Baculovirus expression systems

Abstract

The present invention relates to an optimized baculovirus construct useful for the production of virus(-like) particles or viral vectors, in particular viral vectors for gene therapy.

Claims

1. A method for producing a recombinant adeno-associated virus (rAAV) vector, comprising infecting a cell with one or several recombinant baculovirus(es), each baculovirus comprising a recombinant baculovirus genome harboring a heterologous sequence; wherein the heterologous sequence from each of the one or several recombinant baculovirus(es) encodes a different part of said rAAV vector; and wherein each of the one or several recombinant baculovirus(es) comprises a recombinant baculovirus genome comprising the p26 and p74 baculoviral genes, and wherein the baculoviral genes cathepsin, chitinase and p10 are disrupted in each of the one or several recombinant baculovirus(es).

2. The method according to claim 1, wherein the one or several recombinant baculovirus(es) encode a recombinant AAV genome, recombinant Rep protein and recombinant Cap protein.

3. The method according to claim 1, wherein the p10 gene is disrupted without deleting the p10 promoter.

4. The method according to claim 1, wherein the cell is an insect cell.

5. The method according to claim 1, wherein the genome(s) of the one or several baculovirus(es) is derived from Autographa californica nuclear polyhedrosis virus (AcMNPV).

6. The method according to claim 1, comprising infecting the cell with three baculoviruses: (i) a baculovirus encoding the AAV Rep protein, (ii) a baculovirus encoding the AAV Cap protein; and (iii) a baculovirus encoding the AAV-Inverted Terminal Repeats (AAV-ITRs) genome comprising a gene of interest between the two AAV-ITRs.

7. The method according to claim 1, comprising infecting the cell with two baculoviruses: (i) a baculovirus encoding the AAV Rep protein and the AAV Cap protein; and (ii) a baculovirus encoding the AAV-ITR genome comprising a gene of interest between the two AAV-ITRs.

8. A method for producing an rAAV vector, comprising infecting an insect cell with three recombinant baculoviruses: (i) a baculovirus encoding the AAV Rep protein, (ii) a baculovirus encoding the AAV Cap protein; and (iii) a baculovirus encoding the AAV-ITR genome comprising a gene of interest between the two AAV-ITRs; wherein each of the recombinant baculoviruses comprises a recombinant baculovirus genome derived from the AcMNPV genome comprising the p26 and p74 baculoviral genes, wherein the baculoviral genes cathepsin, chitinase and p10 are disrupted in each of the recombinant baculoviruses, and wherein the p10 gene is disrupted without deleting the p10 promoter.

9. A method for producing an rAAV vector, comprising the step of infecting an insect cell with two recombinant baculoviruses: (i) a baculovirus encoding the AAV Rep protein and the AAV Cap protein; and (ii) a baculovirus encoding the AAV-ITR genome comprising a gene of interest between the two AAV-ITRs; wherein each of the recombinant baculoviruses comprises a recombinant baculovirus genome derived from the AcMNPV genome comprising the p26 and p74 baculoviral genes, wherein the baculoviral genes cathepsin, chitinase and p10 are disrupted in each of the recombinant baculoviruses, and wherein the p10 gene is disrupted without deleting the p10 promoter.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. Schematic map of the AcMNPV bacmid deleted of chitinase, cathepsin, and the p10 ORF, leaving the p10 promoter intact (CCp10) or in combination with a deletion of the p26, p10, and p74 genes (CCp26p10p74).

(2) The AcMNPV bacmid has been inactivated for the chitinase, cathepsin, and p10 or p26, p10, p74 genes. The AAV rep2/cap8 expression cassette is inserted at the Tn7 site of the bacmid. On the same bacmid backbone, the rAAV gene (mSeAP in this example) is transferred at the Tn7 site.

(3) FIG. 2. rAAV viral genome determination in bulk and purified samples.

(4) rAAV productivity has been assessed in bulk samples or purified product samples originating from production performed with wt-; CCp10-; CCp26p10p74-baculovirus backbones.

(5) rAAV titers are quantified through QPCR and expressed as viral genomes per mL (vg/mL)/mL (blue bars), contaminating baculovirus titers are quantified through QPCR in vg/ml (red dots). (a) rAAV bulk samples (b) immuno-affinity purified rAAV.

(6) FIG. 3. Characterization of purified rAAV vectors.

(7) Immuno-affinity purified rAAV vectors are analyzed through SDS-PAGE followed by Coomassie Blue staining (a) or Western blotting of the AAV VP proteins (b).

(8) 1: AAV-mSeAP (510.sup.10 vg) produced with baculovirus WT

(9) 2: AAV8-mSeAP (510.sup.10 vg) produced with baculovirus CCp26p10p74

(10) 3: AAV8-mSeAP (510.sup.10 vg) produced with baculovirus CCp10

(11) FIG. 4. In vivo evaluation of rAAV vectors.

(12) rAAV8-mSeAP produced either with WT or CCp26p10p74 or CCp10 baculoviruses was injected intramuscularly into mice at 10.sup.9 vg (n=4). (a) Time course expression of seric mSeAP is measured. (b) Histological analysis of mSeAP expression. Muscle sections (8 M) were prepared and analyzed for mSeAP localization. (c) rAAV genome quantification in transduced muscle.

EXAMPLES

Materials and Methods

(13) Baculovirus Gene Deletions

(14) Deletion of cathepsin and chitinase from the wild type AcMNPV bacmid was performed from the E. coli DH10Bac strain containing the AcMNPV bacmid (Luckow et al., 1993) and transformed with plasmid pKD46 (Datsenko & Wanner, 2000). A PCR product necessary for the cathepsin/chitinase gene inactivation was generated with primers CC-KO-F and CC-KO-R (Table 1) using pCRTopo-lox-CAT-lox as template (Marek et al., 2011). Gene inactivation was performed according to Marek et al., 2011 and assessed using primers chitinase-105625F and cathepsin-107849R (Table 1). CAT gene marker removal from cathepsin/chitinase null bacmid (AcbacCCcat) was performed as described (Marek et al., 2011) and was verified through PCR and sequencing, using the previously described primers. Second gene inactivation to remove the p10 coding sequence from AcbacCCcat was performed in the same manner, with a PCR product generated with primer pairs p10-KO-F/p10-KO-R (Table 1). Verification of the correct gene inactivation was performed using PCR and sequencing with primer pairs p10-118725-F/p10-119259-R (Table 1). This second gene inactivation led to cathepsin/chitinase/p10 null bacmid (AcbacCCp10), with an intact p10 promoter. Alternatively, the second gene inactivation of the neighboring genes p26-, p10, and p74 in AcbacCCcat was performed in a similar manner, with a PCR product generated with primer pairs p26-KO-F/p74-KO-R (Table 1). Verification of the correct gene inactivation was performed using PCR and sequencing with primer pairs p26-117989-F/p74-121176-R (Table 1). The latter gene inactivation led to cathepsin/chitinase/p26/p10/p74 null bacmid (AcbacCCp26p10p74).

(15) Insertion of AAV Rep/Cap Genes and Recombinant AAV Genome into Bacmid by Transposition

(16) E. coli DH10Bac cells containing wild-type bacmid and E. coli DH10 cells containing AcbacCCp10 or AcbacCCp26p10p74 were transformed with plasmid pMON7124 (Luckow et al., 1993). Transposition was then performed according to the manual of the Bac-to-Bac system (Invitrogen) in to all these three bacmids with plasmid pFBD-mSeAP, encoding a murine secreted alkaline phosphatase reporter gene (mSeAP) controlled by a CMV promoter and flanked by Inverted Terminal Repeats (ITRs) of AAV2, Transposition was also performed with plasmid pSR660 encoding AAV2 rep78/52 gene under the polyhedrin very-late promoter and the AAV8 cap gene under the p10 very-late promoter (Smith et al., 2009) Efficient recombination into the bacmid genome was verified according to the Bac-to-Bac protocol. This resulted in three sets of two bacmids for the production of rAAV particles carrying ITR-mSeAP DNA, each set with a different baculoviral genomic backbone (wt, AcbacCCp10, or AcbacCCp26p10p74).

(17) Cell Line, Baculovirus and rAAV Production

(18) Sf9 cells in suspension culture were grown at 27 C. in SF900II medium (Invitrogen) in 1 L Bellco spinner flasks. Baculoviruses were generated according to the guidelines of the Bac-to-Bac protocol from the deleted bacmids and the recombinant bacmids described above and were amplified in suspension cultures of Sf9 cells in 100 mL Bellco spinners. rAAV production was performed by dual infection of Sf9 cells with baculoviruses harboring the recombinant AAV genome (ITR-mSeAP) and AAV rep2/cap8 genes, each at an MOI of 1.6 in 70 mL of Sf9 cell culture seeded at 10.sup.6 cells/mL in 100 mL Bellco spinners. At 72 h post-infection, 1 mL of the total culture was recovered for direct quantification of rAAV production prior to purification and then stored at 80 C.

(19) rAAV Purification and Characterization

(20) rAAV was purified from bulk on Immuno-affinity AVB sepharose medium (GE Healthcare) accordingly to (Smith et al., 2009). 510.sup.10 viral genome (vg) of purified rAAV vectors were run on SDS-PAGE Bis-Tris 4-12% (Nu-PAGE, Invitrogen), and either directly coomassie stained or transferred to Nitrocellulose membrane (iBlot gel transfer stack nitrocellulose, Invitrogen) prior to immuno detection (see below Western blotting).

(21) Determination of rAAV Genome Titer

(22) A quantitative PCR assay was performed directly on the total culture samples or purified rAAV samples to determine rAAV titer (viral genome per mL of production). Viral DNA was extracted directly from bulk or purified samples using MagNA Pure DNA and viral RNA small volume kit (MagNA Pure 96, Roche). The plasmid used as reference contains the two ITRs of AAV2 and the baculovirus DNA polymerase gene. Serial dilutions were performed to calculate the final copy number of the analyzed sample and a positive control was used to assess efficient titration. Titrations were performed at the same time on the same plate by an independent operator.

(23) Western Blot

(24) Baculovirus bulk samples or purified rAAV8 samples were analyzed through Western blot for AAV VP and Rep proteins.

(25) Anti VP primary antibody is a mouse IgG1 clone B1 (Progen) used in a 1/250.sup.th dilution. Anti Rep primary antibody is a mouse IgG1 clone 303.9 (Progen) used in a 1/100.sup.th dilution. Secondary antibody is a goat anti-mouse Dye 680 (LI-COR) used in a 1/5000.sup.th dilution. Incubation was performed in infrared imaging system blocking buffer (LI-COR) and revelation was performed on the Odyssey system (LI-COR). Intensities of fluorescence were quantified with Odyssey 2.1 software.

(26) In Vivo Injection, Sample Collection and mSeAP Quantification

(27) rAAV vectors, 10.sup.9 vg in 25 L of phosphate buffered saline, were injected intra-muscularly into the left Tibialis Anterior (TA) muscle of C57black6 mice, 6 weeks old (n=4 per vector). Blood samples were collected from injected mice at 3, 7, 14, 21, 28, 35 days post-injection, for mSeAP seric quantification. At day 35, the animals were sacrificed and TA muscles, left and right were collected and frozen before histological and enzymatic assays.

(28) All mice were handled according to directive 2010/63/EU on the protection of animals used for scientific purposes. A mSeAP dosage assay was performed with 12.5 L of mouse serum. mSeAP quantification was realised using the Phospha-Light System kit (Applied Biosystems). Samples were read on a Victor II Luminometer apparatus. Expression levels are expressed as ng of mSeAP per ml, of serum using a standard curve of purified human placental alkaline phosphatase (Applied Biosystems).

(29) Histological Analysis of mSeAP Expression

(30) Muscle sections (8 M) were prepared and analyzed for mSeAP localization using the Nitro Blue Tetrazolium/5-Bromo-4-Chloro-3-Indolyl-Phosphate method, as described before (Riviere et al., 2006). Muscle sections were counterstained with nuclear fast red, and inflammation and muscle integrity were evaluated by hematoxylin-eosin staining and light microscopy analysis.

(31) Detection of rAAV Genome In Vivo

(32) Total DNA samples were extracted from mouse muscle using FastDNA kit (QBIOgene) on a FastPrep apparatus (QBIOgene). rAAV genome titration was performed using QPCR as described in previous section. Normalization was performed using quantification of the titin gene.

(33) Statistical Analysis

(34) Statistical significance of seric mSeAP expression at 35 days following rAAV injection was evaluated. Group comparisons were performed. Variance analysis were performed through Fischer test (=0.05), followed by Student test (=0.05) using Excel program.

(35) Results:

(36) Generation of Baculoviruses Deleted for the Chitinase, Cathepsin, Together with the p10 or the p26, p10, and p74 Genes.

(37) In order to remove multiple genes, sequential deletions need to be introduced in the AcMNPV bacmid. A well-known and established method to investigate gene functions is the manipulation of a baculovirus genome in bacteria by homologous recombination using ET (E. coli. RecE & RecT proteins) or lambda red based recombination directed at a single gene, which is then replaced by an antibiotic selection marker (Datsenko & Wanner, 2000). In order to prepare multiple deletions within the same genome, several different selection markers need to be used or the selection marker needs to be flanked by unique restriction sites, allowing removal after each gene deletion, by digestion and re-ligation. A strategy derived from a method to make deletions/insertions in a bacterial genome (Suzuki et al., 2007; Suzuki et al., 2005) has been adapted for bacmid technology (Marek et al., 2011). After replacement of the first gene with the chloramphenicol acetyl transferase antibiotic marker by homologous recombination, the marker can be removed due to the presence of loxP sites at both ends of the marker. In the setup used, two modified loxP sites are used (lox66 and lox71), each with a different mutation. After recombination by cre-recombinase a lox72 site is left (Lambert et al., 2007), which has now two mutations instead of one, and can no longer be recognized by the cre-recombinase. This allows the subsequent deletion of a second target gene. This method was tested in a bacmid set up to serially remove in two steps the chi/v-cath (deleted nucleotides 105282-107954 according to AcMNPV genetic map (Ayres et al., 1994)) and p10 (deleted nucleotides 118839-119121) or p26/p10/p74 (deleted nucleotides 118044-121072) genes. These deletions were assessed by PCR and sequencing. Sf9 cells were transfected successfully with each of the deletion bacmid DNAs. 96 h post-infection visible signs of baculovirus infection (disruption of the cell layers, higher Sf9 cells diameter and mortality) were observed indicating infectivity of both the AcCCp10 and AcCCp26p10p74 baculoviruses.

(38) Prior to transposition of AAV2 rep gene under the polh and AAV8 cap gene under p10 promoter and AAV-mSeAP sequences in AcCCp10, E. coli DH10 cells, containing the different bacmid constructs, were transformed with plasmid pMON7124 (Luckow et al., 1993) to mediate efficient recombination from transfer vectors containing the constructs of interest into the Tn7 site of the bacmid (FIG. 1).

(39) Following recombination, and prior to bacmid DNA transfection into the Sf9 cells, the absence of non-recombinant bacmid was verified.

(40) The baculoviruses were plaque purified and amplified for two passages. No difference was observed in terms of baculovirus titers (pfu/ml) or AAV VP and Rep protein levels between the recombinant wt-, CCp10, and CCp26p10p74 baculoviruses. The baculoviruses were then used to perform rAAV production.

(41) the Deletion of Chitinase, Cathepsin and p10 Genes does not Improve rAAV Productivity in Sf9 Cells.

(42) Standard rAAV vector productions were performed in spinner cultures clearly showing that the production of recombinant baculovirus, either of the wild-type or the CCp10-type or the CCp26p10p74-type, was comparable leading to titers of 2.0910.sup.11 and 1.3010.sup.11 and 2.1110.sup.11 vg/mL, respectively. Equally, the production of AAV (model transgene: mSeAP) was practically similar when both baculoviruses are used, leading to titers of 1.2710.sup.10, 1.3210.sup.10 and 1.4010.sup.10 vg/mL, respectively (FIG. 2A). The purification of AAV using AVB chromatography led to increases in titer to 4.2510.sup.12 and 2.4710.sup.12, 3.5210.sup.12 vg/mL, respectively (FIG. 2B).

(43) These results indicate that the removal of some non-essential baculovirus genes from the baculovirus backbone has no impact on the production and purification of AAV vectors.

(44) the Use of a Baculovirus Deleted of Chitinase, Cathepsin and p10 or p26, p10, p74 Genes Reduces rAAV Particle Degradation.

(45) The absence of the chitinase, cathepsin, in combination with a p10 ORF deletion or a deletion of the p26, p10 and p74 genes had a beneficial effect on AAV-vector integrity. Most likely, the absence of protease activity (cathepsin) derived from the baculovirus led to reduced vector particle degradation as shown by SDS-PAGE and Western blot (WB) analysis (FIG. 3). These analytical methods clearly indicated the disappearance of at least three VP-specific contaminating degradation bands. The major contaminating degradation band of the three bands is localized closed to VP3 (FIG. 3). The use of CCp10 or CCp26p10p74 baculoviruses instead of wt-baculoviruses thus leads to reduced rAAV vector degradation and to the disappearance of several VP degradation products.

(46) rAAV Particles Produced Using a Baculovirus Deleted of Chitinase, Cathepsin and p10 or p26, p10, p74 Genes Display Higher Infectivity In Vivo.

(47) The disappearance of certain sub-sized protein bands in the WB when using the CCp10 or CCp26p10p74 baculoviruses signifies that the rAAV vector particle is less degraded and may have a better integrity, suggesting that the in vivo infectivity/potency may be improved. In fact when injecting purified rAAV-mSeAP particles produced with the three different baculovirus backbones (wt, CCp10 and CCp26p10p74) intra-muscularly into mice (C57Black6), mSeAP activity was observed in the serum about 1 week after injection. The activity increased to plateau levels of about 5.8 ng/mL, 23.2 ng/mL, and 9.3 ng/mL when using the wt-backbone, CCp10- and CCp26p10p74-backbones for AAV production, respectively, at 3 weeks post-injection (FIG. 4A). The difference is in the order of a factor 4 when using the CCp10-baculovirus backbone for rAAV production, compared to wt-baculovirus backbone (p=0.01). The difference is in the order of a factor 2 when using CCp26p10p74-backbone in place of the wt-backbone (p=0.05).

(48) Thirty-five days after injection, the mice were sacrificed and the injected muscles were histologically analyzed. As for the increased serum levels of mSeAP activity, the mice injected with rAAV produced with the CCp10 baculovirus showed a considerably increased mSeAP activity in the transduced muscle tissue in comparison to those mice injected with rAAV produced with the wt-baculovirus system. The mSeAP activity in the muscle tissue transduced with rAAV produced with CCp26p10p74 was found in the middle range compared to the rAAV produced with the two other baculovirus backbones (FIG. 4B). The increased mSeAP activity observed with rAAV produced with the CCp10 baculovirus is correlated with an increase in rAAV genome copy number delivered to the TA muscle cells as shown by quantitative PCR (FIG. 4C), illustrating that 3.25 more genome copies were delivered compared to the wt production system. In a similar manner, evaluation of the rAAV genome copy number delivered to the TA muscle cells following production with CCp26p10p74 baculovirus led to a 2 fold increase compared to the use of rAAV produced with wt-baculovirus backbone (FIG. 4C). These values are in good accordance with the mSeAP activity levels obtained with the various baculovirus vectors.

REFERENCES

(49) Ayres M D, Howard S C, Kuzio J, Lopez-Ferber M, Possee R D (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202(2): 586-605. Carbonell L F, Hodge M R, Tomalski M D, Miller L K (1988). Synthesis of a gene coding for an insect-specific scorpion neurotoxin and attempts to express it using baculovirus vectors. Gene 73, 409-18. Datsenko K A, Wanner B L (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS 97(12): 6640-6645. Friesen P D & Miller L K (1986). The regulation of baculovirus gene expression in: The Molecular Biology of Baculoviruses (W. Doerfler and P. Boehm, eds.) Springer-Verlag, Berlin, pp. 31-49. Hitchman R B, Possee R D, Crombie A T, Chambers A, Ho K, Siaterli E, Lissina O, Sternard H, Novy R, Loomis K, Bird L E, Owens R J, King L A (Epub 2009 Aug. 5) Genetic modification of a baculovirus vector for increased expression in insect cells. Cell Biol Toxicol. Kaba S A, Salcedo A M, Wafula P O, Vlak J M, van Oers M M (2004). Development of a chitinase and v-cathepsin negative bacmid for improved integrity of secreted recombinant proteins. J Virol Methods 122(1): 113-118. Lambert J M, Bongers R S, Kleerebezem M (2007). Cre-lox-Based System for Multiple Gene Deletions and Selectable-Marker Removal in Lactobacillus plantarum. Appl Environ Microbiol 73(4): 1126-1135. Lebacq-Verheyden A M, Kasprzyk P G, Raum M G, Van Wyke Coelingh K, Lebacq J A, Battey J F. (1988). Posttranslational processing of endogenous and of baculovirus-expressed human gastrin-releasing peptide precursor. Molecular and Cell Biology 8, 3129-35. Luckow V A, Summers M D (1988). Trends in the development of baculovirus expression vectors. Bio Technology 6, 47-55. Luckow V A, Lee S C, Barry G F, Olins P O (1993). Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J Virol 67(8): 4566-4579. Lynn D E (2007). Available lepidopteran insect cell lines. In Methods Mol Biol, pp. 117-137. Maeda S, Kawai T, Obinata M, Fujiwara H, Horiuchi T, Saeki Y, Sato Y, Furusawa M. (1985). Production of human alpha-interferon in silkworm using a baculovirus vector. Nature 315, 592-4. Manno C S, Pierce G F, Arruda V R, Glader B, Ragni M et al. (2006). Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med 12(3): 342-347. Marek M, van Oers M M, Devaraj F F, Vlak J M, Merten O W (2011). Engineering of baculovirus vectors for the manufacture of virion-free biopharmaceuticals. Biotechnol Bioeng 108(5): 1056-1067. Martin B M, Tsuji S, LaMarca M E, Maysak K, Eliason W, Ginns E I (1988). Glycosylation and processing of high levels of active human glucocerebrosidase in invertebrate cells using a baculovirus expression vector. DNA 7, 99-106. McKenna K A, Hong H, van Nunen, Granados R R (1989). Establishment of new Trichoplusia ni cell lines in serum-free medium for baculovirus and recombinant protein production. Journal of Invertebrate Pathology 71, 82-90. Mendell J R, Rodino-Klapac L R, Rosales X Q, Coley B D, Galloway G et al. (2010). Sustained alpha-sarcoglycan gene expression after gene transfer in limb-girdle muscular dystrophy, type 2D. Ann Neurol 68(5): 629-638. Miller D W, Safer P, Miller L K (1986). in Genetic Engineering: Principles and Methods Vol. 8 (eds Setlow, J. & Hollaender, A.) Plenum Publishing, New York, pp. 277-298. Miller L K (1988). Baculoviruses as gene expression vectors. Annual Review Microbiology. 42, 177-99. Miyajima A, Schreurs J, Otsu K, Kondo A, Arai K, Maeda S (1987). Use of the silkworm, Bombyx mori, and an insect baculovirus vector for high-level expression and secretion of biologically active mouse interleukin-3 Gene 58, 273-81. Simonelli F, Maguire A M, Testa F, Pierce E A, Mingozzi F et al. (2010). Gene Therapy for Leber's Congenital Amaurosis is Safe and Effective Through 1.5 Years After Vector Administration. Mol Ther 18(3): 643. Smith G E, Ju G, Ericson B L, Moschera J, Lahm H W, Chizzonite R, Summers M D (1985). Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector. Proceedings National Academy of Sciences USA 82, 8404-8. Smith G E, M D Summers (1979). Restriction maps of five Autographa californica nuclear polyhedrosis virus (MNPV) variants, Trichoplusia ni MNPV and Galleria mellonella MNPV DNAs with endonucleases SmaI, KpnI, BamHI, SacI, XhoI, and EcoRI. J. Viol. 30:828-838. Smith R H, Levy J R, Kotin R M (2009). A Simplified Baculovirus-AAV Expression Vector System Coupled With One-step Affinity Purification Yields High-titer rAAV Stocks From Insect Cells. Mol Ther 17(11): 1888-1896. Suzuki N, Nonaka H, Tsuge Y, Inui M, Yukawa H (2005). New multiple-deletion method for the Corynebacterium glutamicum genome, using a mutant lox sequence. Appl Environ Microbiol 71(12): 8472-8480. Suzuki N, Inui M, Yukawa H (2007). Site-directed integration system using a combination of mutant lox sites for Corynebacterium glutamicum. Appl Microbiol Biotechnol 77(4): 871-878. Van Oers M M (2011). Opportunities and challenges of the baculovirus expression system. Journal of Invertebrate Pathology (in press). Vlak J M, Klinkenberg F A, Zaal K J, Usmany M, Klinge-Roode E C, Geervliet J B, Roosien J, van Lent J W (1988). Functional studies on the p10 gene of Autographa californica nuclear polyhedrosis virus using a recombinant expressing a p10-beta-galactosidase fusion gene. Journal of General Virology 69, 765-76. Westenberg M, Bamps S, Soedling H, Hope I A, Dolphin C T (2010). Escherichia coli MW005: Lambda Red-mediated recombineering and copy-number induction of oriV-equipped constructs in a single host. BMC Biotechnol 10.

SEQUENCE LISTING

(50) TABLE-US-00001 TABLE1 Primersequencesusedinthisstudy Primer Sequence5 to3 Purpose* CC-KO-F CCGCTGTTGAAACAATATTTTATAATACCCTGTTTATAGTTAACAAT chitinase/cathepsin GTCGGCAGCGTCTATGGCCATAGGAATAGGGCCTACCGTTCGTATAA geneinactivationnt TGTATGCTATACGAAGTTAT(SEQIDNO:1) 105771-107700 CC-KO-R CCGCTGTTGAAACAATATTTTATAATACCCTGTTTATAGTTAACAAT GTCGGCAGCGTCTATGGCCATAGGAATAGGGCCTACCGTTCGTATAA TGTATGCTATACGAAGTTAT(SEQIDNO:2) chitinase- CGCGGCCGTACATGGCGACGCCCA(SEQIDNO:3) Verification 105625F cathepsin- GTTTTTAAAGGTCCAATATGGAATG(SEQIDNO:4) Verification 107849R p10-KO-F TTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTAC p10codingsequence AATCTACCGTTCGTATAGCATACATTATACGAAGTTAT inactivation(start (SEQIDNO:5) codontostopcodon) nt118839-119121 P10-KO-R GAATCGTACGAATATTATAAAACAATTGATTTGTTATTTTAAAAA CGATTTACCGTTCGTATAATGTATGCTATACGAAGTTAT (SEQIDNO:6) p10-118725-F CCGGGACCTTTAATTCAACCCAACA(SEQIDNO:7) Verification p10-119259-R CAGCATTTGTTATACACACAGAACT(SEQIDNO:8) Verification M13PUCF CCAGTCACGACGTTGTAAAACG(SEQIDNO:9) Verificationof transposedbacmids M13PUCR AGCGGATAACAATTTCACACAGG(SEQIDNO:10) Verificationof transposedbacmids Genta AGCCACCTACTCCCAACATC(SEQIDNO:11) Verificationof transposedbacmids *Baculovirus numbering is according to Ayres et al., 1994