TUMOR-TARGETING SALMONELLA GALLINARUM STRAIN AND USE THEREOF
20240108664 ยท 2024-04-04
Inventors
- Hyon El CHOY (Gwangju, KR)
- Jae Ho JEONG (Gwangju, KR)
- Dae Jin LIM (Gwangju, KR)
- Hyung Ju LIM (Gwangju, KR)
- Kwangsoo KIM (Gwangju, KR)
Cpc classification
C12Y301/07002
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
A61K49/0097
HUMAN NECESSITIES
C12Y102/0105
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/74
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The present invention relates to a tumor-targeting Salmonella gallinarum strain and the use thereof. The tumor-targeting Salmonella gallinarum strain has excellent tumor proliferation inhibitory activity and enables tumor-specific targeting, and thus can be utilized for treatment and imaging of tumors without any side effects.
Claims
1. An attenuated Salmonella gallinarum strain, lacking guanosine tetraphosphate (ppGpp) production capability.
2. The attenuated Salmonella gallinarum strain of claim 1, wherein the strain is derived by deleting guanosine tetraphosphate production capability from Salmonella gallinarum SG4021 (microorganism accession number: KCTC13985BP).
3. The attenuated Salmonella gallinarum strain of claim 1, wherein the strain is Salmonella gallinarum SG4023 (microorganism accession number: KCTC14338BP).
4. The attenuated Salmonella gallinarum strain of claim 1, wherein the strain lacks a gene coding for a ppGpp synthetase.
5. The attenuated Salmonella gallinarum strain of claim 4, wherein the gene includes relA and spoT.
6. The attenuated Salmonella gallinarum strain of claim 1, wherein the strain lacks a glmS gene.
7. The attenuated Salmonella gallinarum strain of claim 6, wherein the strain is Salmonella gallinarum SG4031 (microorganism accession number: KCTC14339BP).
8. The attenuated Salmonella gallinarum strain of claim 6, wherein the strain is transformed with a plasmid comprising the glmS gene operatively linked to a promoter.
9. The attenuated Salmonella gallinarum strain of claim 8, wherein the plasmid further comprises a luminescence gene.
10. The attenuated Salmonella gallinarum strain of claim 9, wherein the luminescence gene is luxCDABE.
11. A pharmaceutical composition for prevention or treatment of a tumor, the composition comprising the strain of claim 1.
12. The pharmaceutical composition of claim 11, wherein the tumor is a solid cancer.
13. The pharmaceutical composition of claim 11, wherein the tumor is adenocarcinoma.
14. The pharmaceutical composition of claim 11, wherein the tumor is a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, skin cancer, and breast cancer.
15. A method for providing information about tumor analysis, the method comprising the steps of: administering the Salmonella gallinarum strain to a subject; detecting bioluminescence of the strain; and determining the presence of tumor in the subject if the bioluminescence is detected.
16. A method for prevention or treatment of a tumor in a subject, the method comprising administering a composition comprising the strain of claim 1 to the subject.
17. The method of claim 16, wherein the tumor is a solid cancer.
18. The method of claim 16, wherein the tumor is adenocarcinoma.
19. The method of claim 16, wherein the tumor is a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, skin cancer, and breast cancer.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
BEST MODE FOR CARRYING OUT THE INVENTION
[0067] A better understanding of the present disclosure will be obtained from the following Examples which are set forth to illustrate the present disclosure and are not to be construed as limiting the present disclosure.
Example 1. Preparation of Attenuated Salmonella gallinarum Strain and Assay for Tumor Inhibition Activity
[0068] 1-1. Salmonella Strain Growth
[0069] Salmonella spp. were grown at 37? C. in LB medium containing 1% NaCl (Difco Laboratories) under vigorous aeration. A solid support medium was prepared with 1.5% granule agar (Difco Laboratories). Antibiotics were purchased from Sigma Chemical. If necessary, the antibiotics ampicillin, kanamycin, and chloramphenicol were added at respective concentrations of 50 ?g/ml, 50 ?g/ml, and 15 ?g/ml and N-acetyl-D-glucosamine (GlcNAc) was added at a concentration of 100 mg/ml. The bacteria in the broth were roughly estimated using a hemocytometer.
[0070] 1-2. Salmonella Strain Lineage
[0071] Serotype gallinarum variants were originated from the clinical isolate SG 4021 from the livers of chickens with fowl typhoid, bred in a Korean farm (Table 1), and the SG4021 strain was deposited with the Korean Research Institute of Bioscience and Biotechnology (microorganism accession number: KCTC13985BP) on Oct. 8, 2019.
TABLE-US-00001 TABLE 1 Strain Lineage Description S. gallinarum SG4021 wild-type clinical isolate SG4022 relA::kan, spoT::cat SG4023 ?relA, ?spoT SG4030 ?relA, ?spoT, glmS::kan SG4031 ?relA, ?spot, ?glmS SG4032 ?relA, ?spoT/GlmS.sup.+pLux SG4033 ?relA, ?spoT, ?glmS/ GlmS.sup.+pLux S. typhimurium SHJ2037 relA::kan, spoT::cat SMR2130 ?relA, ?spor
[0072] All the Salmonella strain lineages were constructed according to the method developed by Datsenko and Wanner (Proceedings of the National Academy of Sciences 97.12 (2000): 6640-6645), and the attenuation of Salmonella strains was induced by ppGpp deletion (?ppGpp). The ppGpp deleted mutation was made by sequentially introducing relA::kan and spoT::cat into the genome of SG4021. In the glmS open reading frame, the gene carrying kan or cat was produced by PCR amplification using a pair of 60-nt primers, each including a 40-nt homology extension and a 20-nt priming sequence, with pKD13 serving as a template (Table 2).
TABLE-US-00002 TABLE2 SEQID Primer Primerbasesequence(5-3) NO: relA:: forward GTCGTGTGAGCGCTTAGGTGTAGGCTGGAGCTG SEQID kan GTGGATCGCAAGCCTGGGAATTTCCAGCCAGCA NO:1 CTTC reverse CTGGTTCAGCTTACCGAATTCCGGGGATCCGTC SEQID GTGCAGTCGCCGTGCATCAATCACATCCGGCAC NO:2 GACC spoT:: forward GTGACGCTCACGAGGGCTGTAGGCTGGAGCTGC SEQID cat TTAAGCGTCTTCGGCAGGCGTATCTCGTTGCAC NO:3 TTC reverse GCCAGATGTACGCGATCGCGTGCGGTAAGGCGA SEQID ATAAAGGTACTATAGACCATATGAATATCCTCC NO:4 TTAG glmS:: forward CGGCTGGTCAACGTCGGTGCCTTGATTGTGTAG SEQID kan TTACTCAACCGTAACCGATTTTGCCAGGTTACG NO:5 GCTGGAGCTGCTTCGAA reverse GATGTAGCTGAATCCTTCTTGAAGGTCATATGA SEQID ATGTGTGGAATTGTTGGCGCGATCGCGCTTCGT NO:6 ATATCCTCCTTCGTTCC
[0073] Then, the purified PCR amplicons were transformed by electroporation into a Salmonella strain containing a lambda Red helper plasmid (pKD46). The mutants were confirmed by PCR using original and general test primers. Before induction of SG4023 from SG4022, the antibiotic resistant gene was deleted using a helper plasmid carrying pCP20, which is a FLP recombinant enzyme.
[0074] In addition, glmS deleted mutants were produced by the method developed by Datsenko and Wanner (Proceedings of the National Academy of Sciences 97.12 (2000): 6640-6645) (Kaiser et al., Microbiology, 146 Pt 12: 3217-3226, 2000). Salmonella cells are prone to releasing a plasmid carrying a reporter gene unnecessary for survival particularly in animals, but it is difficult to employ an antibiotic resistant gene for a selection determinant. Thus, use was made of glmS deleted mutant phenotypes that are lysed in the animal system due to the insufficiency of the peptidoglycan constituent D-glucosamine (GlcN) or N-acetyl-Dglucosamine (GlcNAc) which is an essential nutrient for. The red recombinase system of bacteriophage lambda was used to inactivate the genomic glmS gene in the Salmonella gallinarum strain.
[0075] 1-3. GlmS+pLux Plasmid
[0076] To assay tumor targeting capability through bioluminescence and compensate for glmS deleted mutation on the chromosome, the balanced-lethal host-vector system having the glmS gene of Salmonella gallinarum incorporated thereinto was constructed.
[0077] Briefly, pLux carrying the lux operon (luxCDABE, ca. 9.5 kb) of Photobacterium leiognathid was inserted into the Xbal restriction enzyme site of a pUC19 plasmid backbone. For use in constructing a plasmid carrying both a lux operon cassette and glmS, the glmS gene of Salmonella gallinarum was amplified using the primers of Table 3.
TABLE-US-00003 TABLE3 SEQID Primer Primerbasesequence(5'-3') NO: glmS forward AAGTCGACATGTGTGGAATTGTTGGC SEQID NO:7 reverse GGGTCGACTTACTCTACGGTAACCGATTTC SEQID NO:8
[0078] The amplified 1.8 kb fragment was digested with Sal I and ligated to the same site of a pLux vector to construct GlmS+pLux. The glmS deleted mutant Salmonella strain transformed with the GlmS+pLux plasmid construct survives even an environment in D-glucosamine (GlcN) and N-acetyl-Dglucosamine (GlcNAc) and exhibits bioluminescence to allow for analysis through optical bioluminescent imaging.
[0079] 1-4. Tumor Cell Line
[0080] From the American Type Culture Collection, murine CT26 colon carcinoma cells, 4T1 breast carcinoma cells, B16F10 melanoma cells, and human ASPC1 pancreas adenocarcinoma cells were purchased. CT26 and 4T1 cells were grown in high-glucose DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Murine B16F10 melanoma cells and ASPC1 cells were grown in RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin.
[0081] 1-5. Assay for Plasmid Stability
[0082] Passage (1/1000) was made overnight in a flesh LB medium which was supplemented every 12 hours. Samples were taken every 24 hours and diluted. A suitable volume was spread three times over GlcNAc-supplemented LB plates irrespective of the presence or absence of ampicillin. Using the number of colonies thus formed, fractions of Salmonella spp. having the plasmid in total viable cells (colony forming unit, CFU) were calculated.
[0083] 1-6. Mouse Model Construction
[0084] The cultured, various tumorous cells were xeno-grafted into the right thigh of each mouse to construct mouse tumor models. From Samtako Company (Korea), male mice at 5 to 8 weeks of age, each weighing 20 to 30 g, were purchased. Management, experiments, and euthanasia were performed on all the animals according to an approved protocol.
[0085] Mice with subcutaneous tumor were constructed as follows: the in vitro cultured tumor cells of Example 1-4 were harvested and suspended in 30 ?l of PBS, followed by subcutaneous injection of 1?10.sup.6 cells of each of CT26, 4T1, and B16F10, and 1?10.sup.7 cells of ASPC1 into right thighs of the mice. For hetero-implantation of tumor cells, injection was made of CT26 and 4T1 cells into BALB/c mice, B16F10 cells into C57/BL6 mice, AsPC-1 cells into BALB/c athymic nu.sup.?/nu.sup.? mice.
[0086] When the tumor size reached 0.5 cm 3 after implantation of tumor cells (about 14 days after implantation), the ppGpp-deleted Salmonella gallinarum strain with mutation glmS of Example 1-2 including GlmS.sup.+pLux of Example 1-3 or Salmonella typhimurium were administered at a dose of about 1?10.sup.7 or about 1?10.sup.8 CFU/ml of PBS via tail vein (0 day, 0 dpi).
[0087] 1-7. Assay for Distribution of Salmonella Spp. in Mouse Internal Organ
[0088] To evaluate the number of live Salmonella spp., ?ppGpp Salmonella typhimurium and ?ppGpp Salmonella 5 gallinarum strain were intravenously at ca. 1?10.sup.7 CFU and at ca. 1?10.sup.8 CFU, respectively, into mouse groups (n=5). Days 1, 5, 10, and 16 after injection, the mice were sacrificed. Organs were excised and homogenized by a homogenizer in sterile PBS containing 0.05% Tween-20. Salmonella spp. were recovered from the homogenate and plated onto agar plates containing 50 ?g/ml kanamycin and 15 ?g/ml chloramphenicol.
[0089] 1-8. Analysis for Tumor Size and Mouse Survival Rate
[0090] Tumor volumes were calculated according to the following formula.
Tumor volume (mm.sup.3)=(tumor length?tumor height?tumor width)/2
[0091] All animal experiments were approved by the Chonnam National University Institutional Animal Care and Use Committee (NO. CNU IACUC-H-2016-15). According to the instruction, mice with a tumor volume of 1,500 mm.sup.3 or larger were sacrificed, and the survival rates of mice were evaluated according to the Gehan-Breslow-Wilcoxon test.
[0092] 1-9. Optical Bioluminescence Imaging
[0093] In order to image the bioluminescence of Salmonella spp. as an index for targeting tumors, mice were anesthetized with 2% isoflurane and then placed in a light-blocked chamber of CCD (charged couple detector) camera-installed IVIS100 (Caliper, Hopkinton, MA, USA). The photons emitted from luciferase-expressing Salmonella spp. were collected and integrated for 1 minute. Pseudo color images representing counted photons were overlaid on bright optical images of rats using living image software version v.2.25 (Xenogen-Caliper, Hopkinto, Mass.).
[0094] 1-10. Immunofluorescent Staining and Confocal Microscopy
[0095] In order to stain Salmonella strains in tumors, the isolated tissues were fixed overnight at room temperature with 3.4% paraformaldehyde in PBS and embedded into Optimal Cutting Temperature compound (OCT; Tissue-Tek). Subsequently, the tissues were frozen and sectioned into 7-mm thick slices using a microtome-cryostat. The tissue slices were collected on aminopropyl triethoxysilane-coated slides. The slides were washed with PBS (pH 7.4) to completely remove OCT and incubated overnight at 4? C. with an anti-Salmonella LPS antibody (1:100, Abcam #ab8274). Thereafter, Alexa Fluor 568-conjugated goat anti-mouse (1:100, Life Technologies A11031) antibody and Alexa Fluor 488-conjugated Phallodin (1:1000, Invitrogen #W21404) were used as secondary antibodies to detect F-actin. After the nuclei were stained with DAPI/Antifade (1:200, Invitrogen), the samples were mounted. Stained images were captured using Zeiss confocal microscope LSM 510 (Zeiss Laboratories), and representative images are given unless otherwise stated.
[0096] 1-11. Statistical Analysis
[0097] Statistical analyses were performed using SPSS 18.0 statistical package (SPSS Inc., Chicago, IL, USA). Statistical significance of tumor growth between control and test groups was determined using two-tailed Student's t-test. P values <0.05 were considered statistically significant, and all data are expressed as mean?SD.
Example 2. Assay for In Vivo Toxicity of Salmonella gallinarum Strains and for Plasmid Stability
[0098] 2-1. Assay for In Vitro Toxicity of Salmonella gallinarum Strains
[0099] In order to apply Salmonella gallinarum strains to bacterial cancer therapy, wild-type Salmonella gallinarum was injected intravenously (i.v.) into the mice which were then analyzed for survival.
[0100] As a result, even though causing typhoid only in fowls, the intravenous injection of the wild-type Salmonella gallinarum strain (SG4021) induced death of all mice at a dose of about 10.sup.5 CFU or greater (
[0101] 2-2. Determination of Dosage According to In Vivo Toxicity of Attenuated Salmonella gallinarum Strain
[0102] Since the wild-type Salmonella gallinarum strain was observed to exhibit in vivo toxicity in Example 2-1, Salmonella gallinarum strain was attenuated by blocking the synthesis of ppGpp.
[0103] Briefly, the ppGpp-deleted (?ppGpp) mutant Salmonella gallinarum strains of Example 1-2 in which both ppGpp synthetase I and II respectively encoded by relA and spoT genes had been mutated, and the Salmonella typhimurium were intravenously injected to BALB/c mice which were then analyzed for survival rate.
[0104] As a result, the mice were observed to survive up to 10.sup.8 CFU of the ?ppGpp Salmonella gallinarum strain (SG4023) (
[0105] It was understood from the data that with the assumption that E. coli was almost free of toxicity, the maximal dose of Salmonella spp. that animals free of nonspecific catastrophe can endure was about 10.sup.8 CFU.
[0106] 2-3. Assay for Plasmid Stability
[0107] With respect to the stability of the transformed plasmids, the same procedure as in Example 1-5 was carried out to evaluate whether the plasmids were lost. As a result, 99% of the plasmids carried by the wild-type Salmonella gallinarum strain (SG4021) were lost by day 4 while the plasmids carried by the glmS-deleted Salmonella gallinarum strain (SG4031) were completely maintained (
[0108] Subsequent experiments employed the ?ppGpp strain, transformed with GlmS+pLux of Example 1-3, having a mutant glmS gene on the genome thereof so as to visualize Salmonella gallinarum strains in mice.
Example 3. Assay for Tumor Targeting of ?ppGpp Salmonella gallinarum Strain
[0109] 3-1. Examination of Tumor Targeting According to Bioluminescence Signal Imaging
[0110] To examine the tumor targeting of the ?ppGpp Salmonella gallinarum strain, bioluminescence signals of the Salmonella gallinarum strain were imaged in the same manner as in Example 1-9.
[0111] As a result, bioluminescence signals were detected mainly from internal organs (liver and spleen) immediately after injection of the ?ppGpp Salmonella gallinarum strain (SG4031) (20 min, 0 day post injection (dpi)). Bioluminescence signals appeared only in the implanted tumor tissues. After appearance of peaks for AsPC-1 at 4 dpi and other tumors at 2 dpi, the bioluminescence signals were gradually diminished.
[0112] Particularly, the Salmonella gallinarum strain was observed to target all the tumors implanted in three different mouse lines (
[0113] 3-2. Retention of Plasmid in Mouse
[0114] The wild-type and the mutant ?ppGpp Salmonella gallinarum strain of Example 1-2 including the GlmS+pLux carrying the mutant glmS gene of Example 1-3 were injected into Balb/c mice including CT26 cells and then imaged at 0, 2, and 4 dpi according to the method of Example 1-9.
[0115] As a result, a strong bioluminescence signal was retained in the glmS-deleted ?ppGpp Salmonella gallinarum strain (SG4031), but not in the ?ppGpp Salmonella gallinarum strain (SG4023) (
Example 4. Anticancer Effect of ?ppGpp Salmonella Gallinarum Strain on CT26 Tumor Mouse Model
[0116] 4-1. Prolonged Duration of Life of Salmonella gallinarum-Treated Mouse
[0117] To CT26 cell-implanted BALB/c mice, ?ppGpp Salmonella gallinarum was intravenously injected at a dose of about 1?10.sup.8 CFU while the ?ppGpp Salmonella typhimurium was used as a control (ca. 1?10.sup.7 CFU). In vivo anticancer activity of the ?ppGpp Salmonella gallinarum strains was analyzed according to Examples 1-8 and 1-10.
[0118] Treatment of about 1?10.sup.8 CFU of the ?ppGpp Salmonella gallinarum strain (SG4023) was observed to significantly improve the inhibitory effect of tumor growth in the mice, compared to the PBS control and about 1?10.sup.7 CFU of the Salmonella typhimurium strain (SMR2130) (
[0119] 4-2. Distribution Pattern of Salmonella gallinarum Strain in Mouse
[0120] To examine distribution patterns of Salmonella gallinarum strains in mice, temporal changes in the number of the Salmonella gallinarum strains were monitored in mouse organs.
[0121] As a result, maximal highest levels (10.sup.8 to 10.sup.9 CFU/g) in tumors were observed in both of the Salmonella strains one day after the injection (1 dpi). The ?ppGpp Salmonella typhimurium strain (SHJ2037) was maintained at the same level in tumor while the number of the ?ppGpp Salmonella gallinarum strain (SG4022) was gradually reduced into 10.sup.6 CFU/g over 16 days. At 1 dpi, the Salmonella typhimurium strain was maintained at a level of 10.sup.6 to 10.sup.7 CFU/g in liver, spleen, and bone, at a level of 10.sup.6 to 10.sup.7 CFU/g, at a level of 10.sup.4 CFU/g in lung, kidney, and heart, and at a level of 10.sup.1 and 10.sup.3 CFU/g in serum and eye, and the levels were not significantly reduced over 16 days. In contrast, the Salmonella gallinarum strain was found to exhibit similar distribution patterns for the organs at 1 dpi. The Salmonella gallinarum strain was completely cleared from the organs by 16 dpi (
[0122] From the data obtained above, it is understood that the ?ppGpp Salmonella gallinarum strain possessing the mutant glmS gene on the chromosome thereof specifically targets tumors to exhibit an anti-tumor effect and as such, can be used for anti-tumor purposes.
[0123] The disclosure has been described above with reference to the preferred embodiments. It will be understood by those skilled in the art that the disclosure may be embodied in various other forms without departing from the spirit or essential characteristics thereof. Therefore, the above-described embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the disclosure is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the disclosure.