DOWN-REGULATION OF ENDOGENOUS GENES
20240107988 ยท 2024-04-04
Assignee
- UNIVERSITAT AUT?NOMA DE BARCELONA (Cerdanyola del Vall?s, ES)
- HELMHOLTZ ZENTRUM M?NCHEN DEUTSCHES FORSCHUNGSZENTRUM F?R GESUNDHEIT UND UMWELT (GMBH) (Neuherberg, DE)
Inventors
- Maria F?tima BOSCH TUBERT (Cerdanyola del Valles, ES)
- Ver?nica JIMENEZ CENZANO (Sabadell, ES)
- Miquel GARCIA MARTINEZ (Terrassa, ES)
- Estefan?a CASANA LORENTE (Sabadell, ES)
- Martin Matthias HRABE DE ANGELIS (Starnberg, DE)
- Gerhard Kurt Herbert PRZEMECK (M?nchen, DE)
- Anna-Lena AMEND (M?nchen, DE)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
A01K67/0278
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Described herein is a genetically modified plant or non-human animal having reduced expression of an endogenous target gene.
Claims
1. A genetically modified plant or non-human animal having reduced expression of an endogenous target gene, wherein the genome of the plant or non-human animal is modified by ectopic integration of at least one copy of a target sequence of a microRNA.
2. The genetically modified plant or non-human animal according to claim 1, wherein the ectopic integration site is located: in the 5 UTR of the target gene or in the region between the 5 UTR and the first exon of the target gene; or in the 3 UTR of the target gene or in the region between the last exon and the 3 UTR of the target gene.
3. The genetically modified plant or non-human animal according to claim 1, wherein the ectopic integration site is located in the 3 UTR of the target gene or in the region between the last exon and the 3 UTR of the target gene.
4. The genetically modified plant or non-human animal according to claim 1, wherein the genome comprises one, two, three, four, five, six, seven, eight or more copies, preferably two, three or four copies, more preferably two copies of the target sequence of a microRNA.
5. The genetically modified plant or non-human animal according to claim 1, wherein the reduced expression is specifically in one or more target cells, tissues and/or organs of an organism, and wherein the target sequence is of a microRNA expressed specifically in said one or more target cells, tissues and/or organs.
6. The genetically modified plant or non-human animal according to claim 1, wherein the plant or non-human animal is a non-human animal, preferably a mammal such as a rodent, more preferably a rat or a mouse, most preferably a mouse.
7. The genetically modified plant or non-human animal according to claim 1, wherein the reduced expression is specifically in the pancreas and wherein the target sequence is of a microRNA expressed specifically in the pancreas, preferably wherein the microRNA is selected from the group consisting of: mir-200a, mir-96, mir-1839-1, mir-34a, mir-7b, mir-7-1, mir-7-2, mir-184, mir-375, mir-219a-1, mir-574, mir-802, mir-152 and mir-148a, more preferably wherein the microRNA is mir-375.
8. The genetically modified plant or non-human animal according to claim 1, wherein the target gene is selected from the group consisting of: HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, KLF11, CEL, PAX4, INS, BLK, ABCC8, APPL1 and KCNJ11, preferably wherein the target genes is HNF1A or HNF4A.
9. The genetically modified plant or non-human animal according to claim 1, which is a plant or non-human animal disease model, preferably a model for a disease associated with or caused by mutations in the target gene, more preferably wherein the disease is a monogenic disease.
10. The genetically modified plant or non-human animal according to claim 9, wherein the disease is maturity onset diabetes of the young type 3 (MODY3) and the target gene is HNF1A, or wherein the disease is maturity onset diabetes of the young type 1 (MODY1) and the target gene is HNF4A.
11. Method for obtaining a genetically modified plant or non-human animal as described in claim 1, comprising: (a) providing a cell of said plant or non-human animal; (b) genetically modifying the cell by ectopic integration of at least one copy of a target sequence of a microRNA in the genome of the cell; (c) generating an embryo from the cell; and (d) growing said embryo to form a genetically modified plant or non-human animal.
12. The method according to claim 11, wherein the at least one copy of a target sequence of a microRNA is introduced by homology-directed repair (HDR), preferably CRISPR-mediated
13. The method according to claim 11, further comprising the step of back-crossing the genetically modified plant or non-human animal with non-genetically modified wildtype plant or non-human animal.
14. Method for identifying and/or evaluating therapeutic efficacy of a candidate agent for treating, inhibiting or preventing a disease, comprising administering the candidate agent to a plant or non-human animal as described in claim 8, or a cell, tissue or organ derived thereof.
15. (canceled)
Description
DESCRIPTION OF THE FIGURES
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
EXAMPLES
General Procedures to the Examples
Generation of MODY3 Mice
[0295] MODY3 mice were generated using CRISPR/Cas9 technology. The gRNA, donor DNA, and Cas9 mRNA were pronuclearly microinjected in one-cell mice embryos. After Cas9-mediated double strand break and homologous recombination with the donor DNA, the two copies of miRT375 were introduced between the exon 10 and the 3 UTR of the mouse HNF1A gene.
MODY3 Mice Genotyping
[0296] Forward (GGACTTGGCCAACAGCTAGT, SEQ ID NO: 20) and reverse (GGAGGAGCAGCAGTGTCAAT, SEQ ID NO: 21) primers targeting exon 10 and the 3 UTR of the HNF1A gene were used for genotyping of the offspring. PCR reaction generated a 392 bp amplicon that was subsequently digested with the EcoRV restriction enzyme. EcoRV digestion generated fragments of 257 and 80 bp in the WT allele; and of 202, 110 and 80 bp in the allele comprising the two miRT375 copies.
Generation of MODY1 Mice
[0297] MODY1 mice were generated using CRISPR/Cas9 technology. The gRNA, donor DNA, and Cas9 mRNA were pronuclearly microinjected in one-cell mice embryos of the genetic background C57BL/6NCrl. After Cas9-mediated double strand break and homologous recombination with the donor DNA, the two copies of miRT375 were introduced between exon 10 and the 3 UTR of the mouse HNF4A gene.
MODY1 Mice Genotyping
[0298] Forward (TAGAAGAGCTTTCCCTGGGC, SEQ ID NO: 18) and reverse (GGGGTGAAGAAGTTGAGGGA, SEQ ID NO: 19) primers targeting exon 10 and the 3 UTR of the HNF4A gene were used for genotyping of the offspring. PCR reaction generated a 602 bp amplicon for the knock-in allele and a 547 bp amplicon for the wild-type allele. Subsequent digestion with EcoRV of the wild-type allele revealed no further fragmentation. Subsequent digestion with EcoRV of the knock-in allele with the two miRT375 copies revealed fragments of 335 and 267 bp.
Subject Characteristics
[0299] Male C57Bl/6J mice and MODY3 mice were used. Mice were fed ad libitum with a standard diet (2018S Teklad Global Diets?, Harlan Labs., Inc., Madison, WI, US) and kept under a light-dark cycle of 12 h (lights on at 8:00 a.m.) and stable temperature (22? C.?2). Mice were weighted weekly after weaning. Blood glucose levels were measured with a Glucometer Elite? analyzer (Bayer, Leverkusen, Germany). For tissue sampling, mice were anesthetized by means of inhalational anesthetic isoflurane (IsoFlo?, Abbott Laboratories, Abbott Park, IL, US) and decapitated. Tissues of interest were excised and kept at ?80? C. or with formalin until analysis. All experimental procedures were approved by the Ethics Committee for Animal and Human Experimentation of the Universitat Autonoma de Barcelona.
[0300] C57BL/6NCrl and MODY1 mice were kept under specific-pathogen free (SPF) conditions in individually-ventilated cages systems (IVC). Mice were fed ad libitum with a standard chow diet (Altromin 1314, Altromin Spezialfutter GmbH & Co. KG, Lage, Germany) and kept under a light-dark-cycle of 12 h (lights on at 6:00 am), stable temperature (22? C.?2? C.) and humidity (55%?10%). Body weight was measured weekly using a standard laboratory balance (Sartorius, Germany). For tissue collection, mice were sacrificed by decapitation. All experimental procedures were approved by state ethics committee by the government of Upper Bavaria.
Recombinant AAV Vectors
[0301] Single-stranded AAV vectors of serotype 8 were produced by triple transfection of HEK293 cells according to standard methods (Ayuso, E. et al., 2010. Curr Gene Ther. 10(6):423-36). Cells were cultured in 10 roller bottles (850 cm2, flat; Corning?, Sigma-Aldrich Co., Saint Louis, MO, US) in DMEM 10% FBS to 80% confluence and co-transfected by calcium phosphate method with a plasmid carrying the expression cassette flanked by the AAV2 ITRs, a helper plasmid carrying the AAV2 rep gene and the AAV of serotypes 8 cap gene, and a plasmid carrying the adenovirus helper functions. Transgenes used were: GFP or mouse HNF1A isoform A coding-sequence driven by 1) the rat insulin promoter 1 (RIPI): 2) the rat insulin promoter 2 (RIPII); 3) the human full length insulin promoter (hINS1.9); or 4) a shortened version of the human insulin promoter (hINS385). AAV were purified with an optimized method based on a polyethylene glycol precipitation step and two consecutive cesium chloride (CsCl) gradients.
[0302] This second-generation CsCl-based protocol reduced empty AAV capsids and DNA and protein impurities dramatically (Ayuso, E. et al., 2010. Curr Gene Ther. 10(6):423-36). Purified AAV vectors were dialyzed against PBS, filtered and stored at ?80? C. Titers of viral genomes were determined by quantitative PCR following the protocol described for the AAV2 reference standard material using linearized plasmid DNA as standard curve (Lock M, et al., Hum. Gene Ther. 2010; 21:1273-1285). The vectors were constructed according to molecular biology techniques well known in the art.
Retrograde Administration through Pancreatic Biliary Duct
[0303] The retrograde injection via the pancreatic biliary duct was conducted as previously described (Jimenez et al., Diabetologia. 2011 May;54(5):1075-86). The animals were anesthetized by an intraperitonial injection of ketamine (100 mg/kg) and xylazine (10 mg/kg). Once the area was shaved and an incision of 2-3 cm was made, the abdomen was opened by an incision through the alba line and an abdominal separator was placed. The bile duct was identified. The liver lobes were separated and the bile duct was clamped in the bifurcation of the hepatic triad to prevent spreading of viral vectors to the liver. A 30 G needle was then inserted in the Vater papilla and advanced retrogrally through the biliary duct. The needle was fixed by clamping the duct at the tip of the intestine to secure its position and prevent the escape of viral vectors into the intestine. The solution of the appropriate dose of viral vectors was slowly injected. One min after the injection, the clip that fixed the needle in place was pulled off and a drop of surgical veterinary adhesive Histoacryl (Braun, TS1050044FP) was applied to the puncture site of the needle. Approximately 2 min later, the clip on the biliary duct was removed and the abdominal wall and skin were sutured. The mice were left on a heating meadow to recover from anesthesia and to prevent heat loss.
Immunohistochemical and Morphometric Analysis
[0304] Tissues were fixed for 24 h in formalin (Panreac Qu?mica), embedded in paraffin, and sectioned. Pancreas sections were incubated overnight at 4? C. with guinea pig anti-insulin (1:100; I-8510; Sigma-Aldrich). Rabbit anti-guinea pig coupled to peroxidase (1:300; P0141; Dako) was used as secondary antibody. The ABC peroxidase kit (Pierce) was used for immunodetection, and sections were counterstained in Mayer's hematoxylin. Images were taken at 2? magnification for the pancreatic area and 10? or 20? magnifications for islets using a Nikon Eclipse E800 microscope (Nikon, Tokyo, Japan). Image analysis and quantification of areas in ?m.sup.2 were performed using an image analysis software (analySIS 3.0; Soft Imaging System, Center Valley, PA, EEUU). The percentage of the ?-cell area in the pancreas was calculated based on two insulin-stained sections separated by 200 ?m by dividing the area of all insulin-positive cells per section by the total pancreatic area of that section. The ?-cell mass was calculated by multiplying the pancreas weight by the percentage of ?-cell area as previously described (Jimenez et al, Diabetologia. 2011 May;54(5):1075-86).
Isolation of Pancreatic Islets from MODY3 Mice
[0305] The pancreatic islets were extracted by pancreas digestion and subsequent isolation of pancreatic islets. In order to digest the pancreas, mice were sacrificed, the abdominal cavity was exposed and 3 ml of a solution of Liberase (Roche, 0104 mg/ml medium without serum M199 (Gibco-Life Technologies 10012-037)) was perfused to the pancreas via the common bile duct. During perfusion, circulation through the Vater ampoule was blocked by placing a clamp. Once perfused, the pancreas was isolated from the animal and kept on ice before being digested at 37? C. for 19 min. To stop digestion and dilute the Liberase solution, 35 ml of cold medium M199 with 10% serum (Biowest S0250-500) were added and the tube stirred for 30 s to completely disintegrate the tissue. Then, two washes with 30 ml and 10 ml respectively of M199 medium supplemented with serum were done. Then, the solution of disintegrated tissue was filtered (450 mm PGI 34-1800-09) and collected into a new tube. The filtrate with 20 ml of medium with serum was centrifuged (Eppendorf 5810R rotor A-4-62) at 200-230?g for 5 min at 4? C. The supernatant was discarded and after carefully removing all traces of the medium, the pellet was resuspended in 13 ml of Histopaque-1077 (Sigma 10771) and M199 medium without serum was added to a volume of 25 ml avoiding mixing the two phases. Then it was centrifuged (Eppendorf 5810R) at 1000?g for 24 min at 4? C. to obtain the pancreatic islets at the interface between the medium and the Histopaque and thus, they were collected with the pipette. Once isolated, the islets were washed twice with 40 ml of medium with serum and centrifuged at 1400 rpm, 2.5 min at room temperature. In the final wash the pellet with islets was resuspended in 15 ml of M199 medium. In this step, and to help their identification under the microscope, the islets were stained by adding a solution of 200 ml Dithizone to the medium (for 10 ml volume: 30 mg Dithizone (Fluka 43820), 9 ml absolute EtOH, 150 ?l NH4OH and 850 ?l H20). After 5 min of incubation, islets were transferred to a petri dish and were hand-picked under the binocular microscope.
Isolation of Pancreatic Islets from MODY1 Mice
[0306] The common bile duct was exposed by dislocating the gut and liver. A bulldog microclamp (Roboz Surgical Instruments Co., Inc., Gaithersburg, MD, USA) was placed on the Ampulla of Vater, the site where the common bile duct enters the duodenum. A 30 G1/2 needle (Braun, Germany) was then used to enter the common bile duct and 3-4 ml of collagenase solution was perfused into the pancreas. The pancreas was then removed from the cadaver and immediately placed on ice in a 15 ml reaction tube containing 3.5 ml collagenase solution for a maximum of 60 min. The pancreas was further digested in a water bath at 37? C. for 15 min with a gentle shaking step after 7.5 min. Next, 10 ml of ice-cold G-solution was added to stop the reaction, then samples were centrifuged at 290?g for 2 min at RT. The supernatant was carefully decanted. Using an additional 10 ml of G-solution, the remaining pancreatic digest was dissolved by repeated vigorous pipetting. The solution was filtered through a metal mesh (pore size approx. 1 mm) into a 50 ml reaction tube in order to remove larger undigested pieces. Another 10 ml of G-solution, used to rinse the 15 ml tube, was also filtered through the metal mesh. Finally, the metal mesh was rinsed with a further 20 ml of G-solution to avoid loss of islets. The complete filtrate was centrifuged at 290?g for 2 min at RT. After decanting the supernatant, the pellet was resuspended in 5.5 ml of Optiprep-RPMI solution. This resuspension was slowly pipetted along the wall into a new 15 ml tube with 2.5 ml Optiprep-RPMI, creating a gradient, which was then overlaid with 6 ml of G-solution to obtain a third layer. The samples were allowed to incubate an additional 10 min at RT to improve gradient formation before centrifuging at 290?g for 15 min at RT with an adjusted slow acceleration and without break to avoid mixing of the gradients. Islets accumulate between the second and the third layer of the gradient. They were carefully collected with a serological pipet and then filtered through a 70 ?m cell strainer to remove any remaining acinar tissue. Islets were captured from the cell strainer by turning the strainer and rinsing it with G-solution into an untreated suspension culture dish. The islets were then picked by hand under a stereomicroscope and placed in a new suspension culture dish with 12 ml islet culture medium (a maximum of 60-80 islets per dish were allowed). Islets were left to rest and recover overnight in an incubator at 37? C. with 5% CO.sub.2 infusion and humidified air before a subsequent islet lysis, RNA isolation or protein isolation was carried out.
G-Solution
[0307] 500 ml HBSS (Life technologies #14025092)+5 ml antibiotic-antimycotic solution (Sigma Aldrich)+5 g BSA; sterile filtered
Collagenase Solution
[0308] 1 mg/ml Collagenase P (Roche, Germany) in 8 ml G-solution; freshly prepared
RPMI Medium
[0309] 445 ml RPMI 1640 medium with UltraGlutamine (Lonza)+5 ml antibiotic-antimycotic solution (Sigma Aldrich)+50 ml FBS (Gibco)
10% RPMI
[0310] 5 ml RPMI medium+45 ml G-solution
Optiprep
[0311] 20 ml OptiPrep? Density Gradient (Sigma Aldrich)+9.7 ml DBPS (Lonza)+0.3 ml HEPES (Lonza)
Optiprep-RPMI Solution
[0312] 5 ml Optiprep+3 ml 10% RPMI; freshly prepared
In Vitro Glucose Stimulated Insulin Secretion
[0313] After islet isolation, islets were cultured O/N at 37? C. in RPMI 1640 medium (11 mM glucose), supplemented with 1% BSA, 2 mM glutamine, and penicillin/streptomycin in an atmosphere of 95% humidified air, 5% CO2, to allow recovery from islet isolation stress. Next, 120 islets of similar size isolated from mice of each experimental group were washed in KRBG30 buffer twice and then were handpicked and seeded in a 6-well plate containing KRB G30 for pre-culture during 2 hours at 37? C. in an atmosphere of 95% humidified air, 5% CO2. Then, 150 ul of KRB G30 (low glucose) or KRB G300 (high glucose) were loaded in a 96-well plate (5 wells per condition). After 2 hours, 20 pre-cultured islets per well were loaded in the new 96-well plate containing low or high glucose medium and were incubated during 1 hour at 37? C. After this incubation, medium and (120 ?l/well) islets were collected separately. Medium was subsequently stored at ?80? C. After collection of islets, acetic acid lysis buffer was added and the mixture was frozen O/N at ?80? C. For islet lysis, islets and acetic acid were boiled at 100? C. for 10 min, then spined at 4? C. for 10 min at 12000 rpm. The supernatant was collected and stored at ?80? C. Insulin content in islets and insulin concentration in culture medium were measured by ELISA.
RNA Analysis in MODY3 Mice
[0314] Total RNA was obtained from islets or liver by using Tripure isolation reagent (Roche Diagnostics Corp., Indianapolis, IN, US), and RNAeasy Microkit (Qiagen NV, Venlo, NL) for islets and RNeasy Tissue Minikit (Qiagen NV, Venlo, NL) for liver. In order to eliminate the residual viral genomes, total RNA was treated with DNAsel (Qiagen NV, Venlo, NL).
[0315] The concentration and purity of the obtained RNA was determined using a device Nanodrop (ND-1000, ThermoScientific). For RT-PCR, 1 ?g of RNA samples was reverse-transcribed using Transcriptor First Strand cDNA Synthesis Kit (04379012001, Roche, California, USA). Real-time quantitative PCR was performed in a SmartCyclerII? (Cepheid, Sunnyvale, USA) using EXPRESS SYBRGreen qPCR supermix (Invitrogen?, Life Technologies Corp., Carslbad, CA, US). Data was normalized with Rplp0 values and analyzed as previously described (Pfaffl, M., Nucleic Acids Res. 2001; 29(9):e45).
TABLE-US-00004 Primerpairs Gene forwardprimer reverseprimer Rplp0 TCCCACCTTGTCTCCAGTCT ACTGGTCTAGGACCCGAGAAG (SEQIDNO:22) (SEQIDNO:23) L-PK GTTTCTTGGGCAACAGGAAG AGGAGGCAAAGATGATGTCC (SEQIDNO:24) (SEQIDNO:25) HNF4a AGATTGACAACCTGCTGCAG TGCCCATGTGTTCTTGCATC (SEQIDNO:26) (SEQIDNO:27) HNF1a TGTCACAGCACCTCAACAAG TGTGGGCTCTTCAATCAGTC (SEQIDNO:28) (SEQIDNO:29) Slc2a2 ATCCCTTGGTTCATG AATTGCAGACCCAGT GTTGC TGCTG (SEQIDNO:30) (SEQIDNO:31)
RNA Analysis in MODY1 Mice
[0316] RNA was isolated from overnight-resting islets using the RNeasy Micro kit (Qiagen, Germany) following the manufacturer's instructions. RNA concentration was measured using a NanoPhotometer? device (Implen, Germany). For cDNA synthesis, RNA was reverse-transcribed using SuperScriptIV (Thermo Fisher) following the manufacturer's instructions. Finally, cDNA was adjusted to a concentration of 2.5 ng/?l. Quantitative real-time PCR (qRT-PCR) was performed in a LightCycler? 480 device (Roche, Germany) using the QuantiFast SYBR Green PCR Kit (Qiagen, Germany) following the manufacturer's instructions and with 0.5 ng cDNA per 20 ?l reaction in 384-well plates. Results were normalized to house-keeping genes Atp5b and Rpl13a and analyzed using the Livak ??Ct method (Methods 25(4), 402-408).
TABLE-US-00005 Primerpairs Gene forwardprimer reverseprimer Atp5b GGTTTGACCGTTGCTGA TAAGGCAGACACCTCTGAGC ATAC (SEQIDNO:33) (SEQIDNO:32) Rpl13a TGAAGCCTACCAGAAAG GCCTGTTTCCGTAACCTCAA TTTGC (SEQIDNO:35) (SEQIDNO:34) Hnf4a_1 GTTCTGTCCCAGCAGAT CTTCTTTGCCCGAATGTCGC CACC (SEQIDNO:37) (SEQIDNO:36) Hnf4a_2 CGTGCTGCTCCTAGGCA CATCGAGGATGCGGATGGAC ATG (SEQIDNO:39) (SEQIDNO:38) Slc2a2 GGGGACAAACTTGGAAG TGAGGCCAGCAATCTGACTA GAT (SEQIDNO:41) (SEQIDNO:40)
Hormone Detection
[0317] Insulin concentrations were determined by Rat Insulin ELISA sandwich assay (90010, Crystal Chem INC. Downers Grove, IL 60515, USA).
Glucose Tolerance Test
[0318] Awake mice were fasted overnight (16 h) and administered with an intraperitoneal injection of glucose (1 or 2 g/kg body weight). Glycemia was measured in tail vein blood samples at the indicated time points.
In Vivo Insulin Release Test
[0319] Awake mice were fasted overnight (16 h) and administered with an intraperitoneal injection of glucose (3 g/kg body weight). Venous blood was collected from tail vein in tubes at the indicated time points and immediately centrifuged to separate serum, which was used to measure insulin levels.
Western Blot Analysis in Samples from MODY3 Mice
[0320] Islets or liver were homogenized in Lysis Buffer. Proteins were separated by 10% SDS-PAGE, and analyzed by immunoblotting with rabbit monoclonal anti-HNF1A (D7Z2Q; Cell signaling) and rabbit polyclonal anti-?-tubulin (ab4074; Abcam) antibodies. Detection was performed using ECL Plus detection reagent (Amersham Biosciences).
Western Blot Analysis in Samples from MODY1 Mice
[0321] Liver tissue was dissected into small pieces and protein was extracted using a Precellys Evolution instrument equipped with a Cryolys Evolution cooling unit (Bertin GmbH, Germany) following the manufacturer's instructions. Protein concentrations were determined using the Pierce BCA Assay Kit (Thermo Fisher) according to the manufacturer's instructions. For Western blot analysis, reduced samples (40 ?g protein per sample) were prepared using BOLT reagents (Life technologies) following the manufacturer's instructions. Denatured samples were loaded onto BOLT 4-12% gradient gels (Life technologies). The Chameleon Duo Ladder (LI-COR Biotechnology GmbH, Germany) was used to visualize protein separation during electrophoresis and to estimate the molecular weight of proteins. After transfer to nitrocellulose membranes (Life technologies), immunodetection was performed with rabbit monoclonal anti-HNF4A (ab199431, Abcam) and rabbit polyclonal anti-?-tubulin (ab4074, Abcam). Fluorophore-conjugated secondary antibodies (926-32211, LI-COR) were used. Analysis was performed using an Odyssey Infrared Imaging System (LI-COR) followed by densitometric quantification using the Studio Lite Ver5.2 software (LI-COR).
Statistical Analysis
[0322] All values are expressed as mean?SEM. Differences between groups were compared by Student's t-test. Differences were considered significant at p<0.05.
Example 1. Generation of the New MODY3 Mouse Model
[0323] A new ?-cell specific mouse model for MODY3 by means of the CRISPR/Cas9 technology was generated. To preclude production of HNF1A specifically in beta-cells, we introduced two copies of the target sequence for the beta-cell specific miRNA375 (miRT375) (SEQ ID NO: 7) upstream the 3 UTR of the HNF1A gene. Specifically, a single guided RNA (sgRNA) (SEQ ID NO: 8) was designed to target the region adjacent to exon 10 and the 3 UTR of the HNF1A gene to introduce two copies of the microRNA 375 target sequence (miRT375), contained in DNA donor, by homology directed repair (HDR) (
[0324] The specific gRNA, the donor DNA, and the Cas9 mRNA were pronuclearly microinjected into one-cell embryos that were subsequently transferred into recipient female mice. F0 generation was genotyped by PCR analysis using specific primers located in the flanking sequences of the knock-in site. Next, the PCR products were digested with EcoRV, leading to different patterns depending on the mice genotype (
Example 2. Downregulation of HNF1A Expression and Production Levels in Islets from MODY3 Mice
[0333] HNF1A expression and protein levels were analyzed in islet samples from 14 to 16-week-old MODY3 mice. Homozygous MODY3 male and female mice showed markedly reduced HNF1A expression levels and HNF1A protein content in islets (=80% reduced HNF1A protein production) (
Example 3. MODY3 Mice Exhibited Mild Hyperglycemia and Impaired Glucose Tolerance
[0334] Body weight follow-up demonstrated that wild-type, heterozygous and homozygous MODY3 mice showed similar body weight (
[0335] Moreover, male and female MODY3 mice showed impaired glucose tolerance in comparison with WT mice at young and adult ages (
Example 4. MODY3 Mice Showed Decreased Beta-Cell Mass and Insulinemia
[0336] To further evaluate the pancreas phenotype in MODY3 mice, pancreatic sections were immunostained against insulin and morphometric analyses were performed. No striking differences in islet morphology and number of islets were detected between MODY3 and WT mice (
Example 5. MODY3 Mice Showed Downregulation of HNF1A Target-Genes and ?-Cell Transcriptional Regulatory Network
[0337] In pancreatic ?-cells, HNF1A has been reported to regulate expression of insulin and ?-cell transcription factors as well as expression of proteins involved in glucose transport and metabolism and mitochondrial function, all of which are involved in insulin secretion (Fajans, S. S. et al. (2001). N. Engl. J. Med., 345, 971-80). Both male and female MODY3 mice showed markedly reduced expression of all HNF1A gene targets examined (
[0338] Altogether, a new ?-cell specific MODY3 mouse model that faithfully mimics the clinical phenotype of MODY3 patients has been developed. This new mouse model represents a useful tool to assess novel treatment strategies for MODY3.
[0339] It is pointed out that neither MODY3 nor MODY1 mice experienced any significant suffering, as evidenced by our results. Their body weight is similar to that of control mice and no increased mortality has been observed. Any possible very mild suffering is limited to displaying mild hyperglycemia.
Example 6. Generation of the New MODY1 Mouse Model
[0340] A new beta-cell specific mouse model for MODY1 by means of the CRISPR/Cas9 technology was generated. To preclude production of HNF4A specifically in beta-cells, we introduced two copies of the target sequence for the beta-cell specific miRNA375 (miRT375) (SEQ ID NO: 7) upstream the 3 UTR of the HNF4A gene. Specifically, a single guided RNA (sgRNA) (SEQ ID NO: 9) was designed to target the region adjacent to exon 10 and the 3 UTR of the HNF4A gene to introduce two copies of the microRNA 375 target sequence (miRT375) and a new EcoRV restriction site (to be used for genotyping of offspring), contained in DNA donor, by homology directed repair (HDR) (
[0341] The specific gRNA, the donor DNA, and the Cas9 mRNA were pronuclearly microinjected into one-cell C57BL/6NCrl embryos that were subsequently transferred into recipient female mice. The F0 generation was genotyped by PCR analysis using specific primers located in the flanking sequences of the knock-in site. Next, the PCR products were digested with EcoRV, leading to different patters depending on the mice genotype (
Example 7. Selection of Beta-Cell Specific Promoter to Drive Expression of HNF1A
[0342] The MODY3 mouse model developed in Example 1 was used to design a suitable gene therapy approach. First, to select the most appropriate beta-cell specific promoter, AAV8 vectors encoding GFP under the control of four candidate promoters were generated. The selected promoters were the rat insulin promoter I (RIPI, SEQ ID NO: 10), rat insulin promoter II (RIPII, SEQ ID NO: 11), the full-length human insulin promoter (hINS1.9, SEQ ID NO: 12), and a 385 by fragment of the human insulin promoter (hIns385, SEQ ID NO: 13). Expression cassettes encoding GFP under the control of either RIPI, RIPII, hINS1.9 or hIns385 promoters and flanked by the inverted terminal repeats (ITRs) of AAV2 were generated. AAV8-GFP vectors (AAV8-RIPI-GFP, AAV8-RIPII-GFP, AAV8-hINS1.9-GFP and AAV8-hIns385-GFP) were produced by triple transfection in HEK293 cells. To evaluate the strength of the promoters and beta-cell specificity of the RIPI, RIPII, hINS1.9 and hIns385 promoters, wild type mice were administered intraductally with AAV8-RIPI-GFP, AAV8-RIPII-GFP, AAV8-hINS1.9-GFP or AAV8-hIns385-GFP vectors. Although all vectors promoted specific GFP overexpression in islets (
[0343] First, expression cassettes encoding the Mus musculus hepatocyte nuclear factor 1A isoform A (HNF1A_a) under the control of either RIPI or RIPII promoters and flanked by the inverted terminal repeats (ITRs) of AAV2 were generated (SEQ ID NO: 14 and 15). AAV8 vectors (AAV8-RIPI-HNF1A_a and AAV8-RIPII-HNF1A_a) were produced by triple transfection in HEK293 cells. To evaluate whether RIPI and RIPII were able to mediate HNF1A_a expression in beta-cells and to assess if this overexpression was safe, wild type mice were administered intraductally with AAV8-RIPI-HNF1A_a or AAV8-RIPII-HNF1A_a vectors. A control group administered intraductally with PBS served as control. Although both vectors promoted specific HNF1A overexpression in islets (
[0344] Next, expression cassettes encoding the Mus musculus hepatocyte nuclear factor 1A isoform A (HNF1A_a) under the control of either hINS1.9 or hIns385 promoters and flanked by the inverted terminal repeats (ITRs) of AAV2 were generated (SEQ ID NO: 16 and 17). AAV8 vectors (AAV8-hINS1.9-HNF1A_a and AAV8-hIns385-HNF1A_a) were produced by triple transfection in HEK293 cells. Wild type mice were administered intraductally with AAV8-hINS1.9-HNF1A_? or AAV8-hIns385-HNF1A_a vectors. A control group administered intraductally with PBS served as control. Mice treated intraductally with AAV8-hINS1.9-HNF1A_a or AAV8-hIns385-HNF1A_a vectors showed increased expression levels of HNF1A in islets (
Example 8. Reversal of MODY3
[0345] Antidiabetic therapeutic efficacy of AAV8-hIns385-HNF1A_a vectors was evaluated in the MODY3 KI mouse model. Wild type (WT) mice were used as healthy controls, and homozygous KI mice administered with PBS served as MODY3 disease controls. Noticeably, KI MODY3 mice treated with AAV8-hIns385-HNF1A_a vectors showed counteraction of the mild hyperglycemia characteristic of the disease model (
Example 9. MODY3 Mice Exhibited Reduced Islet Insulin Content and Impaired Insulin Secretion
[0346] To further phenotype MODY3 KI mice, insulin secretion was evaluated both in vitro and in vivo. To this end, islets from male wild-type and MODY3 mice were incubated with low (1.6 mM) or high glucose (16 mM) and insulin content in islets as well as in the culture medium was analyzed. Islets from MODY3 mice showed decreased insulin content and reduced secretion of insulin into the culture medium at low glucose (
Example 10. Increased HNF1A Expression and Protein Content in Islets from MODY3 Mice Treated with AAV8-hIns385-HNF1A_a Vectors
[0347] HNF1A expression levels and protein content were analyzed in islet samples from 14 to 16-week-old male wild-type, MODY3 and MODY3 mice treated with AAV8-hINS385-mmHNF1? vectors. MODY3 mice treated with AAV8-hIns385-HNF1A_a vectors showed markedly increased HNF1A expression levels and HNF1A protein content in islets compared with MODY3 mice treated intraductally with PBS (
Example 11. MODY3 Mice Treated with AAV8-hIns385-HNF1A_a Vectors Exhibited Improved Fasted Mild Hyperglycemia
[0348] In agreement with counteraction of mild fed hyperglycemia (
Example 12. Reversal of MODY3 at Lower AAV Dose
[0349] Next, antidiabetic therapeutic efficacy of AAV8-hIns385-HNF1A_a vectors was evaluated in the MODY3 KI mouse model at a lower dose. Wild type (WT) mice were used as healthy controls, and homozygous KI mice administered with PBS served as MODY3 disease controls. Noticeably, MODY3 KI mice treated with AAV8-hIns385-HNF1A_a vectors at 10.sup.11 vg/mouse showed counteraction of the mild hyperglycemia characteristic of the disease model (
Example 13. Downregulation of Hn4a Expression in Islets from MODY1 Mice
[0350] Hnf4a expression levels were analyzed using two different primer pairs in islet samples from 12-14-week-old MODY1 mice. Homozygous MODY1 mice showed significantly reduced Hnf4a expression levels in islets (
Example 14. Maintenance of Body Weight in MODY1 Mice
[0351] Weekly measurements of the body weight of wild-type (WT/WT) and homozygous MODY1 (KI/KI) mice of either sex show no changes in body weight gain over the period of 6-24 weeks (
Example 15. MODY1 Mice Showed Downregulation of HNF4A Target Gene Slc2a2 in Islets
[0352] HNF4A was shown to regulate the expression of genes involved ?-cell function, among them Slc2a2, which encodes for the glucose transporter 2 (Wang H. et al. (2000), J. Biol. Chem. 275(47), 35953-35959). The expression of Slcs2a2 was significantly downregulated in islets from homozygous MODY1 (KI/KI) compared to islets from wild-type (WT/WT) littermates (
Sequences
[0353]
TABLE-US-00006 SEQ ID NO: Description of the sequence 1 Nucleotide sequence of homo sapiens HNF1A 2 Nucleotide sequence of homo sapiens HNF4A 3 Nucleotide sequence of mus musculus HNF1A 4 Nucleotide sequence of mus musculus HNF4A 5 Nucleotide sequence of canis lupus familiaris HNF1A 6 Nucleotide sequence of canis lupus familiaris HNF4A 7 Target sequence of mir-375 8 sgRNA for MODY3 model 9 sgRNA for MODY1 model 10 rat insulin promoter 1 11 rat insulin promoter 2 12 full-length human insulin promoter (hINS1.9) 13 positions ?385 to ?1 in the human insulin promoter 14 RIPI-HNF1A gene construct 15 RIPII- HNF1A gene construct 16 hIns1.9- HNF1A gene construct 17 hIns385- HNF1A gene construct 18, 19 Forward and reverse primers targeting exon 10 and the 3 UTR of the HNF4A gene 20, 21 Forward and reverse primers targeting exon 10 and the 3 UTR of the HNF1A gene 22, 23 Rplp0 forward and reverse primers 24, 25 L-PK forward and reverse primers 26, 27 HNF4a forward and reverse primers 28, 29 HNF1a forward and reverse primers 30, 31 Slc2a2 forward and reverse primers 32, 33 Atp5b forward and reverse primers 34, 35 Rpl13a forward and reverse primers 36, 37 Hnf4a_1 forward and reverse primers 38, 39 Hnf4a_2 forward and reverse primers 40, 41 Slc2a2 forward and reverse primers