EXOPOLYSACCHARIDES AND USES THEREOF

20190345268 ยท 2019-11-14

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention refers to exopolysaccharide molecules, conditioned media or compositions comprising said molecules or media. Moreover, the present invention refers to use of said exopolysaccharide molecules, conditioned media or compositions as prebiotic, preferably to boost immune system.

    Claims

    1. An exopolysaccharide comprising at least one repeating unit of rhamnose, galactose and N-acetygalactosamine, in a ratio of 4:1:1, respectively.

    2. The exopolysaccharide according to claim 1, wherein the rhamnitol is 1,2,3,4,5-penta-O-acetyl-L-rhamnitol; and/or the galactose is 1,2,3,4,5,6-hexa-O-acetyl-D-galactitol; and/or the N-acetygalactosamine is 2-acetamido-1,3,4,5,6-penta-O-acetyl-2-deoxy-D-galactitol.

    3. The exopolysaccharide according to claim 1, wherein the rhamnose has L-configuration and/or the galactose has D-configuration and/or the N-acetygalactosamine has D-configuration.

    4. The exopolysaccharide according to claim 3, wherein the repeating unit has Formula I ##STR00002##

    5. The exopolysaccharide according to claim 1, obtained from the L. paracasei DG strain or a mutant strain thereof.

    6. A medium comprising the exopolysaccharide according to claim 1, wherein said medium is a conditioned medium where cells producing said exopolysaccharide have been grown.

    7. The medium according to claim 6, wherein said genetically engineered bacteria comprises the nucleic acid SEQ ID NO: 1 or any fragments thereof.

    8. A composition comprising the exopolysaccharide according to claim 1 and one or more excipients.

    9. A composition comprising the exopolysaccharide according to claim 1 and one or more probiotics.

    10. A method of using the exopolysaccharide according to claim 1 as a medicament, comprising the step of administering the exopolysaccharide to a subject in need thereof, wherein the exopolysaccharide acts a medicament.

    11. A method of using the exopolysaccharide according to claim 1 to boost immune system response, comprising the step of administering the exopolysaccharide to a subject in need thereof, wherein the exopolysaccharide boosts the immune response system in the subject.

    12. A method of using the exopolysaccharide according to claim 1 as functional food, comprising the step of administering the exopolysaccharide to a subject in need thereof, wherein the exopolysaccharide acts a functional food.

    13. The exopolysaccharide according to claim 6, wherein said cells are bacteria.

    14. The exopolysaccharide according to claim 13, wherein said bacteria cells are genetically engineered bacteria and/or bacteria from the L. paracasei DG strain.

    15. The medium according to claim 6, wherein the medium further comprises one or more excipients.

    16. The medium according to claim 6, wherein the medium further comprises one or more probiotics.

    17. The composition according to claim 9, wherein the probiotics comprise any bacteria belonging to the genus Lactobacillus and/or Bifidobacterium.

    18. The composition according to claim 17, wherein said Lactobacillus is the specie Lactobacillus paracasei.

    19. The composition according to claim 18, wherein the Lactobacillus paracasei is the strain Lactobacillus paracasei DG.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0008] FIG. 1 shows a comparative genomic analysis of Lactobacillus paracasei DG with other complete genome sequences of L. paracasei strains. (A) Circular genome atlas of L. paracasei (reference genome) and six other publicly available L. paracasei genomes; highlighted in the atlas are the two putative exopolysaccharide (EPS) regions of strain DG.

    [0009] FIG. 2 shows the NMR analysis of the exopolysaccharide (EPS) isolated from Lactobacillus paracasei DG. In particular, FIG. 2 shows selected regions of the 1H-NMR of the DG-EPS recorded at 70 C. in D2O and using acetone as an internal standard, anomeric (H-1) resonances are labelled A-F in order of decreasing chemical shift.

    [0010] FIG. 3 shows the NMR analysis of the exopolysaccharide (EPS) isolated from Lactobacillus paracasei DG. In particular, FIG. 3 shows selected regions of overlaid COSY (black contours) and TOCSY (grey contours) spectra for the DG-EPS recorded at 70 C.; symbols A-F identify individual sugars and numbers (1-6) identify the C/H ring position.

    [0011] FIG. 4 shows the NMR analysis of the exopolysaccharide (EPS) isolated from Lactobacillus paracasei DG. In particular, FIG. 4 shows selected regions of the HSQC spectrum of DG-EPS; the location of the individual ring and H6-protons and carbons are identified on the top frame, and the location of the anomeric protons and carbons are identified on the bottom frame. The spectrum was recorded in D2O at 70 C.

    [0012] FIG. 5 shows the NMR analysis of the exopolysaccharide (EPS) isolated from Lactobacillus paracasei DG. In particular, FIG. 5 shows the anomeric region of a ROESY spectrum recorded for the DG-EPS; inter- and intra-residue NOEs from the anomeric hydrogens to ring protons are individually labelled.

    [0013] FIG. 6 shows the repeating unit structure of DG-EPS, i.e. the heteropolysaccharide isolated from Lactobacillus paracasei DG.

    [0014] FIG. 7 shows the gene expression analysis by qRT-PCR in human macrophages THP-1 after 4 h stimulation with purified DG-EPS molecule (0.1, 1, and 10 g ml-1), with or without the addition of LPS (1 g ml-1). Expression levels of TNF-, IL-6, IL-8, CCL20, and COX-2 are shown as the fold change of induction (FOI) relative to the control (unstimulated macrophages), which was set at a value of 1. Data are presented as mean of three independent experimentsstandard deviation. Asterisks indicate statistically significant differences (according to two-tailed unpaired Student's t test) compared to unstimulated (samples under the left Y axis) or LPS-stimulated (samples under the right Y axis) THP-1 cells: *, P<0.05; **, P<0.01.

    [0015] FIG. 8 shows the in silico predicted functional organization of the EPS-b region of L. paracasei DG; the figure shows the BLASTN search results for the region EPS-b and has been obtained by adding a picture of the putative EPS gene cluster over the graphic representation of the BLASTN output. In white are indicated open reading frames (ORFs) outside the putative EPS operon; in black are ORFs that do not share significant homology with other sequences in GenBank. D.R., direct repeat sequences.

    DEFINITION

    [0016] In the context of the present invention, exopolysaccharide means extracellular polymeric substances (EPSs) mainly composed of carbohydrates, i.e. natural polymers of high molecular weight secreted by microorganisms into their environment.

    [0017] In the context of the present invention, prebiotic means substances that induce the growth or activity of microorganisms (e.g., bacteria and fungi) that contribute to the well-being of their host.

    [0018] In the context of the present invention, boost immune system means mainly activate immune system cells toward any potentially detrimental elements.

    DETAILED DESCRIPTION

    [0019] In a first aspect, the present invention refers to an exopolysaccharide comprising at least one repeating unit of rhamnose, galactose and N-acetygalactosamine in a ratio of respectively 4:1:1. The exopolysaccharide can be also defined a heteropolysaccharide.

    [0020] According to a preferred embodiment of the invention, the rhamnitol is 1,2,3,4,5-penta-O-acetyl-L-rhamnitol.

    [0021] According to a further preferred embodiment of the invention, the galactose is 1,2,3,4,5,6-hexa-O-acetyl-D-galactitol.

    [0022] According to a further preferred embodiment of the invention, the N-acetygalactosamine is 2-acetamido-1,3,4,5,6-penta-O-acetyl-2-deoxy-D-galactitol.

    [0023] According to a further preferred embodiment of the invention, the rhamnitol is 1,2,3,4,5-penta-O-acetyl-L-rhamnitol, the galactose is 1,2,3,4,5,6-hexa-O-acetyl-D-galactitol, and the N-acetygalactosamine is 2-acetamido-1,3,4,5,6-penta-O-acetyl-2-deoxy-D-galactitol.

    [0024] According to a preferred embodiment, the rhamnose residues have L-configuration and/or the galactose and/or the N-acetygalactosamine has (have) D-configuration.

    [0025] According to a preferred embodiment of the invention the exopolysaccharide comprises the repeating unit having Formula I:

    ##STR00001##

    [0026] Preferably A as a 2,3-linked rhamnose, preferably B as 2-linked rhamnose, preferably C as a 2-linked rhamnose, preferably D as a 3-linked rhamnose; preferably E (N-acetylgalactosamine) is 1,3-linked; and preferably F are terminal galactose monomer.

    [0027] According to a preferred embodiment A is preferably linked to the 3-position of D, C is preferably linked to the 2-position of B, D is preferably linked to the 3-position of E; F is preferably linked to the 2-position of A. According to a further embodiment of the invention, the exopolysaccharide is produced or can be obtained from L. paracasei DG strain or mutant strain thereof.

    [0028] In other words, when these bacteria are grown in an appropriate medium/broth at the appropriate temperature and for predetermined time, the exopolysaccharide molecules are secreted into the medium/broth. This broth/medium is defined conditioned medium meaning that it contains the metabolites derived from bacteria. The exopolysaccharide is one of the metabolites.

    [0029] In some embodiments, the exopolysaccharide remains anchored or is part of the cell membrane and/or cell wall.

    [0030] Therefore, in some embodiments it is possible to isolate the membrane/wall from the bacteria wherein said membrane/wall comprises the exopolysaccharide of the invention.

    [0031] Therefore, as alternative or in combination of using the conditioned medium it is possible to use the membrane/wall fraction of the bacteria comprising the exopolysaccharide or fragments thereof.

    [0032] The Lactobacillus paracasei strain DG has been deposited at the National Collection of Microorganisms Cultures of the Pasteur Institute under the code CNCM 1-1572.

    [0033] A further aspect of the present invention refers to the cluster of genes codifying the proteins involved in the synthesis/expression of the exopolysaccharide of the invention.

    [0034] This cluster comprises SEQ ID NO: 1 or fragments thereof or any sequence having 80-99% of identity.

    TABLE-US-00001 Sequence SEQIDNO Name ccatctttagattattaaataatattatcctagattgcaataataaagtt SEQIDNO: Lactobacillus accacctagaaagaggcttgctcactgcttgaactggggtttgccaacggagacattttc 1 paracasei taggtttgttattgataaacgctgtggctcgttgaatattggcctctgaaacctgatcaa strainDG actgtgttcccttcgggaaatagtagcgaagttctcgattgaaccgttcgttcgtgcccc Exopoly- gttcattcgggtgataggcatggcaaaagtaaatcggtatccgatagcgctttgtaagcg saccharide-b cctgatcgcaggaaaactctttaccgtgatcaaccgtcactgatcgaaccggacccggaa EPS-bregion agtctaccatcagtcttgcaaatcctttgagaacagcattttgtgataagttttcaagct tagttgtcgccattaaacgtgtcacccgatcgacaatggtcaaaacagcagcctttgacc cgcgaccaccgcgaactgtatccatctctaaatgtcctttttcggttcgccgattagctg actcactgcgaatctcaattgaggtgcctactgcttggttatagcgcgaccgaaggtctt gtcttcttttatgacgtttaccgtgatcaaagagttggcttggctgaaaatcgacttgtc tttgataaatccagtggtaaatcgtgtgtggcgcacagtgaacgacataaccgaccattt caggggaccaacctaggtttagcttctcagttaccatccgcttcaacttaggcgttaaaa tcgagtgccgaccacaacgatgccgacaagtatcggcatgatcctgagctataatggcgc agtaatcaccttcagggcaacggtgaagctcatgcctaatagaaatacgagagcggccta aggtcgcggcgatgtattgaatcgtgtggtgttgcatcagttctatctgagatcgttcaa ttaaggttataatggccatgggacctgtccttctctctagatggtatgttatgcaaacac cattttagcaagaacggacaggtcttttttcacattttctgggtggtaactttaattatg caatctaggttataaaatcttttgatagcccggcgtttcatctaatgttaaagcataacg ccgcacattaaaggtgggggaaaccatgttagacaatatcgggaaattggtgcaccaaca gcgccgcagtttgaacttgacgattgagaagttggcggagcgatccggcgtctcgatcag tctgatttcgcgaatggagcgtggagacgtcaacaatatcagcataaaaaaattgaccga cattgcgcgggctttaaatatgcaggtaggcgacttctttattgctccggaaatgagcga tattagcacattagcggtggtgaaatacttaacccacttaccagagaaagaacgggcgcg tgtttccgaggtactcatgcaggtgattaacctgtaagtaccacctttttagaacagtct gtcacttgaggctgttcttttttgatatcaaaaatgtcagaatgaccttaaaaggatggc gcaacccgttgtcagtcagctggtaaaacgcgtatactaaatgcactgattttagacaat gaacgcgaacttgcacggttagcttggtttgacaaagtggcactgaatagttgatcaagt atttgttcggctaacaggctttcttcacaataaccaaccgccatgtggagaacgcatttt aaaagaaggagaatgatcgacatgacatttgaagcaattttaccgtcctttaaagccggc aagaaggccgttcgcaccggctgggaaggtactgagttgtatgtgcaactagttccggaa ggcaaattcgaaggcgacactttgaatccgtattttttgatcaaaactgccgacgaagct ttcagtctctggtcaccgactgactgtgacattttggctgaagactggcagcttgtgaac gcatgacgcatttcgacttcaccgacaagaccgtcatcatcaccggcgcggcttctggca tcggtgcggctcaggcggcggcttttcaggcagctggtgccactgtggtaggaattgacc tccaaccaattagcaacctcacagacgccattcaggccgatgtgagcgatcctgccacgg cagcagcgattgcggctcaataccagccagatattgtctgcaatacggcgggcgtgttgg atggttatcaaactgtgaccgatacggcgctctcggcatggcagcacattctcgatgtcg atcctaccagtcagttcttaatgatcaaggcgctgctgccggggatgctggctcgcggtc acggtattttcatcaatatgagttccatcgctggtttagtcggtggtggtggcggcttgg cgtatactgctgctaagcacgccgtcatcgtcctcaccaagcaattagaccttgattacg ccgccaagggcattcgcgccaacgcgctcgcaccaggcgctatcaacacg cccatgaacgccgctgattttgccggcgacgggaaaatggctgcgtgggtagcgcgcgaa accccagccaaacgctgggccaagcccgaggaagtcgcacaattatccttgtttctggcc agcgatgctgctgattatattcatggaaccgtgattcccattgacggcggctggctcgaa aagtaaacttaatgcattgcaacaccaaaactgaaaacggaaggcaatccttccacgacg atacttactttcctttgatcgtcgttactactggcatagccacaaaggagaacaaacatg caaacaacttcaaccacccatcgttcaatcgtcagtctcgccaaaaccgccatgatcacg tccatttacgtcgtgatgaccctcatgctcagtccactcagcttcggggtcgtacaagtt cggttctccgagatgctcaactacacggcactcttcaaccgccgttatgtctggggcgtc acgctgggtgtttttttggccaatttaacctcgtcaaccgcactcctcgatgtcccaatc ggcaccctcggcacgctcgtcttcatcatcatcagccgctggttagccaaactcgtccaa ccaaaatgggctaaattcaccatcatgggtatccttttcgccttatccatgttcaccatt gccggcgaactgaccatcctcacaaaagtcccattctggccaacctacgctaccatcgcg cttggcgaagccatctcgatggccgtcggtggcgttgtgatgatgattttgacgcgattt gtggatttggataagtaggcgataaggctattgaaagaggctcctatagaaaaaagctta ctggcaggaaaggtttcgctgaagcttttcgatctggcagaagggcaagcaggtctgatt gctgtgttcaaaagttgtcgcaggggttaggcttccgatgcacctgattttggttaaata ttggttaaatacaaaaaagcatcaagacaattgtctcgatgctttttttaatggaaggga tacgccctaaatcttttttaagcaagatgctaatcctaggtaatgatggtcttttcattg ttactttttcaatgtctgcatgacatccttagcaatcaacgtgtagtaatgcggccggcc agcgtcgttcggatggacaccgtcatcagcaaaccagtcgtcattgccacctgccagata ataccaatccaccacatgcagattggcatgggttttagctgccgcatgaatcagcttgtt aaccggatcaatccacgctttccccggagcatacgcggtcacccagaagacctgacgctc agtcccaagctgatccagaatcccgttaatgtcggcctctgtcataggtccgttcgtccc caaactgatcacaaccgtgttagccaacttaccacttgccttcagctgactaataatcgc aggtgctgcctgcacctgccgaccaacctcagcatcaatcgacatctccggaaaaagcac cttcaaatatgccgaactccccagcataatcgaatcgccaatcgccgacaccggcaatgt tttggccgcattaatctcgctgtcagttaagccataaagccgatactgattcagaacctt ttccttcttcaccttcgccttagaatccttctgaatgcgctgccgcgtcgattggttaac cgcaatcgcctgctcagactgataatgcttgacgtagaagaaccccgcgacaccagcagt tgccaatcccaacgcgatacttaatagccagtctcgtagacgtagcttgttttttttcat gatttagtgaacccccaaaatttgcattgcttatattttaaactaaaaatcaggttagtc tgattacaagttagggtcattctgacgggtttataggaaactgtaaatagactgtaataa aatgaaatttgaagttaccaaccttagtaaaaggcgtgtatatcggattcaaactaatct gatagtacaaccaaaaacatgacattcattcaaaacaggtagacttcgtcacacatgcta ggttattatggtttggagtagagttttaaaagtcttttttagaaatgcgggctgcgctgc ttgtggtccgcattttgagtgttggatataaattatgggattaggtggggaaagagttaa tgaacaagcaaatcgacctttcgcagttgtggaatgtatttaaacgcagctttgttgcaa tgattattctcggaattcttgggatggcggctgcttatttcggtgctaaaacgtttattt cgccaaaatatgagtctgatacgtcattgctggtcaatcgcaagcaggataacgatccaa acatgcaattgaatgctcagcaggctgatattcagatcattaatacatacaaggacatta tcacacgtccagtcgttttacaggctgttgcgagtgaactaacaagtccccagcgtgtat tgataaaaaaagctacaaaggcggtttatggtacgcgttacaatgcaacaacaggtgttc gagaagaatatgttactcaaaaagctcaaccggcgcaatataagttaaag ccagctcaatactccaatctttcatctaccgatcttgctaaggtcgtaacagtatccaca cagcaaaattctcaagtgtttaccgttaacgttaaagatacagatcctgttcgggcaaga gatattgcaaatgaagttgctaaggtttttgaaaagaaaattgctaaaatcatgagcatt tccaatgtttccgttgtttcaagggcaacggctgatccgataccagtattgcctcggttg aatctaatggcattaattggcctagttttaggagtgcttgtcgctttcgtttggggattg attcgagaactgacagatcagaccattaaggatattgactttatcacggacgaccttggg ttggttaatttgggaatagtcaattatgttcaacatatgcgtgacatgagtgaagcgatc gatgccacaaagtcaatagaagctgaggatactgaagattacgatgcgtcggactttccg caacgtagccgtcgccgaatctaaggaggaagaaaacatgaagtggtctt tcaaacaacttttccaccggcaacaagaagatcaagaaactcaaaagaac ggggtcattttagtcactttcgctgaaccaaaacatgttgtttcagaacagtttcgcaca gtgcgaactaatattgagtttgctggagcagctcttgataagtgtcaagttgttatgttt acgtcttcagtgatgtccaagggcaagtcgactgtttcggcaaacgttgcggtaacttgg gctcaggcggggaaaaaggttttactgattgattgtgaccttcgacgaccgactgtacat gcaacttttcgaacgcttaatctagagggagtcacaacagtattaacggggaaaagttct gctcacaatatagttgagcaaacatttgtgagtaatttagatattcttacctccgggccg ctacctcccactccgtctgaacttttaaattcacaacgtatggctaacctcgtggattgg gcacgcgacaattatgatattgttgttctagatgcaccgccagttttggcagtatctgat gtacaggtcttagtccccaaaacagatggcgtagtggttgtcgcaaagatggggaagact ttaaagggagacttaagacgaactattgaagttctgaagcttgcaaaagctaaacttctt ggatgtgtagagcgtgtgaatgttaaacgtggcgatcgcggctatggctacggttatggc tacggttatgggaatgaagggactaaataatccgatattatcaacctaaa gaaaaaaggcatagctcaaatatttataaattgatgcttaacgcattgttgtctgttttt gatgtttgggtggttatctgattatttatgtgatttaatagtggcaagaaaagtttataa atttaatatacttgcacaaagatttttaagaatgcaagtttttattcttgcaaagttgaa aaagtgatttcgactttagcacggggaacgcgacatactaaagtcacttcacgtagtgcg tttgggggaggaaggatcatgtatcaacacttcattaaaagaattttagatattttggga gcaataatagcattgctaatcttggcaatcccgtttatcattattgcaatacttattagg atggattcaacgggtccagccttttttcgtcagcaaagaatggggaaggatgggaagccc tttagaatttacaagtttcgtacaatggaccaagaggccccacacgatcttgcaactgct aaactagataatgctaataagcagattacacgggtcggtcgattgctccgaaagacaagt attgatgagttacctcagttcattaatgtgttaaagggcgacatgagcatggtcggacca cgtccggttgtcttgacagaaactgagctaattgaaatgcgtcacaaaaatggcgctgaa agtgctttaccggggataacaggattagcgcaggtaaacggaagagatcggttatccaat ttaagtaaatctaattacgatggtatttatgtttcttcaatttcattttttatagattca aagataatggtcaaaactttctggtatgtagctcttcgattaggtattagagaaggtcgt ccaaattctaaaaaagttaatgctgctaatatcggagaaaaaaatattaggccgaacgaa cagcaactatttttaaaaaggaaagcttagatttaatgaatgataatactaaagaaatta gcttttgtaccgttacttataacagcgcaaaagaagtgacccagttaatagaaaatatag agtctctaaaaagcgatttgttttcctcacgagttttcattgttgataatgggtcccaag atgacacagtgaatatagttttaaagctttctcaggaacactctaatcttgttttaatta ggcctgatgtgaataggggatttggagcaggcaacaatcaggtgttaaatatgattacct cggattaccatattctgattaatccagatgtgcgtataccgtcctccagaacgattgaaa agatgatcgggtatatggatactcattctgatgttggactgttatcccccaaaattctta atgttgacggctcagttcaaaaattatttagacataatcctactgtacttgatatggcgt tacggttcatctcacctaatcttatgaaaaaaaggcaagattggttcgtccatgaagaga ccgggtatactcagagcggagtgatcgatcaagctagtggagcatttatgtttttccgta catctgtatttaaaggtatagcgggttttgatgagagatactttatgtatttggaggatg cagacattactcgtaaggtcaatgctgttagcaaagcaattttttatcctgaagtaagca tcatgcataagtggaatcgacaaaatcattcaaagttgaaattcattggctatacaatta agagcatggttcaatattttaacaaatggggatggaagttattctaaccactggggagat tgattgaatgatttggctgggaattgtctgtattagctttatatctagttgtttccaaaa attagagaagtcagcgggtttgatatcttttttgggtttaggttatttggcgggcacacc aaatatgttgtacgatcccgatgcttttgtctatttacaaaattataattcgggcactga ttatttcgagacaggatataattgggtgacaaagctatttgagcctagtgtagattatca aacatttagattatacagtagtttatttatttttttcctgatgtttttagcagtactttt gatgacaaagcacgtatcaagtattgcgttggtttatgcaatcgcaatgtttccggttga taaagcacagactagaaatgtcatggcagccgtcttttgttcctttttggagttcstgtt gttttgctgtaagcttgggaaaagaggaattcttccctcattactggtcatttttattag gatctttttttcatagtcttgcactctactttcttttactaccattattatggttgtttaaaggctttat tgaaaagcatttttctgcaattactacatgtctaattgttgttgcgtttatttttgaaat cttaggttcaacaagcatagcgccactattagtacaacttttgggaaagtttgcaaatcg tgcgaacgttgcagaaaatgtgtcaactttatatgctggaggtcagccatttagtcagtg gtttgtttctttcgcagttactatgatgataattttaacagttcaatttcttagaaggca ataccctaacaatatgagatcctattaccaaatgattttatgttcttcgatattatggtc agcagcgttaatattgatgactctttcaattgactacataagaattctgagaattgttac gtacttctattttatctatatcgtgaatgttacttcaaatcagaagagcacggatcgcct tataggggtgacaatcagtattggatctgcagtcgttttgatgtttgtcgggttatgggt ctacggatttagtggtgaccaaattcgagcaatttttgggtttatttaaggggactgaag aatgttgaaagttggagtaattgttgttacttacaatccggatttaatgattctacagaa taatctgacgacactaaaaaggcaaaatggcatcaactgtctgattgttgataacggctc taagaattcaaacgatttaaaaaaagtaagtgaaaacttaaaagtcaacattatttcact tgatagtaatcgtgggattgcttatgcacaaaatcgaggttttgaattttttcaaagaga agggttaaagtgggcgcttactttagaccaagacagcatagttcctgataacttactaga agtgtatgtaaagcaaaaagaattgaactcttccgacacagcaattttaacttgtagcta cgttgatgaggactggactggaaagcaaaaagaagctatgcttcagcgtg aaaagattgtgcaaaagcaatatgtcatttcttcaggtaatcttgtaagaatttcctctt ggcaaaaagtgggtggatttgacgaattcctctttattgacatggttgacttcgactttg acgctaaactatttttagctggctttaaaatctggcagacgaatgaagtcgtactaaaac attctgttggacaatccttaaagaagcccatcgtgaaaaaaatacttctgattccagaaa ctgctattttggccgatcattcaccaattcgtcagtattacatttatagaaatagtatta ttttcgagaaaagatacacgatgattacccaacgaaagtttgttgttctccatactttcg ttgcaacaaggagaatgtttgcgtatagcaataagttacgcaagatgtttgcagcttggc gcggagttattgatggtgccagatacaatgtagacaaggacaaacaatttaaaaaaacac tggcaaaactgaaacgatagttatttggggtgaaataatgagaagtgaaaacgtaagtgt cgcaatttgtttagccacgtataacggggagaagtatttagaaaaacagattgactcaat agtttcccaatctgtctctagttggacattgtttattagagatgatggttccaccgatgg aacgcaaaaaatcattaaaaagtttgcaaagaagtatccgcaaaaagttttcaacttatc aggtcttcatggaggcggaaattctaaagaaaatttttttactattctgcaatgggtgag cgaacacaaaacttttgattattttatgttttctgatcaagatgacatttggttacctga taaaattgcattaagtgtcaaggctattgattctgatgattctccatgtttagttcatac tgatctaaaagttgtcgataaaaacttggatacaataacagaatctttcattcggtacag taacttaaattctcaagtaaaggatttttcgcatatccttgtacagaacaatgtaactgg ctgcacaatgttgtggaataagagtttaaacgatttaatcgattttcatccagattctag aatccttatgcatgattggtggattgctttaattgcatcagcgtttggaaatgtcgtctt tgtaaaaactccaaccatcctctatcgacaacatgatgaaaatgtagtgggggcagaagc ggctggttctgtggcatatattatttcaaaattgcgtaattataagttgattaaaaaagg attgcaacgtacctttgggcaagcaaatatttttaaagagatttattatcatcggttaga tgccagttctaaaagtatactagatgagtatttgcagcttcctgccaagtccaaacttag aaaaatatatctttctctcaagtatggatttacaaaacaaagcaccatacaaattattgg gcagtttctttttgtctagtctgttgaggctgattaattgcgagttttaaaaaattattt atatagtgttgggtatcaagttctaaacatgatattgccactcataacaggaccgtatgt tgcacgagttcttggaccgaagggtgttgggattaatacttatacaggtgcagtaacaca atactttgttttattcgctggcctagggatagcgctttatggaaatcgacagattgctta tgttaagggtgacccacatcagttaagcattaccttttgggaaatacagtttattaaaac gattacaacagtttgcgcctttgtcgctttttcaatatatttaattttcgtcaaagaata taagttttatttactgttacaatccgcgtatattttagctacaggatttgatatttcatg gctttatgagggcgttgaggattttaaaaagacctttactagaaacacgttagttcgaat agtctcccttgttctaatcctcacgctggtacacaaacaaagtgacgtttgggtatacat agtcattctcgcagcttctaacctcggtgggtatgttgcgttgtggccaactctaaggcg gctgctcgtacccattaaactgtctgaattacatcctaggaaacatttgaagggcacact gattttatttgtgccatacatgacgctgaacatttatcctatcattaataaaacattact caaacattttcttggggttgatgcttccggttattttgaaaaaagtgatgtgatgatacg tatggcgttgacagtagtgacgtcggtaagcgcagtattactgccacatacatccaaggc ttttgctgatggcaaggtttcgttaattaagaaattgctaaaaacctcttttggatatgt gtccatgatggcattcccaatcgcattaggaatggcggcaatagcaccaaaatttggtgt tttcttttatggtgaagggtttgcaccggttgggccagcaatgatgatagaatctagtgc cattattttcatggggtggtcgagcatcacaggtaatcagtatttaattccgacgatgca gtcaaagcattacacgcactcagttcttctaggctcggttttgaatattgttcttgacgt tcctcttatcattatttttgggcttaatggtgcagcgtttgctactttgattgctgaagc gtttattgctatatatcagttaataatgatcagtggtcaggttgattattccacttggct gatggacatcattaaatattgtgtagctgctataatcatgttctgctttgtttttttcgc aagtagcatgttgacgatgaccatcttgaccttagtgcttgaaatcatgcttggtgccat catttacttagtatgtctgtttcttatgaaacccgcaactaataagcaactcaaacgggc agcattctcaattattaaccgagttcggtcatgattatttttgggggaataatgacaata agacgaagagtttcttggttgattcgttcacctgcacgattacatgttgtgtatcggatt gacgattttacaaataatttgaaggttcgaagactgttacatatactattgatcccagtc ggcatgttaaacttaattaggctaaaactgatgactagatcacctgaaaagtttatgtat caattatcaattgttactacagtcaaaaatgaggctccatacttaagagagtggctgaga tatcacatttcggttggagtacagcacttttatctttatgataatgatagtcaagataac ttagatgaagtgttaaaagatttttccgactacgttactttaacaaagatacacggacga gttagacaatttgatgcatacaatgacgcgataaatcgattcaggtatgaaacaaagtat atggcggtgatagacgcggatgagtttatttttagaccaggtaaagacaagctgttacta cctcttattgattatttactttcaaataagtcatttggaggattggcggtgaattgggca atatttggttcttcgggtttaaaaaagaaacctttaggattggttaccgacaactttgta tatcgggccaacgataactttaggaaaaacaggctggttaaaactatctgcaatccgaga aaagtcttttacttttcagttagccatgctgcaaattacttgccaggtttttatgcagtt aatgagaatcaggaaaaagttgattggacaacaacgcaagttcccagtatcagtaagatt agaattaatcactattattcaaaatcacaagaagagtttttacgaaagcgagctcgaggc gctggggatgttgttggccttagagacttaggagaattcgcagaacatgatcgaaatgat gtttttgacgactcgcttagagtttataatgaatcaagaggtttaaacaaagactgaggg ggatattgaaagatgaaggggattatattagctgggggatccggaactcgactctatcca attacgaaggcaacaagtaaacagttagttccaatttatgacaagcccatgatttattac ccattctctgcgctaatgttgtctgggatcaaagagtttctgattatttctacgccagaa tttctgccacagtttgaagaattatttggtgatggacatactctgggactaaatattcat tacaaggttcaaacagagccaaatggattggctgaggcatttatccttggtgcggatttt atcggtaatgattccgttgctttagtgctgggagataatgttttttatggtgctgggtta tcaaagctattacaagatggggccgcaaaggaatctggcgccacaatttttgggtatcag gtaactgatcctgaacgttttggtgtagtagaatttgatagccatcaacacgctgtatcg attgttgaaaagccaacccatccacgcagtaattatgcagtaactggtttgtatttttat gataatgatgtggttaatattgcaaaaaatgtaaagccatctgcgcgtggcgaacttgaa attaccgatgtgaatgaggaatatcttcgtcgcgggcagctagatgtaaaagttatgggc agaggttatgcttggttagatactggaacgcatgactcattgcttgctgcttcaagtttt gttgcaactattgagaatcaacaaaatcttaaagtggcgtgtcttgaggaaattgcttat cgtatggggtatattaatcttgaacagttggaagaacttgcccagccgctcaaaaaaaat gattatggtcagtatttgttgcgtttggtcaaggaggagagtaagtaatggctttaaaag taatcccgacaaagttaactgatgtcaagttggttgagacagatgtttttggtgataatc gcggtttcttcacagaaacgtatactcgacctaagtttcaagaggcgggcatcacgaatg atttcaatcaagataatcagtcattgtctgctgaagcaggtgtgttaagaggcatgcact accagatggctccacatgcacaaacaaaattagttcgtgtggtaactggtgttgttgaag atgttttggttgacatccgaaagggttcaccaacttatggtcagtgggaaggatatattt taagcgaattcaaccatcgccaattacttgtgccaaaggggtttgctcatgggtttatta cattaactccaaatgttaattttgcttataaggttgaagggtattatgctcctgaagctg atcgtggaattgcctttgatgatcctgacattggcattaattggccaatgtcaacagcac accttattatgtctgagaaggatcaacaccatccacagctgagggatgctgaaaataact ttgtatacggggagatttgataatgaaacttatgatcactggcggggctgggtttatcgg ttcaaattttgttcattttgtttataataaccatccagatgttcagattatggttttgga caagctaacatatgccggcaataaggccaatattgaagatatcttgggcgatcgtgtcaa attagaagtcggggatattgccgacaagaatttggtcgataaattgatgagtgaagtcga tacagttgtcaactttgcggcagaaagtcacaatgacaattcgttgattaatccggatcc gttcctgcacagcaatgttattggcacctatactttacttgaagcagcaagaaagtacga tgttcgattccaccatatttccacagatgaggtgtacggagatctaccattacgtgcgga tcttccaggacacggggaaggccctggcgagaagttcaccgttaacagtcgttataatcc ttccagcccatattcttcaactaaagctgccagtgacatgttggtacatgcatgggcacg ttcatttggcgtacgcgcaacaatttctaattgctcgaataactatggtccataccaaca cattgagaaattcattcctcggcaaatcacaaacattttaagcggaatcaaaccgaagct ttatggcactggcaaaaatgttcgtgattggattcacacaaacgatcattcaagtgctat ctgggatattttgactaacgggaaaattggtgagacttacttgatcggcgccaatggcga aaaagacaataagacggtactcgaacttatcttaaaattgatgggcaaaccagctgatta ctatgaacaggttaaggatcgtccggggcatgatatgcgatatgccattgatgcttccaa aacccgtgaagaacttggttgggaacctcagtatacgaattttgaagaaggtttagcaga taccatcaaatggtacacagatcatcacagctggtggcaaggtgaaaaga ctgcggtagaagaaaagtaccaagaaaacggtcaatgactttagctcatagtaatggtcg tcactaattatgaacctgttattttctggaatgtcgaggagaagatacatgaagactttg attactggtgcgcaaggtcagcttggtacagaattgcgccgcctattagatgcgcagggc gttgcttatcgagcaacagatgcccatgatttagacattactgatgagactgcggttaat cagtattttaaagattatcaacccgagttagtttatcactgtgctgcctatacggctgtc gataaggctgaaggtgaagctaaggcaattaatcaaaaagttaatgttgacggaacacgt aatttggcaaaagcggccgctgaagtagatgcgacacttgtttacatcagtacagattat gtatttgatggtgacagcaaagaaatttataccgtcgatgatcaacctgctccacgtaat gagtatggccgggcaaaatatgaaggtgagcaacaagtccaaaaatatcttaagaagttc tatattattagaacctcatgggtattcggtgaatttggtcataactttgtttatacaatg ttggacttagccaagacacacaaagaactcagcgttgtcgacgatcaatacggtcgtccg tcatggaccaagacactcgcagaattcatgacgttcgcagtgaatcaacatttggattat ggcatttaccacttgtctaatgataacagttgtaactggtacgaatttgctagcgctatt ttggctgacaaagatgttgatgttaagccagtatcgtcatcagagtatccgcagaaggca tggcgtccgcgacattcgattttggacttaagtaagacgaaggttacaggctttaagata gacacttggcaagaagctttgacaaactttttacaagttatcgataaataagtgaaacta gatcaagtgtatcaaaaagaacgtaaaaaccaatctggcgattggtttcggcgccctttt gatacacgtaacaataacgggtctacactttctggtgttgagaaataatcagcactgaac gtgtaggccctttttggataacgcaaaaagacacctattcagtgaccatgctatgcttgt tagcgtcgaaaccaaaagcaagcgaggttatgagtaaatgtcccaatacgattctacact gtccgtccttggaataccagaccataatatcaaagtagcctttgttcgtcatgaatatcg cggcaacggggtacgtcgccgccagtatcatgtgattgatgctgagctgacttaccggtt acactgtgtggctttgaggccttgcaccctaacgggttttacacggcccatgtgcgcgtc ctcaacggggttgaaatgccgacagtcattgacttgcacaagcaacgatggcgctgtcat aactgttaccacacagtcagtgccaagacgccactcgtgcaacccaacca cacgatcgccgctcacatgacagagcgaatcatgaagttagcgcatgaacggttgccagt caaaaccatcgcccgtattatcggaatctcagcctcctcggttcaacggatcattgacca aaatctcaaactccgaccggctcgccggctacccacgcgactctgctttgatgagttccg ttccactcatggcatgatgtcgtttatctgtcttgatgccgattcacatcatctgattgc cttgcttggtgatcgatgcaaccgcacgattaaaaacttcttcctcgctcattattcact cgctgaacgcactcgggtccagacggtcaccatggacatgaatgcagcttatcagacgat tattcatgaggttttccccaaggcccaagtcgtcattgatcggttccatatcattcaact tgcggctcgtgcccttgatcaggtacgcgtccaagcgctcaaacagcttgatgacaaaca cagccgtccttataagatcatgaagacaaactggcggctttttcatcaaactgcgcctga cgctaaacacaaacagttcctgtttggtttgaatgaagacgtcacgcaacaggaggccat cgatattgcacttgatactgagcccaagctcaagcaaacctacgagacctacttagcgct tcatgatgctttgatggtgaagaaacatcccgcggaactggcaaacctgttagctactta cgagccaaacggtacggcaatggacatgacgatcgcgacgcttaagcgac acaaagtcgctgttctcgccgctgtcaccagcccttattccaacggtccgatcgaagggt taaccgcctcatcaagtcactcaaacgatcctgttttggcttcaagaatcagctgaactt cttcaaacgaatcataccaaatcacggcataacatgacaaagacggcggc atgatcctgaagctataataggcgcagtaatcaccttcagggcaacgtgaagctcatgcc taatagaaatacgagagcggcctaaggtcgcggcgatgtattgaatcgtgtggtgttgca tcagttctatctgagatcgttcaattaaggttataatggccatgggacctgtccttctct ctagatggtatgttatgcaaacaccattttagcaagaacggacaggtcttttttcacatt ttctgggtggtaactttaattatgcaatctaggcattaagggtcaaattaccagatgata atatgcctgattcattaataatcgcgtgtgaaaaaggaacattaatcttaggagaattga tgatcg

    [0035] As shown in FIG. 8 the regions codifying for the proteins A-P are fundamental for the synthesis/expression/secretion of the exopolysaccharide.

    [0036] SEQ ID NO: 1 comprises T1 and/or T2 sequences corresponding to transposon sequences. These sequences can be used for insertional mutagenesis.

    [0037] According to a preferred embodiment of the invention, SEQ ID NO: 1 or fragments thereof is introduced, eventually by using a vector, into a cell, preferably a bacterium.

    [0038] This allows obtaining an engineered cell, preferably an engineered bacterium or yeast comprising SEQ ID NO: 1 or fragments thereof. The engineered cell produces the exopolysaccharide of the invention.

    [0039] A further aspect of the invention refers to a medium comprising the exopolysaccharide of the invention, preferably said medium being the conditioned medium where cells producing said exopolysaccharide have been grown. These cells are preferably bacteria or yeast, preferably genetically engineered. Alternatively, the cells producing the exopolysaccharide of the invention is L. paracasei DG strain, that is the bacterium that naturally produces the exopolysaccharide of the invention. Preferably, the genetically engineered cells comprise the nucleic acid SEQ ID NO: 1 or any fragments thereof.

    [0040] A further aspect of the present invention refers to a composition comprising the exopolysaccharide as disclosed above or the conditioned medium as disclosed above and further ingredients, preferably excipients. A further aspect of the present invention refers to the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention in combination with any further probiotic bacteria or yeast. Preferably, the bacteria belong to the genus Lactobacillus and/or Bifidobacterium.

    [0041] Preferably said Lactobacillus belongs to a specie selected from: Lactobacillus paracasei, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus amylolyticus, Lactobacillus amylovorus, Lactobacillus alimentarius, Lactobacillus aviaries, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus cellobiosus, Lactobacillus coryniformis, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus farciminis, Lactobacillus fermentum, Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus hilgardii, Lactobacillus johnsonii, Lactobacillus kefiranofaciens, Lactobacillus kefiri, Lactobacillus mucosae, Lactobacillus panis, Lactobacillus collinoides, Lactobacillus paraplantarum, Lactobacillus pentosus, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus reuteri, Lactobacillus sakei, Lactobacillus salivarius and Lactobacillus sanfranciscensis, more preferably is the strain Lactobacillus paracasei DG.

    [0042] Preferably said Bifidobacterium belongs to a specie selected from: B. animalis, B. B. angulatum, B. asteroides, B. boum, B. choerinum, B. coryneforme, B. cuniculi, B. denticolens, B. dentium, B. gallicum, B. gallinarum, B. indicum, B. inopinaturn, B. lactis, B. magnum, B. merycicum, B. minimum, B. pseudocatenulatum, B. pseudolongum, B. pullorum, B. ruminantium, B. saeculare, B. subtile, B. thermacidophilum, B. thermophilum e B. tsurumiense.

    [0043] Preferably said yeast is preferably Saccharomyces, more preferably Saccharomyces cerevisiae or Saccharomyces boulardii.

    [0044] A further aspect of the present invention refers to the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention for use as a medicament.

    [0045] Preferably, the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention is used in this context to boost immune system response in an individual in need thereof.

    [0046] Therefore the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention is(are) useful as functional food and/or prebiotic.

    [0047] In other words, the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention can be added to any food, such as milk, yogurt, cheese or juice to boost immune response.

    [0048] Therefore, the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention can be useful as adjuvant for treating any disease or deficit or condition caused by impaired or compromised immune response.

    [0049] Preferably, the disease or deficit or condition of the invention involves a downregulation of at least one cytokine, preferably selected from: IL6, IL8, TNF- and CCL20.

    [0050] Indeed, the examples herewith provided show clearly that the exopolysaccharide of the invention is able to increase the expression of cytokines, with particular reference to IL6, IL8, TNF- and CCL20. Therefore, the boosting of immune system or its response is mainly due to its capability of activating cytokines, preferably pro-inflammatory cytokine expression.

    [0051] The disease or deficit or condition preferably used to treat intestinal diseases, preferably selected from: autoimmune diseases, preferably rheumatoid arthritis, lupus erythematosus or myasthenia gravis, immunodeficienfies, allergy or hypersensitivity reactions and infections, preferably bacterial and/or viral.

    [0052] Moreover, the exopolysaccharide of the invention or the conditioned medium of the invention or the composition comprising the exopolysaccharide or the conditioned medium of the invention can be useful as adjuvant for curing/treating non pathological conditions associated to stress, seasons change, vitamins deficiencies, preferably B12 and/or B19, age, pregnancy, alcohol abuse, drugs use and heavy metals poisoning, preferably lead and/or mercury.

    EXAMPLE

    [0053] Identification of the Putative EPS Gene Cluster

    [0054] In light of the potential importance of EPS molecules in the cross-talk between probiotic bacteria and host, we performed in silico analyses to identify putative EPS operons in the draft genome of the probiotic strain L. paracasei DG.

    [0055] The draft genome sequence of L. paracasei DG was obtained through Ion Torrent PGM (Life Technologies, Germany) as previously described (Guglielmetti et al, 2014). The raw sequence data were assembled using MIRA v.3.9 (http://www.chevreux.org/projects_mira.html), applying default parameters recommended for Ion Torrent data processing. Initial automated annotation of the genome was performed using RAST, combined with BLASTX. Results of the gene-finder program were combined manually with data from BLASTP analysis against a non-redundant protein database provided by the National Center for Biotechnology Information (NCBI). The L. paracasei DG draft genome sequence was compared with other L. paracasei genome sequences by means of BLAST Ring Image Generator (BRIG). The functional annotation of the EPS-b region was carried out by combining the results of BLASTN, BLASTP and the CD-search of the Conserved Domain Database (CDD) available at the NCBI website (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).

    [0056] The DNA sequence of the EPS-b region has been deposited in the EMBL database under the accession number LT629195.

    [0057] Specifically, comparative analysis with other genomes of the same species led to the identification in the genome of strain L. paracasei DG of two different regions encoding open reading frames (ORFs) putatively involved in the biosynthesis of EPS molecules (regions EPS-a and EPS-b in FIG. 1).

    [0058] Notably, whereas EPS-a region is common to all L. paracasei genomes investigated, EPS-b is a 13 kb region coding for several putative glycosyltransferases that includes a region of about 7 kb in the center of the cluster that did not find any match with other sequences in GenBank according to BLASTN search. The % GC of the 7 kb region is much lower (36%) than the average GC content of L. paracasei DG's whole genome (approximately 46%) supporting the idea of the acquisition of these genes by horizontal gene transfer from a phylogenetically unrelated host.

    [0059] EPS Isolation and Purification

    [0060] Lactobacillus paracasei strain DG (deposited at the National Collection of Microorganisms Cultures of the Pasteur Institute under the code CNCM I-1572) was grown at 37 C. in de Man-Rogosa-Sharpe (MRS) broth (Difco Laboratories Inc., Detroit, Mich.) for 24 h. This culture was used to inoculate the chemically defined medium (CDM, Table 1).

    TABLE-US-00002 TABLE I Component Concentration (g l.sup.1) Sol. 1 (NH.sub.4).sub.2SO.sub.4 2 MgSO.sub.4 7H.sub.2O 0.15 MnSO.sub.4 4H.sub.2O 0.02 Sol. 2 Adenine 0.005 Pyridoxal 0.002 Nicotinic acid 0.001 Ca.sup.2+-D-pantothenate 0.001 Riboflavin 0.001 Thiamine 0.001 Vitamin B12 0.000001 Biotin 0.00001 p-aminobenzoic acid 0.000005 Folic acid 0.00001 Sol. 4* Guanine 0.005 Xanthine 0.005 Uracil 0.005 Sol. 5 K.sub.2HPO.sub.4 4.56 Sol. 6 Sodium acetate 0.05 Sodium citrate 0.02 KH.sub.2PO.sub.4 0.01 NaCl 0.002 CaCl.sub.2 0.002 Sol. 7 Tween 80 1 Tween 20 1 Glycerol 1 Glucose 20 Casaminoacids 10

    [0061] The multistep extraction and purification of EPS was performed from about 1 L of CDM supplemented with 2% glucose. After growth at 37 C. for 48 h, cells were collected by centrifugation at 12,000g for 15 min at 4 C. (Avant J-26 XPI, Beckman Coulter Ltd, High Wycombe, UK) and separated from the exhausted medium. The two fractions were then treated separately. The exhausted medium was added with an equal volume of absolute ethanol and stored at 4 C. for 48 h. After storage, it was centrifuged at 25,000g for 35 min at 4 C. The obtained pellet (fraction S1) was dissolved in deionized water (about 20-50 ml), whereas the supernatant was added to a second volume of ethanol and stored again at 4 C. for 48 h. Subsequently, the centrifugation step was repeated, and the pellet (fraction S2) was dissolved in deionized water as above. Concerning cell fractions, the pellet was washed with phosphate-buffered saline (PBS) to remove polysaccharide impurities and then treated with 1 M sodium hydroxide and stirred overnight at 4 C. Afterwards, it was centrifuged again at 12,000g 4 C. for 15 min in order to remove sodium hydroxide. Crude EPS was precipitated by the addition of an equal volume of chilled absolute ethanol; this was stored 48 h at 4 C. and then centrifuged at 25,000g 4 C. for 35 min. The recovered pellet (fraction C1) was re-dissolved in deionized water (about 20 ml). The resulting supernatant was then added to a second volume of absolute ethanol and again incubated 48 h at 4 C. Another centrifugation, as described above, a second precipitated fraction (C2) was recovered, which was dissolved in deionized water. Small neutral sugars and proteins were then removed by dialysis (with 100 kDa cut-off cellulose acetate membranes) of the extracted fractions for 72 h at 4 C., against three changes of deionized water per day. After three days, the contents of the dialysis membrane were collected and lyophilized in a freeze-dryer (Northern Scientific, York, UK). The dry mass of EPS was then determined. The presence of contaminating bacterial DNA in the EPS preparations was tested through real-time quantitative PCR (qPCR) with two primer pairs: universal primers targeting 16S rRNA gene (EUB), and DG strain specific primers targeting welF gene. This analysis revealed the presence of 10-63 ng ml-1 in the 1 mg ml-1 stock solutions of EPS, corresponding to an overall maximum concentration of 0.6 ng ml-1 of DNA incubated with THP-1 cells when the highest concentration of EPS (10 g ml-1) was used in immunological experiments.

    [0062] The results show that, although growth was slower than that observed in more conventional media such as MRS broth, CDM was chosen as it does not contain contaminating polysaccharides which interfere with the characterization of bacterial polysaccharides by NMR. In order to isolate a sample of polysaccharide suitable for characterization, L. paracasei DG was grown for three days, at which point the cell biomass was separated from the fermentation liquors by centrifugation. High purity EPS was isolated from the supernatant by fractional precipitation of material. Adding one volume of ethanol released small amounts of an EPS material contaminated with proteins (typically 20-25 mg from a 500 ml batch fermentation). The addition of a second volume of ethanol also precipitated a relatively small amount of EPS (20-25 mg) but with much greater purity and of a purity that was suitable for characterization by NMR. As the yields of EPS were low, and in order to determine if additional material was being retained with the biomass, various different methods were attempted in order to recover capsular material bound to the cells. Stirring a suspension of the cells overnight in an aqueous solution of sodium hydroxide (1 M) and then precipitating crude polysaccharide by adding two volumes of ethanol yielded a significant amount of material which included both polysaccharide and protein. The same approach was adopted for the isolation of extracellular polysaccharide molecules from strain L. paracasei LPC-S01.

    [0063] The purity of the EPSs released into the supernatant was established by examination of a 1H-NMR spectrum of the sample (FIG. 2). The low-field region of the spectrum contained six anomeric signals. Within the error of the experiments, the peak area integrals for each of the anomeric signals were the same, implying that a single EPS having a repeating unit containing six monosaccharides had been isolated. In addition to the anomeric signals, a single resonance with an integral height of three was visible at a chemical shift of 2.05 ppm which is indicative of the presence of an N-acetylhexosamine and a further two sets of overlapping doublets, each integrating to six protons, were present at 1.25 &1.32 ppm; these signals indicated that the repeat unit contained four 6-deoxyhexoses. Determination of monomer composition and linkage analysis

    [0064] To determine the monomer composition of the polysaccharide, the EPS (3 mg) was hydrolyzed by treatment with 2 M trifluoroacetic acid (TFA, 120 C. for 2 h); the released monosaccharides were subsequently derivatized to form alditol acetates, which were analyzed by gas chromatographymass spectrometry (GC-MS). To derivatize the monomers, the mix resuspended in 1 ml Milli-Q water was added with 10 mg NaBH4 and incubated at 40 C. for 2 h. After evaporation of the solution, 1 ml glacial acetic acid was added to the residue, and again evaporated to dryness. Subsequently, 3 ml methanol were added and then evaporated in order to remove the borate complex and to give the methylated sugar alditols. They were then added with 2 ml pyridine and 2 ml acetic anhydride; acetylation reaction ran at 100 C. for 2 h. At the end of the reaction, the solution was evaporated and the acetylated monomers resuspended in water.

    [0065] Extraction with chloroform was performed to collect the organic phase, containing the alditol acetate sugars. Any trace of water was removed by adding anhydrous sodium sulphate and storing the sample 30 min at 4 C. Sodium sulphate was removed by filtration on filter paper and chloroform by evaporation. The resulting residue was resuspended in acetone. The GC-MS analysis was performed on an Agilent 7890A GC system (Santa Clara, Calif., USA) coupled to an Agilent 5675c quadrupole MS. The samples were eluted from a HP-5 column (30 m0.25 mm id, 0.25 m film) using helium as carrier (9 psi, flow rate 1 ml min-1) and using a temperature program (start temperature 150 C., hold time 4 min, and a final column temperature of 250 C. reached via a rising gradient of 4 C. min-1). The ratios of the different sugars were determined by examination of the relative responses of the different alditol acetates with reference to the relative responses determined for a standard mixture of alditol acetates. The integral area for amino sugars was low, and this is a result of their having undergone thermal decomposition during analysis. The final monomer ratio, for the amino sugar, was taken from integration of the nuclear magnetic resonance (NMR) peak integrals for the respective anomeric and H2 protons. The absolute configurations of monosaccharides were determined by conversion to their 2-butyl glycosides using the procedure described by Gerwig et al. 1979. To determine the linkage pattern of the EPS, the sample was permethylated using the procedures described by Ciucanu and Kerek, 1984. The permethylated polysaccharide was then hydrolyzed (2 M TFA, 120 C. for 2 h) and the methylated monosaccharides converted to methylated alditol acetates. The identity of the methylated alditol acetates was determined by analysis of their individual mass spectrum fragmentation patterns generated during GC-MS analysis. The GC-MS analyses were performed on the same instrumentation as the monomer analysis but using the following temperature program: start temperature 155 C., hold time 1 min, and a final column temperature of 195 C. reached via a rising gradient of 0.75 C. min1.

    [0066] GC-MS analysis of the alditol acetates generated during monomer analysis of the EPS identified the presence of 1,2,3,4,5-penta-O-acetyl-L-rhamnitol, 1,2,3,4,5,6-hexa-O-acetyl-D-galactitol, and 2-acetamido-1,3,4,5,6-penta-O-acetyl-2-deoxy-D-galactitol in a ratio of 4:1:1. The results of the monomer analysis identified the presence of rhamnose, galactose, and N-acetylgalactosamine in the repeating unit.

    [0067] The methylated alditol acetates generated during linkage analysis included: a 1,5-di-O-acetyl-2,3,4,6-tetra-O-methylhexitol which confirms that the galactose is present in its pyranose form as a terminal sugar; a 1,3,5-tri-O-acetyl-2-(acetylmethylamino)-2-deoxy-4,6-di-O-methylgalacitol, which confirms that the N-acetylgalactosamine is present in its pyranose form as a 1,3-linked monosaccharide; two 1,2,5-tri-O-acetyl-3,4-di-O-methyl-6-deoxyhexitols, which indicates that two of the rhamnose monomers are 1,2-linked; a 1,3,5-tri-O-acetyl-6-deoxy-2,4-di-O-methylhexitol, which indicates that one of the rhamnose monomers is 1,3-linked; and finally a 1,2,3,5-tetra-O-acetyl-6-deoxy-4-O-methylhexitol suggesting that the final rhamnose is a 1,2,3-linked rhamnose present as a bridging point in the repeating unit.

    [0068] Conversion of the monomers to mixtures of their epimeric 2-butyl-glycosides confirmed that all the rhamnose monomers were of L-absolute configuration whilst both the galactose and N-acetylgalactosamine were of D-absolute configuration.

    [0069] NMR Analysis of the EPS from L. paracasei

    [0070] Nuclear magnetic resonance (NMR) spectra were recorded for EPS samples that were dissolved (10-20 mg ml-1) directly in D2O (Goss Scientific Instruments Ltd., Essex, UK). NMR spectra were recorded at a probe temperature of 70 C. NMR spectra were recorded on a Bruker Avance 500.13 MHz 1H (125.75 MHz 13C) spectrometer (Bruker-Biospin, Coventry, UK) operating with Z-field gradients where appropriate and using Bruker's pulse programs. Chemical shifts are expressed in ppm relative to internal acetone ( 2.225 for 1H and 31.55 for 13C). Spectra recorded included: a 2D gradient-selected double quantum filtered correlation spectrum (gs-DQF-COSY) recorded in magnitude mode at 70 C.; total correlation spectroscopy (TOCSY) experiments recorded with variable mixing times (60, 90, 120 ms); 1H-13C heteronuclear single quantum coherence (HSQC) spectra (decoupled and coupled); a heteronuclear multiple bond correlation (HMBC) spectrum; and finally, a rotating frame nuclear Overhauser effect spectrum (ROESY). The 2D spectra were recorded with 256 experiments of 1024 data points. The ROESY spectrum was recorded using a Bruker pulse sequence and 256 experiments of 1024 data points using a mixing time of 200 ms. For the majority of spectra, time-domain data were multiplied by phase-shifted (squared-) sine-bell functions. After applying zero-filling and Fourier transformation, data sets of 1024-1024 points were obtained.

    [0071] The chemical shifts of each of the protons and carbons in the repeat unit were determined through the inspection of a series of 1D & 2D NMR spectra (Table II).

    TABLE-US-00003 TABLE II Position A B C D E F H1 5.30 5.21 5.15 4.87 4.72 4.53 (C1) (102.6) (102.2) (102.4) (102.5) (103.5) (106.0) H2 4.21 4.07 4.13 3.90 3.82 3.59 (C2) (79.8) (79.6) (80.3) (71.6) (57.1) (72.5) H3 4.01 3.91 3.86 3.79 3.65 3.63 (C3) (78.2) (72.0) (71.3) (79.5) (83.1) (76.5) H4 3.67 3.49 3.35 3.55 3.54 3.93 (C4) (70.4) (73.6) (73.7) (72.9) (72.6) (70.1) H5 3.82 3.77 3.66 4.02 3.45 3.53 (C5) (70.6) (70.6) (73.8) (70.5) (77.3) (70.0) H6 1.32 1.32 1.25 1.25 3.91/3.75 3.75 (C6) (18.6) (18.1) (18.0) (17.9) (62.4) (62.3) Acetyl CH.sub.3 (CH.sub.3CO) 2.05 CH.sub.3 23.5 CO 175.6

    [0072] Analysis of the 1H-1H COSY spectrum (FIG. 3, black contours) in combination with the 1H-1H TOCSY spectrum (FIG. 3, grey contours) allowed the scalar coupling within the individual sugars to be tracked from the anomeric protons (labelled A to F in order of decreasing chemical shift-see FIG. 2) from H1 to H6 in the rhamnose sugars (A, B, C, and D) and from H1 to H4 in the galactose and N-acetylgalactosamine monomers (FIG. 3).

    [0073] A HSQC spectrum was used to correlate ring carbons with their attached protons (FIG. 4) and the distinctive position of C2 and identification of H2 of the N-acetylgalactosamine confirmed, by observation of scalar coupling to H1 resonance at 4.72 on the COSY spectrum, that the anomeric resonance at 4.72 ppm (E in FIG. 2) was that of the N-acetylgalactosamine. The remaining anomeric resonance at 4.53 ppm must therefore belong to the terminal galactose.

    [0074] Through inspection of the carbon chemical shifts of the rhamnose ring carbons, it was possible to identify points of linkages by locating those carbons whose chemical shifts had moved towards low-field positions (above 78 ppm) compared to the values normally associated with unsubstituted ring positions (less than 74 ppm for rhamnose sugars). This identified A as a 2,3-linked rhamnose (C2, 79.8 ppm; C3, 78.2 ppm), B as a 2-linked rhamnose (C2, 79.6 ppm), C as a 2-linked rhamnose (C2, 80.3 ppm), and D as a 3-linked rhamnose (C3, 79.5 ppm). The results of the linkage analysis already identified that the N-acetylgalactosamine (E) is 1,3-linked, and this was confirmed by the high chemical shift of C-3 in E ( 83.1 ppm). Finally, the chemical shifts of the carbons in residue F are in agreement with this being a terminal galactose monomer.

    [0075] The anomeric configuration of the monosaccharides was determined by measuring the 1JC1-H1 coupling constants which were visible on a coupled HSQC spectrum. Residues A to D had 1JC1-H1 coupling constants A (177 Hz), B (172 Hz), C (175 Hz), and D (174 Hz) which are more than 170 Hz, which indicates that the rhamnose residues are alpha-linked, whilst the size of the 1JC1-H1 coupling constants in E (164 Hz) and F (157 Hz) identifies these two resonances as beta-linked monomers. Finally, the sequence of the sugars in the repeating unit was established through inspection of both a 1H-13C-HMBC spectrum and a 1H-1H-ROESY spectrum (FIG. 5). Inter-residue scalar coupling observed on the HMBC spectrum included: coupling between A-H1 & D-C3, indicating A is linked to the 3-position of D; coupling between C-H1 & B-C2, indicating C is linked to the 2-position of B; coupling between D-H1 & E-C3, indicating D is linked to the 3-position of E; coupling between F-H1 & A-C2, indicating F is linked to the 2-position of A. On the ROESY spectrum, inter-residue NOEs were observed: between A-H1 & D-H3, confirming the A(1-3)D linkage; between B-H1 and A-H3 (strong) and A-H4 (moderate), identifying that B is linked to the 3-position of A; between C-H1 & B-H2, confirming the C(1-2)B linkage; between D-H1 & E-H3, identifying a D(1-3)E linkage; between E-H1 & C-H2, identifying the E(1-2)C linkage; and also between F-H1 & A-H2, confirming the F(1-2)A linkage.

    [0076] The combined results of the chemical and NMR analysis of the EPS isolated from L. paracasei DG indicates that the DG-EPS is a novel heteropolysaccharide having the repeating unit structure reported in FIG. 6.

    [0077] Bacterial Adhesion to Caco-2 Cell Line

    [0078] In order to investigate the potential ability of the DG-EPS to mediate the bacterium's interaction with the host, we first used the Caco-2 cell line, which is considered a valuable in vitro tool for studying the mechanisms underlying the interaction between bacterial cells and the human gut.

    [0079] The adhesion of L. paracasei strains to Caco-2 (ATCC HTB-37) cell layer was assessed as previously described in Balzaretti et al, 2015. In brief, for adhesion experiments, fully differentiated Caco-2 cells were used (i.e., 15 days after confluence). 100 g ml-1 EPS was incubated with a monolayer of Caco-2 cells for 1 h at 37 C. Finally, monolayers were examined microscopically (magnification, 400) under oil immersion after Giemsa staining. All experiments were performed in duplicate.

    [0080] The potential involvement of DG-EPS was assessed by testing also the adhesion ability of strain DG after removal of the EPS molecule (naked DG cells, nDG, prepared through PBS washes and mild sonication) and upon pre-incubation of Caco-2 cells with purified EPS.

    [0081] The results demonstrate that purified EPS was unable to affect the adhesion properties of strain DG. In fact, the adhesion of L. paracasei DG was not significantly different from that of nDG and was quite modest (about 300 bacteria per 100 Caco-2 cells); in addition, the adhesion ability was unaffected by the co-incubation of the bacterial cells with purified EPS.

    [0082] Nuclear Factor B (NF-B) Activation by Exopolysaccharides

    [0083] The activation of nuclear factor B (NF-B) was studied by means of a recombinant Caco-2 cell line stably transfected with vector pNiFty2-Luc (InvivoGen, Labogen, Rho, Italy). Recombinant Caco-2 monolayers (approximately 3105 cells/well), cultivated in the presence of 50 g ml-1 zeocin, were washed with 0.1 M Tris-HCl buffer (pH 8.0) and then suspended in fresh Dulbecco's Modified Eagle Medium (DMEM) containing 100 mM HEPES (pH 7.4) and with 0.1 ml of L. paracasei DG-EPS, corresponding to a final concentration of 100 g ml-1. The stimulation was conducted by adding 10 ng ml-1 of interleukin (IL)-1p. After incubation at 37 C. for 4 h, the samples were treated, and the bioluminescence was measured as described by Stuknyte et al., 2011. Two independent experiments were conducted in triplicate for each condition.

    [0084] Recently it has been showed that L. paracasei DG possesses an evident ability to reduce NF-B activation in Caco-2 cells at baseline and upon stimulation with the pro-inflammatory cytokine IL-1p (Balzaretti, 2015), as determined through a reporter system obtained by transfecting Caco-2 cells with a luciferase reporter vector. Here, the same immunological model has been used to test the EPS macromolecule isolated from strain DG. The results show that the purified EPS molecule, differently from the whole bacterial cells and their exhausted broth, was unable to affect NF-B activation both at baseline and in the presence of the pro-inflammatory stimulus IL-1 (data not shown. Other L. paracasei strains under study (namely, strains LPC-S01 and Shirota) displayed the same ability of strain DG in reducing NF-B activation in Caco-2 cells (13), further suggesting that DG-EPS does not contribute to this specific immunomodulatory effect.

    [0085] Activation of THP-1 Human Macrophage Cell Line: Cell Culture, Growth Conditions, and Stimulation Protocol

    [0086] The monocytic THP-1 cell line was purchased from the American Type Culture Collection (Manassas, Va., USA). THP-1 cells were originally cultured from the peripheral blood of 1-year child with acute monocytic leukemia. They are non-adherent cells, which can be differentiated into macrophage-like cells through a protein kinase C-mediated reactive oxygen species (ROS)-dependent signaling pathway by treatment with phorbol myristate acetate (PMA). The normal growth medium for THP-1 cells consisted of RPMI 1640 medium (Lonza, Basel, Switzerland) supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco-BRL, Life Technologies, Milan. Italy), 2 mM L-glutamine, 100 units ml-1 penicillin and 100 g ml-1 streptomycin (Sigma-Aldrich). Cells were seeded at a density of 5105 cells/well in 24-well plates and incubated at 37 C. in a humidified atmosphere of 95% air and 5% CO2. Differentiation was induced by the addition of PMA (Sigma-Aldrich) into the cellular medium at a final concentration of 100 nM and was allowed to proceed for 24 h. Afterwards, cells were washed once with sterile PBS buffer to remove all non-adherent cells, and fresh complete medium was added. Bacteria were used at the multiplicity of infection (MOI) of 50, EPS at final concentrations of 0.1, 1, and 10 g ml-1; lipopolysaccharide (LPS) from Salmonella enterica (Sigma-Aldrich) was used at a final concentration of 1 g ml-1. An untreated sample, i.e., only RPMI 1640 medium with 10% (v/v) FBS, was used as control.

    [0087] Preparation of RNA and Real-Time Quantitative PCR (qRT-PCR)

    [0088] After incubating THP-1 cells at 37 C. for 4 h, the supernatant was carefully removed from each well, and the total cellular RNA was isolated from the adhered cells with the Total RNA Blood and Cultured Cells Kit (GeneAid, New Taipei City, Taiwan). Afterwards, traces of DNA were removed by treatment with DNAse enzyme (Sigma-Aldrich), following the manufacturer's instructions. RNA concentration and purity was determined with a Take3 Multivolume Plate Reader (Biotek, Luzern, Switzerland), and reverse transcription to cDNA was performed with the iScript Select cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, Calif.), using the following thermal cycle: 5 min at 25 C., 30 min at 42 C., and 5 min at 85 C. Real-time Quantitative PCR (qRT-PCR) was carried out in order to measure the mRNA expression levels of cytokines by means of the SYBR Green technology using the SsoFast EvaGreen Supermix (Bio-Rad) on a Bio-Rad CFX96 system according to the manufacturer's instructions.

    [0089] The primers were as follows (5custom-character3):

    TABLE-US-00004 GAPDHforward,5-GGGAAGGTGAAGGTCGGAGT-3; GAPDHreverse,5-TCAGCCTTGACGGTGCCATG-3; IL-6forward,5-CGGTACATCCTCGACGGCAT; IL-6reverse,5-TCACCAGGCAAGTCTCCTCAT-3; IL-8forward,5-TGTGGTATCCAAGAATCAGTGAA-3; IL-8reverse,5-TATGTTCTGGATATTTCATGGTACA-3; CCL20forward,5-CTGCTTGATGTCAGTGCTG; CCL20reverse,5-CACCCAAGTCTGTTTTGG-3; TNF- forward,5-TCAGCTCCACGCCATT-3; TNF- reverse,5-CCCAGGCAGTCAGATCAT-3; COX-2forward,5-CCCTTGGGTGTCAAAGGTAA; COX-2reverse,5-TGAAAAGGCGCAGTTTACG-3.

    [0090] All primers were designed previously, and their specificity was assessed with melting curves during amplification and by 1% agarose gels. Quantitative PCR was carried out according to the following cycle: initial hold at 95 C. for 30 s and then 39 cycles at 95 C. for 2 s and 60 C. (for TNF- and cyclooxygenase COX-2) or 58.2 C. (for IL-6, IL-8 and CCL20) for 5 s. Gene expression was normalized to the reference glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene. The amount of template cDNA used for each sample was 15 ng. All results regarding cytokine mRNA expression levels are reported as the fold of induction (FOI) relative to the control (namely unstimulated THP-1), to which we attributed a FOI of 1. Statistically significant differences have been determined through unpaired Student's t test with a two-tailed distribution.

    [0091] The gene expression of the tumor necrosis factor (TNF)-, the interleukin (IL)-6, the chemokine (C-C motif) ligand 20 (CCL20), the chemokine IL-8, and the cyclooxygenase (COX)-2 were quantified through qRT-PCR. Three concentrations of the purified DG-EPS molecule (0.1, 1, and 10 g ml-1) were tested. The same experiments were performed in the presence of 1 g ml-1 of the pro-inflammatory stimulus LPS.

    [0092] The results show that the purified DG-EPS can stimulate the expression of all genes under study in a concentration-dependent manner, with the exception of COX-2 (FIG. 7). In particular, the chemokines IL-8 and CCL20 were induced approximately 70-fold by 10 g ml-1 DG-EPS, whereas the pro-inflammatory cytokines TNF- and IL-6 26- and 39-fold, respectively. A similar stimulatory profile was observed with bacterial cells of strain DG (MOI 50), even if to a lower extent (FIG. 8). In addition, when EPS was removed by PBS washes and mild sonication, the bacterial cells of strain DG lost their ability to stimulate the gene expression of TNF-, IL-8 and CCL20; the addition of 1 g ml-1 purified EPS partially reconstituted the stimulatory capacity of the cells (FIG. 8).

    [0093] As expected, the stimulation of THP-1 cells with LPS determined a marked overexpression of all tested genes, particularly IL-6, IL-8, and CCL20. However, the addition of DG-EPS did not significantly affect the LPS-associated inductions of all tested genes (FIG. 7).

    [0094] In conclusion, thanks to the genomic analysis on L. paracasei strain DG, we could identify two gene clusters putatively coding for EPS biosynthesis. Interestingly, GenBank search revealed that one of these regions, EPS-b, is unprecedented.

    [0095] After purification of the exopolysaccharidic cell fraction of strain DG, the EPS repeating unit was characterized by means of chromatographic methods and NMR spectroscopy, establishing that it possesses a novel structure.

    [0096] Effectively, the repeating unit structures of a number of different strains of the L. casei group of species (i.e., L. casei, L. paracasei, and L. rhamnosus) have previously been published, and the one reported here is different.

    [0097] Any EPS molecule with a different monosaccharide sequence may represent a potential novel MAMP.

    [0098] DG-EPS displays immunostimulating properties in human leukemia monocytic THP-1 cells by enhancing the gene expression of the pro-inflammatory cytokines TNF- and IL-6 and, particularly, the chemokines IL-8 and CCL20. On the contrary, the expression level of the cyclooxygenase enzyme COX-2 was not affected.

    [0099] The purified EPS produced by L. paracasei DG displayed an immunostimulatory activity, particularly in terms of chemokines expression. Thus, the EPS from L. paracasei DG, rather than an inert molecule, can be considered a bacterial product that can boost the immune system as either a secreted molecule released from the bacterium or also, plausibly, as a capsular envelope on the bacterial cell wall.

    [0100] In conclusion, the probiotic strain L. paracasei DG produces a unique rhamnose-rich hetero-exopolysaccharide, named DG-EPS, possessing immunostimulatory properties.

    [0101] DG-EPS may represent a new molecule for potential nutraceutical and pharmaceutical applications.