INCREASE OF GINSENOSIDE PRODUCTION BY IMPROVEMENT OF NADPH-RELATED BIOSYNTHETIC PATHWAY IN YEAST
20190352649 ยท 2019-11-21
Inventors
- Sun-Chang Kim (Daejeon, KR)
- Ju Young Lee (Gyeonggi-do, KR)
- Jae Eung Kim (Gyeongsangbuk-do, KR)
- In Seung Jang (Busan, KR)
- Jong Geon Jegal (Ulsan, KR)
Cpc classification
International classification
Abstract
The present invention relates to yeast with an enhanced ginsenoside-producing ability prepared by changing Ald2, Ald6, Zwf1, and Zms1, a method of preparing the yeast, and a method for producing ginsenosides using the yeast.
Claims
1. Yeast for producing ginsenosides, wherein the expression levels of NADPH biosynthesis-related genes are changed compared to their endogenous expression levels.
2. The yeast of claim 1, wherein the NADPH biosynthesis-related genes are one or more genes selected from the group consisting of Ald2, Ald6, Zwf1, and Zms1.
3. The yeast of claim 2, wherein the expression level of Ald2 is decreased compared to its endogenous expression level and the expression level of Ald6 is increased compared to its endogenous expression level.
4. The yeast of claim 3, wherein the expression level of Zwf1 is further decreased compared to its endogenous expression level.
5. The yeast of claim 3, wherein the expression level of Zms1 is further increased compared to its endogenous expression level.
6. The yeast of claim 1, wherein the NADPH-producing ability is increased compared to its endogenous level.
7. The yeast of claim 1, wherein the expression levels of ginsenoside synthesis-related genes are further increased compared to their endogenous expression levels.
8. The yeast of claim 7, wherein the genes are one or more selected from the group consisting of PgDDS (Panax ginseng, dammarenediol-II synthase), PgPPDS (Panax ginseng cytochrome P450 CYP716A47), PgCPR (Panax ginseng, NADPH-cytochrome P450 reductase), tHMG1 (S. cerevisiae HMG-CoA reductase), and PgSE (Panax ginseng, squalene epoxidase).
9. A method for preparing recombinant yeast with an enhanced ginsenoside-producing ability, comprising changing the expression levels of the NADPH biosynthesis-related genes compared to their endogenous expression levels.
10. The method of claim 9, wherein the NADPH biosynthesis-related genes are one or more genes selected from the group consisting of Ald2, Ald6, Zwf1, and Zms1.
11. The method of claim 9, wherein the expression level of Ald2 is decreased compared to its endogenous expression level and the expression level of Ald6 is increased compared to its endogenous expression level.
12. The method of claim 11, wherein the expression level of Zwf1 is further decreased compared to its endogenous expression level.
13. The method of claim 11, wherein the expression level of Zms1 is further increased compared to its endogenous expression level.
14. The method of claim 9, wherein the expression levels of one or more genes selected from the group consisting of PgDDS (Panax ginseng, dammarenediol-II synthase), PgPPDS (Panax ginseng cytochrome P450 CYP716A47), PgCPR (Panax ginseng, NADPH-cytochrome P450 reductase), tHMG1 (S. cerevisiae HMG-CoA reductase), and PgSE (Panax ginseng, squalene epoxidase) are increased compared to their endogenous expression levels.
15. A method for producing ginsenosides, comprising: (a) culturing the yeast of claim 1 in a medium; and (b) recovering ginsenosides from the yeast or the medium.
16. A method for producing ginsenosides, comprising: (a) culturing the yeast of claim 2 in a medium; and (b) recovering ginsenosides from the yeast or the medium.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
DETAILED DESCRIPTION OF THE INVENTION
[0086] Hereinafter, the present invention will be described in more detail with reference to the following Examples and Experimental Examples. However, these Examples and Experimental Examples are for illustrative purposes only and the scope of the invention is not limited by these Examples and Experimental Examples.
EXAMPLE 1
Preparation of PPD Modified Yeast Strain
[0087] A protopanaxadiol (PPD)-producing yeast strain of the present invention was prepared by i) introducing a ginsenoside biosynthesis metabolic pathway into Saccharomyces cerevisiae (S. cerevisiae) CEN.PK2-1D wild-type strain [(MAT ura3-52; trp1-289; leu2-3,112; his3 1; MAL2-8; SUC2) and ii) enhancing the mevalonic acid metabolic pathway, which increases biosynthesis of squalene (i.e., an essential precursor for ginsenoside biosynthesis) of the strain, and the prepared strain was named as PPD modified yeast strain(PPD strain).
[0088] The genotype of the PPD strain is S. cerevisiae CEN.PK2-1D trp1::P.sub.GPD1 tHMG1+P.sub.GPDI PgSE+leu2::P.sub.GPD1 PgDDS+P.sub.GPDI PgPPDS+P.sub.GPDI PgCPR.
[0089] Genes, which encode ginsenoside biosynthesis enzymes, i.e. Panax ginseng dammarenediol-II synthase (PgDDS, SEQ ID NO: 5), Panax ginseng cytochrome P450 CYP716A47 (PgPPDS, SEQ ID NO: 6), and Panax ginseng NADPH-cytochrome P450 reductase (PgCPR, SEQ ID NO: 7); and metabolic pathway enzymes for enhancing the mevalonic acid metabolic pathway tHMG1(S.cerevisiae HMG-CoA reductase, SEQ ID NO: 8) and Panax ginseng squalene epoxidase, (PgSE, SEQ ID NO: 9), were each transcribed from GPD1(TDH3), a constitutive high-expression promoter, and expressed.
Example 2
Preparation of Modified Strains Related to NADPH Biosynthetic Pathway
2-1: Preparation of Strain Where Ald2 Gene or Gdh1 Gene is Inactivated
[0090] To examine whether the inactivation of the Ald2 gene or Gdh1 gene, which are genes related to NADPH biosynthesis or consumption pathway, in the PPD modified yeast strain may be involved in the growth of the above yeast strain and PPD-producing ability, modified yeast strains where the Ald2 gene or Gdh1 gene was inactivated were prepared.
[0091] To inactivate the Ald2 gene on the genome, a cassette that inactivates the Ald2 gene was prepared by performing PCR using the previously prepared pUC57-URA3Myc vector (Ju Young Lee et al., (2015) Biotechnol. Bioeng., 112, 751-758.) as a template (
[0092] The inactivity of the Ald2 gene in the obtained strain was confirmed by performing PCR using the genomic DNA of the above cells as a template and a primer set of Ald2_conf_F and Ald2_conf_R, and the strain was named as CEN.PK2-1D, ald2. In the same manner, a Gdh1 inactivation cassette was prepared using a primer set of Del_Gdh1_F and Del_Gdh1_R, and the inactivity of the Gdh1 gene was confirmed using a primer set of Gdh1_conf_F and Gdh1_conf_R primers, and the strain was named as a CEN.PK2-1D, Gdh1. The primers used above are shown in Table 1 below.
TABLE-US-00001 TABLE1 SEQ ID Name PrimerSequence(5.fwdarw.3) NO Del_Ald2_F TTACATTGCATGTCCATCAAAAACAAT 10 CGTGAAAATAAGCCAAAAGAAAACCAG TCACGACGTTGTAAAA Del_Ald2_R CTGCAACATCCCACTCCTTCTTTGCAG 11 TTTCTTTAAACTTTTCAACAAACAGGT TTCCCGACTGGAAAGC Ald2_conf_F TTACATTGCATGTCCATCAAAAACA 12 Ald2_conf_R CTGCAACATCCCACTCCTTC 13 Del_Gdh1_F ACTATCGCATTATTCTAATATAACAGT 14 TAGGAGACCAAAAAGAAAAAGAACCAG TCACGACGTTGTAAAA Del_Gdh1_R GACGGCAATAGCTTCTGGAGTGGAACC 15 CATGTTGGAACCTTCGGCAATAAAGGT TTCCCGACTGGAAAGC Gdh1_conf_F CAGTTAGGAGACCAAAAAGAAAAAGAA 16 Gdh1_conf_R GACGGCAATAGCTTCTGGAG 17
2-2: Preparation of Strain Overexpressing Gnd1, Gdh2, Ald6, Zwf1, or Stb5
[0093] For the overexpression of the Gnd1 gene, the Gnd1 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Gnd1_F and Gnd1_R, and the amplified products were digested with EcoRI and XhoI, and ligated to the p416_GPD vector (
[0094] For the overexpression of the Gdh2 gene, the Gdh2 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Gdh2_F and Gdh2_R, and the amplified products were digested with XbaI and SmaI, and ligated to the p416_GPD vector, which was also digested with XbaI and SmaI, and thereby the p416_GPD_Gdh2 vector was prepared.
[0095] For the overexpression of the Ald6 gene, the Ald6 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Ald6_F and Ald6_R, and the amplified products were digested with BamHI and XhoI, and ligated to the p416_GPD vector, which was also digested with BamHI and XhoI, and thereby the p416_GPD_Ald vector was prepared.
[0096] For the overexpression of the Zwf1 gene, the Zwf1 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Zwf1_F and Zwf1_R, and the amplified products were digested with EcoRI and XhoI, and ligated to the p416_GPD vector, which was also digested with EcoRI and XhoI, and thereby the p416_GPD_Zwf1 vector was prepared.
[0097] For the overexpression of the Stb5 gene, the Stb5 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Stb5_F and Stb5_R, and the amplified products were digested with EcoRI and SalI, and ligated to the p416_GPD vector, which was also digested with EcoRI and SalI, and thereby the p416_GPD_Stb5 vector was prepared.
[0098] The primers used above are shown in Table 2 below.
TABLE-US-00002 TABLE2 SEQ ID Name PrimerSequence(5.fwdarw.3) NO Gnd1_F GGAATTCATGTCTGCTGATTTCGGTTT 19 Gnd1_R CCGCTCGAGTTAAGCTTGGTATGTAGAGGAAGAA 20 Gdh2_F GCTCTAGAATGCTTTTTGATAACAAAAATCGCGG 21 Gdh2_R TCCCCCGGGTCAAGCACTTGCCTCCGCTT 22 Ald6_F CGGGATCCATGACTAAGCTACACTTTGACACTGC 23 Ald6_R CCGCTCGAGTTACAACTTAATTCTGACAGCTTTT 24 ACTTCAG Zwfl_F GGAATTCATGAGTGAAGGCCCCGTCAA 25 Zwfl_R CCGCTCGAGCTAATTATCCTTCGTATCTTCTGGC 26 Stb5_F GGAATTCATGGATGGTCCCAATTTTGCAC 27 Stb5_R ACGCGTCGACTCATACAAGTTTATCAACCCAAGA 28 GACG
[0099] For the overexpression of the Gnd1 gene, Gdh2 gene, Ald6 gene, Zwf1 gene, or Stb5 gene, the p416_GPD_Gnd1 vector, p416_GPD_Gdh2 vector, p416_GPD_Ald6 vector, p416_GPD Zwf1 vector, or p416_GPD_Stb5 vector prepared above was transformed into each wild-type yeast strain of S. cerevisiae CEN.PK2-1D, respectively. The transformation was performed by conventional heat shock transformation, and the cells were cultured in a uracil drop-out medium so that only those strains where a vector containing a particular gene to be a subject for overexpression and URA3 were able to grow.
[0100] As a result, the prepared strains were named as CEN.PK2-1D+Gnd1, CEN.PK2-1D+Gdh2, CEN.PK2-1D+Ald6, CEN.PK2-1D+Zwf1, and CEN.PK2-1D+Stb5, respectively.
2-3: Preparation of Strains Where Ald2 is Inactivated and Ald6 is Overexpressed, and Strains where Gdh1 is Inactivated and Gdh2 is Overexpressed
[0101] For the inactivation of the Ald2 gene and overexpression of the Ald6 gene, the Ald6 gene was amplified from the genomic DNA of S. cerevisiae CEN.PK2-1D by performing PCR using a primer set of Ald6 F and Ald6 R (Table 2) and the amplified products were digested with BamHI and XhoI, and ligated to the pUC57GPD-URA3Myc vector (Ju Young Lee et al., (2015) Biotechnol. Bioeng., 112, 751 to 758), which was also digested with BamHI and XhoI, and thereby the pUC57GPD-URA3Myc_Ald6 vector was prepared (
[0102] For the inactivation of the Gdh1 gene and overexpression of Gdh2 gene, the pUC57GPD-URA3Myc_Gdh2 vector was prepared in the same manner as in Example 2-2 by performing PCR using the primer set Gdh2_F and Gdh2_R (Table 2) and ligation by digestion with XbaI and SmaI. Furthermore, for the inactivation of the Gdh1 gene and overexpression of Gdh2 gene, a cassette that substitutes the Gdh1 gene with the Gdh2 gene was prepared by performing PCR using the above-prepared pUC57GPD-URA3Myc_Gdh2 vector as a template and Del_Gdh1_F and Del_Gdh1_R, the homologous recombinant sequences of Gdh1 gene region on the genome, as primers.
[0103] The prepared cassette was transformed into the cells of each wild-type yeast strain of S. cerevisiae CEN.PK2-1D. The transformation was performed by conventional heat shock transformation. After the transformation, the cells were cultured in a uracil drop-out medium so that the Ald2 gene or Gdh1 gene on the genome was able to be substituted with the cassette containing URA3.
[0104] The substitution of the Ald2 gene with Ald6 gene and the substitution of Gdh1 gene with Gdh2 gene in the strain were confirmed by performing PCR using the genomic DNA of the above cells as a template and a primer set of Ald2_conf_F and Ald2_conf_R and a primer set of Gdh1_conf_F and Gdh1_conf_R, respectively.
[0105] As a result, the prepared strains were named as CEN.PK2-1D,ald2::ald6 and CEN.PK2-1D,Gdh1::Gdh2, respectively.
EXAMPLE 3
Confirmation of Amount of NADPH Production in Wild-Type Yeast and Transformed Yeast
[0106] A wild-type yeast strain, S. cerevisiae CEN.PK2-1D, and transformed yeast strains therefrom were inoculated into 50 mL of minimal uracil drop-out media containing 2% glucose such that the absorbance at OD.sub.600 became 0.5, and cultured while stirring at 30 C. at a rate of 250 rpm under aerobic conditions for 24 hours.
[0107] At the time of terminating the culture, the amount of nicotinamide adenine dinucleotide phosphate (NAPDH) in the cell was analyzed using the EnzyChrom NADP.sup.+/NADPH assay kit (ECNP-100). The accompanying procedures of the analysis method were adjusted to be suitable for the experimental conditions as follows.
[0108] Specifically, the cell culture containing 10 OD (about 810.sup.9 cells) based on the OD.sub.600 measurement using a spectrophotometer was separated by a centrifuge, the supernatant was discarded, and the cells in the form of a pellet were collected, washed with a cold PBS buffer, and mixed with an NADPH extraction buffer. The resultant was heated at 60 C. for 5 minutes, and an assay buffer (20 L) and an NADPH extraction buffer (100 L) were added thereto and mixed well. The mixed solution was centrifuged at 14,000 rpm for 5 minutes using a centrifuge, and the sample values set at 565 nm were measured using only the supernatant by a spectrophotometer. The measured values were substituted into a calibration curve and the concentration values of NADPH were obtained. The concentration values of NADPH after 24 hours of culture are shown in
[0109] Specifically, as shown in
EXAMPLE 4
Confirmation of Growth and Amount of PPD Production of Transformed Modified Strains
[0110] The strains where the cellular concentration of NADH was increased compared to that of the control group were selected in Example 3, and the effects of the genes from these strains, which affect the NADPH biosynthetic pathway, on the growth of PPD yeast cells and their PPD production were examined.
4-1: Preparation of Strains Where Zwf1 or Stb5 is Overexpressed in PPD Yeast Cells
[0111] First, the Zwf1 gene and Stb5 gene were introduced into PPD yeast cells and overexpressed therein, and the effect of the overexpression of these genes on the growth of PPD yeast cells and their PPD production were examined.
[0112] Specifically, for overexpression of the Zwf1 gene or Stb5 gene in PPD yeast cells, and the p416_GPD_Zwf1 vector and the p416_GPD_Stb5 vector prepared in Example 1 were introduced into the PPD yeast strain, respectively. The transformation was performed by conventional heat shock transformation, and the cells were cultured in a uracil drop-out medium so that only those strains where the p416_GPD_Zwf1 vector or the p416_GPD_Stb5 vector containing URA3 was introduced were able to grow.
[0113] As a result, the prepared strains were named as PPD, p416_GPD_Zwf1 and PPD, p416_GPD_Stb5, respectively.
4-2: Preparation of Yeast Strains Where Ald2 is Inactivated and Ald6 is Overexpressed, and Strains Where Gdh1 is Inactivated and Gdh2 is Overexpressed in PPD Yeast Cells
[0114] In PPD yeast cells, the expression of the Ald2 gene was inhibited by substituting it with Ald6 gene while simultaneously overexpressing the Ald6 gene under the strong GPD promoter, and the effect of the overexpression of the Ald6 gene on the growth of PPD yeast cells and PPD production were examined. In the same manner, Gdh1 gene was inhibited by substituting it with Gdh2 gene and then the Gdh2 gene was overexpressed, and the effect of the overexpression of the Gdh2 gene on the growth of PPD yeast cells and PPD production were examined.
[0115] Specifically, for the inactivation of the Ald2 gene and overexpression ofAld6 gene, and the inactivation of the Gdh1 gene and overexpression of the Gdh2 gene in PPD yeast cells, a DNA cassette for homologous recombination was obtained in the same manner as described above, using pUC57GPD-URA3Myc_Ald6 and pUC57GPD-URA3Myc_Gdh2. The prepared cassette was introduced into each PPD yeast strain. The transformation was performed by conventional heat shock transformation. After the transformation, the cells were cultured in a uracil drop-out medium so that only the Ald2 gene or Gdh1 gene on the genome was able to be substituted with the cassette containing URA3. The substitution of the Ald2 gene with Ald6 gene and the substitution of Gdh1 gene with Gdh2 gene in the obtained strains was confirmed by performing PCR using the genomic DNA of the above cells as a template and a primer set of Ald2_conf_F and Ald2_conf_R and a primer set of Gdh1_conf_F and Gdh1_conf_R, respectively.
[0116] As a result, the prepared strains were named as PPD,ald2::ald6 and PPD,Gdh1::Gdh2, respectively.
4-3: Preparation of Strains Where Zwf1 is Inactivated in PPD Yeast Cells
[0117] In the strains prepared in Example 4-2, the Zwf1 gene was further inactivated so as to control the PP pathway, and the effect of the detoured carbon-flux due to the inactivation of the Zwf1 gene on the growth of PPD yeast cells and their PPD production were examined.
[0118] Specifically, a cassette that inactivates the Zwf1 gene was obtained by performing PCR using the pUC57-URA3Myc vector (Ju Young Lee et al., (2015) Biotechnol. Bioeng., 112, 751 to 758) prepared above as a template and Del_Zwf1_F and Del_Zwf1_R, the homologous recombinant sequences of Zwf1 gene region on the genome, as primers. The prepared inactivation cassette was transformed into the yeast strain of PPD,ald2::ald6. The transformation was performed by conventional heat shock transformation. After the transformation, the cells were cultured in a uracil drop-out medium so that the Zwf1 gene on the genome was able to be substituted with the cassette containing URA3.
[0119] The inactivity of the Zwf1 gene in the obtained strain was confirmed by performing PCR using the genomic DNA of the above cells as a template and a primer set of Zwf1_conf_F and Zwf1_conf_R, and the strain was named as PPD,ald2::a1d6,zwf1. The primers used above are shown in Table 3 below.
TABLE-US-00003 TABLE3 SEQ ID Name PrimerSequence(5.fwdarw.3) NO Del_Zwfl_F TATAGACAGAAAGAGTAAATCCAATAGAAT 34 AGAAAACCACATAAGGCAAGCCAGTCACGA CGTTGTAAAA Del_Zwfl_R CCTCCCAACGCTCGTTTTCGATGTTGAAAG 35 TCATTGCTGCAAAAGTGACAAGGTTTCCCG ACTGGAAAGC Zwfl_conf_F AGAATAGAAAACCACATAAGGCAAG 36 Zwfl_conf_R CCTCCCAACGCTCGTTTTCG 37
4-4: Preparation of Vector for Overexpression of Zms1 in PPD Yeast Cells
[0120] Additionally, in the strains prepared in Example 4-2, Zms1 gene was overexpressed and the effects of the overexpression of the Zms1 gene on the growth of PPD yeast cells and PPD production were examined.
[0121] Specifically, for the overexpression of the Zms1 gene, the Zms1 gene was amplified by performing PCR using the genomic DNA of S. cerevisiae CEN.PK2-1D and a primer set of Zms1_F and Zms1_R. The amplified PCR products were digested with XmaI and XhoI and then ligated to the p416_GPD vector, which was also digested with XmaI and XhoI, and thereby the p416_GPD_Zms1 vector was prepared. The primers used above are shown in Table 4 below.
TABLE-US-00004 TABLE4 SEQ ID Name PrimerSequence(5.fwdarw.3) NO Zms1_F TAGTGGATCCCCCGGGATGTTTGTGAACGGT 38 AATCAATCTAATTTC Zms1_R AATTACATGACTCGAGTTATATTCTAGTGTT 39 TCTTTTTTTCGTAAC
[0122] For the overexpression of the Zms1 gene, the p416_GPD_Zms1 vector prepared above was introduced into each of the PPD yeast strain and the PPD,ald2::ald6 strain. The transformation was performed by conventional heat shock transformation, and the cells were cultured in a uracil drop-out medium so that only those strains where the p416_GPD_Zms1 vector containing URA3 introduced were able to grow.
[0123] As a result, the prepared strains were named as PPD,p416_GPD_Zms1 and PPD,ald2::ald6,p416_GPD_Zms1, respectively.
EXAMPLE 5
Confirmation of Growth of Transformed Yeast Strains and Their PPD Production
[0124] The transformed yeast strains prepared above were inoculated into 50 mL of minimal URA drop-out media containing 2% glucose such that the absorbance at OD.sub.600 became 0.5, and cultured while stirring at 30 C. at a rate of 250 rpm under aerobic conditions for 144 hours. The OD.sub.600 values of the cells during the culture were measured using a spectrophotometer. The intracellular metabolites (i.e., squalene, 2,3-oxidosqualene, and protopanaxadiol) were analyzed by high performance liquid chromatography (HPLC).
[0125] As a result, the cell growth (i.e., the OD.sub.600 values of the cell culture) and the concentration of each intracellular metabolite are shown in the following Table 5, and
TABLE-US-00005 TABLE 5 Concentration of metabolites according to cultivation of transformed modified yeast strains OD.sub.600 Protopanaxadiol (mg/L) 72 h 144 h 72 h 144 h Control 26.75 24.62 0 1.52 +Zwf1 26.03 22.91 0.03 0.51 +STB5 19.70 20.80 1.09 0.64 Ald2 + Ald6 13.19 11.88 1.58 6.01 Gdh1 + Gdh2 24.82 24.08 0 0.40
[0126] Specifically, referring to the results of
[0127] From the above results, it was confirmed that when the expression levels of NADPH biosynthesis-related proteins (Ald2, Ald6, Zwf1, and Zms1) were changed compared to their endogenous expression levels, the amount of the protopanaxadiol production was significantly increased.
[0128] From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.