Method and reagent for constructing nucleic acid double-linker single-strand cyclical library
10479991 ยท 2019-11-19
Assignee
Inventors
- Yuan Jiang (Shenzhen, CN)
- Qiaoling LI (Shenzhen, CN)
- Andrei ALEXEEV (Woodland, CA, US)
- Evan Hurowitz (Mountain View, CA)
- Xia ZHAO (Shenzhen, CN)
- Tong WANG (Shenzhen, CN)
- Chao DONG (Shenzhen, CN)
- Dong LI (Shenzhen, CN)
- Radoje Drmanac (Los Altos Hills, CA)
- Wenwei Zhang (Shenzhen, CN)
- Hui Jiang (Shenzhen, CN)
Cpc classification
C12N15/1093
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
B01J19/0046
PERFORMING OPERATIONS; TRANSPORTING
C40B50/18
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C40B50/06
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
B01J19/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
A method and reagent for constructing a nucleic acid double-linker single-strand cyclic library. The method comprises: breaking a nucleic acid into nucleic acid fragments; connecting a first linker sequence; producing by amplification a first product provided with the first linker sequence at either end, where a U nucleobase site is provided on primer sequences and a nicking enzyme recognition sequence is either provided or not provided on same, and a first affinity tag is provided on one of the primer sequences; using USER enzyme to cleave the first product; cyclizing the cleaved first product; treating the cyclization product with either a phosphatase or a nicking enzyme; using a solid-phase vector for combination with a cyclized molecule; performing a restrictive gap translation reaction; removing by digestion any portion that did not undergo the restrictive gap translation reaction; connecting a second linker sequence; producing by amplification a second product provided with the second linker sequence at either end; denaturing the second product, and cyclizing a single-strand nucleic acid molecule. The method allows an increase in the length of library insert fragments, a simplified library construction process, reduced library construction time, and reduced library construction costs.
Claims
1. A method for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, comprising the following steps carried out in the following order: (1) disrupting a nucleic acid into nucleic acid fragments for library construction and selecting disrupted fragments using magnetic bead purification or gel recovery; (2) subjecting the fragments to dephosphorylation and end repairing reactions; (3) ligating a 5 adaptor A sequence to the fragments, wherein the 5 adaptor A sequence comprise a strand with 5 end phosphorylation modification and the other strand with 3 end dideoxy modification and uracil (U) base sites; (4) performing a one-step reaction of Uracil-Specific Excision Reagent enzyme digestion and phosphorylation using Uracil-Specific Excision Reagent (USER) enzyme and T4 polynucleotide kinase; (5) ligating a first 3 L-type adaptor sequence to the 5 end of each strand of the phosphorylated nucleic acid fragments; (6) performing a first polymerase chain reaction (PCR) amplification to obtain first products having the first adaptor sequence at both ends, wherein the primer sequences used in the first PCR have a U base site and have a nickase recognition sequence, and one of the primers has a biotin label; followed by purification using magnetic beads; (7) digesting the first products with a Uracil-Specific Excision Reagent (USER) enzyme to remove the U base site in the primer sequences to generate sticky ends and generate or do not generate a gap; (8) performing a double-stranded cyclization of the digested first products to generate cyclic nucleic acid molecules, which having a nickase recognition sequence on one strand and a gap on the other strand or having a nickase recognition sequence but not a gap on both strands, such that cyclization occurs due to the complementarity of the sticky ends to generate cyclized nucleic acid molecules; (9) performing linear digestion by treating the cyclic nucleic acid molecules having a nickase recognition sequence on one strand and a gap on the other strand or having a nickase recognition sequence but not a gap on both strands with a nickase to generate a nick; (10) performing magnetic purification by binding the treated cyclic nucleic acid molecules to streptavidin magnetic beads via the biotin label on the cyclic nucleic acid molecules; and allowing a solid phase carrier harboring a second affinity label to bind to the cyclic nucleic acid molecules; (11) enzymatically digesting the nickase recognition sequence with nickase to get a nick on each single-strand to provide an initiation site for controlled nick translation (CNT), wherein the enzymatic reaction proceeds on the magnetic beads without eluting the nucleic acids from the magnetic beads; (12) initiating a controlled nick translation reaction from the nick and/or gap by using the cyclic nucleic acid molecules bound to the streptavidin magnetic beads, wherein in the controlled gap translation reaction, the length of the gap translation fragments generated is controlled by controlling at least one factor selected from the group consisting of the molar ratio of deoxynucleotide triphosphates (dNTPs) to the nucleic acid molecules as template, the enzymatic reaction temperature, and the enzymatic reaction time, to generate nucleic acid fragments with a length in the range of 50-250 base pairs (bp); (13) digesting and removing the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled gap translation reaction to obtain linear nucleic acid molecules; (14) ligating a second adaptor sequence bubble-type adaptor comprising a top strand and a bottom strand which are complementary to one another to both ends of the linear nucleic acid molecules, wherein the bottom strand having U base sites; (15) performing Uracil-Specific Excision Reagent (USER) enzyme digestion of the U base site; (16) performing a second polymerase chain reaction amplification to obtain second products having the second adaptor sequence at both ends; (17) denaturing the second products to obtain single-stranded nucleic acid molecules, and cyclizing one of the single-stranded nucleic acid molecules with a mediating sequence complementary to both ends of the single-stranded nucleic acid molecule to obtain the library of single-stranded cyclic nucleic acid fragments having double adaptors to produce nucleic acid fragments in a size range of 50 bp to 250 bp, and wherein the steps of the method provide fragments suitable for next-generation sequencing on a Complete Genomics sequencing platform.
2. The method according to claim 1, wherein the first adaptor sequence comprises a first 5 adaptor sequence and a first 3 L-type adaptor sequence that respectively ligate to the 3 end and the 5 end of each strand of the fragments; the first 5 adaptor sequence comprises a 5 end-phosphorylated long strand and a complementary short strand, the short strand having dideoxy modification at the 3 end, and the short strand comprising a U base site; and a portion of the first 3 L-type adaptor sequence which is adjacent to the ligated fragment is complementary to part of the bases of the first 5 adaptor sequence; and said ligating a first adaptor sequence to both ends of the nucleic acid fragments specifically comprises: dephosphorylating the nucleic acid fragments; subjecting the dephosphorylated nucleic acid fragments to end repairing; ligating the first 5 adaptor sequence to the 3 end of each strand of the nucleic acid fragments; digesting the U base site of the short strand of the first 5 adaptor sequence with a USER enzyme; phosphorylating the USER enzyme-digested nucleic acid fragments; and ligating the first 3 L-type adaptor sequence to the 5 end of each strand of the phosphorylated nucleic acid fragments.
3. The method according to claim 1, wherein each of the primer sequences used in the first PCR has a U base site and a nickase recognition sequence; and after digesting the U base site with the USER enzyme, sticky ends are formed at both ends of the nucleic acid fragments, and cyclization occurs due to the complementarity of the sticky ends, generating cyclized nucleic acid molecules; then a nickase is used to digest the nickase recognition sequence to generate a nick.
4. The method according to claim 1, wherein one of the primer sequences used in the first PCR has two U base sites, while the other primer sequence has a single U base site; and after digesting the U base sites with the USER enzyme, sticky ends are formed at both ends of the nucleic acid fragments, and cyclization occurs due to the complementarity of the sticky ends, generating cyclized nucleic acid molecules.
5. The method according to claim 4, wherein following cyclizing the digested first products, the method further comprises: digesting the nucleic acid molecules that are not cyclized.
6. The method according to claim 4, wherein said digesting and removing the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled gap translation reaction specifically comprises: first degrading the cyclic nucleic acid molecules with a double strand exonuclease until the gaps at both ends meet; and then degrading the resulting single strands with a single strand exonuclease; or directly excising the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled gap translation reaction with an endonuclease.
7. The method according to claim 4, wherein the second adaptor sequence is a bubble-type adaptor sequence, comprising two base sequences which are complementary to each other in terminal portions but not complementary to each other in a middle portion, thus forming a bubble shape in the middle portion; the middle portion harbors a U base site, and one of the strands of the bubble-type adaptor sequence has an overhanging thymine (T base) at the 5 end; and said ligating a second adaptor sequence to both ends of the linear nucleic acid molecules specifically comprises: subjecting the linear nucleic acid molecules to end repairing and to a reaction of adding adenine (A base) to the 3 end; ligating a bubble-type adaptor sequence to each end of the linear nucleic acid molecules by means of pairing of the T base with the A base; and digesting the U base site in the middle portion by using a USER enzyme.
8. The method according to claim 4, wherein following cyclizing the single-stranded nucleic acid molecules, the method further comprises: digesting the single-stranded nucleic acid molecules that are not cyclized.
9. A method for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, comprising the following steps in the following order: (1) disrupting of 1 g of genomic DNA using ultrasound in a 96-well polymerase chain reaction (PCR) plate; (2) selecting nucleic acid fragments by adding magnetic beads to the disrupted DNA and separating the beads on a magnetic rack; (3) dephosphorylation of the fragments using shrimp alkaline phosphatase; (4) end-repairing the fragments using deoxyribonucleotide triphosphates (dNTPs), bovine serum albumin and T4 deoxyribonucleic acid polymerase; (5) ligating a 5 adaptor A sequence using having SEQ ID NO: 1 and a 5 blocking sequence having SEQ ID NO: 2; (6) digesting the products of step (5) in a one-step reaction with Uracil-Specific Excision Reagent (USER) enzyme and phosphorylation using T4 polynucleotide kinase; (7) ligating a first adaptor 3 L-type adaptor A sequence having SEQ ID NO: 3 using T4 DNA ligase; (8) performing a first polymerase chain reaction (PCR) using primer 1 having SEQ ID NO: 4 and primer 2 having SEQ ID NO: 5 followed by purification using magnetic beads; (9) removal of uracil using USER enzyme; (10) double strand cyclization; (11) linear digestion followed by magnetic purification, wherein the initiation site is in the form of a nick, and adaptor A sequence harbors and a nickase recognition sequence; (12) binding cyclic DNA to streptavidin magnetic beads which bind via a biotin label on the DNA; (13) enzymatic digestion with nickase; (14) controlled gap translation reaction using dNTPs and DNA polymerase I; (15) digestion at the gap by T7 endonuclease I; (16) filling of sticky ends and addition of A at the 3 end using Klenow fragment and Klex NTA mix; (17) ligation of a bubble-type adaptor comprising a top strand and a bottom strand, which are complementary to one another having SEQ ID NO: 6 and SEQ ID NO: 7; (18) USER enzyme digestion; (19) performing polymerase chain reaction using primer F and primer R having SEQ ID NO: 8 and SEQ ID NO: 9; (20) single strand cyclization by nucleic acid single strand O via corresponding complementary sequences, wherein the nucleic acid single strand O having SEQ ID NO: 10; and (21) linear DNA digestion using Exonuclease 1 and Exonuclease 3, to produce nucleic acid fragments in a size range of 200 bp to 300 bp, and wherein the steps of the method provide fragments suitable for next-generation sequencing on a Complete Genomics sequencing platform.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE INVENTION
(8) The present invention is described in further detail below by reference to particular embodiments. Unless otherwise stated, the techniques used in the following embodiments are all conventional techniques known to a person skilled in the art, and the instruments, equipments and reagents used are all publicly available, e.g. commercially available, to a person skilled in the art.
(9) In the present invention, the concepts of first and second used in any cases should not be construed as conveying the meaning of order or technique, and they serve only to distinguish the objects to which they refer from other objects.
(10) In the present invention, the first affinity label and the second affinity label can be a component in a biological binding reaction commonly used in biology, such as an antigen or antibody, a strand of a short double-stranded DNA fragment, a biotin or streptavidin, and the like. When an antigen is selected as the first affinity label, an antibody that binds to the antigen is selected as the second affinity label, and vice versa. When a strand of a short double-stranded DNA fragment is selected as the first affinity label, the other strand complementary to the strand is selected as the second affinity label, and vice versa; and when a biotin is selected as the first affinity label, a streptavidin that binds to the biotin is selected as the second affinity label, and vice versa. In an embodiment of the present invention, the first affinity label is a biotin lab el, and the second affinity label is a streptavidin label, both label strongly binding to each other.
(11) Reference is made to
(12) In the method according to the present invention for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, as shown in
(13) In an alternative embodiment of the present invention, a U base site is introduced into the primers for the first PCR, and is digested with a USER enzyme to generate a gap as an initiation point for the controlled gap translation reaction. 3The basic principle underlying the generation of the gap is as shown in
(14) In the present invention, the reaction initiated from the nick and/or gap is referred to as controlled gap translation reaction, because the length of the target fragments generated by the reaction can be controlled in a certain range by controlling the usage amount of dNTPs, the usage amount of the nucleic acid molecules as template, the enzyme reaction temperature and time, among other factors. Nucleic acid fragments having a length in a certain range are suitable for a particular sequencing platform. In general, the length of the target fragments in the present invention is preferably controlled in the range of 50-250 bp. Such a length is several times longer than the length of the target fragments obtained by a conventional library construction protocol for a CG sequencing platform.Moreover, the CNT technique of the present application allows for controlling the library insert fragments in a very narrow range without performing gel recovery, which effectively enhances the operability of the gap translation technique.
(15) Reference is now made to
(16) In a preferred embodiment of the present invention, ligation is performed using an L-type adaptor instead of a conventional adaptor. Reference is now made to
(17) The unique innovations of the present invention are mainly as follows: the enzymatic reactions are performed on streptavidin magnetic beads and can be performed following binding of nucleic acids to the streptavidin magnetic beads, without the need to elute the nucleic acids; and double-stranded nucleic acids having a particular length are generated using controlled gap translation reaction.
(18) The cyclic acid molecules bind to the streptavidin magnetic beads via the biotin label. In each subsequent step of enzymatic reaction, the nucleic acid molecules remain bound to the magnetic beads. Throughout these steps, the enzymes and ions in the reactions can simply be removed by washing operations, in which the double-stranded nucleic acids harboring the biotin label would not be eluted. Only after the second PCR will the double-stranded nucleic acids be denatured into two single strands, and then the single strands not having the biotin label are collected.
(19) In conventional experimental operations of Complete Genomics Corporation, enzymatic reactions are performed in a solution. After each step of enzymatic reaction, the target fragments need to be bound by newly added magnetic beads, the enzymes and buffers and the like in the reaction need to be washed, and finally the target fragments need to be eluted for reaction in the following step. On the contrary, the enzymatic reactions in the present invention are performed on streptavidin magnetic beads, and it suffices to add the magnetic beads once. After the double-stranded nucleic acid molecules bind to the magnetic beads, no multiple and repeated operations of eluting and of adding new magnetic beads for rebinding are needed. The desired target fragments can be collected by a simple washing operation, omitting the fragment purification operation in a number of steps. This not only saves the time in experimental operations, but also decreases the usage amount of magnetic beads, thus reducing the cost. Moreover, as repeated operations of binding and eluting with respect to the samples and the magnetic beads are avoided, the loss of experimental samples is reduced and the yield of the final target fragments is increased. In an embodiment of the present invention, magnetic beads are used as the solid-phase carrier. However, the solid-phase carrier is not limited to magnetic beads, but can also be chips or other solid-phase carriers. The purpose of the present invention is be achieved so long as streptavidin is bound to a solid-phase carrier.
(20) In the conventional library construction process of Complete Genomics Corporation, a III class enzyme digestion site is present on the cyclic DNA. After the III class enzyme recognizes the digestion site, it will digest the cyclic DNA 26 bp from the digestion site, turning the cyclic DNA into two linear DNA fragments. Then the target fragments can be collected by means of binding of the biotin label on the DNA to streptavidin magnetic beads. In such a process, target fragments obtained after digestion are only 26 bp, restricting the fragment size of the library. Moreover, the enzymatic reactions take a long time of up to 16 hours. On the contrary, the present invention employs the gap generated during cyclization, or replaces a III class enzyme recognition site with a nickase recognition site. After the cyclic DNA binds to streptavidin magnetic beads, the two strands are digested, forming a gap or nick respectively thereon. Then the translation of the gap or nick is achieved by virtue of the 5-3 polymerase activity and 3-5 exonuclease activity of a polymerase, such that both strands of the target fragments undergo polymerization-extension starting from the gap or nick in the 5-3 direction, thus increasing the length of library insert fragments. The length of the fragments can be controlled by controlling reaction conditions. The reaction conditions to be controlled include the usage amount of dNTPs, the usage amount of the polymerase, temperature, time, among others. When the dNTPs are depleted, the DNA polymerase will further function as an exonuclease and continue to excise in the 3-5 direction of the strand to generate sufficiently large gaps. At last, the other single strand is excised at the gaps by a single strand endonuclease, forming double-stranded nucleic acids with both ends. The target fragments to be recovered harbor biotin labels, which have already bound to streptavidin magnetic beads, on which enzymatic reactions can be performed. Therefore, the target fragments can be obtained by simple washing operations to remove the enzymes, buffers, etc., in the reactions and then used in subsequent reactions. With this process, the enzymatic reaction takes about 2.5 hours. In comparison with a conventional process, this not only shortens the time, but also increases the length of the final library insert fragments and achieves control over the length of the fragments.
(21) The present invention is illustrated in detail with reference to the following example.
(22) 1. Disruption of genomic DNA: Genomic DNA can be disrupted in a number of methods, and no matter they are a physical ultrasonic method or an enzymatic reaction method, well-established protocols are commercially available. In this example, the physical ultrasonic method was employed for disruption.
(23) A 96-well PCR plate was added with a polytetrafluoroethylene line. 1 g of genomic DNA was added, then TE buffer solution or enzyme-free pure water was added to make up to 100 t. The plate was sealed with a membrane and then placed in an E220 ultrasonic disruptor to conduct ultrasonic disruption. The conditions for disruption were shown in Table 1.
(24) TABLE-US-00001 TABLE 1 Parameter Value Filling factor 21% Pressure (PIP) 500 Pulse factor 500 Disruption 20 s, twice time
(25) 2. Selection of fragments following disruption: A magnetic bead purification method or gel recovery method can be employed. In this example, the magnetic bead purification method was used.
(26) The disrupted DNA was added with 45 L of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. The resulting mixture was placed on a magnetic rack, and supernatant was collected. The supernatant was added with 18 L of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. The resulting mixture was placed on a magnetic rack, and supernatant was aspirated off. The magnetic beads were washed twice with 75% ethanol and air dried. Then 30 L of TE solution was added, and the mixture was mixed well and stood for 7-15 min to allow the recovered products to dissolve.
(27) 3. Dephosphorylation reaction of the fragments: The recovered products from the previous step were used, and a system was formulated according to Table 2.
(28) TABLE-US-00002 TABLE 2 Reaction component Volume (L) 10x NEB buffer 2 3.6 Shrimp alkaline 3.6 phosphatase (1 U/L) Total 7.2
(29) 7.2 L of the reaction solution was added to the recovered products from the previous step. The mixture was mixed well and incubated at 37 C. for 45 min and at 65 C. for 10 min. Then the temperature was ramped down to 4 C. at a rate of 0.1 C. per second.
(30) 4. End repairing of the fragments. A system was formulated according to Table 3.
(31) TABLE-US-00003 TABLE 3 Reaction component Volume (L) Enzyme-free water 7.32 10x NEB buffer 2 1.08 0.1M adenosine triphosphate 0.48 dNTPs (25 mM, Enzymatic) 0.48 Bovine serum albumin (10 mg/ml) 0.24 T4 deoxyribonucleic acid polymerase (3 U/L) 1.2 Total 10.8
(32) The system was mixed well and the products from the previous step were added. The mixture was mixed well and incubated at 12 C. for 20 min. The reaction was purified with 48 L of Ampure XP magnetic beads, and the recovered products were dissolved using 40 L of TE buffer solution.
(33) 5. Ligation of 5 adaptor A sequence: The 5 adaptor A sequence used in this example was as follows (in this example, the sequences are shown in the direction of from 5 end to 3 end from left to right, // represents modification group, phos represents phosphorylation, dd represents dideoxy, bio represents biotin, and the characters in bold represent a tag sequence).
(34) TABLE-US-00004 5 adaptorAsequence: (SEQIDNO:1) /5phos/AAGCTGAGGGTACTGTGTCATAAATAGCACGAGACGTTC TCGACT; 5 blockingsequence: (SEQIDNO:2) TACCCUCAGCT/3ddT/.
(35) A mixed solution of 5 adaptor A (10 M) was formulated according to Table 4.
(36) TABLE-US-00005 TABLE 4 Reaction component Volume (L) 5 adaptor A sequence (100 M) 12 5 blocking sequence (100 M) 10 TE buffer 78 Total 100
(37) 4.5 L of the mixed solution of 5 adaptor A formulated (10 M) was added into the products of the previous step, and the mixture was sufficiently mixed.
(38) A ligation reaction system was formulated according to Table 5.
(39) TABLE-US-00006 TABLE 5 Reaction component Volume (L) Enzyme-free pure water 13.1 2x ligation buffer 1 60 T4 DNA ligase (fast) (600 U/L) 2.4 Total 75.5
(40) The 2 ligation buffer 1 used in this example was formulated according to Table 6.
(41) TABLE-US-00007 TABLE 6 Volume Reaction component (L) 1M tromethamine 37.5 1M citric acid 9.6 1M magnesium chloride 35 1M trisodium citrate 20 100% glycerol 50 10% Tween-80 1 30% polyethylene glycol 8000 333 0.1M adenosine triphosphate 10 0.5M trichloroethyl phosphate 2 (pH 7.0) Enzyme-free pure water 1.9 Total 500
(42) A mixed solution of the ligation reaction system with the adaptor and the products was mixed well, and the mixture was incubated at 25 C. for 30 min and at 65 C. for 10 min, followed by decreasing the temperature to 4 C.
(43) 6. One-step reaction of USER enzyme digestion and phosphorylation: Into the reaction solution from the previous step were added 1.2 L of USER enzyme (1 U/L) and 1.2 L of T4 polynueleotide kinase (10 U/L). The mixture was mixed well and incubated at 37 C. for 20 min. The reaction was purified with 108 L of Ampure XP magnetic beads (Agencourt). The beads were rinsed with 70% ethanol twice, and with the rinsing liquid having been blot up, were air dried at room temperature for 2 min. Then the beads were resuspended in 48 L of a 3 L-type adaptor reaction system.
(44) 7. Ligation of 3 L-type adaptor A sequence: The 3 L-type adaptor A sequence used in this example was as shown below: ACGTTCTCGACUCCTCAGCTT (SEQ ID NO: 3).
(45) The 3 L-type adaptor reaction system was formulated according to Table 7:
(46) TABLE-US-00008 TABLE 7 Reaction component Volume (L) Enzyme-free pure water 28.98 3x ligation buffer 2 16.02 L-type adaptor sequence (100 M) 1.8 T4 DNA ligase (fast) (600 U/L) 1.2 Total 48
(47) The 3 ligation buffer 2 used in this example was formulated according to Table 8.
(48) TABLE-US-00009 TABLE 8 Reaction component Volume (L) polyethylene glycol-8000 (50%) 60 Tris-Cl, pH 7.8 (2M) 7.5 Adenosine triphosphate (100 mM) 3 Bovine serum albumin (10 mg/mL) 1.5 Magnesium chloride (1M) 3 Dichlorodiphenyltrichloroethane 0.15 (DDT) (1M) Enzyme-free pure water 24.9
(49) The Ampure XP magnetic beads resuspended in 48 L of the 3 L-type adaptor reaction system was incubated in an incubator at a rotation speed of 300 rpm at 25 C. for 30 min. After reaction was complete, 43.2 L of Ampure XP magnetic bead binding buffer was added to conduct incubation at room temperature for 10 min. The supernatant was removed and the beads were washed with 70% ethanol twice, followed by air dried at room temperature for 5-10 min. The recovered products were dissolved with 30 L of TE buffer solution.
(50) 8. Polymerase chain reaction:
(51) The sequence of primer 1 was as follows:
(52) TABLE-US-00010 (SEQIDNO:4) AGTCGAGAACGUCTCG/iBiodT/GCT;
(53) The sequence of primer 2 was as follows:
(54) TABLE-US-00011 (SEQIDNO:5) ACGTTCTCGACUCCTCAGCTT.
(55) A PCR system was formulated according to Table 9.
(56) TABLE-US-00012 TABLE 9 Reaction component Volume (L) Enzyme-free pure water 186.5 2x PfuTurbo Cx buffer 275 PfuTurbo Cx heat-activated nucleic acid 11 polymerase (2.5 U/L) 20 M primer 1 13.75 20 M primer 2 13.75 Total volume 500
(57) Into the above system was added 50 L (180 ng) of the recovered products from the previous step. The mixture was mixed well and reaction was allowed under the conditions set out in Table 10.
(58) TABLE-US-00013 TABLE 10 Temperature Time Cycle 95 C. 3 min 1 95 C. 30 s 7 56 C. 30 s 72 C. 4 min 68 C. 10 min 1 Ramping the temperature down to 4 C. at a rate of 0.1 C./s 4 C. Holding the temperature
(59) After reaction was complete, purification was conducted using 550 L of Ampure XP magnetic beads, and the recovered products were dissolved with 80 L of TE buffer. 1 L of the recovered products was assayed with a Qubit dsDNA HS assay kit (Invitrogen Corp.) to quantitate the concentration of the products. 2 L of the products was used for reaction at the next step.
(60) 9. Removal of uracil: A reaction solution as shown in Table 11 below was formulated.
(61) TABLE-US-00014 TABLE 11 Reaction component Volume (L) Enzyme-free pure 25.8 water 10x Taq buffer 11 USER enzyme (1 U/L) 13.2 Total volume 50
(62) The above reaction solution was added into 60 L (2 g) of the reaction products from the previous step, and the mixture was mixed well and incubated at 37 C. for 1 h.
(63) 10. Double strand cyclization:Reaction system 1 as shown in Table 12 below was formulated.
(64) TABLE-US-00015 TABLE 12 Reaction component Volume (L) Enzyme-free pure water 1520 10x TA buffer 180 Total volume 1700
(65) The reaction products from the previous step were added into reaction system 1. The mixture was mixed well and evenly dispensed into 4 tubes. The tubes were placed in a water bath at 50 C. for reaction for 15 min. After the reaction was complete, the tubes were placed in a water bath at ambient temperature for reaction for 15 min.
(66) Reaction system 2 as shown in Table 13 below was formulated.
(67) TABLE-US-00016 TABLE 13 Reaction component Volume (L) Enzyme-free pure water 98 20 Circ buffer 100 T4 DNA ligase (fast) (600 U/L) 2 Total volume 200
(68) The 20Circ buffer used in the example was formulated according to Table 14.
(69) TABLE-US-00017 TABLE 14 Reaction component Concentration Tris-Cl, pH 7.5 66 mM Potassium acetate 132 mM Magnesium acetate 20 mM Dichlorodiphenyltrichloroethane (DDT) 1 mM Adenosine triphosphate 20 mM
(70) Into each of the 4 tubes of reaction system 1 was added 50 L of reaction system 2, and the tubes were incubated at room temperature for 1 h.
(71) 330 L of Ampure XP magnetic beads was added into the reaction products of each tube (500 L). The mixture in each tube was mixed well and stood for 7-15 min. After placing the tubes on a magnetic rack, supernatant was collected. The supernatant was added with 170 L of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. After placing the tubes on a magnetic rack, supernatant was aspirated off, and the magnetic beads were washed with 75% ethanol twice. After air drying the magnetic beads, 65 L of TE buffer was added to each of the 4 tubes to dissolve the purified products.
(72) 11. Linear digestion: A reaction system as shown in Table 15 below was formulated.
(73) TABLE-US-00018 TABLE 15 Reaction component Volume (L) Enzyme-free pure water 0.7 Plasmid-Safe 9X reaction buffer 8.9 Plasmid-Safe ATP-dependent DNase 10.4 Total volume 20
(74) The products from the previous step were added into the reaction system, and the mixture was mixed well and incubated at 37 C. for 1 h.
(75) Purification was conducted using 80 L of Ampure XP magnetic beads, and the recovered products were dissolved using 82 L of TE buffer. 1 L of the recovered products was assayed with a Qubit dsDNA HS assay kit (Invitrogen Corp.) to quantitate the concentration of the products. 700 ng of the products was used for reaction at the next step. The initiation site for CNT reaction on the double-strand cyclized DNA formed in this example is in the form of nick. That is, both are complete double-stranded cyclic DNAs, and the adaptor A sequence harbors a nickase recognition sequence.
(76) 12. Binding of cyclic DNA to magnetic beads:500 ng of cyclic DNA was added to streptavidin magnetic beads (Life Technologies) and binding was allowed at room temperature for 1 h, such that the cyclic DNA bound to the streptavidin magnetic beads via the biotin label on the DNA. The resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with a high-salt wash solution once, washed with a low-salt wash solution once, and rinsed with 1NEB buffer 2 once. The high-salt wash solution and the low-salt wash solution were respectively formulated according to Table 16 and Table 17.
(77) TABLE-US-00019 TABLE 16 Reaction component Volume (L) Tris-Cl, pH 7.5 (1M, SIGMA) 5000 Sodium chloride (5M, SIGMA) 10000 Enzyme-free pure water 35000 Total 50000
(78) Before use, 10% Tween 20 was added to a final concentration of 0.05%.
(79) TABLE-US-00020 TABLE 17 Reaction component Volume (L) Tris-Cl, pH 7.5 (1M, SIGMA) 5000 Sodium chloride (5M, SIGMA) 3000 Enzyme-free pure water 42000 Total 50000
(80) Before use, 10% Tween 20 was added to a final concentration of 0.05%.
(81) 13. Enzymatic digestion with nickase: A system was formulated according to Table 18 below.
(82) TABLE-US-00021 TABLE 18 Reaction component Volume (L) Enzyme-free water 66.3 10 NEB buffer 2 8 Nt.BvbCI 1.7 Total 80
(83) 80 L of the reaction solution was added to the magnetic beads from the previous step, and the mixture was mixed well to allow reaction at 37 C. for 60 min.
(84) After reaction, the resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with the high-salt wash solution once, washed with the low-salt wash solution once, and rinsed with 1NEB buffer 2 once.
(85) 14. Controlled gap translation reaction:A system was formulated according to Table 19 below.
(86) TABLE-US-00022 TABLE 19 Reaction component Volume (L) Enzyme-free pure water 48 10 NEB buffer 2 6 dNTPs (0.014 mM, Enzymatic) 4.3 DNA polymerase I (E. coli) (10 U/L, NEB) 1.8 Total 60
(87) The usage amounts of dNTPs and DNA polymerase I are variable and can be adjusted according to the length of the target fragments desired.
(88) 60 L of the reaction solution was added to the magnetic beads from the previous step, and the mixture was mixed well and allowed to react at 25 C. for 15 min. Then 1.2 L of EDTA (0.5 M, AMBION) was added and the resulting mixture was allowed to react at 65 C. for 15 min.
(89) After reaction, the resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with the high-salt wash solution once, washed with the low-salt wash solution once, and rinsed with 1NEB buffer 2 once.
(90) 15. Digestion at the gap by an endonuclease: A system was formulated according to Table 20 below.
(91) TABLE-US-00023 TABLE 20 Reaction component Volume (L) Enzyme-free pure water 78 10 NEB buffer 2 9 T7 endonuclease I (10 U/L, NEB) 3 Total 90
(92) 90 L of the reaction solution was added to the magnetic beads from the previous step, and the mixture was mixed well and allowed to react at 25 C. for 15 min. Then 2 L of EDTA (0.5 M, AMBION) was added. After reaction, the resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with the high-salt wash solution once, washed with the low-salt wash solution twice, and then resuspended in 100 L of the low-salt wash solution.
(93) 16. Filling of the sticky ends and addition of A at the 3 end:A system was formulated according to Table 21 below.
(94) TABLE-US-00024 TABLE 21 Reaction component Volume (L) Enzyme-free pure water 0.8 5 Klex NTA mix 26 Klenow fragment (3.fwdarw.5 exo-) (5 U/L, NEB) 3.2 Total 30
(95) 30 L of the reaction solution was added to the resuspended magnetic beads from the previous step, and the mixture was mixed well and allowed to react at 37 C. for 60 min. Then 2 L of EDTA (0.5 M, AMBION) was added. After reaction, the resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with the low-salt wash solution for three times, and then resuspended in 70 L of the low-salt wash solution.
(96) 17. Ligation of adaptor B (bubble-type adaptor):
(97) Adaptor B consisted of a top strand L and a bottom strand S which were complementary to each other, the strands having the following sequences:
(98) TABLE-US-00025 TopstrandL: (SEQIDNO:6) /phos/AGTCGGAGGCCAAGCGTGCTTAGGACAT; BottomstrandS: (SEQIDNO:7) GTCCTAAGCACUGTAGTGTACGATCCGACTT.
(99) A system was formulated according to Table 22 below.
(100) TABLE-US-00026 TABLE 22 Reaction component Volume (L) Enzyme-free pure water 21 3 ligation buffer 2 56.8 Adaptor B (10 M) 20 T4 ligase (600 U/L, Enzymatics) 3.2 Total 100
(101) 100 L of the reaction solution was added to the resuspended magnetic beads from the previous step, and the mixture was mixed well and allowed to react at room temperature for 30 min and then at 65 C. for 10 min.
(102) 18. USER enzyme digestion: 1 L of USER enzyme (1 U/L, NEB) was added, and the mixture was mixed well and allowed to react at 37 C. for 60 min. Then 4.5 L of EDTA (0.5 M, AMBION) was added. After reaction, the resulting mixture was placed on a magnetic rack, and the supernatant was removed. The magnetic beads were washed with the low-salt wash solution for three times, and the single strands having no biotin label were separated by using 40 L of 0.1 M sodium hydroxide. An acidic buffer was added to neutralize the products separated, the total volume of the products after neutralization being 60 L. The other strands having biotin label remained bound to the magnetic beads.
(103) 19. Polymerase chain reaction:
(104) The sequences of the primer F and primer R used in this example were as follows:
(105) TABLE-US-00027 PrimerF: (SEQIDNO:8) /bio/ATGTCCTAAGCACGCTTGGCC; PrimerR: (SEQIDNO:9) /phos/GTAGTGTACGATCCGACTT.
(106) A system was formulated according to Table 23 below.
(107) TABLE-US-00028 TABLE 23 Reaction component Volume (L) Single-stranded DNA from the previous step 30 Enzyme-free pure water 160 2 PfuCx buffer 219.8 PfuCx heat-activated nucleic acid polymerase (2.5 8.2 U/L, Agilen) Primer F (20 M, Sangon) 11 Primer R (20 M, Sangon) 11 Total volume 440
(108) After mixing well, reaction was allowed under the conditions shown in Table 24 below:
(109) TABLE-US-00029 TABLE 24 Temperature Time 95 C. 3 min 95 C. 30 s 56 C. 30 s 72 C. 4 min Repeating steps 2 to 4 for 7 times 68 C. 10 min
(110) After reaction was complete, purification was performed using 400 L of Ampure XP magnetic beads (Agencourt), and the recovered products were dissolved in 80 L of TE buffer solution.
(111) 20. Single strand cyclization:Both ends of the products from the previous step could be ligated together by nucleic acid single strand O via corresponding complementary sequences. The sequence of nucleic acid single strand O was as follows:
(112) TABLE-US-00030 (SEQIDNO:10) ATCGTACACTACATGTCCTAAGCA.
(113) 100 ng of the PCR products from the previous step was added with 10 L of nucleic acid single strand O (10 M, Sangon). The mixture was mixed well and placed at 95 C. for 3 min, then rapidly placed on ice for cooling. A system was formulated according to Table 25 below.
(114) TABLE-US-00031 TABLE 25 Reaction component Volume (L) Enzyme-free pure water 36.4 10 TA buffer (Epicentre Corp.) 12 100 mM adenosine triphosphate (Epicentre 1.2 Corp.) T4 ligase (600 U/L, Enzymatics) 0.4 Total 50
(115) 50 L of the reaction solution was added into a mixed solution of the PCR products and the single strand O, and the mixture was mixed well and allowed to react at 37 C. for 60 min.
(116) 21. Linear DNA digestion: A system was formulated according to Table 26 below.
(117) TABLE-US-00032 TABLE 26 Reaction component Volume (L) Enzyme-free pure water 2 10 TA buffer (Epicentre Corp.) 0.8 Exonuclease 1 (20 U/L, NEB Corp.) 3.9 Exonuclease 3 (100 U/L, NEB Corp.) 1.3 Total 8
(118) 8 L of the reaction solution was added into the ligation reaction solution from the previous step, and the mixture was mixed well and allowed to react at 37 C. for 30 min; and 6 L of EDTA (0.5 M) was added. Then, the products were purified and recovered using 170 L of PEG32 magnetic beads, and redissolved in 55 L of TE buffer.
(119) The concentration and total amount of the final products in the four parallel experiments in this example were as shown in Table 27 below. The results of electrophoresis were shown in
(120) TABLE-US-00033 TABLE 27 Sample name Concentration (ng/L) Total amount (ng) C22 0.33 18.33 D22 0.32 17.87 E22 0.32 17.87 F22 0.31 17.15
(121) From the above table it can be seen that the concentration and total amount of the library were sufficient to meet the requirements of subsequent sequencing with respect to library size. Moreover, the results of electrophoresis (
(122) The disclosure set forth above is intended to describe the present invention in further detail by reference to particular embodiments, and is not to be construed as limiting the practical implementation of the present invention thereto. A number of simple deductions or substitutions could be made by a person of ordinary skill in the art to which the present invention pertains without departing from the concept of the present invention.