. In one embodiment, step ii) could be eliminated with positive compounds from i) being directly tested for enhancing C>U RNA deamination in a cell based assay.
[0078] In one embodiment, the disclosure provides a method for screening a plurality of compounds for their ability to inhibit APOBEC3 driven C>U deamination in a RNA molecule in the presence or absence of hypoxia and/or interferons comprising performing one or more of the following: i) testing the plurality of compounds for reducing deamination C in isolated DNA molecule (such as a single stranded DNA molecule); ii) testing the positive compounds from i) for reducing C>U deamination in isolated RNA molecule; and iii) optionally testing the positive compounds for reducing C>U RNA deamination from ii) in cell based assays wherein the cells are exposed to hypoxia and/or interferons, and then optionally in vivo systems. In one embodiment, step ii) could be eliminated with positive compounds from i) being directly tested for reducing C>U RNA deamination in a cell based assay.
[0079] Determination of deamination of DNA or RNA can be carried out by methods known in the art. For example, DNA and RNA deamination can be determined by Sanger reaction or high throughput sequencing techniques. For DNA deamination, treatment with UDG glycosylase and alkaline treatment may be used to cleave the DNA molecule. For RNA deamination, radioactive primer extension and gel electrophoresis may be used. In one embodiment, allele specific qPCR may be used to measure RNA editing (Baysal et al., PeerJ., Sep. 10, 2013, 1:e152. doi: 10.7717/peerj. 152. eCollection 2013); incorporated herein by reference).
[0080] Determination of C>U deamination can be carried out in a cell-free system. For example, isolated polynucleotide (polyribonucleotides or polydeoxyribonucleotides) may be used. In one embodiment, the length of the polynucleotides is at least 15. Thus, the substrates may be short polynucleotides or long RNA or single stranded DNA molecules. In one embodiment, the length is from 15 to 100 nucleotides and all integer lengths therebetween. In one embodiment, the length is from 30 to 50 nucleotides.
[0081] In vitro assays with purified APOBEC3A or APOBEC3G can be carried out by contacting APOBEC3A or APOBEC3G (such as 1-10 mM) with a suitable polynucleotide substrate (such as 2-2.5 pM full-length RNA or single-stranded DNA, in suitable buffers (such as 10 mM Tris (pH 8.0), 50 mM KCl and 10 or 100 uM ZnCl.sub.2 with or without 10 mM 1,10-phenanthroline). The reactions can be incubated for suitable periods of time. For in vitro RNA-editing assay with transfectant cell lysate, reaction can be carried out at 37 C. for 4-11 h with RNA in a suitable buffer containing RNAse inhibitor (such as in 100 mM KCl, 10 mM HEPES (pH 7.4), 1 mM DTT and 1 mM EDTA). Cell-based assays can be performed 24-48 hours after transfection of cells (such as 293T cell line) with a mammalian expression vector containing APOBEC3A or APOBEC3G coding regions. This can be useful to achieve overexpression of the enzymes. Total RNA can be extracted and RT-qPCR is can be performed (such as by using a method described in Baysal et al. PeerJ:e152, incorporated herein by reference).
[0082] In one embodiment, the RNA substrate contains the motif CCAUCG or CCACCG with the underlined C targeted for editing. In one embodiment, variants of this motif can also be used which are single-nucleotide variations within the motif. In one embodiment, UC is the motif, and in one embodiment, CC is the motif with underlined C targeted for editing. In one embodiment, the RNA (polyribonucleotide substrate) contains stem-loop structures which contain the editable Cs in the loops. The stem loop size may be 4 nucleotides or more. In one embodiment, the RNA substrate comprises only one target C>U editing motif. In one embodiment, the RNA substrate comprises 2 or more target C>U editing motifs.
[0083] In one embodiment, the ss DNA substrate comprises the motif TC. In one embodiment, the ss DNA comprises the motif CC. The ss DNA substrate may comprise one or more target motifs.
[0084] For carrying out cell based assays, any type of cells may be used. For example, cells may be in vivo, or freshly isolated or primary or secondary cultures, or cell lines. In one embodiment, the cells are peripheral blood mononuclear cells (PBMCs). In one embodiment, the cells may be lymphocytes and monocytes. These cells may be purified from the blood by using routine methods (such as density gradients, flow cytometry and the like). The cells may be further purified as desired. For example, CD14 monocytes may be isolated using anti-CD14 antibody based methods employing magnets or flow cytometry. Alternatively, monocytes can be physically enriched by cold-aggregation of PBMCs, as described herein, or by plate adherence. We found that APOBEC3A-mediated RNA editing occurs primarily CD14 positive monocytes or monocyte-derived macrophages that are treated by interferons. The cells may be used as such, or may be transfected with vectors encoding APOBEC3A or APOBEC3G to result in overexpression of these enzymes. The cells may be exposed to hypoxia and/or interferons. The interferons can be IFN gamma and IFN1.
[0085] In one embodiment, the effect of various compounds may be tested after the cells are exposed to conditions of hypoxia and/or interferons. For example, hypoxic conditions may be created in culture by exposing cells to 10% or less O.sub.2 (with 5% CO2 and the rest nitrogen). In one embodiment, the O.sub.2 is from 1 to 5%. In one embodiment, the O.sub.2 is less than 1%. The cells may be exposed to the hypoxic conditions and/or interferons for desired lengths of time. For example, cells may be exposed for from 6 hours to 48 hours or more.
[0086] The interferons useful for the present methods include IFN gamma and IFN1. IFN1 is considered a universal type I IFN . In one embodiment, the IFN1 comprises a hybrid of N-terminal IFN-2 and C-terminal IFN-1 produced in E. Coli. Useful range of interferon includes 50-500 U/ml for IFN gamma; 50 U/ml to 2,500 U/ml for IFN type 1 to induce APOBEC3A mediated RNA editing.
[0087] The agents identified by the methods of the present disclosure may be further tested for anti-tumor activity (such as those agents which inhibit C>U deamination) or for anti-viral activity (such as those agents which enhance C>U deamination activity).
[0088] The following examples are provided to further illustrate this invention.
EXAMPLE 1
[0089] This examples demonstrates identification of APOBEC3A as an RNA editing enzyme.
[0090] Methods
[0091] Isolation and Culture of Cells
[0092] The TLA-HEK293T 293T human embryonic kidney cell-line was obtained from Open Biosystems (Huntsville, Ala.). Peripheral blood mononuclear cells of anonymous platelet donors were isolated from peripheral blood in Trima Accel leukoreduction system chambers (Terumo BCT, Lakewood, Colo.) after thrombocytapheresis, in accordance with a protocol approved by the institutional review board of Roswell Park Cancer Institute. A density gradient centrifugation method using polysucrose-containing Lymphocyte Separation Medium (Mediatech, Manassas, Va.) was used for PBMC isolation. MEPs were prepared from PBMCs using the well-established cold aggregation method (Mentzer et a., Cell Immunol 101, 312-319 (1986) with slight modification. Briefly, PBMCs were subjected to gentle rocking at 4 C. for an hour and aggregated cells that sedimented through fetal bovine serum (FBS; VWR, Radnor, Pa.) were collected as MEPs after 0.5-3 hours for high monocyte enrichment (70% monocytes as assessed by immunofluorocytometry for CD14), or after 8-16 hours for mild enrichment (20%-40% monocytes); the latter was used in all experiments except for the ones of
[0093] Generation and Polarization of Macrophages
[0094] CD14+ monocytes isolated from PBMCs by magnetic sorting and stored frozen in RPMI-1640 with 36% v/v FBS and 10% v/v dimethyl sulfoxide, were thawed and cultured for a week at a density of 0.25 million per ml with 50 ng per ml recombinant human macrophage colony stimulating factor (MCSF; Life Technologies, Carlsbad, Calif.), 1 GlutaMAX-I (Life Technologies) and 1 mM sodium pyruvate (Mediatech) to generate M0 macrophages. M0 macrophages were also similarly generated from fresh monocytes isolated from PBMCs by the Percoll -based method. For M1 or M2 macrophage polarization, M0 cells were treated for two days with 20 ng per ml recombinant human IFNy (Life Technologies) and 100 ng per ml E. coli lipopolysaccharides (LPS; List Biological Laboratories, Campbell, Calif.), or 20 ng per ml recombinant human interleukin 4 (Life Technologies), respectively. RNA was isolated from cells using the Total RNA Purification Kit from Norgen Biotek (Thorold, Canada).
[0095] Hypoxia and Interferon Treatments
[0096] For hypoxia, cells were cultured under 1% O2, 5% CO2 and 94% N2 in an Xvivo System (Biospherix, Lacona, N.Y.). Human IFN and universal type I IFN, a hybrid of N-terminal IFN-2 and C-terminal IFN-1, produced in E. coli were obtained from PBL Assay Science (Piscataway, N.J.), and respectively used at 200 and 300-1,500 U per ml. Unless noted otherwise, hypoxia and/or interferon treatments were for 24 hours. Differential viability of MEPs after 1-day culture in normoxia versus hypoxia was not observed as evaluated by Trypan blue stain. Transfected 293T cells were subjected to hypoxia and/or interferon treatment 24 hours after transfection.
[0097] RNA Sequencing of MEPs
[0098] Indexed sequencing libraries were generated from RNA, isolated using TRIzol and without DNAse treatment, as per methods and reagents provided with the TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero ribosomal RNA reduction chemistry (Illumina, San Diego, Calif.). PCR for library generation employed 10 cycles. Electrophoresis of the libraries on Bioanalyzer 2100 instrument (Agilent, Santa Clara, Calif.) showed highest peaks at 220-240 bp. Paired-end, multiplexed sequencing of libraries (three per flow cell lane) to generate reads of 101 bases (b) was performed on HiSeg 2000 instrument with TruSeq SBS and PE Cluster v3 Kits (Illumina). CASAVA 1.8.2 software (Illumina) was used for base-calling and de-multiplexing to obtain the raw RNA sequencing reads for further analyses. RNA sequencing of all six samples of this study was performed in one batch.
[0099] Macrophage RNA Sequencing Data of Beyer Et Al.
[0100] Paired-end, 101 b read sequence data generated using TruSeq RNA Sample Preparation Kit on Illumina HiSeQ 2000 for paired M1 and M2 macrophages derived from CD14+ monocytes of three donors was obtained as SRA files from NCBI SRA (accession number SRP012015). Raw data in fastq format was extracted from the files with fastq-dump utility in NCBI SRA Toolkit 2.3.3 (ncbi.nlm.nih.gov/sites/books/NBK158900/).
[0101] Processing of RNA Sequencing Reads
[0102] Quality of reads was assessed using FastQC 0.10.1 (URL: www.bioinformatics.babraham.ac.uk/projects/fastqc/). Trimmomatic 0.32 (URL: www.usadellab.org/cms/?page=trimmomatic) was used to trim 12 b from 5 end, and remove adapter sequences and poor-quality bases from the reads. The Trimmomatic call was invoked with HEADCROP:12 ILLUMINACLIP: TruSeq3-PE-2.fa:2:30:10:6:TRUE LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:30, to satisfy these criteria, in order: (1) remove 12 b from the 5 end of all reads because of base bias at these positions; (2) remove read segments that matched sequences of adapters and primers used for sequencing library preparation (the TruSeq3-PE-2.fa file provided with Trimmomatic was used); (3) remove leading/trailing bases with Phred33 base quality score <5; (4) using a sliding window of four bases, remove the most 5 base if the average Phred33 base quality score of the four bases was <15; and, (5) completely discard trimmed reads with <30 remaining bases. Pair-mates of a fraction of raw reads were lost following this read processing with Trimmomatic. Processed read data thus had both paired and unpaired reads (
[0103] Mapping of Processed RNA Sequencing Read Pairs
[0104] Processed read pairs were uniquely mapped to the hg19 genome with the Subread (Liao et al., Nucleic Acids Res 41, e108 (2013)) subjunc 1.4.3-pl aligner. The subread-buildindex command of Subread was used with default argument values to index the whole genome FASTA file for the UCSC hg19 genome assembly (obtained from Illumina iGenomes). Subread subjunc command was used for mapping paired reads to the genome using the genome index with arguments u and H but otherwise default argument values to permit only unique mapping of a read and using Hamming distance to break ties when there were more than one best mappings. The nature of genomic regions that the reads mapped to was assessed using RSeQC 2.3.7. Mapping statistics are provided in
[0105] Processed RNA Sequencing Reads Mapping with TopHat2 Aligner
[0106] Processed reads, both paired and unpaired, were also mapped to the UCSC hg19 human genome assembly with the TopHat2 2.0.10 aligner, permitting only unique mapping of a read with up to three nucleotide mismatches. The bowtie2 index for the UCSC hg19 genome assembly was obtained from ftp.ccb.jhu.edu/pub/data/bowtie2_indexes, and the transcriptome index was built with TopHat2 using the GTF gene annotation file from UCSC (6 Mar. 2013 version) in the Illumina iGenomes UCSC hg19 data. The tophat2 command was used with the transcriptome and bowtie2 genome indexes, and the following argument values specified: mate-inner-dist=50, mate-std-dev=40, max-multihits=1, read-mismatches=3, read-edit-dist=3, no-novel-juncs (and library-type=fr-firststrand, in case of the RNA sequencing data of MEPs). The nature of genomic regions that the reads mapped to was assessed using RSeQC (URL: rseqc.sourceforge.net). Mapping statistics are provided in
[0107] Generation of Mapped RNA Sequencing Read Pileups
[0108] After clipping overlaps of read pair-mates with clipOverlap utility in bamUtil 1.0.10 (URL: genome.sph.umich.edu/wiki/BamUtil), pileups were produced from the mapping data (BAM files) with mpileup in SAMtools 0.1.19 (URL: www.htslib.org), with computation of base alignment quality disabled (B), anomalous reads permitted (A), maximum depth (d) set at 80,000, and aligner-reported read mapping quality (Q)>0 and Phred33 base quality score (q)>19 required.
[0109] Analyses of Mapped RNA Sequencing Read Pileups
[0110] Paired comparison of pileups for the three pairs, from three different human donors, of normoxic and hypoxic MEP, or M2 and M1 macrophage samples was performed to identify genome sites with differential RNA editing in MEPs under hypoxia (test samples) compared to normoxia (control samples), or in M1 macrophages (test) compared to M2 macrophages (control). Python 2.7, R 3.0 and shell scripts were used for the analysis. Sites considered for analysis satisfied all of the following criteria regarding the A/T/G/C base-calling reads that covered them: (1) 20 calls (per sample, as for the other criteria here) in both samples of 1 pair, and 5 calls in all six samples; (2) 50% of calls for the reference human genome base in all test or all control samples; (3) 2 variant (other than the reference base) but identical base-calls in 2 test or 2 control samples, with 1 such calls in all test or all control samples, and 5 base-calls for a different variant in all six samples; and, (4) 95% reads with a base-call for either the reference or variant nucleotide in all six samples (thus, only one type of nucleotide change was considered for a site). Variation or editing level for sites was calculated as the ratio of variant base-calling- to the sum of variant and reference base-calling-read counts. Sites were then filtered by editing level, requiring: (1) 2.5% in 2 test or 2 control samples; (2) mean 5% for test or control samples; and, (3) range/mean 2 across all six samples (to reduce subsequent multiple testing). Variant sites with known maximum population prevalence >20% for identical sequence polymorphism (as per the popfreq_max ANNOVAR database, detailed below), or sites that did not map to a known RefSeq gene (URL: www.ncbi.nlm.nih.gov/refseq), or mapped to either exons of >1 RefSeq genes on both chromosome strands, or mapped to only introns of >1 RefSeq genes on both chromosome strands were excluded. Annotation data (BED files) for RefSeq gene introns and exons for the UCSC hg19 genome assembly were obtained on 21 Mar. 2014 using UCSC Genome Browser (URL: genome.ucsc.edu). The inverted beta-binomial (IBB) test for multiple paired count data was then applied to the remaining variant sites to identify sites that were differentially edited between the test and control samples. To control false discovery resulting from multiple testing, q-values were calculated from IBB test P values using the qvalue function in the qvalue Bioconductor package with these argument values specified: pi0.method=bootstrap, robust. Sites that were further considered had q-value <0.05 and >2-fold difference in either direction for editing level between test and control samples (fold-change values, capped at an absolute value of 104, were estimated by the IBB test) in analysis of Subread subjunc-aligned RNA sequencing data as well as an IBB test P value <0.05 and >2-fold difference in analysis of TopHat2-aligned RNA sequencing data. Sites were then filtered if either of their 5 and 3, 29 b-long, flanking genomic sequences, respectively with either the reference or variant base at the 3 and 5 end, aligned perfectly with the genome at another location; blat 35 (URL: genome.ucsc.edu) was used for this purpose. Finally, for filtering based on sequencing read strand bias, sites were filtered out if in the Subread subjunc-aligned data the variant base was called from a total across all six samples of >9 forward RNA sequencing reads but no reverse read, or vice versa, or if the number of forward and reverse reads were significantly different for either the test or control samples (IBB test P value <0.05). Numbers of sites that were left after and filtered by different steps of the analysis described here are noted in
[0111] Analyses of RNA Editing Sites
[0112] ANNOVAR tool (23 Aug. 2013 release;openbioinformatics.org/annovar) and ljb23_metalr (22 Feb. 2014), popfreq_max (21 Aug. 2013), RefSeq-based refGene (13 Nov. 2013), and dbSNP 138-based snp138 (13 Dec. 2013) ANNOVAR databases were used to annotate sites with information such as gene features they are located in, frequencies of known C/T genomic DNA polymorphism, and effects on amino acid coding. Coding genomic strand sequences flanking the editing sites were extracted from the whole genome FASTA file for the UCSC hg19 genome assembly (obtained from Illumina iGenomes) with the getfasta utility in bedtools 2.17.0 (github.com/arq5/bedtools), and these sequences were analyzed as transcript RNA sequences. Palindromic sequence context of editing sites was manually examined. RNA folding was predicted with ViennaRNA package 2.1.6 (tbi.univie.ac.at/RNA). These annotations are provided in
[0113] Gene Expression, RNA and Whole Exome Sequencing Data
[0114] Level 3, gene-level expression data determined by RNA sequencing with the UNC v2 pipeline were obtained from Broad Institute GDAC Firehose (2014_03_16 stddata run). RNA and whole sequencing data mapped to the hg19 genome assembly (BAM files) were obtained from Cancer Genomics Hub (University of California, Santa Cruz) respectively during February and March, and October 2014.
[0115] Analysis of TCGA Tumor RNA Sequencing Data for SDHB Editing
[0116] Pileups were generated as described above. Editing was deemed indeterminable for a sample if <99% of mapped reads had a base-call other than A or G, or there were <200 calls with none for A, or there were <100 calls with only one for A (SDHB gene is coded on the minus chromosome strand). Otherwise, C>U editing level was estimated as the ratio of G to the sum of A and G calls. Information on C/T single nucleotide polymorphisms in SDHB protein coding sequence was obtained from dbSNP (build 37).
[0117] RNA Sequencing Data Analysis for Varied Gene Expression
[0118] Gene-level raw count values of transcripts were analyzed with the edgeR Bioconductor package (version 3.2.3) for normalization with the trimmed mean of M-values method and inter-group comparison of gene expression by exact or likelihood ratio tests. For analyses of RNA sequencing data of tumor samples of TCGA, genes with raw count value >0 for N samples, irrespective of group membership, where N equals the size of the SDHB c.136C>U editing-positive group, were considered as expressed, and values for prior.df and rowsum.filter parameters in estimateCommonDisp and estimateTagwiseDisp functions of edgeR were respectively set at 0.2 and 4N. An exact test was used to generate P values. For analyses of RNA sequencing data of MEPs and macrophages, genes with raw count value >1 for 3 samples, irrespective of group membership, were considered as expressed, and pair-wise comparison of gene expression between groups using generalized linear models with negative binomial distribution and a likelihood ratio test to generate P values was performed. False discovery rates (FDR) were estimated from P values with the Benjamini-Hochberg method, and genes with FDR <0.05 were considered as differentially expressed. Summarized results of differential gene expression analyses are provided in
[0119] Gene Expression Constructs and Site-Directed Mutagenesis
[0120] Sequence-verified plasmid constructs in pCMV6 vector for CMV promoter-driven expression of human APOBEC3A, APOBEC3G, CDA and SDHB cDNAs, with sequences matching NCBI RefSeq sequences NM_145699.2, NM_021822.1, NM_001785.1 and NM_003000.2, respectively, for the generation of C-terminal Myc-DDK-tagged APOBEC3A, and untagged APOBEC3G, CDA and SDHB proteins were obtained from OriGene (Rockville, Md.; product numbers RC220995, SC122916, SC119015 and SC319204, respectively). An inducible bacterial expression construct for APOBEC3A with a C-terminal His6-tag in the pET21 vector was obtained from Dr. Jinwoo Ahn (University of Pittsburgh, USA). Site-directed mutagenesis of APOBEC3A constructs (c.216G>C/p.E72D, c.301T>A/p.C101S or c.400C>G/p.P134A; primer sequences shown in
[0121] Transfection of Plasmid DNA
[0122] 293T cells were transfected with plasmid DNA using the liposomal X-tremeGENE 9 DNA reagent (Roche, Indianapolis, Ind.) or jetPRIME (Polyplus-transfection, New York, N.Y.) reagents as per guidelines provided by the reagent manufacturer. Transfection efficiency with both reagents was 60%-80% as assessed by fluorescent microscopy of cells transfected with the pLemiR plasmid DNA (Open Biosystems) for expression of a red fluorescent protein. Cells were harvested two days after transfection.
[0123] Knock-Down of APOBEC3A RNA in M1 Macrophages
[0124] A day before induction of M1 polarization, M0 macrophages at a density of 1 million cells per ml in 1 ml medium per well of 6-well plates were transfected with 100 nM of negative control (Silencer negative control no. 1, product number AM4611, Life Technologies) or either or equimolar mix of two human APOBEC3A siRNAs (Silencer 45715 and 45810 respectively with sense sequences GACCUACCUGUGCUACGAATT (SEQ ID NO:1)and GCAGUAUGCUCCCGAUCAATT (SEQ ID NO:2), Life Technologies) using Lipofectamine RNAiMAX (Life Technologies) as per guidelines supplied by the manufacturer. IFN and LPS were added with 1 ml medium to each well to induce M1 polarization, and cells were harvested a day later.
[0125] LINE-1 Retrotransposition Assay
[0126] Briefly, firefly luciferase expression conditional to the retrotransposition of a human LINE-1 element from a plasmid DNA to the genome is measured in this assay. 293T cells at 50% confluence in 12-well tissue culture plates were co-transfected with 0.75 g of the LINE-1 plasmid, 0.5 g of pcDNA 3.1(+) or an APOBEC3A expression plasmid, 0.25 of pcDNA 3.1(+), and 1 ng of pRL-SV40 plasmid (per well). Transfectants were lysed after two days for measurement of their firefly and Renilla luciferase activities using Dual-Luciferase Reporter Assay System (Promega). Retrotransposition was quantified as the ratio of firefly and Renilla luciferase activities.
[0127] Reverse Transcription and PCR
[0128] RNA was reverse transcribed with random DNA hexamers and/or oligo-dT primers using material and methods provided with the Transcriptor First Strand cDNA Synthesis (Roche) or High Capacity cDNA Reverse Transcription (Life Technologies) kits. PCR typically employed 35 cycles of amplification and an annealing temperature of 60 C. PCR oligonucleotide primers (Integrated DNA Technologies, Coralville, Iowa) are listed in
[0129] Sanger Sequencing
[0130] Sequencing primers (Integrated DNA Technologies) are listed in
[0131] Immunoblotting of Cell Lysates
[0132] Whole cell lysates were prepared using M-PER reagent (Thermo Fisher, Rockford, Ill.) with 1 Halt protease and phosphatase inhibitor cocktail (Thermo Fisher). Reducing and denaturing polyacrylamide gel electrophoresis of 20 g proteins in Laemmli buffer system was performed on pre-cast, 4%-15% gradient polyacrylamide gels (Mini-PROTEAN TGX, Bio-Rad, Hercules, Calif.). Proteins were then transferred to polyvinylidene difluoride membrane with a pore-size of 0.2 m for 7 minutes at 1.3 A in a Bio-Rad Trans-Blot Turbo apparatus. Membranes were incubated in Tris-buffered 0.15 M NaCl of pH 7.5 with 0.05% v/v TWEEN 20 (Sigma Aldrich, Saint Louis, Mo.) and 5% w/v dried, non-fat, cow milk (Carnation, Nestl, Glendale, Calif.) with antibodies at dilutions recommended by their manufacturers. Rabbit polyclonal anti-APOBEC3A (product number sc-130688, D-23, 1:200 dilution; used in the experiments for
[0133] DNA Deamination Assay with Cell Lysates
[0134] The deamination assay described by Byeon et al. (Nat Commun 4, 1890 (2013)). was used. Whole cell lysates were prepared using M-PER reagent (Thermo Fisher, Rockford, Ill.) with 1 Halt protease and phosphatase inhibitor cocktail (Thermo Fisher). Briefly, 180 nM 5 Alexa Fluor 488 fluorescent dye-labeled ssDNA substrate of 40 bases (Integrated DNA Technologies) was incubated at 37 C. for an hour with 10 l lysate and 10 units of E. coli uracil DNA glycosylase (New England Biolabs) in 10 mM Tris (pH 8.0), 50 mM NaCl, 1 mM dithiothreitol (DTT) and 1 mM ethylene-diamine-tetraacetic acid (EDTA) in a volume of 50 l. The reaction was stopped by adding 40 g proteinase K (Life Technologies) and incubating it for 20 minutes at 65 C. 10 l of 1 N NaOH was added to the reaction which was then incubated at 37 C. for 15 minutes. After adding 10 l of 1 N HCl, the reaction (10 l) was electrophoresed on a 10% denaturing polyacrylamide gel. Typhoon 9400 Imager (GE Healthcare) was used to scan the gel in fluorescence mode.
[0135] Purification of Recombinant APOBEC3A Proteins
[0136] Rosetta 2(DE3)pLysS E. coli (EMD Millipore) transformed with a bacterial expression construct for C-His6-tagged APOBEC3A and grown in Luria broth at 37 C. were induced for expression of the recombinant protein with 0.3 mM isopropyl -D-1-thiogalactopyranoside (IPTG) and cultured overnight at 18 C. Harvested cells were lysed with a French pressure cell (American Instrument Corporation, Hartland, Wis.) and Ni-NTA His.Bind Resin (EMD Millipore) was used as per manufacturer's instructions to purify APOBEC3A protein from the lysates by affinity chromatography. Isolated protein was concentrated using an Amicon Ultra-4 Centrifugal Filter Unit with Ultracel-3 membrane (EMD Millipore; nominal molecular weight limit of 3 kDa). The concentrated protein was stored in 25 mM Tris (pH 8.0) with 50 mM NaCl, 1 mM DTT, 5% v/v glycerol, and 0.02% w/v sodium azide. Staining with Coomassie blue of protein preparation electrophoresed on a denaturing polyacrylamide gel indicated that it had APOBEC3A at >90% purity.
[0137] In Vitro SDHB Editing Assay
[0138] Whole cell lysates of 293T transfectants were prepared using lysis buffer containing 0.2% Surfact-Amps NP-40 (Thermo Fisher), 30 mM 4-(2-hydroxyethyl)-1-piperazine-ethane-sulfonic acid (HEPES; pH 7.5), 100 mM KCl, 25 mM NaCl, 1.5 mM MgCl2, 1 mM DTT, and 0.5 Halt protease and phosphatase inhibitor cocktail, and stored with 10% v/v glycerol at 80 C. SDHB ORF RNA of 1.1 kb was generated by in vitro transcription of Xhol enzyme-linearized plasmid DNA using reagents and methods provided with the MEGAscript T7 Transcription Kit (Life Technologies). SDHB RNA isolated from the transcription reaction was treated with DNAse I (Thermo Fisher), and its integrity verified by electrophoresis on an agarose gel. For in vitro SDHB RNA editing assay, transfectant cell lysate (2-8 l containing 21-84 g protein) was incubated at 37 C. for 4-11 hours with 50 pg (125 amole) of SDHB RNA in a buffer containing 0.02 U per l RNAse inhibitor (Protector, Roche), 100 mM KCl, 10 mM HEPES (pH 7.4), 1 mM DTT and 1 mM EDTA in a total volume of 50 l. In vitro assays with purified APOBEC3A contained 5-10 M APOBEC3A, 2-2.5 pM SDHB full-length RNA or single-stranded SDHB DNA (c.37-c.156), 10 mM Tris (pH 8.0), 50 mM KCl, and 10 or 100 nM ZnCl2 with or without 10 M 1,10-phenanthroline (Sigma Aldrich). The reactions were incubated for 2 hours at 37 C. RNA was purified from the reactions containing transfectant lysates or purified APOBEC3A using TRIzol (Life Technologies) as per manufacturer's instructions. The c.136C>U editing of the exogenous RNA was assessed by allele-specific RT-PCR (Baysal et al., PeerJ 1, e152 (2013)) using a forward PCR primer (GGAATTCGGCACGAGGAC) (SEQ ID NO:3)that does not bind the cDNA of endogenous SDHB RNA. For Sanger sequencing to assess a 619 b segment of the RNA that spanned exons 1 to 5, the cDNA was amplified with primers with sequences GGTCCTCAGTGGATGTAGGC (SEQ ID NO:4) and TGGACTGCAGATACTGCTGCT (SEQ ID NO:5). For reactions with SDHB DNA as substrate, 4 l of the reaction was directly used in PCR of volume 20 l with primers with sequences TTGCCGGCCACAACCCTT (SEQ ID NO:6) and AGCCTTGTCTGGGTCCCATC (SEQ ID NO:7) to amplify the substrate for Sanger sequencing by the forward primer.
[0139] Other
[0140] SDHB gene expression and c.136C>U RNA editing was quantified by RT-PCR. Unless noted otherwise, total RNA, genomic DNA and plasmid DNA were isolated using material and methods provided with TRIzol, DNA Wizard Genomic DNA Purification Kit (Promega), and Plasmid Kit (Qiagen, Germantown, Md.), respectively. RNA/DNA was quantified by spectrophotometry on a Nanodrop 2000 instrument (Thermo Fisher). Proteins were quantified using Bio-Rad Dc assay with bovine serum albumin standards. Statistical tests were two-tailed and were performed using R 3.0, Excel 2010 (Microsoft, Redmond, Wash.), or Prism 6.0 (GraphPad, San Diego, Calif.) software.
[0141] Results
[0142] SDHB RNA Editing in IFN-Treated MEPs and M1 Macrophages
[0143] Similar to hypoxia, an IFN-rich microenvironment is another factor that monocytes are exposed to during inflammation. IFNs also up-regulate expression of APOBEC3 cytidine deaminases, candidate enzymes that may be responsible for the SDHB c.136C>U RNA editing observed in monocytes. We therefore examined whether interferons induce SDHB c.136C>U RNA editing. As shown in the left panel of
[0144] IFN is an inducer of M1 (pro-inflammatory) polarization of macrophages, which are derived from monocyte precursors. We therefore examined and compared SDHB c.136C>U RNA editing in basal, unpolarized (M0), M1 and M2 macrophages. M0 cells were derived in vitro from CD14+ peripheral blood monocytes, and matched M1 and M2 macrophages were generated from the M0 cells by treatment with IFN and lipopolysaccharides, and interleukin-4, respectively. The SDHB RNA editing was found to be absent in M0 macrophages but occurred at an average level of 27% in M1 cells (
[0145] Wide-Spread RNA Editing in Hypoxic MEPs and M1 Macrophages
[0146] To investigate whether hypoxia affects editing of RNAs other than SDHB in MEPs, we performed RNA sequencing of matched normoxic and hypoxic MEPs of three healthy individuals. We also examined whole transcriptome RNA sequencing data obtained by Beyer et al. (PLoS One 7, e45466 (2012)) for matched M1 and M2 macrophages generated in vitro from peripheral blood monocytes of three individuals to determine whether M1 macrophage polarization differentially affects editing of other RNAs besides SDHB. Such comparison of whole transcriptomes of paired samples to identify RNA editing is less likely to falsely identify sequencing and mapping artifacts or genome sequence variations as RNA editing events.
[0147] About 84%-90% and 94%-97% of RNA sequencing reads of the MEPs and macrophages, respectively, could be uniquely mapped to the UCSC hg19 reference human genome (
[0148] Putative RNA editing was found to be up- and down-regulated respectively at 3,137 and 29 sites by hypoxia in MEPs, and respectively at 139 and 2 sites by M1 compared to M2 macrophage polarization (
[0149] The average editing level in hypoxic MEPs was >10% and >20% for respectively 93 (45%) and 25 (12%) of the 206 C>U sites for which editing was up-regulated by hypoxia. In normoxic MEPs, the levels were <1% and <5% for respectively 162 (79%) and 202 (98%) of the 206 sites (
[0150] Sequence and Structural Contexts of C>U RNA Editing Sites
[0151] C>U editing sites were most commonly present within a CCAUCG sequence motif (edited site underlined), with CAUC and its CACC, CCUC, CUUC and UAUC 1-nucleotide (nt) variants present for approximately 79% and 85% of the editing sites of MEPs and macrophages, respectively (
[0152] Validation of Site-Specific C>U RNA Editing in MEPs
[0153] Thirty-three non-synonymous C>U RNA editing sites (in 33 genes) that were identified in analysis of RNA sequencing data (
[0154] MEPs contain both monocytes and lymphocytes. To determine the RNA editing levels of the 31 experimentally validated genes in these individual cell types, Sanger sequencing of RT-PCR products of monocyte and lymphocyte isolates (
[0155] For two of the transcripts for which the editing results in a nonsense codon change, SDHB (NCBI reference sequence NM_003000, exon 2:p.R46X) and SIN3A (NM_001145357, exon 20:p.Q1197X), the effect of hypoxia-induced C>U RNA editing on protein level was examined by immunoblotting assays of whole cell lysates of monocytes isolated from normoxic or hypoxic MEPs of three donors in a separate experiment. As shown in
[0156] APOBEC3A Expression is Associated with SDHB RNA Editing
[0157] Next, we examined whether expression of any cytidine deaminase gene(s) was associated with SDHB c.136C>U RNA editing in monocytes and macrophages. CDA and the seven APOBEC3 genes were identified as expressed in RNA sequencing data of MEPs, and only CDA expression was up-regulated by hypoxia (
[0158] To further understand the association of cytidine deaminase gene expression with SDHB c.136C>U RNA editing, we evaluated RNA sequencing data in the Cancer Genome Atlas (TCGA) for three randomly chosen cancers, primary head and neck squamous cell carcinoma (HNSC), lung adenocarcinoma (LUAD), and secondary skin cutaneous melanoma (SKCM). Because tumors contain immune cells and can have hypoxic regions, we hypothesized that some degree of SDHB c.136C>U variation may be noticeable in the RNA sequences of the TCGA samples. Somatic SDHB c.136C>T mutation has not been identified in any TCGA sample for these cancers (data release 17 of International Cancer Genome Consortium (Hudson et al. Nature 464, 993-998 (2010)).
[0159] The scrutiny of TCGA's RNA sequencing data for the tumor tissues indicated putative C>U RNA editing of SDHB open reading frame (ORF) at c.136, but at no other site, in 30.2%, 26.4%, and 9.6% of the respectively 298 HNSC, 220 LUAD and 187 SKCM cases that were examined (
[0160] APOBEC3A Overexpression Causes C>U RNA Editing in 293T Cells
[0161] As noted above, the expression of APOBEC3A or CDA positively correlated the most with C>U RNA editing in cancer tissues, MEPs or macrophages (
[0162] Sanger sequencing of RT-PCR products of the 293T transfectants showed that exogenous APOBEC3A, but not CDA, also caused site-specific C>U RNA editing for 30 genes for which RNA editing was previously validated for MEPs (editing for EVI2B could not be examined because of low gene expression;
[0163] Notably, exogenous APOBEC3G also caused low-level, site-specific RNA editing for 11 genes in 293T transfectants (
[0164] APOBEC3A Knock-Down Reduces RNA Editing in M1 Macrophages
[0165] To validate that APOBEC3A mediates SDHB c.136C>U RNA editing in M1 macrophages (
[0166] RNA Editing by APOBEC3A Variants and Retrotransposition
[0167] The C101 residue of APOBEC3A is critical for binding of zinc, and the C101S APOBEC3A mutant completely lacks deamination activity against cytidines of ssDNA in vitro (Chen et al. Curr Biol 16, 480-485 (2006), Mitra et al. Nucleic Acids Res 42, 1095-1110 (2014)). As expected, cell lysates of the 293T transfectants exogenously expressing this mutant (
[0168] APOBEC3A suppresses retrotransposition in cell-based assays and this suppression is dependent on its ssDNA cytidine deaminating catalytic integrity (see discussion). To test whether RNA editing and retrotransposition suppressing functions of APOBEC3A are linked, we tested the effect of mutations on LINE1 (L1)-retrotransposition. We found that the ability of the E72D, C101S and P134A variants to inhibit retrotransposition paralleled their RNA editing activities (
[0169] In Vitro Deamination of SDHB RNA and ssDNA by APOBEC3A
[0170] The various observations thus far noted suggest that APOBEC3A can deaminate cytidines in RNA. To demonstrate that APOBEC3A can edit c.136C>U in SDHB RNA in vitro, an SDHB ORF RNA of 1.1 kb with an artificial sequence at its 5 end was incubated with whole cell lysates of 293T transfectants. Editing of the RNA at c.136 was quantified by allele-specific RT-PCR with a 5 primer that was specific to the artificial sequence and using the same 3-primers as described (Baysal et al., PeerJ 1, e152 (2013)). Lysate expressing APOBEC3A but not a control transfectant induced C>U editing of the exogenous SDHB RNA at c.136 in a time- and dose-dependent manner, and this activity was not seen with the heat-inactivated lysate (
[0171] Discussion
[0172] In this study, we demonstrate that APOBEC3A, a cytidine deaminase highly expressed in myeloid cells, is a C>U RNA editing enzyme that modifies the monocyte/macrophage transcriptome. The RNA editing in monocytes is activated by hypoxia and interferons in both independent and additive manners (
[0173] The RNA editing activity of APOBEC3A (
[0174] Non-synonymously C>U RNA-edited genes identified in this study may represent players that mediate the anti-viral and -retrotransposition function of APOBEC3A.
[0175] APOBEC3A is believed to deaminate foreign but not host genomic DNA in primary cells, and previous studies have demonstrated the deamination activity of the enzyme against ssDNA but not RNA (Mitra et al., Nucleic Acids Res 42, 1095-1110 (2014), Stenglein et al., Nat Struct Mol Biol 17, 222-229 (2010). Our data (
[0176] An important finding of this study is that hypoxia independently activates C>U RNA editing to levels comparable to those induced by IFN1 (
[0177] Monocytes and monocyte-derived pro-inflammatory macrophages play an important role in pathogenesis of common diseases including infectious diseases, obesity, cancer, Alzheimer's disease and atherosclerosis. We found that APOBEC3A causes non-synonymous RNA editing of transcripts of the APP, AP2A1, CAST, LRP10 and XPO1 genes (
[0178] Our findings reveal an unprecedented extent and level of protein-recoding RNA editing in innate immune cells in response to certain micro-environmental factors associated with inflammation, which is mediated by APOBEC3A. In the light of important role which APOBEC3A plays in restricting diverse viruses and retrotransposons, these findings suggest a deaminase-dependent cellular RNA editing model which can be used to investigate the molecular bases of these restrictions and to identify agents that affect RNA editing.
[0179] RNA Sequencing data of MEPs were deposited in NCBI Sequence Read Archive (SRA) with accession number SRP040806.
TABLE-US-00001 TABLE 1 Candidate sites experimentally examined for validation of C > U RNA editing.sup.a Editing level (%).sup.d Chromosomal cDNA and amino MEPs Macrophages Gene position.sup.b acid change.sup.c Normoxia Hypoxia M2 M1 AP2A1 19:50295238 C520T, R174X 0 15.5 NA NA APP 21:27326988 C1546T, R516C 0 8.5 NA NA ASCC2 22:30221126 C202T, R68X 0.9 19.1 NA NA C1QA 1:22965523 C361T, R121W NA NA 0.1 10.7 CAST 5:96106257 C1826T, S609F 0 7.2 0.1 5.2 CCDC109B 4:110605624 C638T, S213L 0.3 20.4 NA NA EVI2B 17:29632509 C119T, S40L 0 18.1 0.6 12.1 FAM89B 11:65340979 C437T, P146L 0 16.2 NA NA GLTSCR2 19:48253494 C349T, R117W 0.5 6.8 0.2 11.2 GPR160 3:169801777 C17T, S6L 0.6 15.7 NA NA HLA-DMA 6:32918428 C241T, R81C 0.6 9.9 NA NA ICAM3.sup.e 19:10444896 C1381T, Q461X 0 18.4 0 7.2 ITGB2 21:46319067 C908T, S303L 0.9 5.1 NA NA LGALS9 17:25967659 C193T, R65W 0.2 7.6 0 5.4 LRP10 14:23346296 C1702T, R568X 0 6.2 NA NA NBN 8:90955531 C2134T, H712Y 4 24.2 0 22.4 PABPC4 1:40027426 C1840T, H614Y 4.4 31.7 1.6 39.9 PCGF3 4:737366 C367T, R123W 2 22.2 0 12.8 PPA2 4:106317458 C319T, Q107X NA NA 0.2 8.8 PRPF40A 2:153515789 C2404T, R802X 0 5.1 NA NA RGS10 10:121275109 C311T, S104L 0.2 7.9 0 15.3 RNH1 11:499165 C464T, S155L 3 18.5 0 9.2 SDHB 1:17371320 C136T, R46X 2.6 23 1.1 15.6 SIN3A 15:75668008 C3589T, Q1197X 0 17.2 NA NA SETX.sup.e 9:135201977 C5008T, Q1670X 1.9 24.6 NA NA SUPT6H 17:27005584 C1138T, R380X 0.6 12.3 NA NA TMEM109 11:60687274 C109T, R37X 0 11.2 NA NA TMEM131 2:98409343 C3650T, S1217L 5.7 26.4 NA NA TMEM179B 11:62556843 C364T, R122X NA NA 0 5.2 TRAPPC11 4:184585120 C100T, R34X 0 15.8 NA NA UBE2J1 6:90048208 C292T, H98Y 4 16.1 1.1 18.9 VIM 10:17277300 C1141T, R381C 0.3 15.7 NA NA XPO1 2:61760990 C43T, Q15X 2.7 10 NA NA .sup.aNA, either editing level was not different between the two groups of samples or it could not be determined .sup.bBased on the UCSC hg19 genome assembly used for mapping reads with the Subread subjunc aligner .sup.cNucleotide numbering for the shortest transcript isoform, with A of the ATG translation initiation codon at position 1 .sup.dCalculated in analysis of RNA sequencing data (FIG. 19); mean value (n = 3) .sup.eFailed Sanger sequencing-based experimental validation
[0180] The following sequences are listed in the figures:
TABLE-US-00002 ID Sequence No. AGCCTCGCCTTTGCCGA 8 TGACATCCCCCGCATCCTGG 10 CACACATATTCACTTCCAACTTTAAC 12 GGCCGAGGACCCGAAGG 14 ATGTCCGCGCAGAACAGAA 16 CTTTGACGAGACTCTACAGAAG 18 AGGCAGGAAGACCTGGCAGA 20 AAACCTGCAGATGACCAAGAC 22 AGAGAGAGCACCATTTACTG 24 CTCACCCAGGAGGGGAGAATC 26 GCAAAAGAAGTTAACAGCTGAG 28 TCAACCTCGACTCAGCGCTG 30 TTGTTGTCAGAGGCCCCA 32 GGAAGATCATCAGTCAAGGAAG 34 TGGCTGCTACCCCACTCCTG 36 AATCGGCTGGCGCAACGTCA 38 CTCAGCTCCAGTGGAACCAG 40 CACCTGCAAGCTCTATGCCAT 42 AAATCCATCTGGCATAAATGATGA 44 GGGAATGCTGCTGGAGATAG 46 TGGTACCAGGCCTCCAAG 48 GATGATGTTAAGAAGTTCAAACC 50 GAGGACATAACTCTAGAATCTG 52 GAAAATGCAAGATAAGACGCAG 54 GCTGCACCTCAGCGACAAC 56 TGTGGATAGTCTGGATAAGCT 59 TGATTACCTAGACCGAGGGC 61 ATAGCAGTGGCCTGAGAAAG 63 ATCTCAGGAGAATCGTTGGT 65 GGCGATGACTCGGACCCAG 67 TGTGACATCGTAAACATGAG 69 CCAGACTCCGATTTTGATGGAG 71 GCAGAAGAATGGTACAAATCCA 73 GCATCAGCAAGAGCAACAG 75 CTGGTGCCTGGGGCG 9 CATGTGCTGGTCATTGAGCAG 11 GTCCAGGCGCTCCACTTC 13 TTCTGACACAGGCTGCGAAG 15 CAACTTCATCCTGAATCTCCT 17 AAAGAGCACGCAGAGGTCCAG 19 GGGTACAGTGCAGACGAATC 21 AGTCATCTTTTGGCTTGGAAG 23 ATATCCCAGGAGTACACCCA 25 CGATAGCAATTGCCCTGAAATCC 27 GTTGGTTGTCCAGCAGTGACT 29 GATGTGGAAGGCATCCTGCA 31 TCCTTCCGCCTGAGCTTCTT 33 CCCAAGTATGATCAAGAATAGC 35 GCCCTATTTGCTGGATCATCC 37 CTCGTAGGTCTTCACCATCC 39 AGGATCCCGTTCACCATCAC 41 CAAGGGGAGCAGCAGAAGG 43 CTCCATTTCCTGCCTTAGCC 45 TCAAACCTTGAGTTGAATTCCATA 47 CTGCGGTGGTAGTCGTTGTC 49 ATCTTGCTTCCTCTTGAGTGCA 51 GATTTATGTCTCCTCTTCTTAC 53 CTGGTCCTGGAGTTTCTGGA 55 CTGAGCCTGGAGCTGGGGT 57 GTCAAAGTAGAGTCAACTTCAT 58 GCACATGCTCCTTGGTCCA 60 ATGCCATCAGCAAGAGGTTTGT 62 CTCTGACACCAGGTGCATGG 64 AGCAGACTGTGAAGAAGCTGCT 66 CCAAATTCACCCAAGAAGAG 68 GGAATGTACCACTCATATGAAG 70 GCTCTTCTTTCCTCAGGAGTG 72 CTGTAGGTGGCAATCTCAATG 74 TCAGTACTTCTTGAGCCATTC 76 GCAAGAGTTCCTTTTCATCTTGC 78 CTTTCATTATAAACCCGCTATAG 79 TCACCCTGTGTCCTTTGCAG 80 GAAGACTATTTGCTTTCCCTGG 81 TATGCATGATTTACCATCTTTGC 83 GTTGGCTTTGGTCCACCAC 84 CTTTCTCTTGCCACAGCAGCT 86 CCAGCAAAATGGAATTATCTTGT 87 GCACTCAGCTCACTGTGCTT 89 CAGTTGGTCCCTTTTTCAGC 90 TGCATTGTTTATTCCTCAGGC 92 CACCAGACATCTTTCTCACC 94 GTCATGGGATCAGTGGCTTAC 77 GGAGGGGATTCTTGCTCAC 82 TGAAAATAGCCACACATACGG 85 CTCTCCTTCAATAGCTGGCTT 88 AACACATGCCATCACAATGCC 91 GCTTTGTAAAAGCAACTGGGT 93 ACGCATCCAAGTCTGAGTTCC 95 GCATCCGGACAGGCATCCAA 96 GCCATGCGGACCTGCGCTTCT 97 CTGGAGCCCCAGCTTCTCCTG 99 TGATTACGACGCCCTATATAAGGAGG 101 GGCCGTAAAAGCCACAGAG 98 GAGATGAACCAAGTGACCCTG 100 TAGATGCGGGCAGCGAAG 102
EXAMPLE 2
[0181] This examples demonstrates identification of APOBEC3G as an RNA editing enzyme. In Example 1, we describe that A3A concordantly induces widespread site-specific C>U RNA editing of cellular transcripts in proinflammatory macrophages and in monocytes exposed to hypoxia and/or interferons. We also show that RNA editing function of A3A can be recapitulated by transient overexpression in 293T cells which causes site-specific RNA editing of thousands of genes (in revision). In this example, To explore whether A3G is capable of RNA editing, we transiently overexpressed it in 293T cells, performed transcriptome-wide sequencing and analysis and performed targeted experiments. We found that A3G is capable of RNA editing of a distinct set of genes, including some linked to HIV-1 replication as host factors.
[0182] RNA Seq Analysis and Verification
[0183] To examine transcriptome-wide RNA editing events of APOBEC3G, we transfected 1 g of pA3G into 293T cells (293T/A3G) which caused robust protein expression (
[0184] In analyses of RNA sequencing data to identify single-nucleotide sequence variations, significant differences in RNA sequences of the two groups of A3G and control transfectants were identified for 712 genomic positions. At all these positions, the sequence variation was of C>U but not any other type. Average levels of such putative C>U RNA editing were 0 in all the control samples and >5% in all the APOBEC3G transfectant samples for all 712 sites. Average C>U RNA editing levels in the A3G transfectant samples at the 712 sites were between 4% and 51% (mean=11%, SD=7%). Editing level was >20% and >30% for respectively 86 (12%) and 15 (2%) sites (
[0185] 690 (97%) of the 712 sites occur in the known human (RefSeq) transcriptome. Of these 692 sites, 405 (59%) are in known exonic RNA sequences (table X). C>U editing of RNA at the 712 sites is predicted to result in 174 (24%) synonymous, 173 (24%) missense and 48 (7%) nonsense changes in RNA translation (Table 2). Protein recoding RNA editing occurred in 221 sites in 217 genes. The 690 editing sites that are in the known transcriptome are transcribed for a total of 635 genes. The higher number of editing sites (4) was seen for two genes, HCFC1 and IGF2BP1. Two and 48 genes respectively had 3 and 2 editing sites (table X). Correlation between editing and gene expression levels was not observed. Notably, C>U recoding RNA editing at 27 sites in 27 genes was also catalyzed by A3A which causes such recoding of 1,100 genes in the 293T overexpression system. This finding suggests that A3A has a broader target gene profile than A3G and that RNA editing targets of these two enzymes are largely distinct.
[0186] To validate novel RNA editing sites identified by the RNA seq analysis of 293T/A3G cells, we performed Sanger sequencing of 24 new protein recoding C>U RNA editing sites in 24 genes (Table 3). These genes were chosen either because their editing levels were high enough (e.g. SCD, TM7SF3, CLASP1, PRPSAP2) to be informative in site-directed mutagenesis studies (below) or they were previously linked to HIV-1 infectivity (e.g. NMT1, CHMP4B, MPAK1) through functional studies. We validated RNA editing for 24 of 24 by Sanger sequencing in duplicate 293T/A3G transfectants, with possible exception of the ZNF142 editing which was seen only in only one replicate (
[0187] To identify common features of sequence contexts of the editing sites, we examined 12 b-long sequences flanking the edited C residue. The edited C has a C, U, A or G at the immediate 5 position for 613 (87%), 84 (12%), 9 and 6 sites, respectively. This observation and sequence logo analysis (
[0188] We previously noted that Cs edited by APOBEC3A are frequently located at the 3-end of a tetra nucleotide flanked by long inverted repeats, suggesting a stem-loop structure. Here, examination of the Cs edited by APOBEC3G and confirmed by Sanger sequencing also suggests similar stem-loop structure. The Cs edited by APOBEC3G is located commonly at the 3-end of a tetra loop flanked by inverted repeats (median=4) (Table 3).
[0189] Among the six transfectant samples of the study, 18,028 genes were considered as expressed and were analyzed for differential expression. Of the 7,582 (42.1%) genes that were differentially expressed (P<0.05), 61 and 83 were respectively down- and up-regulated with 2 fold-change in the APOBEC3G transfectants compared to controls.
[0190] In Vitro RNA Editing by Purified APOBEC3G
[0191] Transfection experiments that show editing of RNA but not DNA suggest that RNA is a substrate for A3G. To confirm that A3G can edit RNA in vitro, we generated 405 nt RNA sequence spanning nucleotides c.632-c.1036 of KIAA1715 by in vitro transcription and incubated it with APOBEC3G protein purified from overexpressing 293T cells. An 89 nt long ssDNA substrate containing the KIAA1715 cDNA sequence through nucleotides c.68-c.772 was included as a control. KIAA1715 mRNA acquires c.C751U mutation upon transient overexpression of A3G in 293T cells. As expected, APOBEC3G catalyzed c.C751U site-specific deamination in the RNA substrate. None of the other CC or TC sequences shows evidence of deamination by Sanger sequencing. C>T mutations were also not evident in the corresponding c.C751 site in the ssDNA template. Lack of deamination detectable by Sanger sequencing in ssDNA template is expected since A3G deaminates viral cDNA at 1%-1.5% levels which are distributed to multiple Cs {{729 Harris, Reuben S 2003; 730 Feng, Y. 2011;}}. These results suggest that certain sites in RNA are more favorable deamination substrates than ssDNA by A3G, likely owing to certain sequence/structural contexts in RNA.
[0192] A3G Site-Directed Mutagenesis for RNA Editing
[0193] A3G NTD is involved in non-specific RNA binding but not in ssDNA deamination. To examine whether NTD is involved in RNA deamination, we initially created NTD core catalytic site mutant C97S, CTD core catalytic site mutant C291S, NTD critical RNA binding mutants W94A, W127A and C97S/C291S , W94A/W127A double mutants by site directed mutagenesis. Sanger sequencing of 293T/A3G transfectants of the mutants for eight highly edited genes showed that among single site mutants, the most dramatic reduction in RNA editing levels was observed by C97S and C291S mutants. C291S completely abolished RNA editing for all genes. C97S completely abolished RNA editing for MED1, GOLGA5 (C2074T), RFX7, PRPSAP2 and SCD but minimal residual editing was observed for ITFG1, KIAA1715 and TM7SF3. These results suggest that catalytic integrity of both NTD and CTD is essential for RNA editing, but certain RNA targets may be minimally edited even without an active NTD active site. W127A and to a lesser extent W94 mutants are reported to be essential for RNA interaction, oligomerization and virion encapsidation. We find that W127A, but not W94A, mutant impaired RNA editing (
[0194] To further examine role of the NTD conserved catalytic domain residues, we created additional mutants C100S, H65R, E67Q, D128K and P129A. These results show that N-terminal conserved catalytic residues C100, H65R and E67Q are essential for normal RNA editing (
[0195] In Vitro RNA Editing by Purified APOBEC3G
[0196] Transfection experiments that show editing of RNA but not DNA suggest that RNA is a substrate for A3G. To confirm that A3G can edit RNA in vitro, we generated 405 nt RNA sequence spanning nucleotides c.632-c.1036 of KIAA1715 by in vitro transcription and incubated it with APOBEC3G protein purified from overexpressing 293T cells. An 89 nt long ssDNA substrate containing the KIAA1715 cDNA sequence through nucleotides c.68-c.772 was included as a control. KIAA1715 mRNA acquires c.C751U mutation upon transient overexpression of A3G in 293T cells. APOBEC3G catalyzed c.C751U site-specific deamination in the RNA substrate. None of the other CC or TC sequences shows evidence of deamination by Sanger sequencing. C>T mutations were also not evident in the corresponding c.C751 site in the ssDNA template. Lack of deamination detectable by Sanger sequencing in ssDNA template is expected since A3G deaminates viral cDNA at 1%-1.5% levels which are distributed to multiple Cs. These results suggest that certain sites in RNA are more favorable deamination substrates than ssDNA by A3G, likely owing to certain sequence/structural contexts in RNA.
[0197] RNA Editing by APOBEC3G Targets Cellular Genes Involved in HIV-1 Infection
[0198] We noted that some host genes known to be involved in HIV infectivity are targeted for RNA editing. These genes include ACIN1, CHMP4B, SIN3A, subunit genes of mediator complex MED (MED1, MED28), NFAT5, NMT1, RBM14 and MAPK1 MED 1, which encodes a subunit of SP1/mediator complex is implicated in HIV-1 replication in several studies. Other edited genes that belong to cellular pathways important for HIV-1 infectivity (e.g. NF-KB, ESCRT, chromatin modifications) are also noted (Table 4). RNA editing of host genes linked to HIV-1 infectivity by previous functional studies suggests that A3G may alter the host environment to antagonize HIV-1 infection. The antagonistic effect of RNA editing may involve reducing the amount or quality of the accessory host proteins that are critical for HIV-1 life cycle. Alternatively, but not exclusively, RNA editing of host genes might facilitate virion encapsidation of A3G by modifying the intracellular protein trafficking pathways.
TABLE-US-00003 TABLE 2 Gene features and effects on translation codon for APOBEC3G-mediated C < U RNA editing sites.sup.a 5 untranslated region 39 Exonic Synonymous 174 Non-synonymous Nonsense 48 Stop loss 0 Missense 173 Unknown 2 Non-coding RNA 8 3 untranslated region 227 Intronic Coding RNA 12 Non-coding RNA 7 Untranscribed.sup.b 10 Intergenic 12 .sup.aAs reported by the ANNOVAR annotation tool .sup.bWithin 1 kb up- or down-stream respectively of a known transcription start or endsite
TABLE-US-00004 TABLE 3 Sanger validation of selected C > U recoding RNA editing sites identified in 293T/A3G cells RNA Sizes (of loop editing RNA (N . . . C)/ level editing immediately Chromosomal (RNA level flanking Gene.sup.a position.sup.b cDNA and amino acid change.sup.c seq) (Sanger) palindrome .sup.d ACINI 14:23063490 NM_001164816:exon6:c.C676T: 0.22 0.23 4/5 p.Q226X CDC6 17:40291480 NM_001254:exon4:c.C472T: 0.08 0.14 3/6 p.Q158X CHMP4B 20:33850995 NM_176812:exon3:c.C412T: 0.07 0.09 4/5 p.Q138X CLASP1 2:121469844 NM_001142273:exon9:c.C829T: 0.26 0.45 3, 4/2 p.R277W GOLGA5 14:92809464 NM_005113:exon4:c.C937T: 0.09 0.19 4/4 p.Q313X GOLGA5 14:92837408 NM_005113:exon12:c.C2074T: 0.10 0.13 3/3 p.R692X ITFG1 16:47155742 NM_030790:exon18:c.C1816T: 0.16 0.38 3/2 p.R606W KIAA1715 2:175939613 NM_030650:exon10:c.C751T: 0.26 0.34 4/5 p.R251X MAPK1 22:21788373 NM_002745:exon6:c.C740T: 0.13 0.11 4/3 p.P247L MED1 17:39410258 NM_004774:exon17:c.C1963T: 0.27 0.38 4/6 p.Q655X NFAT5 16:69693268 NM_006599:exon12:c.C3389T: 0.12 0.12 4/2 p.S1130L NFRKB 11:129873843 NM_006165:exon20:c.C2527T: 0.07 0.09 7/5 p.Q843X NMT1 17:45061373 NM_021079:exon1:c.C44T: 0.23 0.19 4/6(i + 1) p.P15L NVL 1:224289696 NM_001243146:exon11:c.C796T: 0.06 0.09 4/4 p.Q266X PRPSAP2 17:18928928 NM_001243936:exon9:c.C802T: 0.25 0.35 4/4 p.R268W RBM14 11:66626504 NM_006328:exon3:c.C1846T: 0.22 0.26 4/2 p.R616C RFX7 15:56096472 NM_022841:exon9:c.C1256T: 0.29 0.29 4/3 p.P419L SCD 10:100352431 NM_005063:exon3:c.C376T: 0.24 0.33 4/4 p.R126C SGPL1 10:70854801 NM_003901:exon5:c.C355T: 0.05 0.11 4/4(i + 1) p.Q119X SUCLA2 13:47973266 NM_003850:exon5:c.C661T: 0.13 0.17 4/6 p.Q221X TM7SF3 12:26974149 NM_016551:exon12:c.C1529T: 0.30 0.39 4/2 p.P510L
TABLE-US-00005 TABLE 4 Genes that undergo C > U recoding RNA editing by APOBEC3G regulate cellular pathways involved in HIV-1 infection. Interacts ESCRT with pathway, RNA, DNA HIV Nuclear HIV RNA replication, NF-KB Chromatin RNA/ membrane/ Cyto- Mito- MAPK trafficking modification pathway modifiers proteins pore skeleton chondria Proteasome signaling Golgi ZNF142 MED1, USP34 PAXIP1 ACIN1 LBR PDLIM3 DNM1L PSMD4 LAMTOR3 GOLGA3, MED15, PSMC3 GOLGA5 MED28 CHMP4B PAPOLG TAB1 NFRKB WDR48 NUP205 CLASP1 SUCLA2 MAPK1 MID2 CDC6 UBE2L3 CTCF NSUN5 NUP54 CAMSAP1 RBM14 SETD2 UBE2N SMARCA4 NMT1 (UBC13) VPS37A NFAT5 KMT2A, HSPA5 KMT2C, KMT2D ATRN NEIL3 BAZ1B AP2M1 HUWE1 CHD7, CHD8 SIN3A EIF31 CBX6 SMG6 ARID4A PHF2 ATF7IP JADE1 ASH1L EP300
EXAMPLE 3
[0199] This examples demonstrates that APOBEC3G is involved in RNA editing in natural killer cells and cancer cells and that inhibiting APOBEC3G in cancer cells stops their proliferation. In Example 1, we describe that A3A concordantly induces widespread site-specific C>U RNA editing of cellular transcripts in proinflammatory macrophages and in monocytes exposed to hypoxia and/or interferons. We also show that RNA editing function of A3A can be recapitulated by transient overexpression in 293T cells which causes site-specific RNA editing of thousands of genes (in revision). In example 2 we show that APOBEC3G is an RNA editing exzyme. In this example, we examine whether A3G is involved in RNA editing of immune cells and cancer cells. We demonstrated that A3G is involved in RNA editing in natural killer cells and in lymphoma cells. Inhibition of RNA editing in lymphoma cells stops cancer proliferation.
[0200] Results
[0201] Cell Type Specific Expression of APOBEC3G
[0202] To examine the endogenous RNA editing activity of A3G, we first analyzed A3G's cell type specific expression levels. A meta-analysis of the publicly available microarray datasets (Abbas et al., Genes Immun 2005, 6:319-331) indicated high expression of A3G in gamma delta T cells, NK cells and CD8+ T cells (in that order,
[0203] Identification of RNA Editing by APOBEC3G in NK Cells
[0204] We have previously shown that A3A, which is highly expressed in monocytes and macrophages shows very low or the absence of RNA editing in these cells when freshly isolated from peripheral blood mononuclear cells (PBMCs) (Sharma et al., Nat Commun 2015, 6:6881). However, RNA editing is induced when monocytes/macrophages are cultured at a high cell density and low oxygen (hypoxia, 1% O.sub.2) or by interferons (Sharma et al., Nat Commun 2015, 6:6881; Baysal et al., PeerJ 2013, 1:e152). We cultured PBMCs for 40 hours at a high cell density (510.sup.7 cells in 1.8 ml per well in a 12-well plate) under normoxia or hypoxia and isolated NK cells. Under these conditions, we observed upregulation of the phosphorylated subunit of the eukaryotic initiation factor-2 (eIF-2) at Ser 51-a conserved event activated in response to various cell stresses including hypoxia at 20 h, suggesting that NK cells were stressed (
[0205] RNASeq Analysis of NK Cells
[0206] To determine the transcriptome-wide targets of C>U RNA editing and their respective editing level in NK cells, we performed RNASeq analysis. PBMCs (n=3 donors) were cultured at a high density with/without hypoxia (1% O.sub.2) and site-specific editing of TM7SF3 RNA was first confirmed, which showed higher level of editing in hypoxia relative to normoxia. The three normoxic and three hypoxic NK cells RNA samples were then sequenced by following the TruSeq RNA Exome protocol (see methods). Analysis of the RNASeq results was based on all C>U editing events in exons and UTRs that were (a) at least 5% in any sample, (b) overrepresented in the hypoxia group and (c) located in a putative RNA stem-loop structure (see methods for details).
[0207] RNASeq analysis revealed 122 site-specific C>U editing events which were edited at a higher level in hypoxia as compared to normoxia, although editing also occurred in normoxia at variable levels due to cellular crowding in NK cells. The largest group of editing events comprised of non-synonymous changes, including 52 missense and 10 stop gain changes (
[0208] We identified that 37 of the 122 RNA editing sites in NK cells were among the 712 sites (exons+UTRs) in the 293T/A3G system whereas only 10 edited sites in NK cells were among the 4,171 sites in the 293T/A3A system (p=10.sup.5, Fisher's exact test) indicating that A3G is more likely to catalyze RNA editing in NK cells than A3A (
[0209] We determined the functional clustering of genes that undergo non-synonymous changes (n=62) due to RNA editing in NK cells using DAVID Bioinformatics Resources. The highest enrichment was for genes involved in translation initiation, translation and ribosome (
[0210] We also examined the changes in gene expression that occur during the induction of RNA editing in NK cells due to cellular crowding and hypoxia. We found upregulation of 82 genes and downregulation of 237 genes (fold change>2 and padj<0.005,
[0211] Confirmation of APOBEC3G-Mediated RNA Editing in Lymphoma Cell Lines
[0212] To confirm A3G-mediated RNA editing and to examine the functional consequence of this editing in a cell line, we searched for cell lines that express A3G. We first examined the relative expression of A3G in silico in more than a 1,000 cell lines at the CCLE database. The highest expression of A3G was observed in leukemia and lymphoma cell lines (
[0213] As compared to primary CD4+ T cells, A3G is highly expressed in the HuT78 lymphoma cell line (
[0214] To determine the effect of A3G knock-down on RNA editing, we analyzed the editing level of three RNAs (TM7SF3, EIF3I and RFX7) previously validated as editing targets in NK cells. When cultured at a high density (mentioned above), we found site-specific editing of TM7SF3, EIF3I and RFX7 RNAs in WT HuT78 cells and the level of editing was reduced in the A3G KD HuT78 cells (
[0215] Considering that (1) A3G has a CC nucleotide preference, (2) RNA editing targets in NK cells and in 293T/A3G overexpression system overlap significantly (3) the same RNAs are site-specifically edited in NK and HuT78 cells-both highly expressing A3G; and (4) A3G KD HuT78 cells show decreased RNA editing, these results collectively indicate that A3G is an endogenous, inducible mRNA editing enzyme in NK, CD8+ and HuT78 (and JVM3) cells.
[0216] A3G Induces RNA Editing by Mitochondrial Respiratory Inhibition, Independently of HIF-1
[0217] To determine whether high density of HuT78 cells, which induces RNA editing by A3G, causes hypoxia, we cultured 110.sup.6 HuT78 cells in 100 l per well in 96 well plates (high density) and the same number of cells in 1 ml culture in 6 well plates (low density), each under normoxia and hypoxia. We analyzed the stabilization of the hypoxia-inducible factor-1 (HIF-1) protein, which is well known to be stabilized in hypoxic cells to promote the synthesis of mRNAs involved in cellular homeostasis, and measured the RNA editing levels of TM7SF3. As expected, HIF-1 was not stabilized at T0when the cells were at a non-stressed state or under low density normoxic cell culture (6 well) after 24 hours (
[0218] We tested the effect of inhibitors of mitochondrial complex II by atpenin A5 (AtA5) and of the complex III by myxothiazol (MXT) on RNA editing in HuT78 cells cultured in normoxia. Additionally, to test whether endoplasmic reticulum (ER) stress can also induce RNA editing, we treated the cells with Thapsigargin (Tg). Tg is considered to induce ER stress by raising intracellular calcium levels and lowers the ER calcium levels by specifically inhibiting the endoplasmic reticulum Ca.sup.++ ATPase, resulting in the accumulation of unfolded proteins and an increased accumulation eIF-2 phosphorylated at Ser 51 (
[0219] Although the A3G expression data did not include the NK-92 lymphoma cell line in the CCLE database, given its similar characteristics to primary NK cells and the convenience of culturing NK-92 cells as compared with primary NK cells, we tested the induction of RNA editing in NK-92 cells. We treated NK-92 cells with normoxia with or without the mitochondrial inhibitors (AtA5 or MXT) or hypoxia alone at intermediate density in 24 well plates for 2 days. Interestingly, RNA editing was induced by the inhibition of mitochondrial respiration (25%), but only slightly by hypoxia treatment (
[0220] APOBEC3G promotes Warburg-like metabolic remodeling and suppresses proliferation under stress
[0221] In the current study, we find that A3G non-synonymously edits several mitochondrial genes' RNAs including TUFM, HADHA, HSD17B10 and PHB2 in hypoxic NK cells (
[0222] To test the role of A3G on bioenergetics in response to high cell density and hypoxic stress, we measured the metabolic profile of WT and KD HuT78 cells using the Seahorse platform. We performed the mitochondrial and the glycolytic stress tests to measure the oxygen consumption rate, representative of basal respiration and the extracellular acidification rate, representative of glycolysis in cells cultured at a high density in three separate experiments (
[0223] Hypoxic stress can suppress translation and lead to growth arrest by inhibiting cell cycle progression in non-transformed cells or by promoting apoptosis by the p53 pathway in transformed cells. To examine the role of A3G on cellular proliferation under stress, we measured the proliferation of the WT and KD HuT78 cells when cultured at a high density for 22 hours followed by recovery period by culturing these stressed cells at a low density for another 48 hours. The fraction of viable cells reduced in WT, but increased in A3G-KD HuT78 cells during 22 hours of stress (
[0224] Discussion
[0225] In this study we find that A3G edits scores of RNAs in NK cells and CD8+ T lymphocytes as well as lymphoma cell lines, when cultured at a high density and hypoxia. A3G-mediated site-specific RNA editing is triggered by the inhibition of mitochondrial respiration, and targets the mRNAs of many ribosomal and translational genes resulting in non-synonymous changes. A3G reduces mitochondrial respiration relative to glycolysis, and suppresses cell proliferation under stress in transformed lymphoma cells (
[0226] There are two major differences in A3-mediated RNA editing and ADAR- and APOBEC1-mediated editing. First, A3-mediated RNA editing is induced upon hypoxic stress (A3A and A3G) or by IFNs (A3A), while it is essentially absent or rare in baseline unstressed immune cells (
[0227] We find that the knockdown of A3G in HuT78 lymphoma cells reduces the predicted deleterious RNA editing of EIF3I in association with reduced mitochondrial respiration and cell proliferation during hypoxic stress. Thus, our findings indicate that A3G promotes hypoxic stress responses via RNA editing of EIF3I, ribosomal/translational genes and possibly other stress-related genes.
[0228] Cancer cells switch to aerobic glycolysis even in the presence of a functional mitochondria and this phenomenon is termed the Warburg effect. However, the function of Warburg effect in tumor growth, proliferation and support of cellular biosynthetic programs is still inconclusive. In response to acute hypoxia, A3G-medited RNA editing in the WT cells may promote Warburg effect by preferring glycolysis over mitochondrial respiration and decreased translation, while limiting overall cellular proliferation.
[0229] Interestingly, even though normal B cells and plasma cells show low expression of A3G (
[0230] We also find that RNA editing by A3G can be induced by normoxic inhibition of mitochondrial respiration and occurs independently of HIF-1 stabilization (
[0231] The unexpected discovery of RNA editing functions for A3A and A3G require reconsideration of the physiological functions of the A3 enzymes solely as anti-viral factors. Our findings suggest that the primary function of A3G in vivo may be cellular RNA editing to facilitate adaptation to mitochondrial hypoxic stress in lymphocytes.
[0232] This present disclosure study demonstrates endogenous inducible site-specific RNA editing activity of the A3G cytidine deaminase, and identifies its physiological function in human immune and transformed cells. Widespread RNA editing by A3G can facilitate cellular adaptation to hypoxic cell stress triggered by mitochondrial respiratory inhibition in primary cytotoxic lymphocytes and lymphoma cell lines. A3G is the third endogenous C>U RNA editing enzyme to be identified in mammals. In addition, our study uncovers a novel epitranscriptomic gene regulation mechanism in cytotoxic lymphocytes, specifically NK cells. APOBEC3 cytidine deaminases may define a new class of RNA editing enzymes that are induced in response to certain cell stress factors.
[0233] Methods
[0234] RNA Sequencing
[0235] RNAs (DNA-free) were extracted from NK cells of 3 donors subjected to normoxia and hypoxia treatments (6 samples total) using the Total RNA clean-up and concentration kit (Norgen Biotek) as per the manufacturer's instructions. RNA Libraries were prepared using the Illumina TruSeq RNA Exome protocol and kit reagents. RNA input for intact total RNA was 10 ng. RNA QC analysis by electrophoresis (2100 Expert, B.02.08.51648, Agilent Technologies, Inc.) showed RIN numbers of 9.6, 7.8, 6.4 for normoxic and 2.8, 9.4 and 2 for hypoxic samples. These RIN numbers showed evidence of RNA degradation. Therefore, for degraded RNA samples input amount was determined by calculating the percentage of RNA fragments >200 nt (DV200) by running the samples on an RNA ScreenTape (Agilent Technologies) and performing region analysis using the Tapestation Analysis Software. Based on the DV200 calculation of 52-85%, 40 ng was the input amount and was considered suitable for this protocol. Fragmentation of the RNA was performed on intact samples. First and second strand synthesis were preformed to generate double-stranded cDNA. The 3 ends were adenylated and Illumina adapters were ligated using T-A ligation. PCR was performed to generate enough material for hybridization and capture. PCR products were validated for the correct sizing using D1000 Screentape (Agilent Technologies). 200 ng of each product was pooled together in 4-plex reactions for hybridization and capture. Two sequential rounds of hybridization and capture were performed using the desired Capture Oligo pool. A second round of PCR was done to generate sufficient libraries for sequencing. Final libraries were validated for correct size distribution on a D1000 Screentape, quantified using KAPA Biosystems qPCR kit, and the 4-plex capture pools were pooled together in an equimolar fashion, following experimental design criteria.
[0236] Each pool was denatured and diluted to 2.4 pM with 1% PhiX control library added. Each pool was denatured and diluted to 16 pM for On-Board Cluster Generation and sequencing on a HiSeq2500 sequencer using 100 cycle paired-end cluster kit and rapid mode SBS reagents following the manufacturer's recommended protocol (Illumina Inc.) and 100 million paired reads per sample were obtained.
[0237] RNA Editing Bioinformatics Analysis
[0238] RNA editing events detection: Sequence reads passing quality filter from Illumina RTA were first checked using FastQC and then mapped to GENCODE (gencodegenes.org/) annotation database (V25) and human reference genome (GRCh38.p7) using Tophat2 with a lenient alignment strategy allowing at most 2 mismatches per read to accommodate potential editing events . The mapped bam files were further QCed using RSeqQC. Then all samples were run through the GATK best practices pipeline of SNV calling (https://gatkforums.broadinstitute.org/gatk/discussion/3892/the-gatk-best-practices-for-variant-calling-on-rnaseq-in-full-detail) using RNASeq data to obtain a list of candidate variant sites. All known SNPs from dbSNP (V144) were removed from further analyses.
[0239] Hypoxia induced editing events filtering: Pileups at candidate sites were generated using samtools for all samples and the base counts for alternative and reference base were calculated. Potential candidates for RNA editing were first filtered using the following two criteria: (a) at least 5% editing level on any sample within the population; (b) only C>T and G>A events were selected. The editing base counts were modeled as Binomial distribution and the effect of hypoxia on RNA editing at each site was tested with a generalized linear model (GLM) using paired samples. Multiple test adjustment was applied using Benjamini-Hochberg procedure to control false discovery rate (FDR). Hypoxia induced editing events were identified with log-odds-ratio greater than 0 and adjusted-p value less than 0.05.
[0240] Results: A table specifying the editing site, the type of editing event, editing level and number of reads on a reference and alternative bases on each sample for each group was initially produced filtering events with OR>1 and a FDR<0.05 level.
[0241] Annotation: Hypoxia induced editing events passing filters were annotated using ANNOVAR with RefSeq gene annotation database to identify gene features, protein changes and potential impact. Also 15 base pair upstream and downstream flanks from the variant sites were displayed in separate columns.
Manual filter: The above analyses initially revealed 383 C>U editing sites which were then subjected to a final stringent manual filtering step which retained only those sites (a) in exons and UTRs, (b) with -1 position (relative to edited C) is either a C or T and (c) within a stem-loop structure where the edited C is at the 3-end of a putative tri- or tetra loop which is flanked by a stem that was at least 2 base pair long when base complementarity was perfect, or at least 4 base pair long when complementarity was imperfect by 1 nucleotide mismatch or 1 nucleotide bulging. This stringent manual filter reduced the number of edited sites to 122.
[0242] RNASeq Differential Expression Analysis
[0243] Raw counts for each gene were generated using HTSeq with intersection strict mode. Differential gene expression was analyzed by DESeq2. Bioconductor package with paired sample design to identify hypoxia induced gene expression changes.
[0244] Conservation analysis of amino acids recoded by RNA editing in NK cells The impact of non-synonymous RNA editing on protein function was examined by PolyPhen and SIFT programs from ENSEMBL VEP tool, which give a score and a verbal description of the impact (https://useast.ensembl.org/info/docs/tools/vep/index.html). In addition, conservation score based on 100 vertebrates basewise conservation was obtained from UCSC (phyloP100way).
[0245] Isolation and Culture of Cells
[0246] The HuT78, JVM3 and NK-92 cell-lines were obtained from ATCC. Hut 78 cells were cultured in IMDM (ATCC) containing 20% Fetal Bovine serum (FBS) (Sigma-Aldrich), JVM3 cells were cultured in RPMI (ATCC) containing 10% FBS and NK-92 cells were cultured in Alpha Minimum Essential medium without ribonucleosides and deoxyribonucleosides (Life Technologies) but with 2 mM L-glutamine and 1.5 g/L sodium bicarbonate as well as 0.2 mM inositol, 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid, 500 U/ml IL-2 (Aldesleukina kind gift from Novartis), 12.5% horse serum (ATCC) and 12.5% FBS. Peripheral blood mononuclear cells (PBMCs) of anonymous platelet donors were isolated from peripheral blood in Trima Accel leukoreduction system chambers (Terumo BCT) in accordance with an institutional review board-approved protocol, in RPMI-1640 medium (Mediatech) with 10% FBS, 100 U/ml penicillin and 100 g/m1 streptomycin (Mediatech). NK, CD4+ and CD8+ cells were isolated from PBMCs (cultured at 510.sup.7 in 1.8 ml per well in 12 well plates) by immunomagnetic negative selection using the EasySep Human NK Cell Isolation Kit (Stemcell Technologies, catalog #17955), EasySep Human CD4+ Cell Isolation Kit (Stemcell Technologies, catalog #17952) and EasySep Human CD8+ Cell Isolation Kit (Stemcell Technologies, catalog #17953), respectively, following the manufacturer's instructions. Enrichment for NK cells was >90% (Additional file 1;
[0247] Cell Stress and Inhibitor Treatment
[0248] For cell crowding experiments, the HuT78 cells were cultured at a density of 0.5-110.sup.6 cells per 100 l per well in 96 well plates for 22-24 hours at 37 C.
[0249] For hypoxia treatment, PBMCs were cultured at a density of 510.sup.7 in 1.8 ml per well in 12 well plates under 1% O.sub.2, 5% CO.sub.2 and 94% N.sub.2 in an Xvivo System (Biospherix) for 40 hours. Following culture, NK, CD4+ and CD8+ cells were separated as mentioned above. In case of HuT78, the cells were cultured in the hypoxia chamber for 24 or 40 hours at a density of 110.sup.6 cells per ml in 6 well plates.
[0250] For testing the mitochondrial inhibitors, HuT78 and NK-92 cells were cultured at 0.533 10.sup.6 cells per 0.5 ml in 24 well plates in normoxia with or without AtA5 and MXT or hypoxia alone for 2 days at 37 C.
[0251] Human IFN- was obtained from PeproTech and used at a concentration of 50 ng/ml. AtA5 (Cayman chemical #11898) and MXT (Sigma Aldrich #T5580) was used at a concentration of 1 M.
[0252] Extracellular Flux Assays
[0253] HuT78 cells (scramble WT and KD) were plated in 96-well plates at a density of 0.5 or 110.sup.6 in 100 l per well (total 310.sup.6 cells) and incubated for 22-24 hours at 37 C. The cells were harvested and washed with PBS and re-counted on a hemocytometer (INCYTO C-Chip). Half of the cells were re-suspended in the XF base media specific for the Mitochondrial and the other half in XF base media specific for the Glycolytic Stress Tests (below), respectively. For all extracellular flux assays, cells were plated on cell-tak coated Seahorse XF96 cell culture microplates in (duplicate, triplicate or quadruplicate, depending on the cell count post culture) at a density of 3-610.sup.5 cells per well. The assay plates were spin seeded for 5 minutes at 1,000 rpm and incubated at 37 C. without CO.sub.2 prior to performing the assay on the Seahorse Bioscience XFe96 (Agilent). The Mitochondrial Stress Test was performed in XF Base Media containing 10 mM glucose, 1 mM sodium pyruvate, and 2 mM L-glutamine and the following inhibitors were added at the final concentrations: Oligomycin (2 M), Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) (2 M), Rotenone/Antimycin A (0.5 M each). The Glycolytic Stress Test was performed in XF Base Media containing 2 mM L-glutamine and the following reagents were added at the final concentrations: Glucose (10 mM), Oligomycin (2 M), and 2-deoxy-glycose (50 mM).
[0254] shRNA-Mediated Knock-Down of APOBEC3G in HuT78 Cells
[0255] A3G knock-down in Hut78 cells was performed at the RPCCC gene modulation shared resource. For A3G knock-down, GIPZ human A3G shRNAs with the following Clone ID's were used: V2LHS_80856, V2LHS_80785, V2LHS_80786 (Dharmacon). Lentiviruses were produced by cotransfection of 293T cells with A3G shRNA (or pGIPZ non-silencing control) along with psPAX2 and pMD2.G packaging plasmids, using the LipoD293 reagent (1:2.5 DNA to lipoD293 ratio) (SignaGen Laboratories) as per the manufacturer's instructions. Culture supernatants were collected 48 and 72 hours after transfection and cleared by filtration through 0.45 m cellulose acetate syringe filter. For shRNA expression, 110.sup.6 Hut78 cells were pelleted and re-suspended with 1 ml culture supernatants containing the virus and 1 l of 4 mg/ml polybrene. The cells were placed in 6 well plates and incubated for 30 mins at 37 C. The plate was sealed and spun at 1800 rpm for 45 mins in a microtiter rotor (Beckman Coulter) at room temperature and then incubated for 6 hours at 37 C. After infection the cells were centrifuged at 500 g for 5 mins and resuspended in IMDM media and incubated for 48 hours at 37 C. Puromycin (1 g/ml) was added to the media to select for GFP positive cells. Clone ID V2LHS_80856 cells did not proliferate. Clone IDs V2LHS_80785 and V2LHS_80786 HuT78 cells were further sorted by the BD FACSaria II cell sorter (BD Biosciences) to obtain >95% pure GFP positive cells. A3G knock-down was verified by measuring the expression of A3G by qPCR. While Clone ID V2LHS_80785 did not show any difference in A3G gene expression in the WT and KD cells, clone ID V2LHS_80786 showed a significant reduction in A3G expression and was henceforth used for our studies (KD HuT78 cells) (
[0256] RT-PCR and Sanger Sequencing
Total RNA was isolated and reverse transcribed to generate cDNAs. DNA primers used for PCR were obtained from Integrated DNA Technologies and are noted in Table 6. Primers used for PCR of cDNA templates were designed such that the amplicons spanned multiple exons. Agarose gel electrophoresis of PCR products was performed to confirm the generation of a single product in a PCR and then sequenced on the 3130 xL Genetic Analyzer (Life Technologies) at the RPCCC genomic core facility as described previously (Sharma et al., Sci Rep 2016, 6:39100). To quantify RNA editing level, the major and minor chromatogram peak heights at putative edited nucleotides were quantified with Sequencher 5.0/5.1 software (Gene Codes, MI). Since the software identifies a minor peak only if its height is at least 5% that of the major peak's, we have considered 0.048 [=5/(100+5)] as the detection threshold. For quantitative PCR to assess APOBEC3G and APOBEC3F gene expression, reactions using LightCycler 480 Probes Master and SYBR Green I dye were performed on a LightCycler 480 System (Roche). Quantification cycle (C.sub.q) values were calculated by the instrument software using the maximum second derivative method, and the mean C.sub.q value of duplicate PCR reactions was used for analysis.
[0257] Immunoblotting Assays of Cell Lysates
[0258] Whole cell lysates were prepared and immunoblot was performed as described previously (Sharma et al., Nat Commun 2015, 6:6881; Sharma et al., Hum Mol Genet 2017, 26:1328-1339). APOBEC3G antiserum (Apo C17, catalog number-10082) was obtained from the NIH AIDS Reagent program (Kao et al., Retrovirology 2004, 1:27; Khan et al., J Virol 2005, 79:5870-5874), Rabbit monoclonal Phospho-eIF-2 (Ser51) (product number-3398, DG98) was obtained from Cell Signaling Technology, mouse monoclonal anti--actin (product number AM4302, AC-15) was obtained from Life Technologies, mouse monoclonal anti-HIF1 (product number GTX628480, GT10211) and rabbit polyclonal anti--Tubulin (product number GTX110432) was obtained from GeneTex and used at dilutions recommended by their manufacturers in 5% milk, except Phospho-eiF-2, which was diluted in 5% BSA. HRP-conjugated goat anti-mouse or anti-rabbit antibodies were purchased from Life Technologies and used at 1:2000 dilution followed by chemiluminescent detection of the proteins.
[0259] Cell Proliferation Assay
[0260] WT and KD HuT78 cells (110.sup.6 cells in 100 l per well) were seeded in 96-well round-bottom plates and incubated covered in the culture medium for 22 hours in a 37 C. humidified hypoxia chamber (1% O.sub.2) or 37 C. humidified culture chamber (21% O.sub.2). Cell viability was determined using a WST-8 viability stain based colorimetric assay (Dojindo Molecular Technologies, Inc.). Plates were read at 450 nm on an Epoch2 microplate reader (Biotek) using the Gen5 software (Biotek).
[0261] Statistical Analysis
[0262] Statistical analysis was performed using GraphPad Prism (7.03). A3G expression levels and mean editing levels in different cell types (
[0263] Others
[0264] Gene expression analysis of A3G is performed on two online platforms: (1) BIOGPS at biogps.org/#goto=welcome, a collection of thousands of gene expression datasets and (2) Cancer Cell Line Encyclopedia (CCLE) portal at portals.broadinstitute.org/ccle. CCLE database contains 1457 cell lines. Weblogo is created at weblogo.berkeley.edu/(2/19/18) with default parameters.
TABLE-US-00006 TABLE 5 Conservation of amino acids recoded by A3G-mediated RNA editing in translational and ribosomal genes Mutation Gene AAChange PolyPhen SIFT PhyloP 1:32231146-CT EIF3I NM_003757:exon11:c.C928T:p.R310C Possibly damaging deleterious(0) 2.64453 (0.901) 15:55196824-GA RSL24D1 NM_016304:exon1:c.C67T:p.R23C Benign Deleterious 3.43396 (0.011) (0.02) 6:35470271-CT RPL10A NM_007104:exon5:c.C403T:p.P135S possibly_damaging Deleterious 7.64955 (0.866) (0.01) 19:17863201-CT RPL18A NM_000980:exon5:c.C469T:p.R157W Benign Deleterious 3.41186 (0.12) (0.03) 17:28720820-CT RPL23A NM_000984:exon2:c.C139T:p.R47W Benign Tolerated 1.92739 (0.013) (0.28) 19:39433341-GA RPS16 NM_001020:exon5:c.C373T:p.R125C possibly_damaging Deleterious 7.59689 (0.901) (0.03) 16:1962610-GA RPS2 NM_002952:exon6:c.C596T:p.P199L possibly_damaging Deleterious 9.862 (0.905) (0.03) 1:39561754-GA PABPC4 NM_001135653:exon15:c.C1927T:p.H643Y Benign Deleterious 10.003 (0.063) (0.02)
TABLE-US-00007 TABLE6 RT-PCR CDNA GDNA primers* Forward Reverse SIZE SIZE Gene (5-to-3) (5-to-3) (bp)# (bp)# EIF3I ATGAGAGTGGA GTGGTGGGATT 536 4099 GAGCTCAACC ACAGGCATGA (SEQID (SEQID NO:103) NO:104) FAM89B TCAACCTCGAC GATGTGGAAGG 321 713 TCAGCGCTG CATCCTGCA (SEQID (SEQID NO:105) NO:106) GOLGA5 TCCAAAGATCC CTCCTGCTCTC 353 3423 AAAGAGACTCA TCTTCAGAGTG AG(SEQID (SEQID NO:107) NO:108) HSD17B10 CAGCGTGTCGG AGTCGGCTAGG 564, 2829 AGCGTGAAG GAAGGGCACT 646, (SEQID (SEQID 673 NO:109) NO:110) RFX7 GCAATGGAGTG TTGGAGAGCGA 330 1790 ACTAATCTTCC ATGGTGAGTG T(SEQID (SEQID NO:111) NO:112) RPL10A TTTCCGGTTAG AAGGCCCGGAC 638, 636, CGCGGCGTGAG ATTCTGC 991 2300 AAGC(SEQID (SEQID NO:113) NO:114) RPS2 CGTCACCAAGT GGGCTGAGGTG 736 2334 TGGGCCGCTT TAGCAGTCATC (SEQID (SEQID NO:115) NO:116) TM7SF3 GACAGTTACTG CTAGGGTCCAG 263 1531 GTCCACAAGC AATGTTTGTCA (SEQID C(SEQID NO:117) NO:118) TUFM GGTCGGGACCC ATGGCCAGCGT 650 1543 TGAGTTAGG GTTGGTGACT (SEQID (SEQID NO:119) NO:120 APOBEC3G GGCCGAGGACC TTCTGACACAG 99 CGAAGG GCTGCGAAG (SEQID (SEQID NO:121) NO:122) APOBEC3F TGCCTTGGTAC AGTGGAAGTAG 108 AAATTCGATG AATATGTGTGG AC(SEQID ATAC(SEQID NO:123) NO:124) B2- CTCGCTCCGTG TGGATGAAACC 152 Micro GCCTTAGCT CAGACACATAG glubin (SEQID CA(SEQID NO:125) NO:126) *underlined primers were used for sequencing
[0265] While the invention has been described through certain embodiments, routine modifications to the disclosure will be apparent to those skilled in the art, and such modifications are intended to be within the scope of the disclosure.