COMPOSITIONS AND METHODS FOR PRODUCING TOBACCO PLANTS AND PRODUCTS HAVING ALTERED ALKALOID LEVELS
20190343166 ยท 2019-11-14
Assignee
Inventors
- Andrew Carl Adams (Midlothian, VA)
- Marcos Fernando de Godoy Lusso (Chesterfield, VA)
- Sreepriya Pramod (Glen Allen, VA)
- Dongmei Xu (Glen Allen, VA)
Cpc classification
A24B13/00
HUMAN NECESSITIES
C12N15/8243
CHEMISTRY; METALLURGY
A01H1/101
HUMAN NECESSITIES
International classification
A24B15/10
HUMAN NECESSITIES
A24B13/00
HUMAN NECESSITIES
A24D3/04
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides the identification of tobacco Nic1 locus. Also provided are tobacco plants with altered total alkaloid and nicotine levels and commercially acceptable leaf grade, their development via breeding or transgenic approaches, and production of tobacco products from these tobacco plants. Also provided are compositions and methods for producing tobacco plants having novel Nic1 mutations or alleles to reduce nicotine levels. Further provided are sequence polymorphisms and molecular markers for breeding tobacco with reduced nicotine or nicotine free while maintaining tobacco leaf grade and tobacco product quality.
Claims
1. A tobacco plant, or part thereof, comprising a Nicotine1 (Nic1) locus comprising a first allele of a first SNP marker selected from the group consisting of SEQ ID NOs: 131 to 136, and a Nicotine2 (Nic2) locus comprising a second allele of a second SNP marker selected from the group consisting of SEQ ID NOs: 137 to 142; wherein said tobacco plant produces leaves having a USDA grade index value of at least about 65% of the USDA grade index value of leaves of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said Nic1 and Nic2 loci; wherein said tobacco plant comprises a nicotine level less than 2.0%; wherein said first allele of said first SNP marker comprises one or more nucleotides selected from the group consisting of nucleotide A at the polymorphic site of said SEQ ID Nos. 131, nucleotide T at the polymorphic site of said SEQ ID Nos. 132, nucleotide G at the polymorphic site of said SEQ ID Nos. 133, nucleotide C at the polymorphic site of said SEQ ID Nos. 134, nucleotide T at the polymorphic site of said SEQ ID Nos. 135, and nucleotide G at the polymorphic site of said SEQ ID Nos. 136; and wherein said second allele of said second SNP marker comprises one or more nucleotides selected from the group consisting of nucleotide C at the polymorphic site of said SEQ ID Nos. 137, nucleotide A at the polymorphic site of said SEQ ID Nos. 138, nucleotide A at the polymorphic site of said SEQ ID Nos. 139, nucleotide A at the polymorphic site of said SEQ ID Nos. 140, nucleotide G at the polymorphic site of said SEQ ID Nos. 141, and nucleotide C at the polymorphic site of said SEQ ID Nos. 142.
2. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more.
3. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant comprises nicotine at a level below 25% of the nicotine level of said control plant when grown in similar growth conditions.
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. A population of the tobacco plants of claim 1.
11. Cured tobacco material from said tobacco plant of claim 1.
12. The cured tobacco material of claim 11, wherein said cured tobacco material comprises a lower level of nicotine compared to cured tobacco material from said control tobacco plant when grown in similar growth conditions.
13. The cured tobacco material of claim 11, wherein said tobacco plant comprises nicotine at a level between 0.2% and 0.6%.
14. The cured tobacco material of claim 11, wherein said cured tobacco material is made by a curing process selected from the group consisting of flue curing, air curing, fire curing, and sun curing.
15. A tobacco product comprising the cured tobacco material of claim 11.
16. The tobacco product of claim 15, wherein said tobacco product is selected from the group consisting of a cigarette, a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
17. The tobacco product of claim 15, wherein said tobacco product is a smokeless tobacco product.
18. (canceled)
19. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant comprises nicotine at a level below 10% of the nicotine level of said control plant when grown in similar growth conditions.
20. (canceled)
21. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant is not a flue-cured tobacco.
22. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant is a burley tobacco.
23. The tobacco plant, or part thereof, of claim 1, wherein said tobacco plant is an oriental tobacco.
24. A tobacco seed giving rise to the tobacco plant of claim 1.
25. The tobacco plant, or part thereof, of claim 1, wherein said Nic1 locus, said Nic2 locus, or both are also present in LA Burley 21.
26. A method of selecting a tobacco plant, said method comprising: (a) isolating nucleic acids from a collection of tobacco germplasm; (b) assaying said nucleic acids for one or more first markers within 5 centimorgans (cM) of a first SNP marker selected from the group consisting of SEQ ID NOs. 131 to 136; and (c) selecting a tobacco plant having a low nicotine trait based on said marker assay.
27. The method of claim 26, further comprising: assaying the nucleic acids for one or more second markers within 5 centimorgans (cM) of a second SNP marker selected from the group consisting of SEQ ID NOs. 137 to 142.
28. The method of claim 27, wherein said one or more first markers are selected from the group consisting of SEQ ID NOs. 131 to 136, and wherein said one or more second markers are selected from the group consisting of SEQ ID NOs. 137 to 142.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
BRIEF DESCRIPTION OF THE SEQUENCES
[0032] SEQ ID No: 1 sets forth the sequence of a Nic1 associated deletion, Scaffold0002504, identified from LA BU21.
[0033] SEQ ID No: 2 sets forth the sequence of a Nic2 associated deletion, Scaffold0000549, identified from LA BU21.
[0034] SEQ ID Nos: 3 to 8 set forth primer sequences used for PCR confirmation of identified Nic1 and Nic2 deletions.
[0035] SEQ ID Nos: 9 to 28 set forth genomic sequences of 20 annotated genes in Nic1 associated deletion Scaffold0002504.
[0036] SEQ ID Nos: 29 to 48 set forth cDNA sequences of 20 annotated genes in Nic1 associated deletion Scaffold0002504.
[0037] SEQ ID Nos: 49 to 68 set forth amino acid sequences encoded by 20 annotated genes in Nic1 associated deletion Scaffold0002504.
[0038] SEQ ID Nos: 69 and 70 set forth exemplary transformation cassette sequences for suppressing g100614_Scaffold0002504 and g100631_Scaffold0002504 via RNA interference (RNAi).
[0039] SEQ ID Nos: 71 and 72 set forth reference TN90 alleles of sequence polymorphisms.
[0040] SEQ ID No: 73 sets forth the sequence of a tobacco genomic sequence assembly NT2.0-Scaffold4274 which comprises a re-sequenced segment of NT1.0-Scaffold0002504. Specifically, nucleotides 148796 to 282345 of NT2.0-Scaffold4274 correspond to and replace NT1.0-Scaffold0002504 between nucleotides 384701 to 542313 in the minus orientation.
[0041] SEQ ID No: 74 sets forth the sequence of a tobacco genomic sequence assembly NT2.0-Scaffold14415 which comprises a re-sequenced segment of NT1.0-Scaffold0002504. Specifically, nucleotides 1 to 59671 of NT2.0-Scaffold14415 correspond to and replace NT1.0-Scaffold0002504 between nucleotides 288601 to 363040 in the minus orientation.
[0042] SEQ ID Nos: 75 and 82 set forth re-sequenced and re-fined genomic sequences of eight annotated genes in Nic1 associated deletion.
[0043] SEQ ID Nos: 83 and 84 set forth further annotated cDNA and amino acid sequences of the gene in g100623_Scaffold0002504 based on re-sequencing.
[0044] SEQ ID No: 85 sets forth the genomic sequence of the complete Nic1 deletion region in LA BU21.
[0045] SEQ ID Nos: 86 to 100 set forth genomic sequences of 15 annotated genes in SEQ ID No: 85.
[0046] SEQ ID Nos: 101 to 115 set forth cDNA sequences of 15 annotated genes in SEQ ID No: 85.
[0047] SEQ ID Nos: 116 to 130 set forth protein sequences of 15 annotated genes in SEQ ID No: 85.
[0048] SEQ ID Nos: 131 to 142 set forth 12 SNP marker sequences flanking nic1 or nic2 deletion.
[0049] SEQ ID Nos: 143 and 144 set forth two SNP marker sequences associated with an ERF-39 like gene.
[0050] SEQ ID Nos: 145 to 147 set forth genomic, cDNA, and protein sequences of an ERF-39 like gene.
[0051] SEQ ID Nos: 148 to 164 set forth sequences of inverted repeat-containing RNAi cassettes targeting NDG1 to NDG15.
[0052] Various sequences disclosed herein include N in nucleotide sequences or X in amino acid sequences. N can be any nucleotide, e.g., A, T, G, C, or a deletion or insertion of one or more nucleotides. In some instant, a string of N are shown. The number of N does not necessarily correlate with the actual number of undetermined nucleotides at that position. The actual nucleotide sequences can be longer or shorter than the shown segment of N. Similarly, X can be any amino acid residue or a deletion or insertion of one or more amino acids. Again, the number of X does not necessarily correlate with the actual number of undetermined amino acids at that position. The actual amino acid sequences can be longer or shorter than the shown segment of X.
DETAILED DESCRIPTION
[0053] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. One skilled in the art will recognize many methods can be used in the practice of the present disclosure. Indeed, the present disclosure is in no way limited to the methods and materials described. For purposes of the present disclosure, the following terms are defined below.
[0054] Any references cited herein, including, e.g., all patents and publications are incorporated by reference in their entirety.
[0055] As used herein, the singular form a, an, and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0056] The term about is used herein to mean approximately, roughly, around, or in the region of. When the term about is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth.
[0057] As used herein, a tobacco plant can be from any plant from the Nicotiana genus including, but not limited to Nicotiana tabacum, Nicotiana amplexicaulis PI 271989; Nicotiana benthamiana PI 555478; Nicotiana bigelovii PI 555485; Nicotiana debneyi; Nicotiana excelsior PI 224063; Nicotiana glutinosa PI 555507; Nicotiana goodspeedii PI 241012; Nicotiana gossei PI 230953; Nicotiana hesperis PI 271991; Nicotiana knightiana PI 555527; Nicotiana maritima PI 555535; Nicotiana megalosiphon PI 555536; Nicotiana nudicaulis PI 555540; Nicotiana paniculata PI 555545; Nicotiana plumbaginifolia PI 555548; Nicotiana repanda PI 555552; Nicotiana rustica; Nicotiana suaveolens PI 230960; Nicotiana sylvestris PI 555569; Nicotiana tomentosa PI 266379; Nicotiana tomentosiformis; and Nicotiana trigonophylla PI 555572.
[0058] In some aspects, the present disclosure provides tobacco plants, or part thereof, comprising a mutation in Nic1 locus, a mutation in Nic2 locus, or both, wherein the tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more. In some aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value selected from the group consisting of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more. In other aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein the control plant shares an essentially identical genetic background with the tobacco plant except the mutation. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% of the USDA grade index value of a control plant when grown in similar growth conditions, wherein the control plant shares an essentially identical genetic background with the tobacco plant except the mutation. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of between 65% and 130%, between 70% and 130%, between 75% and 130%, between 80% and 130%, between 85% and 130%, between 90% and 130%, between 95% and 130%, between 100% and 130%, between 105% and 130%, between 110% and 130%, between 115% and 130%, or between 120% and 130% of the USDA grade index value of the control plant. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of between 70% and 125%, between 75% and 120%, between 80% and 115%, between 85% and 110%, or between 90% and 100% of the USDA grade index value of the control plant. In some aspects, tobacco plants disclosed herein comprise nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of a control plant when grown in similar growth conditions, wherein the control plant shares an essentially identical genetic background with the tobacco plant except the mutation. In other aspects, tobacco plants disclosed herein comprise a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%. In further aspects, tobacco plants disclosed herein further comprises a transgene or mutation directly suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, A622, and MATE transporter.
[0059] In some aspects, the present disclosure provides tobacco plants, or part thereof, comprising a mutation in Nic1 locus, a mutation in Nic2 locus, or both, wherein the tobacco plant is capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein the control plant shares an essentially identical genetic background with the tobacco plant except the mutation. In other aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value selected from the group consisting of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more. In other aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value selected from the group consisting of between 50 and 95, between 55 and 95, between 60 and 95, between 65 and 95, between 70 and 95, between 75 and 95, between 80 and 95, between 85 and 95, between 90 and 95, between 55 and 90, between 60 and 85, between 65 and 80, between 70 and 75, between 50 and 55, between 55 and 60, between 60 and 65, between 65 and 70, between 70 and 75, between 75 and 80, between 80 and 85, between 85 and 90, and between 90 and 95. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% of the USDA grade index value of the control plant. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of between 65% and 130%, between 70% and 130%, between 75% and 130%, between 80% and 130%, between 85% and 130%, between 90% and 130%, between 95% and 130%, between 100% and 130%, between 105% and 130%, between 110% and 130%, between 115% and 130%, or between 120% and 130% of the USDA grade index value of the control plant. In further aspects, tobacco plants disclosed herein are capable of producing leaves having a USDA grade index value of between 70% and 125%, between 75% and 120%, between 80% and 115%, between 85% and 110%, or between 90% and 100% of the USDA grade index value of the control plant. In other aspects, tobacco plants disclosed herein comprise nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of the control plant when grown in similar growth conditions. In other aspects, tobacco plants disclosed herein further comprises a transgene or mutation directly suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, A622, and MATE transporter.
[0060] In some aspects, the present disclosure also provides a tobacco variety, cultivar, or line comprising a mutation selected from the group consisting of a nic1 mutation, a nic2 mutation, and a combination thereof, wherein the tobacco variety, cultivar, or line has a leaf grade comparable to the leaf grade of a control tobacco variety, cultivar, or line when grown in similar growth conditions, wherein the control tobacco variety shares an essentially identical genetic background with the tobacco variety, cultivar, or line except the mutation.
[0061] In some aspects, the present disclosure further provides non-transgenic tobacco plants, or part thereof, comprising a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%, wherein the tobacco plants are capable of producing leaves having a USDA grade index value of 50 or more 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more. In other aspects, such non-transgenic tobacco plants comprise a nicotine level of less than 2.0% and are capable of producing leaves having a USDA grade index value of 70 or more. In furthers aspects, such non-transgenic tobacco plants comprise a nicotine level of less than 1.0% and are capable of producing leaves having a USDA grade index value of 70 or more.
[0062] In some aspects, the present disclosure also provides a tobacco plant, or part thereof, comprising a non-transgenic mutation, wherein the non-transgenic mutation reduces the nicotine level of the tobacco plant to below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of a control plant when grown in similar growth conditions, wherein the tobacco plant is capable of producing leaves having a USDA grade index value comparable to the USDA grade index value of the control plant, and wherein the control plant shares an essentially identical genetic background with the tobacco plant except the non-transgenic mutation.
[0063] In some aspects, the present disclosure provides tobacco plants, or part thereof, comprising a mutation in Nic1 locus, wherein the mutation is absent from LA Burley 21. In some aspects, tobacco plants provided herein comprise a shorter chromosome deletion at Nic1 locus compared to LA Burley 21. In other aspects, tobacco plants provided herein comprise no deletion of a complete gene or a complete genic coding sequence in Nic1 locus. In some aspects, tobacco plants provided herein are homozygous at Nic1 locus. In other aspects, tobacco plants provided herein are heterozygous at Nic1 locus. In some aspects, tobacco plants provided herein comprise a Nic1 mutation selected from the group consisting of a point mutation, a deletion, an insertion, a duplication, and an inversion. In some aspects, Nic1 mutations in the tobacco plants provided herein are introduced by an approach selected from the group consisting of random mutagenesis and targeted mutagenesis. In other aspects, Nic1 mutations in the tobacco plants provided herein are introduced by a targeted mutagenesis approach selected from the group consisting of meganuclease, zinc finger nuclease, TALEN, and CRISPR.
[0064] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
[0065] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes comprising a coding sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 29 to 48, 83, 101 to 115, 146, and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes comprising a coding sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 29 to 48, 83, 101 to 115, 146, and fragments thereof.
[0066] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes encoding a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 84, 116 to 130, 147 and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes encoding a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 84, 116 to 130, 147 and fragments thereof.
[0067] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
[0068] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes comprising a coding sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 33, 48, 101, 102, and 146, and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes comprising a coding sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 33, 48, 101, 102, and 146, and fragments thereof.
[0069] In some aspects, tobacco plants provided herein comprise one or more mutations within one or more genes encoding a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 53, 68, 116, 117, and 147, and fragments thereof. In some aspects, one or more mutations reduce the expression or activity of one or more genes encoding a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 53, 68, 116, 117, and 147, and fragments thereof.
[0070] LA Burley 21 is a low total alkaloid tobacco line produced by incorporation of a low alkaloid gene(s) from a Cuban cigar variety into Burley 21 through several backcrosses (Legg et al. 1970). It has approximately 0.2% total alkaloids (dry weight) compared to the about 3.5% (dry weight) of its parent, Burley 21. LA BU21 has a leaf grade well below commercially acceptable standards.
[0071] Unless specified otherwise, measurements of alkaloid or nicotine levels or leaf grade index values mentioned herein for a tobacco plant, variety, cultivar, or line refer to average measurements, including, for example, an average of multiple leaves of a single plant or an average measurement from a population of tobacco plants from a single variety, cultivar, or line. A population of tobacco plants or a collection of tobacco leaves for determining an average measurement (e.g., alkaloid or nicotine level or leaf grading) can be of any size, for example, 5, 10, 15, 20, 25, 30, 35, 40, or 50. Industry-accepted standard protocols are followed for determining average measurements or grad index values.
[0072] As used herein, similar growth conditions refer to similar environmental conditions and/or agronomic practices for growing and making meaningful comparisons between two or more plant genotypes so that neither environmental conditions nor agronomic practices would contribute to or explain any difference observed between the two or more plant genotypes. Environmental conditions include, for example, light, temperature, water (humidity), and nutrition (e.g., nitrogen and phosphorus). Agronomic practices include, for example, seeding, clipping, undercutting, transplanting, topping, and suckering. See Chapters 4B and 4C of Tobacco, Production, Chemistry and Technology, Davis & Nielsen, eds., Blackwell Publishing, Oxford (1999), pp 70-103.
[0073] Alkaloids are complex, nitrogen-containing compounds that naturally occur in plants, and have pharmacological effects in humans and animals. Nicotine is the primary natural alkaloid in commercialized cigarette tobacco and accounts for about 90 percent of the alkaloid content in Nicotiana tabacum. Other major alkaloids in tobacco include cotinine, nornicotine, myosmine, nicotyrine, anabasine and anatabine. Minor tobacco alkaloids include nicotine-n-oxide, N-methyl anatabine, N-methyl anabasine, pseudooxynicotine, 2,3 dipyridyl and others.
[0074] In some aspects, tobacco plants provided herein comprise a lower level of total alkaloid or an individual alkaloid compared to a control tobacco plant without a Nic1 mutation when grown in similar growth conditions. In other aspects, tobacco plants provided herein comprise a lower level of one or more alkaloids selected from the group consisting of cotinine, nornicotine, myosmine, nicotyrine, anabasine and anatabine, compared to a control tobacco plant when grown in similar growth conditions. In some aspects, a lower alkaloid level refers to an alkaloid level of below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the alkaloid level of a control tobacco plant. In other aspects, a lower alkaloid level refers to an alkaloid level of about between 0.5% and 1%, between 1% and 2%, between 2% and 3%, between 3% and 4%, between 4% and 5%, between 5% and 6%, between 6% and 7%, between 7% and 8%, between 8% and 9%, between 9% and 10%, between 11% and 12%, between 12% and 13%, between 13% and 14%, between 14% and 15%, between 15% and 16%, between 16% and 17%, between 17% and 18%, between 18% and 19%, between 19% and 20%, between 21% and 22%, between 22% and 23%, between 23% and 24%, between 24% and 25%, between 25% and 26%, between 26% and 27%, between 27% and 28%, between 28% and 29%, or between 29% and 30% of the alkaloid level of a control tobacco plant. In further aspects, a lower alkaloid level refers to an alkaloid level of about between 0.5% and 5%, between 5% and 10%, between 10% and 20%, between 20% and 30% of the alkaloid level of a control tobacco plant.
[0075] Alkaloid levels can be assayed by methods known in the art, for example by quantification based on gas-liquid chromatography, high performance liquid chromatography, radio-immunoassays, and enzyme-linked immunosorbent assays. For example, nicotinic alkaloid levels can be measured by a GC-FID method based on CORESTA Recommended Method No. 7, 1987 and ISO Standards (ISO TC 126N 394 E. See also Hibi et al., Plant Physiology 100: 826-35 (1992) for a method using gas-liquid chromatography equipped with a capillary column and an FID detector.
[0076] Alternatively, tobacco total alkaloids can be measured using a segmented-flow colorimetric method developed for analysis of tobacco samples as adapted by Skalar Instrument Co (West Chester, Pa.) and described by Collins et al., Tobacco Science 13:79-81 (1969). In short, samples of tobacco are dried, ground, and extracted prior to analysis of total alkaloids and reducing sugars. The method then employs an acetic acid/methanol/water extraction and charcoal for decolorization. Determination of total alkaloids was based on the reaction of cyanogen chloride with nicotine alkaloids in the presence of an aromatic amine to form a colored complex which is measured at 460 nm. Unless specified otherwise, total alkaloid levels or nicotine levels shown herein are on a dry weight basis (e.g., percent total alkaloid or percent nicotine).
[0077] In some aspects, tobacco plants provided herein comprise a lower level of nicotine compared to a control tobacco plant without a Nic1 mutation when grown in similar growth conditions. In some aspects, a lower nicotine level refers to an average nicotine level of below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the average nicotine level of a control tobacco plant. In other aspects, a lower nicotine level refers to an average nicotine level of about between 0.5% and 1%, between 1% and 2%, between 2% and 3%, between 3% and 4%, between 4% and 5%, between 5% and 6%, between 6% and 7%, between 7% and 8%, between 8% and 9%, between 9% and 10%, between 11% and 12%, between 12% and 13%, between 13% and 14%, between 14% and 15%, between 15% and 16%, between 16% and 17%, between 17% and 18%, between 18% and 19%, between 19% and 20%, between 21% and 22%, between 22% and 23%, between 23% and 24%, between 24% and 25%, between 25% and 26%, between 26% and 27%, between 27% and 28%, between 28% and 29%, or between 29% and 30% of the average nicotine level of a control tobacco plant. In further aspects, a lower nicotine level refers to an average nicotine level of about between 0.5% and 5%, between 5% and 10%, between 10% and 20%, between 20% and 30% of the average nicotine level of a control tobacco plant.
[0078] In some aspects, tobacco plants provided herein comprise an average nicotine level selected from the group consisting of about 0.01%, 0.02%, 0.05%, 0.75%, 0.1%, 0.15%, 0.2%, 0.3%, 0.35%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4%, 5%, 6%, 7%, 8%, and 9% on a dry weight basis. In other aspects, tobacco plants provided herein comprise an average nicotine level selected from the group consisting of about between 0.01% and 0.02%, between 0.02% and 0.05%, between 0.05% and 0.75%, between 0.75% and 0.1%, between 0.1% and 0.15%, between 0.15% and 0.2%, between 0.2% and 0.3%, between 0.3% and 0.35%, between 0.35% and 0.4%, between 0.4% and 0.5%, between 0.5% and 0.6%, between 0.6% and 0.7%, between 0.7% and 0.8%, between 0.8% and 0.9%, between 0.9% and 1%, between 1% and 1.1%, between 1.1% and 1.2%, between 1.2% and 1.3%, between 1.3% and 1.4%, between 1.4% and 1.5%, between 1.5% and 1.6%, between 1.6% and 1.7%, between 1.7% and 1.8%, between 1.8% and 1.9%, between 1.9% and 2%, between 2% and 2.1%, between 2.1% and 2.2%, between 2.2% and 2.3%, between 2.3% and 2.4%, between 2.4% and 2.5%, between 2.5% and 2.6%, between 2.6% and 2.7%, between 2.7% and 2.8%, between 2.8% and 2.9%, between 2.9% and 3%, between 3% and 3.1%, between 3.1% and 3.2%, between 3.2% and 3.3%, between 3.3% and 3.4%, between 3.4% and 3.5%, and between 3.5% and 3.6% on a dry weight basis. In further aspects, tobacco plants provided herein comprise an average nicotine level selected from the group consisting of about between 0.01% and 0.1%, between 0.02% and 0.2%, between 0.03% and 0.3%, between 0.04% and 0.4%, between 0.05% and 0.5%, between 0.75% and 1%, between 0.1% and 1.5%, between 0.15% and 2%, between 0.2% and 3%, and between 0.3% and 3.5% on a dry weight basis.
[0079] The present disclosure also provides tobacco plants having altered nicotine levels without negative impacts over other tobacco traits, e.g., leaf grade index value. In one aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein provides cured tobacco of commercially acceptable grade. Tobacco grades are evaluated based on factors including, but not limited to, the leaf stalk position, leaf size, leaf color, leaf uniformity and integrity, ripeness, texture, elasticity, sheen (related with the intensity and the depth of coloration of the leaf as well as the shine), hygroscopicity (the faculty of the tobacco leaves to absorb and to retain the ambient moisture), and green nuance or cast. Leaf grade can be determined, for example, using an Official Standard Grade published by the Agricultural Marketing Service of the US Department of Agriculture (7 U.S.C. 511). See, e.g., Official Standard Grades for Burley Tobacco (U.S. Type 31 and Foreign Type 93), effective Nov. 5, 1990 (55 F.R. 40645); Official Standard Grades for Flue-Cured Tobacco (U.S. Types 11, 12, 13, 14 and Foreign Type 92), effective Mar. 27, 1989 (54 F.R. 7925); Official Standard Grades for Pennsylvania Seedleaf Tobacco (U.S. Type 41), effective Jan. 8, 1965 (29 F.R. 16854); Official Standard Grades for Ohio Cigar-Leaf Tobacco (U.S. Types 42, 43, and 44), effective Dec. 8, 1963 (28 F.R. 11719 and 28 F.R. 11926); Official Standard Grades for Wisconsin Cigar-Binder Tobacco (U.S. Types 54 and 55), effective Nov. 20, 1969 (34 F.R. 17061); Official Standard Grades for Wisconsin Cigar-Binder Tobacco (U.S. Types 54 and 55), effective Nov. 20, 1969 (34 F.R. 17061); Official Standard Grades for Georgia and Florida Shade-Grown Cigar-Wrapper Tobacco (U.S. Type 62), Effective April 1971. A USDA grade index value can be determined according to an industry accepted grade index. See, e.g., Bowman et al, Tobacco Science, 32:39-40(1988); Legacy Tobacco Document Library (Bates Document #523267826-523267833, Jul. 1, 1988, Memorandum on the Proposed Burley Tobacco Grade Index); and Miller et al., 1990, Tobacco Intern., 192:55-57 (all foregoing references are incorporated by inference in their entirety). In one aspect, a USDA grade index is a 0-100 numerical representation of federal grade received and is a weighted average of all stalk positions. A higher grade index indicates higher quality. Alternatively, leaf grade can be determined via hyper-spectral imaging. See e.g., WO 2011/027315 (published on Mar. 10, 2011, and incorporated by inference in its entirety).
[0080] In some aspects, tobacco plants provided herein comprise a similar level of one or more tobacco aroma compounds selected from the group consisting of 3-methylvaleric acid, valeric acid, isovaleric acid, a labdenoid, a cembrenoid, a sugar ester, and a reducing sugar, compared to control tobacco plants when grown in similar growth conditions. In other aspects, tobacco plants provided herein comprise a Nic1 mutation, a Nic2 mutation, or a combination thereof having no impact over the level of one or more tobacco aroma compounds selected from the group consisting of 3-methylvaleric acid, valeric acid, isovaleric acid, a labdenoid, a cembrenoid, a sugar ester, and a reducing sugar.
[0081] As used herein, tobacco aroma compounds are compounds associated with the flavor and aroma of tobacco smoke. These compounds include, but are not limited to, 3-methylvaleric acid, valeric acid, isovaleric acid, cembrenoid and labdenoid diterpenes, and sugar esters. Concentrations of tobacco aroma compounds can be measured by any known metabolite profiling methods in the art including, without limitation, gas chromatography mass spectrometry (GC-MS), Nuclear Magnetic Resonance Spectroscopy, liquid chromatography-linked mass spectrometry. See The Handbook of Plant Metabolomics, edited by Weckwerth and Kahl, (Wiley-Blackwell) (May 28, 2013).
[0082] As used herein, reducing sugar(s) are any sugar (monosaccharide or polysaccharide) that has a free or potentially free aldehdye or ketone group. Glucose and fructose act as nicotine buffers in cigarette smoke by reducing smoke pH and effectively reducing the amount of free unprotonated nicotine. Reducing sugars balances smoke flavor, for example, by modifying the sensory impact of nicotine and other tobacco alkaloids. An inverse relationship between sugar content and alkaloid content has been reported across tobacco varieties, within the same variety, and within the same plant line caused by planting conditions. Reducing sugar levels can be measured using a segmented-flow colorimetric method developed for analysis of tobacco samples as adapted by Skalar Instrument Co (West Chester, Pa.) and described by Davis, Tobacco Science 20:139-144 (1976). For example, a sample is dialyzed against a sodium carbonate solution. Copper neocuproin is added to the sample and the solution is heated. The copper neocuproin chelate is reduced in the presence of sugars resulting in a colored complex which is measured at 460 nm.
[0083] In some aspects, tobacco plants provided herein comprise one or more non-naturally existing mutant alleles at Nic1 or Nic2 locus which reduce or eliminate one or more gene activity from Nic1 or Nic2 locus. In some aspects, these mutant alleles result in lower nicotine levels. Mutant Nic1 or Nic2 alleles can be introduced by any method known in the art including random or targeted mutagenesis approaches.
[0084] Such mutagenesis methods include, without limitation, treatment of seeds with ethyl methylsulfate (EMS) (Hildering and Verkerk, In, The use of induced mutations in plant breeding. Pergamon press, pp 317-320, 1965) or UV-irradiation, X-rays, and fast neutron irradiation (see, for example, Verkerk, Neth. J. Agric. Sci. 19:197-203, 1971; and Poehlman, Breeding Field Crops, Van Nostrand Reinhold, N.Y. (3.sup.rd ed), 1987), transposon tagging (Fedoroff et al., 1984; U.S. Pat. Nos. 4,732,856 and 5,013,658), as well as T-DNA insertion methodologies (Hoekema et al., 1983; U.S. Pat. No. 5,149,645). EMS-induced mutagenesis consists of chemically inducing random point mutations over the length of the genome. Fast neutron mutagenesis consists of exposing seeds to neutron bombardment which causes large deletions through double stranded DNA breakage. Transposon tagging comprises inserting a transposon within an endogenous gene to reduce or eliminate expression of the gene. The types of mutations that may be present in a tobacco gene include, for example, point mutations, deletions, insertions, duplications, and inversions. Such mutations desirably are present in the coding region of a tobacco gene; however mutations in the promoter region, and intron, or an untranslated region of a tobacco gene may also be desirable.
[0085] In addition, a fast and automatable method for screening for chemically induced mutations, TILLING (Targeting Induced Local Lesions In Genomes), using denaturing HPLC or selective endonuclease digestion of selected PCR products is also applicable to the present disclosure. See, McCallum et al. (2000) Nat. Biotechnol. 18:455-457. Mutations that impact gene expression or that interfere with the function of genes disclosed herein can be determined using methods that are well known in the art. Insertional mutations in gene exons usually result in null-mutants. Mutations in conserved residues can be particularly effective in inhibiting the function of a protein. In some aspects, tobacco plants disclosed herein comprise a nonsense (e.g., stop codon) mutation is one or more Nic1 genes described herein.
[0086] Is some aspects, the present disclosure also provides tobacco lines with altered nicotine levels while maintaining commercially acceptable leaf quality. These lines can be produced by introducing mutations into one or more genes at Nic1 or Nic2 locus via precise genome engineering technologies, for example, Transcription activator-like effector nucleases (TALENs), meganuclease, zinc finger nuclease, and CRISPR-cas9 system. See, e.g., Gaj et al., Trends in Biotechnology, 31(7):397-405 (2013).
[0087] The screening and selection of mutagenized tobacco plants can be through any methodologies known to those having ordinary skill in the art. Examples of screening and selection methodologies include, but are not limited to, Southern analysis, PCR amplification for detection of a polynucleotide, Northern blots, RNase protection, primer-extension, RT-PCR amplification for detecting RNA transcripts, enzymatic assays for detecting enzyme or ribozyme activity of polypeptides and polynucleotides, and protein gel electrophoresis, Western blots, immunoprecipitation, and enzyme-linked immunoassays to detect polypeptides. Other techniques such as in situ hybridization, enzyme staining, and immunostaining also can be used to detect the presence or expression of polypeptides and/or polynucleotides. Methods for performing all of the referenced techniques are known.
[0088] The present disclosure also provides compositions and methods for inhibiting the expression or function of one or more polypeptides from Nic1 locus in a plant, particularly plants of the Nicotiana genus, including tobacco plants of the various commercial varieties.
[0089] In some aspects, the present disclosure provides tobacco plants, or part thereof, comprising a heterologous expression cassette comprising a Nic1 inhibitory sequence of a gene comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof, wherein the inhibitory sequence is operably linked to a promoter that is functional in a plant cell, and wherein the inhibitory sequence has at least 90% sequence identity to a fragment of at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides of the sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof. In other aspects, the present disclosure provides tobacco plants, or part thereof, comprising a heterologous expression cassette comprising a Nic1 inhibitory sequence of a gene comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof, wherein the inhibitory sequence is operably linked to a promoter that is functional in a plant cell, and wherein the inhibitory sequence has at least 90% sequence identity to a fragment of at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides of the sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof. In some aspects, a Nic1 inhibitory sequence is capable of being transcribed as an inhibitory polynucleotide selected from the group consisting of a single-stranded RNA polynucleotide, a double-stranded RNA polynucleotide, and a combination thereof.
[0090] As used herein, the terms inhibit, inhibition, and inhibiting are defined as any method known in the art or described herein that decreases the expression or function of a gene product of interest (e.g., a target gene product). Inhibition can be in the context of a comparison between two plants, for example, a genetically altered plant versus a wild-type plant. Alternatively, inhibition of expression or function of a target gene product can be in the context of a comparison between plant cells, organelles, organs, tissues, or plant parts within the same plant or between different plants, and includes comparisons between developmental or temporal stages within the same plant or plant part or between plants or plant parts. Inhibition includes any relative decrement of function or production of a gene product of interest, up to and including complete elimination of function or production of that gene product. The term inhibition encompasses any method or composition that down-regulates translation and/or transcription of the target gene product or functional activity of the target gene product. In some aspects, the mRNA or protein level of one or more genes from Nic1 locus in a modified plant disclosed herein is less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% of the protein level of the same gene in a plant that is not a mutant or that has not been genetically modified to inhibit the expression of that gene.
[0091] The term inhibitory sequence encompasses any polynucleotide or polypeptide sequence capable of inhibiting the expression or function of a gene involved in nicotine biosynthesis regulation from Nic1 locus in a plant, such as full-length polynucleotide or polypeptide sequences, truncated polynucleotide or polypeptide sequences, fragments of polynucleotide or polypeptide sequences, variants of polynucleotide or polypeptide sequences, sense-oriented nucleotide sequences, antisense-oriented nucleotide sequences, the complement of a sense- or antisense-oriented nucleotide sequence, inverted regions of nucleotide sequences, hairpins of nucleotide sequences, double-stranded nucleotide sequences, single-stranded nucleotide sequences, combinations thereof, and the like. The term polynucleotide sequence includes sequences of RNA, DNA, chemically modified nucleic acids, nucleic acid analogs, combinations thereof, and the like.
[0092] Inhibitory sequences are designated herein by the name of the target gene product. Thus, a Nic1 inhibitory sequence refers to an inhibitory sequence that is capable of inhibiting the expression of a gene involved in nicotine biosynthesis regulation from Nic1 locus in a plant, for example, at the level of transcription and/or translation, or which is capable of inhibiting the function of a gene product. When the phrase capable of inhibiting is used in the context of a polynucleotide inhibitory sequence, it is intended to mean that the inhibitory sequence itself exerts the inhibitory effect; or, where the inhibitory sequence encodes an inhibitory nucleotide molecule (for example, hairpin RNA, miRNA, or double-stranded RNA polynucleotides), or encodes an inhibitory polypeptide (e.g., a polypeptide that inhibits expression or function of the target gene product), following its transcription (for example, in the case of an inhibitory sequence encoding a hairpin RNA, miRNA, or double-stranded RNA polynucleotide) or its transcription and translation (in the case of an inhibitory sequence encoding an inhibitory polypeptide), the transcribed or translated product, respectively, exerts the inhibitory effect on the target gene product (e.g., inhibits expression or function of the target gene product).
[0093] A Nic1 inhibitory sequence disclosed herein can be a sequence triggering gene silencing via any silencing pathway or mechanism known in the art, including, but not limited to, sense suppression/cosuppression, antisense suppression, double-stranded RNA (dsRNA) interference, hairpin RNA interference and intron-containing hairpin RNA interference, amplicon-mediated interference, ribozymes, small interfering RNA, artificial or synthetic microRNA, and artificial trans-acting siRNA. A Nic1 inhibitory sequence may range from at least about 20 nucleotides, about 50 nucleotides, about 70 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, and up to the full-length polynucleotide encoding the proteins of the present disclosure, depending upon the desired outcome. In one aspect, a Nic1 inhibitory sequence can be a fragment of between about 50 and about 400 nucleotides, between about 70 and about 350 nucleotides, between about 90 and about 325 nucleotides, between about 90 and about 300 nucleotides, between about 90 and about 275 nucleotides, between about 100 and about 400 nucleotides, between about 100 and about 350 nucleotides, between about 100 and about 325 nucleotides, between about 100 and about 300 nucleotides, between about 125 and about 300 nucleotides, or between about 125 and about 275 nucleotides in length. In some embodiments, a fragment of a cytochrome P450 polynucleotide is about 50, about 60, about 70, about 80, about 90, about 100, about 125, about 150, about 175, about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 400 nucleotides in length, and other such values between about 70 and about 400 nucleotides.
[0094] The use of the term polynucleotide is not intended to limit the present disclosure to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the present disclosure also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.
[0095] In some aspects, the present disclosure provides recombinant DNA constructs comprising a promoter that is functional in a tobacco cell and operably linked to a polynucleotide that encodes an RNA molecule capable of binding to an RNA encoding a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 84, 116 to 130, 147, and fragments thereof, and wherein the RNA molecule suppresses the expression of the polypeptide. In some aspects, the RNA molecule is selected from the group consisting of a microRNA, an siRNA, and a trans-acting siRNA. In other aspects, the recombinant DNA construct encodes a double stranded RNA. Also provided are transgenic tobacco plants or part thereof, cured tobacco material, or tobacco products comprising these recombinant DNA constructs. In some aspects, these transgenic plants, cured tobacco material, or tobacco products comprise a lower level of nicotine compared to a control tobacco plant without the recombinant DNA construct. Further provided are methods of reducing the nicotine level of a tobacco plant, the method comprising transforming a tobacco plant with any of these recombinant DNA constructs.
[0096] As used herein, operably linked refers to a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous.
[0097] As used herein and when used in reference to a sequence, heterologous refers to a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. The term also is applicable to nucleic acid constructs, also referred to herein as polynucleotide constructs or nucleotide constructs. In this manner, a heterologous nucleic acid construct is intended to mean a construct that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. Heterologous nucleic acid constructs include, but are not limited to, recombinant nucleotide constructs that have been introduced into a plant or plant part thereof, for example, via transformation methods or subsequent breeding of a transgenic plant with another plant of interest.
[0098] As used herein, gene expression refers to the biosynthesis or production of a gene product, including the transcription and/or translation of the gene product.
[0099] Also provided herein are compositions and methods for overexpressing one or more polypeptides from Nic1 locus in a plant, particularly plants of the Nicotiana genus, including tobacco plants of the various commercial varieties.
[0100] In some aspects, the present disclosure provides recombinant DNA constructs comprising a promoter that is functional in a tobacco cell and operably linked to a polynucleotide that encodes a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 84, 116 to 130, 147, and fragments thereof. Also provided are transgenic tobacco plants or part thereof, cured tobacco material, or tobacco products comprising these recombinant DNA constructs. In some aspects, these transgenic plants, cured tobacco material, or tobacco products comprise an increased level of nicotine compared to a control tobacco plant without the recombinant DNA construct. Further provided are methods of increasing the nicotine level of a tobacco plant, the method comprising transforming a tobacco plant with any of these recombinant DNA constructs.
[0101] In some aspects, recombinant DNA constructs or expression cassettes disclosed herein can also comprise a selectable marker gene for the selection of transgenic cells. Selectable marker genes include, but are not limited to, genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as -galactosidase and fluorescent proteins such as green fluorescent protein (GFP).
[0102] In some aspects, recombinant DNA constructs or expression cassettes disclosed herein comprise a promoter selected from the group consisting of a constitutive promoter, an inducible promoter, and a tissue-preferred promoter (for example, a leaf-specific or root-specific promoter). Exemplary constitutive promoters include the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Exemplary chemical-inducible promoters include the tobacco PR-la promoter, which is activated by salicylic acid. Other chemical-inducible promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156). Additional exemplary promoters that can be used herein are those responsible for heat-regulated gene expression, light-regulated gene expression (for example, the pea rbcS-3A; the maize rbcS promoter; the chlorophyll alb-binding protein gene found in pea; or the Arabssu promoter), hormone-regulated gene expression (for example, the abscisic acid (ABA) responsive sequences from the Em gene of wheat; the ABA-inducible HVA1 and HVA22, and rd29A promoters of barley and Arabidopsis; and wound-induced gene expression (for example, of wunl), organ specific gene expression (for example, of the tuber-specific storage protein gene; the 23-kDa zein gene from maize described by; or the French bean (-phaseolin gene), or pathogen-inducible promoters (for example, the PR-1, prp-1, or (-1,3 glucanase promoters, the fungal-inducible wirla promoter of wheat, and the nematode-inducible promoters, TobRB7-5A and Hmg-1, of tobacco arid parsley, respectively).
[0103] In some aspects, tobacco plants provided herein further comprise increased or reduced expression of activity of genes involved in nicotine biosynthesis or transport. Genes involved in nicotine biosynthesis include, but are not limited to, arginine decarboxylase (ADC), methylputrescine oxidase (MPO), NADH dehydrogenase, ornithine decarboxylase (ODC), phosphoribosylanthranilate isomerase (PRAI), putrescine N-methyltransferase (PMT), quinolate phosphoribosyl transferase (QPT), and S-adenosyl-methionine synthetase (SAMS). Nicotine Synthase, which catalyzes the condensation step between a nicotinic acid derivative and methylpyrrolinium cation, has not been elucidated although two candidate genes (A622 and NBB1) have been proposed. See US 2007/0240728 A1 and US 2008/0120737A1. A622 encodes an isoflavone reductase-like protein. In addition, several transporters may be involved in the translocation of nicotine. A transporter gene, named MATE, has been cloned and characterized (Morita et al., PNAS 106:2447-52 (2009)).
[0104] In some aspects, tobacco plants provided herein further comprise an increased or reduced level of mRNA, protein, or both of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, ADC, ODC, PRAI, SAMS, BBL, MATE, A622, and NBB1, compared to a control tobacco plant. In other aspects, tobacco plants provided herein further comprise a transgene directly suppressing the expression of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, ADC, ODC, PRAI, SAMS, BBL, MATE, A622, and NBB1. In other aspects, tobacco plants provided herein further comprise a transgene or mutation suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, ADC, ODC, PRAI, SAMS, BBL, MATE, A622, and NBB1. In other aspects, tobacco plants provided herein further comprise a transgene overexpressing one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, ADC, ODC, PRAI, SAMS, BBL, MATE, A622, and NBB1.
[0105] Also disclosed herein are the transformation of tobacco plants with recombinant constructs or expression cassettes described herein using any suitable transformation methods known in the art. Methods for introducing polynucleotide sequences into tobacco plants are known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods. Stable transformation refers to transformation where the nucleotide construct of interest introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. Transient transformation is intended to mean that a sequence is introduced into the plant and is only temporally expressed or is only transiently present in the plant.
[0106] Suitable methods of introducing polynucleotides into plant cells of the present disclosure include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Shillito et al. (1987) Meth. Enzymol. 153:313-336; Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,104,310, 5,149,645, 5,177,010, 5,231,019, 5,463,174, 5,464,763, 5,469,976, 4,762,785, 5,004,863, 5,159,135, 5,563,055, and 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, U.S. Pat. Nos. 4,945,050, 5,141,131, 5,886,244, 5,879,918, and 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926). Also see Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation).
[0107] In other aspects, recombinant constructs or expression cassettes disclosed herein may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating an expression cassette of the present disclosure within a viral DNA or RNA molecule. It is recognized that promoters for use in the expression cassettes disclosed herein also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5:209-221.
[0108] Any plant tissue that can be subsequently propagated using clonal methods, whether by organogenesis or embryogenesis, may be transformed with a recombinant construct or an expression cassette disclosed herein. By organogenesis in intended the process by which shoots and roots are developed sequentially from meristematic centers. By embryogenesis is intended the process by which shoots and roots develop together in a concerted fashion (not sequentially), whether from somatic cells or gametes. Exemplary tissues that are suitable for various transformation protocols described herein include, but are not limited to, callus tissue, existing meristematic tissue (e.g., apical meristems, axillary buds, and root meristems) and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem), hypocotyls, cotyledons, leaf disks, pollen, embryos, and the like.
[0109] In some aspects, tobacco plants provided herein are from a tobacco type selected from the group consisting of flue-cured tobacco, air-cured tobacco, dark air-cured tobacco, dark fire-cured tobacco, Galpao tobacco, and Oriental tobacco. In other aspects, tobacco plants provided herein are from a tobacco type selected from the group consisting of Burley tobacco, Maryland tobacco, and dark tobacco.
[0110] Flue-cured tobaccos (also called Virginia or bright tobaccos) amount to approximately 40% of world tobacco production. Flue-cured tobaccos are often also referred to as bright tobacco because of the golden-yellow to deep-orange color it reaches during curing. Flue-cured tobaccos have a light, bright aroma and taste. Flue-cured tobaccos are generally high in sugar and low in oils. Major flue-cured tobacco growing countries are Argentina, Brazil, China, India, Tanzania and the U.S. In some aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a flue-cured tobacco background selected from the group consisting of CC 13, CC 27, CC 33, CC 37, CC 65, CC 67, CC 700, GF 318, GL 338, GL 368, GL 939, K 346, K 399, K326, NC 102, NC 196, NC 291, NC 297, NC 299, NC 471, NC 55, NC 606, NC 71, NC 72, NC 92, PVH 1118, PVH 1452, PVH 2110, SPEIGHT 168, SPEIGHT 220, SPEIGHT 225, SPEIGHT 227, SPEIGHT 236, and any variety essentially derived from any one of the foregoing varieties. In other aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a flue-cured tobacco background selected from the group consisting of Coker 48, Coker 176, Coker 371-Gold, Coker 319, Coker 347, GL 939, K 149, K326, K 340, K 346, K 358, K 394, K 399, K 730, NC 27NF, NC 37NF, NC 55, NC 60, NC 71, NC 72, NC 82, NC 95, NC 297, NC 606, NC 729, NC 2326, McNair 373, McNair 944, Ox 207, Ox 414 NF, Reams 126, Reams 713, Reams 744, RG 8, RG 11, RG 13, RG 17, RG 22, RG 81, RG H4, RG H51, Speight H-20, Speight G-28, Speight G-58, Speight G-70, Speight G-108, Speight G-111, Speight G-117, Speight 168, Speight 179, Speight NF-3, Va 116, Va 182, and any variety essentially derived from any one of the foregoing varieties. See WO 2004/041006 A1. In further aspects, low-alkaloid or low-nicotine tobacco plants, seeds, hybrids, varieties, or lines disclosed herein are in any flue cured background selected from the group consisting of K326, K346, and NC196.
[0111] Air-cured tobaccos include Burley, Maryland, and dark tobaccos. The common factor is that curing is primarily without artificial sources of heat and humidity. Burley tobaccos are light to dark brown in color, high in oil, and low in sugar. Burley tobaccos are air-cured in barns. Major Burley growing countries are Argentina, Brazil, Italy, Malawi, and the U.S. Maryland tobaccos are extremely fluffy, have good burning properties, low nicotine and a neutral aroma. Major Maryland growing countries include the U.S. and Italy. In some aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a Burley tobacco background selected from the group consisting of Clay 402, Clay 403, Clay 502, Ky 14, Ky 907, Ky 910, Ky 8959, NC 2, NC 3, NC 4, NC 5, NC 2000, TN 86, TN 90, TN 97, R 610, R 630, R 711, R 712, NCBH 129, Bu 21Ky 10, HB04P, Ky 14L 8, Kt 200, Newton 98, Pedigo 561, Pf561 and Va 509. In further aspects, low-alkaloid or low-nicotine tobacco plants, seeds, hybrids, varieties, or lines disclosed herein are in any Burley background selected from the group consisting of TN 90, KT 209, KT 206, KT212, and HB 4488. In other aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a Maryland tobacco background selected from the group consisting of Md 10, Md 40, Md 201, Md 609, Md 872 and Md 341.
[0112] Dark air-cured tobaccos are distinguished from other types primarily by its curing process which gives dark air-cured tobacco its medium- to dark-brown color and distinct aroma. Dark air-cured tobaccos are mainly used in the production of chewing tobacco and snuff. In some aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a dark air-cured tobacco background selected from the group consisting of Sumatra, Jatim, Dominican Cubano, Besuki, One sucker, Green River, Virginia sun-cured, and Paraguan Passado.
[0113] Dark fire-cured tobaccos are generally cured with low-burning wood fires on the floors of closed curing barns. Their leaves have low sugar content but high nicotine content. Dark fire-cured tobaccos are used for making pipe blends, cigarettes, chewing tobacco, snuff and strong-tasting cigars. Major growing regions for dark fire-cured tobaccos are Tennessee, Kentucky, and Virginia, USA. In some aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a dark fire-cured tobacco background selected from the group consisting of Narrow Leaf Madole, Improved Madole, Tom Rosson Madole, Newton's VH Madole, Little Crittenden, Green Wood, Little Wood, Small Stalk Black Mammoth, DT 508, DT 518, DT 592, KY 171, DF 911, DF 485, TN D94, TN D950, VA 309, and VA 359.
[0114] Oriental tobaccos are also referred to as Greek, aroma and Turkish tobaccos due to the fact that they are typically grown in eastern Mediterranean regions such as Turkey, Greece, Bulgaria, Macedonia, Syria, Lebanon, Italy, and Romania. The small plant and leaf size, characteristic of today's Oriental varieties, as well as its unique aroma properties are a result of the plant's adaptation to the poor soil and stressful climatic conditions in which it develop over many past centuries. In some aspects, low-alkaloid or low-nicotine tobacco plants or seeds provided herein are in a Oriental tobacco background selected from the group consisting of Izmir, Katerini, Samsun, Basma and Krumovgrad, Trabzon, Thesalian, Tasova, Sinop, Izmit, Hendek, Edirne, Semdinli, Adiyanman, Yayladag, Iskenderun, Duzce, Macedonian, Mavra, Prilep, Bafra, Bursa, Bucak, Bitlis, Balikesir, and any variety essentially derived from any one of the foregoing varieties.
[0115] In some aspects, low-alkaloid or low-nicotine tobacco plants, seeds, hybrids, varieties, or lines disclosed herein are essentially derived from or in the genetic background of BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY907LC, KTY14L8 LC, Little Crittenden, McNair 373, McNair 944, msKY 14L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129, NC 2002, Neal Smith Madole, OXFORD 207, Perique tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN 86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, or VA359, Maryland 609, HB3307PLC, HB4488PLC, KT206LC, KT209LC, KT210LC, KT212LC, R610LC, PVH2310, NC196, KTD14LC, KTD6LC, KTD8LC, PD7302LC, PD7305LC, PD7309LC, PD7318LC, PD7319LC, PD7312LC, ShireyLC, or any commercial tobacco variety according to standard tobacco breeding techniques known in the art.
[0116] All foregoing mentioned specific varieties of dark air-cured, Burley, Maryland, dark fire-cured, or Oriental type are only listed for exemplary purposes. Any additional dark air-cured, Burley, Maryland, dark fire-cured, Oriental varieties are also contemplated in the present application.
[0117] Also provided herein are populations of tobacco plants described herein. In one aspect, a population of tobacco plants disclosed herein has a planting density of between about 5,000 and about 8000, between about 5,000 and about 7,600, between about 5,000 and about 7,200, between about 5,000 and about 6,800, between about 5,000 and about 6,400, between about 5,000 and about 6,000, between about 5,000 and about 5,600, between about 5,000 and about 5,200, between about 5,200 and about 8,000, between about 5,600 and about 8,000, between about 6,000 and about 8,000, between about 6,400 and about 8,000, between about 6,800 and about 8,000, between about 7,200 and about 8,000, or between about 7,600 and about 8,000 plants per acre. In another aspect, a population of tobacco plants disclosed herein is in a soil type with low to medium fertility.
[0118] Also provided herein are containers of seeds from tobacco plants described herein. A container of tobacco seeds of the present disclosure may contain any number, weight, or volume of seeds. For example, a container can contain at least, or greater than, about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000 or more seeds. Alternatively, the container can contain at least, or greater than, about 1 ounce, 5 ounces, 10 ounces, 1 pound, 2 pounds, 3 pounds, 4 pounds, 5 pounds or more seeds. Containers of tobacco seeds may be any container available in the art. By way of non-limiting example, a container may be a box, a bag, a packet, a pouch, a tape roll, a tube, or a bottle.
[0119] Also provided herein is cured tobacco material made from low-alkaloid or low-nicotine tobacco plants described herein. Further provided is cured tobacco material made from tobacco plants described herein with higher levels of total alkaloid or nicotine.
[0120] Curing is the aging process that reduces moisture and brings about the destruction of chlorophyll giving tobacco leaves a golden color and by which starch is converted to sugar. Cured tobacco therefore has a higher reducing sugar content and a lower starch content compared to harvested green leaf. In some aspects, green leaf tobacco provided herein can be cured using conventional means, e.g., flue-cured, barn-cured, fire-cured, air-cured or sun-cured. See, for example, Tso (1999, Chapter 1 in Tobacco, Production, Chemistry and Technology, Davis & Nielsen, eds., Blackwell Publishing, Oxford) for a description of different types of curing methods. Cured tobacco is usually aged in a wooden drum (e.g., a hogshead) or cardboard cartons in compressed conditions for several years (e.g., two to five years), at a moisture content ranging from 10% to about 25%. See, U.S. Pat. Nos. 4,516,590 and 5,372,149. Cured and aged tobacco then can be further processed. Further processing includes conditioning the tobacco under vacuum with or without the introduction of steam at various temperatures, pasteurization, and fermentation. Fermentation typically is characterized by high initial moisture content, heat generation, and a 10 to 20% loss of dry weight. See, e.g., U.S. Pat. Nos. 4,528,993, 4,660,577, 4,848,373, 5,372,149; U.S. Publication No. 2005/0178398; and Tso (1999, Chapter 1 in Tobacco, Production, Chemistry and Technology, Davis & Nielsen, eds., Blackwell Publishing, Oxford). Cure, aged, and fermented tobacco can be further processed (e.g., cut, shredded, expanded, or blended). See, for example, U.S. Pat. Nos. 4,528,993; 4,660,577; and 4,987,907. In one aspect, the cured tobacco material of the present disclosure is sun-cured. In another aspect, the cured tobacco material of the present disclosure is flue-cured, air-cured, or fire-cured.
[0121] Tobacco material obtained from the tobacco lines, varieties or hybrids of the present disclosure can be used to make tobacco products. As used herein, tobacco product is defined as any product made or derived from tobacco that is intended for human use or consumption.
[0122] Tobacco products provided herein include, without limitation, cigarette products (e.g., cigarettes and bidi cigarettes), cigar products (e.g., cigar wrapping tobacco and cigarillos), pipe tobacco products, products derived from tobacco, tobacco-derived nicotine products, smokeless tobacco products (e.g., moist snuff, dry snuff, and chewing tobacco), films, chewables, tabs, shaped parts, gels, consumable units, insoluble matrices, hollow shapes, reconstituted tobacco, expanded tobacco, and the like. See, e.g., U.S. Patent Publication No. US 2006/0191548.
[0123] As used herein, cigarette refers a tobacco product having a rod and filler. The cigarette rod includes the cigarette paper, filter, plug wrap (used to contain filtration materials), tipping paper that holds the cigarette paper (including the filler) to the filter, and all glues that hold these components together. The filler includes (1) all tobaccos, including but not limited to reconstituted and expanded tobacco, (2) non-tobacco substitutes (including but not limited to herbs, non-tobacco plant materials and other spices that may accompany tobaccos rolled within the cigarette paper), (3) casings, (4) flavorings, and (5) all other additives (that are mixed into tobaccos and substitutes and rolled into the cigarette).
[0124] As used herein, reconstituted tobacco refers to a part of tobacco filler made from tobacco dust and other tobacco scrap material, processed into sheet form and cut into strips to resemble tobacco. In addition to the cost savings, reconstituted tobacco is very important for its contribution to cigarette taste from processing flavor development using reactions between ammonia and sugars.
[0125] As used herein, expanded tobacco refers to a part of tobacco filler which is processed through expansion of suitable gases so that the tobacco is puffed resulting in reduced density and greater filling capacity. It reduces the weight of tobacco used in cigarettes.
[0126] Tobacco products derived from plants of the present disclosure also include cigarettes and other smoking articles, particularly those smoking articles including filter elements, wherein the rod of smokable material includes cured tobacco within a tobacco blend. In an aspect, a tobacco product of the present disclosure is selected from the group consisting of a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, hookah tobacco, shredded tobacco, and cut tobacco. In another aspect, a tobacco product of the present disclosure is a smokeless tobacco product. Smokeless tobacco products are not combusted and include, but not limited to, chewing tobacco, moist smokeless tobacco, snus, and dry snuff. Chewing tobacco is coarsely divided tobacco leaf that is typically packaged in a large pouch-like package and used in a plug or twist. Moist smokeless tobacco is a moist, more finely divided tobacco that is provided in loose form or in pouch form and is typically packaged in round cans and used as a pinch or in a pouch placed between an adult tobacco consumer's cheek and gum. Snus is a heat treated smokeless tobacco. Dry snuff is finely ground tobacco that is placed in the mouth or used nasally. In a further aspect, a tobacco product of the present disclosure is selected from the group consisting of loose leaf chewing tobacco, plug chewing tobacco, moist snuff, and nasal snuff. In yet another aspect, a tobacco product of the present disclosure is selected from the group consisting of an electronically heated cigarette, an e-cigarette, an electronic vaporing device.
[0127] In an aspect, a tobacco product of the present disclosure can be a blended tobacco product. In another aspect, a tobacco product of the present disclosure can be a low nicotine tobacco product. In a further aspect, a tobacco product of the present disclosure may comprise nornicotine at a level of less than about 3 mg/g. For example, the nornicotine content in such a product can be 3.0 mg/g, 2.5 mg/g, 2.0 mg/g, 1.5 mg/g, 1.0 mg/g, 750 g/g, 500 pg/g, 250 pg/g, 100 pg/g, 75 pg/g, 50 pg/g, 25 pg/g, 10 pg/g, 7.0 pg/g, 5.0 pg/g, 4.0 pg/g, 2.0 pg/g, 1.0 pg/g, 0.5 pg/g, 0.4 pg/g, 0.2 pg/g, 0.1 pg/g, 0.05 pg/g, 0.01 pg/g, or undetectable.
[0128] In some aspects, cured tobacco material or tobacco products provided herein comprise an average nicotine level selected from the group consisting of about 0.01%, 0.02%, 0.05%, 0.75%, 0.1%, 0.15%, 0.2%, 0.3%, 0.35%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4%, 5%, 6%, 7%, 8%, and 9% on a dry weight basis. In other aspects, cured tobacco material or tobacco products provided herein comprise an average nicotine level selected from the group consisting of about between 0.01% and 0.02%, between 0.02% and 0.05%, between 0.05% and 0.75%, between 0.75% and 0.1%, between 0.1% and 0.15%, between 0.15% and 0.2%, between 0.2% and 0.3%, between 0.3% and 0.35%, between 0.35% and 0.4%, between 0.4% and 0.5%, between 0.5% and 0.6%, between 0.6% and 0.7%, between 0.7% and 0.8%, between 0.8% and 0.9%, between 0.9% and 1%, between 1% and 1.1%, between 1.1% and 1.2%, between 1.2% and 1.3%, between 1.3% and 1.4%, between 1.4% and 1.5%, between 1.5% and 1.6%, between 1.6% and 1.7%, between 1.7% and 1.8%, between 1.8% and 1.9%, between 1.9% and 2%, between 2% and 2.1%, between 2.1% and 2.2%, between 2.2% and 2.3%, between 2.3% and 2.4%, between 2.4% and 2.5%, between 2.5% and 2.6%, between 2.6% and 2.7%, between 2.7% and 2.8%, between 2.8% and 2.9%, between 2.9% and 3%, between 3% and 3.1%, between 3.1% and 3.2%, between 3.2% and 3.3%, between 3.3% and 3.4%, between 3.4% and 3.5%, and between 3.5% and 3.6% on a dry weight basis. In further aspects, cured tobacco material or tobacco products provided herein comprise an average nicotine level selected from the group consisting of about between 0.01% and 0.1%, between 0.02% and 0.2%, between 0.03% and 0.3%, between 0.04% and 0.4%, between 0.05% and 0.5%, between 0.75% and 1%, between 0.1% and 1.5%, between 0.15% and 2%, between 0.2% and 3%, and between 0.3% and 3.5% on a dry weight basis.
[0129] The present disclosure also provides methods for breeding tobacco lines, cultivars, or varieties comprising a desirable level of total alkaloid or nicotine, e.g., low nicotine or nicotine free. Breeding can be carried out via any known procedures. DNA fingerprinting, SNP mapping, haplotype mapping or similar technologies may be used in a marker-assisted selection (MAS) breeding program to transfer or breed a desirable trait or allele into a tobacco plant. For example, a breeder can create segregating populations in a F.sub.2 or backcross generation using F1 hybrid plants disclosed herein or further crossing the F1 hybrid plants with other donor plants with an agronomically desirable genotype. Plants in the F.sub.2 or backcross generations can be screened for a desired agronomic trait or a desirable chemical profile using one of the techniques known in the art or listed herein. Depending on the expected inheritance pattern or the MAS technology used, self-pollination of selected plants before each cycle of backcrossing to aid identification of the desired individual plants can be performed. Backcrossing or other breeding procedure can be repeated until the desired phenotype of the recurrent parent is recovered. A recurrent parent in the present disclosure can be a flue-cured variety, a Burley variety, a dark air-cured variety, a dark fire-cured variety, or an Oriental variety. Other breeding techniques can be found, for example, in Wernsman, E. A., and Rufty, R. C. 1987. Chapter Seventeen. Tobacco. Pages 669-698 In: Cultivar Development. Crop Species. W. H. Fehr (ed.), MacMillan Publishing Go., Inc., New York, N.Y., incorporated herein by reference in their entirety.
[0130] Results of a plant breeding program using the tobacco plants described herein includes useful lines, cultivars, varieties, progeny, inbreds, and hybrids of the present disclosure. As used herein, the term variety refers to a population of plants that share constant characteristics which separate them from other plants of the same species. A variety is often, although not always, sold commercially. While possessing one or more distinctive traits, a variety is further characterized by a very small overall variation between individuals within that variety. A pure line variety may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques. A variety can be essentially derived from another line or variety. As defined by the International Convention for the Protection of New Varieties of Plants (Dec. 2, 1961, as revised at Geneva on Nov. 10, 1972; on Oct. 23, 1978; and on Mar. 19, 1991), a variety is essentially derived from an initial variety if: a) it is predominantly derived from the initial variety, or from a variety that is predominantly derived from the initial variety, while retaining the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety; b) it is clearly distinguishable from the initial variety; and c) except for the differences which result from the act of derivation, it conforms to the initial variety in the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety. Essentially derived varieties can be obtained, for example, by the selection of a natural or induced mutant, a somaclonal variant, a variant individual from plants of the initial variety, backcrossing, or transformation. A first tobacco variety and a second tobacco variety from which the first variety is essentially derived, are considered as having essentially identical genetic background. A line as distinguished from a variety most often denotes a group of plants used non-commercially, for example in plant research. A line typically displays little overall variation between individuals for one or more traits of interest, although there may be some variation between individuals for other traits.
[0131] In some aspects, the present disclosure provides a method of introgressing a low nicotine trait into a tobacco variety, the method comprising: (a) crossing a first tobacco variety comprising a low nicotine trait with a second tobacco variety without the low nicotine trait to produce one or more progeny tobacco plants; (b) genotyping the one or more progeny tobacco plants for a polymorphic marker linked to the low nicotine trait, wherein the polymorphic marker is in a chromosomal interval flanked by any two of polymorphic loci listed in Table 3 or flanked by any two of polymorphic loci listed in Table 4; and (c) selecting a progeny tobacco plant comprising the low nicotine trait. In other aspects, these methods further comprise backcrossing the selected progeny tobacco plant with the second tobacco variety. In further aspects, these methods further comprise: (d) crossing the selected progeny plant with itself or with the second tobacco variety to produce one or more further progeny tobacco plants; and (e) selecting a further progeny tobacco plant comprising the low nicotine trait. In some aspects, the step (e) of selecting comprises marker-assisted selection. In some aspects, these methods produce a single gene conversion comprising a low nicotine trait. In some aspects, these methods produce a single gene conversion comprising a Nic1 introgression. In some aspects, the second second tobacco variety is an elite variety. In other aspects, the genotyping step of these methods involve one or more molecular marker assays. In other aspects, the polymorphic marker used this method comprises a polymorphism selected from the group consisting of single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequence (Indels), simple sequence repeats of DNA sequence (SSRs), a restriction fragment length polymorphism (RFLP), and a tag SNP. In other aspects, the selected progeny tobacco plant comprises a shorter chromosome deletion at Nic1 locus compared to LA Burley 21.
[0132] In other aspects, the present disclosure provides a method of introgressing a low nicotine trait into a tobacco variety, the method comprising: (a) crossing a first tobacco variety comprising a low nicotine trait with a second tobacco variety without the low nicotine trait to produce one or more progeny tobacco plants; (b) genotyping the one or more progeny tobacco plants for a polymorphic marker linked to the low nicotine trait, wherein the polymorphic marker is within 20 cM of any one of polymorphic loci listed in Table 3 and Table 4; and (c) selecting a progeny tobacco plant comprising the low nicotine trait. In some aspects, this method comprises selecting simultaneously or concurrently for one or more molecular markers associated with or closely linked to Nic1 locus as well as one or more molecular markers associated with or closely linked to Nic2 locus.
[0133] In some aspects, the present disclosure provides a method of selecting a tobacco plant having a low nicotine trait, the method comprising: (a) isolating nucleic acids from a collection of tobacco germplasm; (b) assaying the nucleic acids for one or more markers closely linked to Nic1 locus; and (c) selecting a tobacco plant having a low nicotine trait based on the marker assay. In some aspects, the assayed one or more markers closely linked to Nic1 locus are within about 20 cM, 10 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.5 cM, or less than 0.5 cM of any one of polymorphic loci listed in Table 3. In other aspects, this method further comprising assaying for one or more markers closely linked to Nic2 locus. In some aspects, the assayed one or more markers closely linked to Nic2 locus are within about 20 cM, 10 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.5 cM, or less than 0.5 cM of any one of polymorphic loci listed in Table 4. In some aspects, this method further comprises determining the nicotine level of the selected plant to confirm the low nicotine trait.
[0134] Also disclosed herein is a method of introgressing a low nicotine trait into a tobacco variety, the method comprising: (a) crossing a first tobacco variety comprising a low nicotine trait with a second tobacco variety without the low nicotine trait to produce one or more progeny tobacco plants; (b) genotyping the one or more progeny tobacco plants for a polymorphic marker linked to the low nicotine trait, wherein the polymorphic marker is in a chromosomal interval flanked by any two of polymorphic loci listed in Table 4; and (c) selecting a progeny tobacco plant comprising the low nicotine trait. In some aspects, these methods produce a single gene conversion comprising a low nicotine trait. In some aspects, these methods produce a single gene conversion comprising a Nic2 introgression. In some aspects, the second tobacco variety is an elite variety. In other aspects, the genotyping step of these methods involve one or more molecular marker assays. In other aspects, the polymorphic marker used this method comprises a polymorphism selected from the group consisting of single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequence (Indels), simple sequence repeats of DNA sequence (SSRs), a restriction fragment length polymorphism (RFLP), and a tag SNP. In other aspects, the selected progeny tobacco plant comprises a shorter chromosome deletion at Nic2 locus compared to LA Burley 21.
[0135] As used herein, locus is a chromosome region where a polymorphic nucleic acid, trait determinant, gene, or marker is located. The loci of this disclosure comprise one or more polymorphisms in a population; e.g., alternative alleles are present in some individuals. As used herein, allele refers to an alternative nucleic acid sequence at a particular locus. The length of an allele can be as small as 1 nucleotide base, but is typically larger. For example, a first allele can occur on one chromosome, while a second allele occurs on a second homologous chromosome, e.g., as occurs for different chromosomes of a heterozygous individual, or between different homozygous or heterozygous individuals in a population. As used herein, the term chromosome interval designates a contiguous linear span of genomic DNA that resides on a single chromosome.
[0136] As used herein, a centimorgan (cM) is a unit of measure of recombination frequency. One cM is equal to a 1% chance that a marker at one genetic locus will be separated from a marker at, a second locus due to crossing over in a single generation. Genetic distances referred herein can be calculated from recombination values using the Kosambi function (Kosambi, The estimation of map distances from recombination values. Annals of Eugenics, 12:172-75 (1944)).
[0137] As used herein, closely linked to or associated with means that the marker or locus is within about 20 cM, 10 cM, 5 cM, 1 cM, 0.5 cM, or less than 0.5 cM of another marker or locus. For example, 20 cM means that recombination between the marker and the locus with a frequency of equal to or less than about 20%.
[0138] As used herein, introgression or introgress refers to the transmission of a desired allele of a genetic locus from one genetic background to another.
[0139] As used herein, crossed or cross means to produce progeny via fertilization (e.g. cells, seeds or plants) and includes crosses between plants (sexual) and self fertilization (selfing).
[0140] As used herein, backcross and backcrossing refer to the process whereby a progeny plant is repeatedly crossed back to one of its parents. In a backcrossing scheme, the donor parent refers to the parental plant with the desired gene or locus to be introgressed. The recipient parent (used one or more times) or recurrent parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed. The initial cross gives rise to the F1 generation. The term BC1 refers to the second use of the recurrent parent, BC2 refers to the third use of the recurrent parent, and so on. In some aspects, a backcross is performed repeatedly, with a progeny individual of each successive backcross generation being itself backcrossed to the same parental genotype.
[0141] As used herein, single gene converted or single gene conversion refers to plants that are developed using a plant breeding technique known as backcrossing, or via genetic engineering, wherein essentially all of the desired morphological and physiological characteristics of a variety are recovered in addition to the single gene transferred into the variety via the backcrossing technique or via genetic engineering.
[0142] As used herein, elite variety means any variety that has resulted from breeding and selection for superior agronomic performance.
[0143] As used herein, selecting or selection in the context of marker-assisted selection or breeding refer to the act of picking or choosing desired individuals, normally from a population, based on certain pre-determined criteria.
[0144] As used herein, the term trait refers to one or more detectable characteristics of a cell or organism which can be influenced by genotype. The phenotype can be observable to the naked eye, or by any other means of evaluation known in the art, e.g., microscopy, biochemical analysis, genomic analysis, an assay for a particular disease tolerance, etc. In some cases, a phenotype is directly controlled by a single gene or genetic locus, e.g., a single gene trait. In other cases, a phenotype is the result of several genes.
[0145] As used herein, marker assay means a method for detecting a polymorphism at a particular locus using a particular method, e.g., measurement of at least one phenotype (such as seed color, flower color, or other visually detectable trait), restriction fragment length polymorphism (RFLP), single base extension, electrophoresis, sequence alignment, allelic specific oligonucleotide hybridization (ASO), random amplified polymorphic DNA (RAPD), microarray-based technologies, and nucleic acid sequencing technologies, etc.
[0146] As used herein, marker assisted selection (MAS) is a process by which phenotypes are selected based on marker genotypes. Marker assisted selection breeding refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
[0147] As used herein, polymorphism means the presence of one or more variations in a population. A polymorphism may manifest as a variation in the nucleotide sequence of a nucleic acid or as a variation in the amino acid sequence of a protein. Polymorphisms include the presence of one or more variations of a nucleic acid sequence or nucleic acid feature at one or more loci in a population of one or more individuals. The variation may comprise but is not limited to one or more nucleotide base changes, the insertion of one or more nucleotides or the deletion of one or more nucleotides. A polymorphism may arise from random processes in nucleic acid replication, through mutagenesis, as a result of mobile genomic elements, from copy number variation and during the process of meiosis, such as unequal crossing over, genome duplication and chromosome breaks and fusions. The variation can be commonly found or may exist at low frequency within a population, the former having greater utility in general plant breeding and the latter may be associated with rare but important phenotypic variation. Useful polymorphisms may include single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequence (Indels), simple sequence repeats of DNA sequence (SSRs), a restriction fragment length polymorphism (RFLP), and a tag SNP. A genetic marker, a gene, a DNA-derived sequence, a RNA-derived sequence, a promoter, a 5 untranslated region of a gene, a 3 untranslated region of a gene, microRNA, siRNA, a tolerance locus, a satellite marker, a transgene, mRNA, ds mRNA, a transcriptional profile, and a methylation pattern may also comprise polymorphisms. In addition, the presence, absence, or variation in copy number of the preceding may comprise polymorphisms.
[0148] As used herein, SNP or single nucleotide polymorphism means a sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or variable. SNP markers exist when SNPs are mapped to sites on the genome.
[0149] As used herein, marker or molecular marker or marker locus is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. The map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co-segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple molecular tests without actually evaluating the appearance of the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage and/or under environmental conditions where the trait can be expressed. In some aspects, markers used herein exhibit LOD scores of 2 or greater, 3 or greater, 4 or greater, 5 or greater, 6 or greater, 7 or greater, 8 or greater, or 9 or greater with Nic1 or Nic2 loci disclosed herein, measuring using a method known in the art such as Qgene Version 2.23 (1996) and default parameters.
[0150] In one aspect, the present disclosure provides a tobacco plant, or part thereof, comprising a first chromosomal deletion flanked by and not comprising any two of Nic1 Marker Nos. 1 to 207, a second chromosomal deletion flanked by and not comprising any two of Nic2 Marker Nos. 1 to 340, or both said first and said second chromosomal deletions, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, or 95 or more. In another aspect, a tobacco plant comprises a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%. In one aspect, further provided are a population of the tobacco plants in this paragraph, cured tobacco material made therefrom, a tobacco blend comprising said cured tobacco material, and a tobacco product comprising the cured tobacco material.
[0151] In another aspect, the present disclosure provides a tobacco plant, or part thereof, comprising a mutation selected from the group consisting of a first chromosomal deletion flanked by and not comprising any two of Nic1 Marker Nos. 1 to 207, a second chromosomal deletion flanked by and not comprising any two of Nic2 Marker Nos. 1 to 340, and both said first and said second chromosomal deletions, wherein said tobacco plant is capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said mutation. In one aspect, a tobacco plant comprises nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of said control plant when grown in similar growth conditions. In one aspect, further provided are a population of the tobacco plants in this paragraph, cured tobacco material made therefrom, a tobacco blend comprising said cured tobacco material, and a tobacco product comprising the cured tobacco material.
[0152] In one aspect, a first chromosomal deletion is flanked by and not comprising any two of Nic1 Marker Nos. 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 100, 101 to 120, 121 to 140, 141 to 160, 161 to 180, 181 to 200, or 201 to 207. In another aspect, a first chromosomal deletion is flanked by and not comprising any two of Nic1 Marker Nos. 1 to 10, 11 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 81 to 90, 91 to 100, 101 to 110, 111 to 120, 121 to 130, 131 to 140, 141 to 150, 151 to 160, 161 to 170, 171 to 180, 181 to 190, 191 to 200, or 201 to 207.
[0153] In one aspect, a second chromosomal deletion is flanked by and not comprising any two of Nic2 Marker Nos. 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 100, 101 to 120, 121 to 140, 141 to 160, 161 to 180, 181 to 200, 201 to 220, 221 to 240, 241 to 260, 261 to 280, 281 to 300, 301 to 320, or 321 to 340. In another aspect, a second chromosomal deletion is flanked by and not comprising any two of Nic2 Marker Nos. 1 to 10, 11 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 81 to 90, 91 to 100, 101 to 110, 111 to 120, 121 to 130, 131 to 140, 141 to 150, 151 to 160, 161 to 170, 171 to 180, 181 to 190, 191 to 200, 201 to 210, 211 to 220, 221 to 230, 231 to 240, 241 to 250, 251 to 260, 261 to 270, 271 to 280, 281 to 290, 291 to 300, 301 to 310, 311 to 320, 321 to 330, or 331 to 340.
[0154] It is understood that any tobacco plant of the present disclosure can further comprise additional agronomically desirable traits, for example, by transformation with a genetic construct or transgene using a technique known in the art. Without limitation, an example of a desired trait is herbicide resistance, pest resistance, disease resistance; high yield; high grade index value; curability; curing quality; mechanical harvestability; holding ability; leaf quality; height, plant maturation (e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing); stalk size (e.g., a small, medium, or a large stalk); or leaf number per plant (e.g., a small (e.g., 5-10 leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number of leaves), or any combination. In some aspects, low-nicotine or nicotine-free tobacco plants or seeds disclosed herein comprise one or more transgenes expressing one or more insecticidal proteins, such as, for example, a crystal protein of Bacillus thuringiensis or a vegetative insecticidal protein from Bacillus cereus, such as VIP3 (see, for example, Estruch et al. (1997) Nat. Biotechnol. 15:137). In other aspects, tobacco plants disclosed herein further comprise an introgressed trait conferring resistance to brown stem rot (U.S. Pat. No. 5,689,035) or resistance to cyst nematodes (U.S. Pat. No. 5,491,081).
[0155] The present disclosure also provides tobacco plants comprising an altered nicotine level but having a yield comparable to the yield of corresponding initial tobacco plants without such a nicotine level alternation. In one aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein provides a yield selected from the group consisting of about between 1200 and 3500, between 1300 and 3400, between 1400 and 3300, between 1500 and 3200, between 1600 and 3100, between 1700 and 3000, between 1800 and 2900, between 1900 and 2800, between 2000 and 2700, between 2100 and 2600, between 2200 and 2500, and between 2300 and 2400 lbs/acre. In another aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein provides a yield selected from the group consisting of about between 1200 and 3500, between 1300 and 3500, between 1400 and 3500, between 1500 and 3500, between 1600 and 3500, between 1700 and 3500, between 1800 and 3500, between 1900 and 3500, between 2000 and 3500, between 2100 and 3500, between 2200 and 3500, between 2300 and 3500, between 2400 and 3500, between 2500 and 3500, between 2600 and 3500, between 2700 and 3500, between 2800 and 3500, between 2900 and 3500, between 3000 and 3500, and between 3100 and 3500 lbs/acre. In further aspects, low-nicotine or nicotine-free tobacco plants disclosed herein provide a yield between 65% and 130%, between 70% and 130%, between 75% and 130%, between 80% and 130%, between 85% and 130%, between 90% and 130%, between 95% and 130%, between 100% and 130%, between 105% and 130%, between 110% and 130%, between 115% and 130%, or between 120% and 130% of the yield of a control plant having essentially identical genetic background except a Nic1 mutation, a Nic2 mutation, a Nic1 transgene, a Nic2 transgene, or combinations thereof. In further aspects, low-nicotine or nicotine-free tobacco plants disclosed herein provide a yield between 70% and 125%, between 75% and 120%, between 80% and 115%, between 85% and 110%, or between 90% and 100% of the yield of a control plant having essentially identical genetic background except a Nic1 mutation, a Nic2 mutation, a Nic1 transgene, a Nic2 transgene, or combinations thereof
[0156] In one aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein is adapted for machine harvesting. In another aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein is harvested mechanically.
[0157] In some aspects, tobacco plants provided herein are hybrid plants. Hybrids can be produced by preventing self-pollination of female parent plants (e.g., seed parents) of a first variety, permitting pollen from male parent plants of a second variety to fertilize the female parent plants, and allowing F1 hybrid seeds to form on the female plants. Self-pollination of female plants can be prevented by emasculating the flowers at an early stage of flower development. Alternatively, pollen formation can be prevented on the female parent plants using a form of male sterility. For example, male sterility can be produced by male sterility (MS), or transgenic male sterility wherein a transgene inhibits micro sporogenesis and/or pollen formation, or self-incompatibility. Female parent plants containing MS are particularly useful. In aspects in which the female parent plants are MS, pollen may be harvested from male fertile plants and applied manually to the stigmas of MS female parent plants, and the resulting F1 seed is harvested.
[0158] Plants can be used to form single-cross tobacco F1 hybrids. Pollen from a male parent plant is manually transferred to an emasculated female parent plant or a female parent plant that is male sterile to form F1 seed. Alternatively, three-way crosses can be carried out wherein a single-cross F1 hybrid is used as a female parent and is crossed with a different male parent. As another alternative, double-cross hybrids can be created wherein the F1 progeny of two different single-crosses are themselves crossed. Self-incompatibility can be used to particular advantage to prevent self-pollination of female parents when forming a double-cross hybrid.
[0159] In one aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein is male sterile. In another aspect, a low-nicotine or nicotine-free tobacco variety disclosed herein is cytoplasmic male sterile. Male sterile tobacco plants may be produced by any method known in the art. Methods of producing male sterile tobacco are described in Wernsman, E. A., and Rufty, R. C. 1987. Chapter Seventeen. Tobacco. Pages 669-698 In: Cultivar Development. Crop Species. W. H. Fehr (ed.), MacMillan Publishing Go., Inc., New York, N.Y. 761 pp.
[0160] In further aspects, tobacco parts provided herein include, but are not limited to, a leaf, a stem, a root, a seed, a flower, pollen, an anther, an ovule, a pedicel, a fruit, a meristem, a cotyledon, a hypocotyl, a pod, an embryo, endosperm, an explant, a callus, a tissue culture, a shoot, a cell, and a protoplast. In one aspect, tobacco part provided herein does not include seed. In one aspect, this disclosure provides tobacco plant cells, tissues, and organs that are not reproductive material and do not mediate the natural reproduction of the plant. In another aspect, this disclosure also provides tobacco plant cells, tissues, and organs that are reproductive material and mediate the natural reproduction of the plant. In another aspect, this disclosure provides tobacco plant cells, tissues, and organs that cannot maintain themselves via photosynthesis. In another aspect, this disclosure provides somatic tobacco plant cells. Somatic cells, contrary to germline cells, do not mediate plant reproduction.
[0161] The provided cells, tissues and organs may be from seed, fruit, leaf, cotyledon, hypocotyl, meristem, embryos, endosperm, root, shoot, stem, pod, flower, infloresence, stalk, pedicel, style, stigma, receptacle, petal, sepal, pollen, anther, filament, ovary, ovule, pericarp, phloem, vascular tissue. In another aspect, this disclosure provides a tobacco plant chloroplast. In a further aspect, this disclosure provides epidermal cells, stomata cell, leaf or root hairs, a storage root, or a tuber. In another aspect, this disclosure provides a tobacco protoplast.
[0162] Skilled artisans understand that tobacco plants naturally reproduce via seeds, not via asexual reproduction or vegetative propagation. In one aspect, this disclosure provides tobacco endosperm. In another aspect, this disclosure provides tobacco endosperm cells. In a further aspect, this disclosure provides a male or female sterile tobacco plant, which cannot reproduce without human intervention.
[0163] In some aspects, the present disclosure provides a nucleic acid molecule comprising at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 48, 75 to 82, 86 to 115, and 131 to 146, and fragments thereof. In other aspects, the present disclosure provides a nucleic acid molecule comprising at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, 146, and fragments thereof. In some aspects, the present disclosure provides a polypeptide or protein comprising at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 116 to 130, and 147. In other aspects, the present disclosure provides a polypeptide or protein comprising at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 116 to 130, and 147. In other aspects, the present disclosure provides a biologically active variant of a protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 116 to 130, and 147. A biologically active variant of a protein of the present disclosure may differ from that protein by as few as 1-15 amino acid residues, as few as 10, as few as 9, as few as 8, as few as 7, as few as 6, as few as 5, as few as 4, as few as 3, as few as 2, or as few as 1 amino acid residue. Also provided herein are orthologous genes or proteins of genes or proteins from Nic1 locus. Orthologs are genes derived from a common ancestral gene and which are found in different species as a result of speciation. Orthologs may share at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity or similarity at the nucleotide sequence and/or the protein sequence level. Functions of orthologs are often highly conserved among species.
[0164] As used herein, the term sequence identity or identity in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity.
[0165] Nucleic acid molecules, polypeptides, or proteins provided herein can be isolated or substantially purified. An isolated or purified nucleic acid molecule, polypeptide, protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. For example, an isolated or purified polynucleotide or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
[0166] The present disclosure further provides a method manufacturing a tobacco product comprising tobacco material from tobacco plants disclosed herein. In some aspects, methods disclosed herein comprise conditioning aged tobacco material made from tobacco plants disclosed herein to increase its moisture content from between about 12.5% and about 13.5% to about 21%, blending the conditioned tobacco material to produce a desirable blend. In one aspect, the method of manufacturing a tobacco product disclosed herein further comprises casing or flavoring the blend. Generally, during the casing process, casing or sauce materials are added to blends to enhance their quality by balancing the chemical composition and to develop certain desired flavor characteristics. Further details for the casing process can be found in Tobacco Production, Chemistry and Technology, Edited by L. Davis and M. Nielsen, Blackwell Science, 1999.
[0167] Tobacco material provided herein can be also processed using methods including, but not limited to, heat treatment (e.g., cooking, toasting), flavoring, enzyme treatment, expansion and/or curing. Both fermented and non-fermented tobaccos can be processed using these techniques. Examples of suitable processed tobaccos include dark air-cured, dark fire cured, burley, flue cured, and cigar filler or wrapper, as well as the products from the whole leaf stemming operation. In some aspects, tobacco fibers include up to 70% dark tobacco on a fresh weight basis. For example, tobacco can be conditioned by heating, sweating and/or pasteurizing steps as described in U.S. Publication Nos. 2004/0118422 or 2005/0178398.
[0168] Tobacco material provided herein can be subject to fermentation. Fermenting typically is characterized by high initial moisture content, heat generation, and a 10 to 20% loss of dry weight. See, e.g., U.S. Pat. Nos. 4,528,993; 4,660,577; 4,848,373; and 5,372,149. In addition to modifying the aroma of the leaf, fermentation can change either or both the color and texture of a leaf. Also during the fermentation process, evolution gases can be produced, oxygen can be taken up, the pH can change, and the amount of water retained can change. See, for example, U.S. Publication No. 2005/0178398 and Tso (1999, Chapter 1 in Tobacco, Production, Chemistry and Technology, Davis & Nielsen, eds., Blackwell Publishing, Oxford). Cured, or cured and fermented tobacco can be further processed (e.g., cut, expanded, blended, milled or comminuted) prior to incorporation into the oral product. The tobacco, in some cases, is long cut fermented cured moist tobacco having an oven volatiles content of between 48 and 50 weight percent prior to mixing with the copolymer and optionally flavorants and other additives.
[0169] In some aspects, tobacco material provided herein can be processed to a desired size. In certain aspects, tobacco fibers can be processed to have an average fiber size of less than 200 micrometers. In some aspects, tobacco fibers are between 75 and 125 micrometers. In other aspects, tobacco fibers are processed to have a size of 75 micrometers or less. In some aspects, tobacco fibers include long cut tobacco, which can be cut or shredded into widths of about 10 cuts/inch up to about 110 cuts/inch and lengths of about 0.1 inches up to about 1 inch. Double cut tobacco fibers can have a range of particle sizes such that about 70% of the double cut tobacco fibers falls between the mesh sizes of 20 mesh and 80 mesh.
[0170] Tobacco material provided herein can be processed to have a total oven volatiles content of about 10% by weight or greater; about 20% by weight or greater; about 40% by weight or greater; about 15% by weight to about 25% by weight; about 20% by weight to about 30% by weight; about 30% by weight to about 50% by weight; about 45% by weight to about 65% by weight; or about 50% by weight to about 60% by weight. Those of skill in the art will appreciate that moist tobacco typically refers to tobacco that has an oven volatiles content of between about 40% by weight and about 60% by weight (e.g., about 45% by weight to about 55% by weight, or about 50% by weight). As used herein, oven volatiles are determined by calculating the percentage of weight loss for a sample after drying the sample in a pre-warmed forced draft oven at 110 C. for 3.25 hours. The oral product can have a different overall oven volatiles content than the oven volatiles content of the tobacco fibers used to make the oral product. The processing steps described herein can reduce or increase the oven volatiles content.
[0171] The following paragraphs provide a list of exemplary embodiments.
Embodiment 1
[0172] A tobacco plant, or part thereof, comprising a mutation in Nic1 locus, a mutation in Nic2 locus, or both, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more.
Embodiment 2
[0173] The tobacco plant, or part thereof, of Embodiment 1, wherein said tobacco plant is capable of producing leaves having a USDA grade index value selected from the group consisting of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more.
Embodiment 3
[0174] The tobacco plant, or part thereof, of Embodiment 1, wherein said tobacco plant is capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said mutation.
Embodiment 4
[0175] The tobacco plant, or part thereof, of Embodiment 1, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% of the USDA grade index value of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said mutation.
Embodiment 6
[0176] The tobacco plant, or part thereof, of Embodiment 1, wherein said tobacco plant comprises a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%.
Embodiment 7
[0177] The tobacco plant, or part thereof, of Embodiment 1, wherein said tobacco plant further comprises a transgene or mutation directly suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, A622, and MATE transporter.
Embodiment 8
[0178] A tobacco plant, or part thereof, comprising a mutation in Nic1 locus, a mutation in Nic2 locus, or both, wherein said tobacco plant is capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said mutation.
Embodiment 9
[0179] The tobacco plant, or part thereof, of Embodiment 8, wherein said tobacco plant is capable of producing leaves having a USDA grade index value selected from the group consisting of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more.
Embodiment 10
[0180] The tobacco plant, or part thereof, of Embodiment 8, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% of the grading index of said control plant.
Embodiment 11
[0181] The tobacco plant, or part thereof, of Embodiment 8, wherein said tobacco plant comprises nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of said control plant when grown in similar growth conditions.
Embodiment 12
[0182] The tobacco plant, or part thereof, of Embodiment 8, wherein said tobacco plant further comprises a transgene or mutation directly suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, A622, and MATE transporter.
Embodiment 13
[0183] A plant of a tobacco variety comprising a mutation selected from the group consisting of a nic1 mutation, a nic2 mutation, and a combination thereof, wherein said tobacco variety has a leaf grading index comparable to the leaf grading index of a control tobacco variety when grown in similar growth conditions, wherein said control tobacco variety shares an essentially identical genetic background with said tobacco variety except said mutation.
Embodiment 14
[0184] A non-transgenic tobacco plant, or part thereof, comprising a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more.
Embodiment 15
[0185] The non-transgenic tobacco plant, or part thereof, of claim 14, wherein said non-transgenic tobacco plant comprises a nicotine level of less than 2.0% and is capable of producing leaves having a USDA grade index value of 70 or more.
Embodiment 16
[0186] The non-transgenic tobacco plant, or part thereof, of claim 14, wherein said non-transgenic tobacco plant comprises a nicotine level of less than 1.0% and is capable of producing leaves having a USDA grade index value of 70 or more.
Embodiment 17
[0187] A tobacco plant, or part thereof, comprising a non-transgenic mutation, wherein said non-transgenic mutation reduces the nicotine level of said tobacco plant to below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of a control plant when grown in similar growth conditions, wherein said tobacco plant is capable of producing leaves having a USDA grade index value comparable to the USDA grade index value of said control plant, and wherein said control plant shares an essentially identical genetic background with said tobacco plant except said non-transgenic mutation.
Embodiment 18
[0188] A population of the tobacco plants of any one of Embodiments 1 to 17.
Embodiment 19
[0189] Cured tobacco material from the tobacco plant of any one of claims 1 to 17.
Embodiment 20
[0190] The cured tobacco material of Embodiment 19, wherein said cured tobacco material is made by a curing process selected from the group consisting of flue curing, air curing, fire curing, and sun curing.
Embodiment 21
[0191] A tobacco blend comprising the cured tobacco material of claim 19.
Embodiment 22
[0192] The tobacco blend of Embodiment 21, wherein the cured tobacco material constitutes about at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cured tobacco in said tobacco blend by weight.
Embodiment 23
[0193] The tobacco blend of Embodiment 21, wherein the cured tobacco material constitutes about at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cured tobacco in said tobacco blend by volume.
Embodiment 24
[0194] A tobacco product comprising the cured tobacco material of claim 19.
Embodiment 25
[0195] The tobacco product of Embodiment 24, wherein the tobacco product is selected from the group consisting of a cigarette, a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
Embodiment 26
[0196] The tobacco product of Embodiment 24, wherein the tobacco product is a smokeless tobacco product.
Embodiment 27
[0197] The tobacco product of Embodiment 26, wherein the smokeless tobacco product is selected from the group consisting of loose leaf chewing tobacco, plug chewing tobacco, moist snuff, and nasal snuff.
Embodiment 28
[0198] A reconstituted tobacco comprising the cured tobacco material of claim 19.
Embodiment 29
[0199] A tobacco plant, or part thereof, comprising a mutation in Nic1 locus, wherein said mutation is absent from a LA Burley 21 variety.
Embodiment 30
[0200] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises a shorter chromosome deletion at Nic1 locus compared to said LA Burley 21 variety.
Embodiment 31
[0201] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises a lower level of nicotine compared to a control tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 32
[0202] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level in a control tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 33
[0203] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises a lower level of total alkaloid compared to a control tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 34
[0204] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises a lower level of one or more alkaloid selected from the group consisting of nicotine, nornicotine, anabasine, and anatabine, compared to a control tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 35
[0205] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant comprises a similar level of one or more compounds selected from the group consisting of 3-methylvaleric acid, valeric acid, isovaleric acid, a labdenoid, a cembrenoid, a sugar ester, and a reducing sugar, compared to a control tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 36
[0206] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is homozygous.
Embodiment 37
[0207] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is heterozygous.
Embodiment 38
[0208] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is selected from the group consisting of a point mutation, a deletion, an insertion, a duplication, and an inversion.
Embodiment 39
[0209] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is introduced by an approach selected from the group consisting of random mutagenesis and targeted mutagenesis.
Embodiment 40
[0210] The tobacco plant, or part thereof, of Embodiment 39, wherein said targeted mutagenesis is mediated by meganuclease, zinc finger nuclease, TALEN, or CRISPR.
Embodiment 41
[0211] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant further comprises a mutation in Nic2 locus.
Embodiment 42
[0212] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a gene comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
Embodiment 43
[0213] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation reduces the expression or activity of said gene.
Embodiment 44
[0214] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a gene comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 45
[0215] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 46
[0216] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a gene comprising a coding sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 33, 48, 101, 102, and 146, and fragments thereof.
Embodiment 47
[0217] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 33, 48, 101, 102, and 146, and fragments thereof.
Embodiment 48
[0218] The tobacco plant, or part thereof, of Embodiment 29, wherein said mutation is located within a gene encoding a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 53, 68, 116, 117, 147, and fragments thereof.
Embodiment 49
[0219] The tobacco plant, or part thereof, of Embodiment 29, wherein said plant further comprises a reduced level of mRNA, protein, or both of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, MATE, and
[0220] A622, compared to a tobacco plant without said mutation when grown in similar growth conditions.
Embodiment 50
[0221] The tobacco plant, or part thereof, of Embodiment 29, wherein said plant further comprises a transgene or mutation suppressing the expression or activity of one or more genes encoding a product selected from the group consisting of PMT, MPO, QPT, BBL, A622, and MATE transporter.
Embodiment 51
[0222] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant is a hybrid.
Embodiment 52
[0223] The tobacco plant, or part thereof, of Embodiment 29, wherein said part is selected from the group consisting of a leaf, a stem, a root, a seed, a flower, pollen, an anther, an ovule, a pedicel, a fruit, a meristem, a cotyledon, a hypocotyl, a pod, an embryo, endosperm, an explant, a callus, a tissue culture, a shoot, a cell, and a protoplast.
Embodiment 53
[0224] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant is from a variety selected from the group consisting of flue-cured tobacco, air-cured tobacco, dark fire-cured tobacco, and Galpao tobacco, and Oriental tobacco.
Embodiment 54
[0225] The tobacco plant, or part thereof, of Embodiment 29, wherein said tobacco plant is from a variety selected from the group consisting of Burley tobacco, Maryland tobacco, and dark air-cured tobacco.
Embodiment 55
[0226] A population of the tobacco plants of Embodiment 29.
Embodiment 56
[0227] Cured tobacco material from the tobacco plant of Embodiment 29.
Embodiment 57
[0228] The cured tobacco material of Embodiment 56, wherein said cured tobacco material comprises a lower level of nicotine compared to cured tobacco material from a control tobacco plant without said mutation.
Embodiment 58
[0229] The cured tobacco material of Embodiment 56, wherein said tobacco plant comprises nicotine at a level between 0.2% and 0.6%.
Embodiment 59
[0230] The cured tobacco material of Embodiment 56, wherein said tobacco plant comprises nicotine at a level between 1.0% and 3.0%.
Embodiment 60
[0231] The cured tobacco material of Embodiment 56, wherein said cured tobacco material is made by a curing process selected from the group consisting of flue curing, air curing, fire curing, and sun curing.
Embodiment 61
[0232] A tobacco blend comprising the cured tobacco material of claim 56.
Embodiment 62
[0233] A tobacco product comprising the cured tobacco material of claim 56.
Embodiment 63
[0234] The tobacco product of Embodiment 62, wherein the tobacco product is selected from the group consisting of a cigarette, a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
Embodiment 64
[0235] The tobacco product of Embodiment 62, wherein the tobacco product is a smokeless tobacco product.
Embodiment 65
[0236] The tobacco product of Embodiment 64, wherein the smokeless tobacco product is selected from the group consisting of loose leaf chewing tobacco, plug chewing tobacco, moist snuff, and nasal snuff.
Embodiment 66
[0237] A reconstituted tobacco comprising the cured tobacco material of claim 56.
Embodiment 67
[0238] A recombinant DNA construct comprising a promoter that is functional in a tobacco cell and operably linked to a polynucleotide that encodes a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 49 to 68, 84, 116 to 130, 147, and fragments thereof.
Embodiment 68
[0239] A tobacco plant, or part thereof, comprising the recombinant DNA construct of claim 67.
Embodiment 69
[0240] A tobacco plant, or part thereof, of Embodiment 68, wherein said tobacco plant comprises a higher level of nicotine compared to a control tobacco plant without said recombinant DNA construct.
Embodiment 70
[0241] Cured tobacco material from the tobacco plant of Embodiment 68.
Embodiment 71
[0242] A tobacco product comprising the cured tobacco material of claim 70.
Embodiment 72
[0243] A method of increasing the nicotine level of a tobacco plant, said method comprising transforming a tobacco plant with the recombinant DNA construct of claim 67.
Embodiment 73
[0244] A recombinant DNA construct comprising a promoter that is functional in a tobacco cell and operably linked to a polynucleotide that encodes an RNA molecule capable of binding to an RNA encoding a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 49 to 68, 84, 116 to 130, 147, and fragments thereof, and wherein said RNA molecule suppresses the expression of said polypeptide.
Embodiment 74
[0245] A tobacco plant, or part thereof, comprising the recombinant DNA construct of claim 73.
Embodiment 75
[0246] The tobacco plant, or part thereof, of Embodiment 74, wherein said RNA molecule is selected from the group consisting of a microRNA, an siRNA, and a trans-acting siRNA.
Embodiment 76
[0247] The tobacco plant, or part thereof, of Embodiment 74, wherein said polynucleotide encodes a double stranded RNA.
Embodiment 77
[0248] The tobacco plant, or part thereof, of Embodiment 74, wherein said tobacco plant comprises a lower level of nicotine compared to a control tobacco plant without said recombinant DNA construct.
Embodiment 78
[0249] Cured tobacco material from the tobacco plant of Embodiment 74.
Embodiment 79
[0250] A tobacco product comprising the cured tobacco material of claim 78.
Embodiment 80
[0251] A method of reducing the nicotine level of a tobacco plant, said method comprising transforming a tobacco plant with the recombinant DNA construct of claim 73.
Embodiment 81
[0252] A tobacco plant, or part thereof, comprising a heterologous expression cassette comprising a Nic1 inhibitory sequence of a gene comprising a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof, wherein said inhibitory sequence is operably linked to a promoter that is functional in a plant cell, and wherein said inhibitory sequence has at least 90% sequence identity to a fragment of at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides of sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
Embodiment 82
[0253] The tobacco plant, or part thereof, of Embodiment 81, wherein said Nic1 inhibitory sequence is capable of being transcribed as an inhibitory polynucleotide selected from the group consisting of a single-stranded RNA polynucleotide, a double-stranded RNA polynucleotide, and a combination thereof.
Embodiment 83
[0254] The tobacco plant, or part thereof, of Embodiment 81, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, and a tissue-preferred promoter.
Embodiment 84
[0255] The tobacco plant, or part thereof, of Embodiment 81, wherein said promoter is a root-specific promoter.
Embodiment 85
[0256] A tobacco plant, or part thereof, comprising a heterologous expression cassette comprising a Nic1 inhibitory sequence of a gene comprising a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof, wherein said inhibitory sequence is operably linked to a promoter that is functional in a plant cell, and wherein said inhibitory sequence has at least 90% sequence identity to a fragment of at least 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides of sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 86
[0257] A method of introgressing a low nicotine trait into a tobacco variety, said method comprising: [0258] a. crossing a first tobacco variety comprising a low nicotine trait with a second tobacco variety without said low nicotine trait to produce one or more progeny tobacco plants; [0259] b. genotyping the one or more progeny tobacco plants for a polymorphic marker linked to said low nicotine trait, wherein said polymorphic marker is in a chromosomal interval flanked by any two of polymorphic loci listed in Table 3 or flanked by any two of polymorphic loci listed in Table 4; and [0260] c. selecting a progeny tobacco plant comprising the low nicotine trait.
Embodiment 87
[0261] The method of Embodiment 86, wherein the method further comprises backcrossing said selected progeny tobacco plant with said second tobacco variety.
Embodiment 88
[0262] The method of Embodiment 86, wherein the method further comprises: [0263] d. crossing the selected progeny plant with itself or with the second tobacco variety to produce one or more further progeny tobacco plants; and [0264] e. selecting a further progeny tobacco plant comprising the low nicotine trait.
Embodiment 89
[0265] The method of Embodiment 88, wherein the step (e) of selecting comprises marker-assisted selection.
Embodiment 90
[0266] The method of Embodiment 86, wherein the method produces a single gene conversion comprising said low nicotine trait.
Embodiment 91
[0267] The method of Embodiment 86, wherein the second tobacco variety is an elite variety.
Embodiment 92
[0268] The method of Embodiment 86, wherein the genotyping involves one or more molecular marker assays.
Embodiment 93
[0269] The method of Embodiment 86, wherein the polymorphic marker comprises a polymorphism selected from the group consisting of single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequence (Indels), simple sequence repeats of DNA sequence (SSRs), a restriction fragment length polymorphism (RFLP), and a tag SNP.
Embodiment 94
[0270] The method of Embodiment 86, wherein the genotyping comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
Embodiment 95
[0271] The method of Embodiment 86, wherein the genotyping comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID Nos: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 96
[0272] The method of Embodiment 86, wherein the first tobacco variety is LA Burley 21.
Embodiment 97
[0273] The method of Embodiment 86, wherein the selected progeny tobacco plant comprises a shorter chromosome deletion at Nic1 locus compared to LA Burley 21.
Embodiment 98
[0274] A method of introgressing a low nicotine trait into a tobacco variety, said method comprising:
a. crossing a first tobacco variety comprising a low nicotine trait with a second tobacco variety without said low nicotine trait to produce one or more progeny tobacco plants;
b. genotyping the one or more progeny tobacco plants for a polymorphic marker linked to said low nicotine trait, wherein said polymorphic marker is within 20 cM of any one of polymorphic loci listed in Table 3 and Table 4, or is any one of SEQ ID Nos. 131 to 144; and
c. selecting a progeny tobacco plant comprising the low nicotine trait.
Embodiment 99
[0275] The method of Embodiment 98, wherein the genotyping comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
Embodiment 100
[0276] The method of Embodiment 98, wherein the genotyping comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 101
[0277] A method of selecting a tobacco plant having a low nicotine trait, said method comprising:
a. isolating nucleic acids from a collection of tobacco germplasm;
b. assaying the nucleic acids for one or more markers closely linked to Nic1 locus or Nic2 locus; and
c. selecting a tobacco plant having a low nicotine trait based on the marker assay.
Embodiment 102
[0278] The method of Embodiment 101, wherein the one or more markers are within about 20 cM, 10 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.5 cM, or less than 0.5 cM of any one of polymorphic loci listed in Table 3 and Table 4, or any one of SEQ ID Nos. 131 to 144.
Embodiment 103
[0279] The method of Embodiment 101, wherein the assaying comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 9 to 28, 75 to 82, 86 to 100, 145, and fragments thereof.
Embodiment 104
[0280] The method of Embodiment 101, wherein the assaying comprises assaying for the presence or absence of a nucleic acid sequence located within a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 28, 33, 48, 82, 86, 87, 101, 102, 145, and 146, and fragments thereof.
Embodiment 105
[0281] The method of Embodiment 101, wherein the method further comprises determining the nicotine level of said selected plant to confirm said low nicotine trait.
Embodiment 106
[0282] The method of Embodiment 101, wherein the collection of tobacco germplasm is a haploid breeding population.
Embodiment 107
[0283] A tobacco plant, or part thereof, comprising a first chromosomal deletion flanked by and not comprising any two of Nic1 Marker Nos. 1 to 207, a second chromosomal deletion flanked by and not comprising any two of Nic2 Marker Nos. 1 to 340, or both said first and said second chromosomal deletions, wherein said tobacco plant is capable of producing leaves having a USDA grade index value of 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, or 95 or more.
Embodiment 108
[0284] The tobacco plant, or part thereof, of Embodiment 107, wherein said tobacco plant comprises a nicotine level selected from the group consisting of less than 3%, less than 2.75%, less than 2.5%, less than 2.25%, less than 2.0%, less than 1.75%, less than 1.5%, less than 1.25%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1%, and less than 0.05%.
Embodiment 109
[0285] The tobacco plant, or part thereof, of Embodiment 107, wherein said first chromosomal deletion is flanked by and not comprising any two of Nic1 Marker Nos. 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 100, 101 to 120, 121 to 140, 141 to 160, 161 to 180, 181 to 200, or 201 to 207.
Embodiment 110
[0286] The tobacco plant, or part thereof, of Embodiment 107, wherein said first chromosomal deletion is flanked by and not comprising any two of Nic1 Marker Nos. 1 to 10, 11 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 81 to 90, 91 to 100, 101 to 110, 111 to 120, 121 to 130, 131 to 140, 141 to 150, 151 to 160, 161 to 170, 171 to 180, 181 to 190, 191 to 200, or 201 to 207.
Embodiment 111
[0287] The tobacco plant, or part thereof, of Embodiment 107, wherein said second chromosomal deletion is flanked by and not comprising any two of Nic2 Marker Nos. 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 100, 101 to 120, 121 to 140, 141 to 160, 161 to 180, 181 to 200, 201 to 220, 221 to 240, 241 to 260, 261 to 280, 281 to 300, 301 to 320, or 321 to 340.
Embodiment 112
[0288] The tobacco plant, or part thereof, of Embodiment 107, wherein said second chromosomal deletion is flanked by and not comprising any two of Nic2 Marker Nos. 1 to 10, 11 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 81 to 90, 91 to 100, 101 to 110, 111 to 120, 121 to 130, 131 to 140, 141 to 150, 151 to 160, 161 to 170, 171 to 180, 181 to 190, 191 to 200, 201 to 210, 211 to 220, 221 to 230, 231 to 240, 241 to 250, 251 to 260, 261 to 270, 271 to 280, 281 to 290, 291 to 300, 301 to 310, 311 to 320, 321 to 330, or 331 to 340.
Embodiment 113
[0289] A tobacco plant, or part thereof, comprising a mutation selected from the group consisting of a first chromosomal deletion flanked by and not comprising any two of Nic1 Marker Nos. 1 to 207, a second chromosomal deletion flanked by and not comprising any two of Nic2 Marker Nos. 1 to 340, and both said first and said second chromosomal deletions, wherein said tobacco plant is capable of producing leaves having a USDA grade index value comparable to that of a control plant when grown in similar growth conditions, wherein said control plant shares an essentially identical genetic background with said tobacco plant except said mutation.
Embodiment 114
[0290] The tobacco plant, or part thereof, of Embodiment 113, wherein said tobacco plant comprises nicotine at a level below 1%, below 2%, below 5%, below 8%, below 10%, below 12%, below 15%, below 20%, below 25%, below 30%, below 40%, below 50%, below 60%, below 70%, or below 80% of the nicotine level of said control plant when grown in similar growth conditions.
Embodiment 115
[0291] A population of the tobacco plants of any one of Embodiments 107 to 114.
Embodiment 116
[0292] Cured tobacco material from the tobacco plant of any one of claims 107 to 114.
Embodiment 117
[0293] The cured tobacco material of Embodiment 116, wherein said cured tobacco material is made by a curing process selected from the group consisting of flue curing, air curing, fire curing, and sun curing.
Embodiment 118
[0294] A tobacco blend comprising the cured tobacco material of claim 116.
Embodiment 119
[0295] The tobacco blend of Embodiment 118, wherein the cured tobacco material constitutes about at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cured tobacco in said tobacco blend by weight.
Embodiment 120
[0296] The tobacco blend of Embodiment 118, wherein the cured tobacco material constitutes about at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of cured tobacco in said tobacco blend by volume.
Embodiment 121
[0297] A tobacco product comprising the cured tobacco material of claim 116.
Embodiment 122
[0298] The tobacco product of Embodiment 121, wherein the tobacco product is selected from the group consisting of a cigarette, a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
Embodiment 123
[0299] The tobacco product of Embodiment 121, wherein the smokeless tobacco product is selected from the group consisting of loose leaf chewing tobacco, plug chewing tobacco, moist snuff, and nasal snuff.
[0300] Having now generally described the disclosure, the same will be more readily understood through reference to the following examples that are provided by way of illustration, and are not intended to be limiting of the present disclosure, unless specified.
EXAMPLES
Example 1: Whole Genome Sequencing of Tobacco Lines Having Low Alkaloid
[0301] Whole genome sequencing was used to determine the genetic lesion underlying the nic1 mutation in Low Alkaloid (LA) Burley 21. Four tobacco lines were sequenced. These are LA Burley 21 (nic1 nic2, Average nicotine 0.3% on a dry weight basis (Range0.2-0.6%)), Low Intermediate (LI) Burley 21 (nic1 Nic2, Average nicotine 2.3% (Range1.5-3.0%)), High Intermediate (HI) Burley 21 (Nic1 nic2, Average nicotine 3.7% (Range2.5-5.0%)), and wild-type Burley 21 (also referred to as BU21) (Nic1 Nic2, Average nicotine 4.7% (Range4.0-6.0%)). LA Burley 21 (also referred to as LA BU21) is a low total alkaloid line produced by incorporation of a low alkaloid gene(s) from a Cuban cigar variety into Burley 21 through several backcrosses (Legg et al. 1970).
[0302] Genomic DNA samples were prepared from tobacco leaves. Green leaf tissue from three plants each belonging to BU21 and LA BU21, as well as the High and Low Intermediates (HI BU21 and LI BU21, respectively) were collected. The tissue was flash frozen in liquid nitrogen and stored at 80 C. The stored tissue was ground in liquid Nitrogen and equal amount of tissue from the three plants belonging to each of the four lines was pooled together (10 g total final weight) for sequencing.
[0303] DNA library preparation and sequencing were performed following standard industry protocols, which include, e.g., shearing of DNA to create paired end libraries with average insert size of 500 bp. The raw sequences were mapped to a proprietary TN90 genome, and Single Nucleotide Polymorphisms (SNPs) as well as Insertions and Deletions (InDels) were identified using a whole genome variant detection pipeline. The variant detection pipeline performs trimming and filtering of raw sequencing data based on sequence quality, followed by selection of reads with minimum length of 75 bp and maximum number of 2 unknown bases. These reads were then mapped to Altria's proprietary tobacco (TN90) genome using the software gaMap v2.0.0 (BETA). Only mapped reads with a quality score of at least 40 were further used in SNP and InDel detection using software gaVariant v.2.0.0 BETA. Only SNPs and InDels with a minimum variant quality of 37, genotype quality of 85 and a coverage depth of 7 were included for further analyses. The number of paired end sequencing reads, filtered reads, mapped reads, as well as percentage of mapped reads for each of the four lines are provided in Table 1. The mean coverage for the 4 varieties ranges between 22-40, which exceeds the recommended coverage for variant detection (approximately 20). Table 2 provides details on the number of SNPs and InDels detected in each of the four lines.
TABLE-US-00001 TABLE 1 Whole-genome sequencing statistics of the four sequenced Burley lines. Sample Raw reads Reads filtered reads mapped % Filtered % Mapped BU21 1,030,266,578 987,988,031 815,146,282 95.9 82.51 HI BU21 928,747,952 889,038,519 738,942,909 95.72 83.12 LI BU21 838,709,526 800,400,171 663,625,600 95.43 82.91 LA BU21 792,837,196 755,706,369 621,019,698 95.32 82.18 Total 3,590,561,252 3,433,133,090 2,838,734,489 95.59 82.68
TABLE-US-00002 TABLE 2 Genotyping statistics of the four sequenced Burley lines. Sample SNPs Insertions Deletions % SNPs % Insertions % Deletions BU21 2,349,123 304,814 397,514 76.984 9.98915 13.02705 HI BU21 2,253,395 292,635 386,493 76.842 9.97895 13.17954 LI BU21 2,138,321 276,921 371,838 76.723 9.93588 13.34149 LA BU21 2,083,729 265,561 358,655 76.949 9.80674 13.24455 Total 8,824,568 1,139,931 1,514,500 76.8745 9.92768 13.19816
Example 2: Analysis of the Genome Sequences to Identify Nic1 and Nic2 Loci
[0304] The genome sequences from Example 1 were analyzed to identify the nic1 and nic2 mutations in LA BU21. The sequences were first analyzed at Nic2 locus. The Nic2 locus was previously reported by Shoji et. al (2010) to comprise a deletion of 7 Ethylene Response Factor (ERF) genes. These deleted ERF genes were mapped to a single contiguous region of the TN90 genome. We scanned the sequencing data of BU21, HI BU21, LI BU21 and LA BU21 and identified that the variant profile in this region of the genome consists of homozygous reference (TN90) allele genotypes across BU21 and LI BU21, and missing data across HI BU21 and LA BU21. This indicates that Nic2 deletion is represented in the variant genotypes as missing data.
[0305] Previous literature suggests that Nic1 and Nic2 loci likely contain duplicated genes each originating from one of the progenitor species, Nicotiana tomentosiformis or N. sylvestris (Hibi et al., 1994). Further, Shoji et al. (2010) reported that Nic2 locus is derived from N. tomentosiformis, and that nic2 is a deletion. The similar nature of their origin suggested that nic1 may also be a deletion. A custom perl script was written to detect a pattern of homozygous or heterozygous reference allele calls in BU21 and HI BU21, and missing data in LI BU21 and LA BU21. The custom perl script detected a total of 14035 scaffolds with nearly 37916 variants sites total that match the pattern of missing data in LA BU21 and LI BU21 and homozygous genotypes in HI BU21 and BU21. The mean number of variants observed per scaffold is nearly 3 (2.701). One contiguous region or scaffold (Scaffold0002504, SEQ ID No: 1) contains 207 variant sites with this pattern (Table 3). Hence, this outlier scaffold has 76.67 times the number of variants with the specified pattern compared to the mean number of variants across the remaining scaffolds. Scaffold0002504 provides the first indication of the location of Nic1 locus.
[0306] Based on the coverage of the reads across scaffolds, no sequencing bias was observed to account for the absence of reads in LI BU21 and LA BU21. Further, at the known Nic2 locus (Scaffold0000549, SEQ ID No: 2), a similar pattern was observed where LA BU21 and HI BU21 show missing data and BU21 and LI BU21 show homozygous reference allele calls (340 sites on Scaffold0000549 compared to 2.49 sites observed in all scaffolds exhibiting such a pattern of variant sites) (Table 4).
TABLE-US-00003 TABLE3 PolymorphicsitesinaNicldeletionsegment, NT1.0-Scaffold0002504.POSindicatesthe nucleotidepositionofeachpolymorphicsiteon Scaffold0002504.REFreferstothesequenceof areferenceTN90allele.ALTreferstoasequence polymorphismfoundinK326,NarrowLeafMadole, orOrientaltype.0/0 referstohomozygousfor thereferenceTN90allelewhile./. refersto missingdata(e.g.,deletion). Nic1 Marker No. POS REF ALT BU21 HI LI LA 1 240 T A 0/0 0/0 ./. ./. 2 1750 CA C 0/0 0/0 ./. ./. 3 2064 G A 0/0 0/0 ./. ./. 4 2671 G A 0/0 0/0 ./. ./. 5 2678 G T 0/0 0/0 ./. ./. 6 5174 G T 0/0 0/0 ./. ./. 7 5176 A C 0/0 0/0 ./. ./. 8 5781 C T 0/0 0/0 ./. ./. 9 5812 A G 0/0 0/0 ./. ./. 10 6312 G T 0/0 0/0 ./. ./. 11 6349 T G 0/0 0/0 ./. ./. 12 6373 T C 0/0 0/0 ./. ./. 13 8028 T G 0/0 0/0 ./. ./. 14 12004 AT A 0/0 0/0 ./. ./. 15 12668 T C 0/0 0/0 ./. ./. 16 12939 A G 0/0 0/0 ./. ./. 17 13171 G T 0/0 0/0 ./. ./. 18 13644 G T 0/0 0/0 ./. ./. 19 14078 G A 0/0 0/0 ./. ./. 20 14085 T C 0/0 0/0 ./. ./. 21 29126 G T 0/0 0/0 ./. ./. 22 46969 G A 0/0 0/0 ./. ./. 23 54856 C T 0/0 0/0 ./. ./. 24 54923 T C 0/0 0/0 ./. ./. 25 63743 T C 0/0 0/0 ./. ./. 26 69020 G T 0/0 0/0 ./. ./. 27 78215 A G 0/0 0/0 ./. ./. 28 87817 T G 0/0 0/0 ./. ./. 29 91989 A G 0/0 0/0 ./. ./. 30 92936 C G 0/0 0/0 ./. ./. 31 104894 G T 0/0 0/0 ./. ./. 32 108471 A G 0/0 0/0 ./. ./. 33 108492 G A 0/0 0/0 ./. ./. 34 108503 A C 0/0 0/0 ./. ./. 35 109907 A C 0/0 0/0 ./. ./. 36 112193 A T 0/0 0/0 ./. ./. 37 114778 C T 0/0 0/0 ./. ./. 38 114852 C T 0/0 0/0 ./. ./. 39 117178 A G 0/0 0/0 ./. ./. 40 123634 G A 0/0 0/0 ./. ./. 41 130508 A G 0/0 0/0 ./. ./. 42 130966 T C 0/0 0/0 ./. ./. 43 131000 C T 0/0 0/0 ./. ./. 44 131045 C A 0/0 0/0 ./. ./. 45 134007 A G 0/0 0/0 ./. ./. 46 134046 A G 0/0 0/0 ./. ./. 47 136601 C T 0/0 0/0 ./. ./. 48 136884 GT G 0/0 0/0 ./. ./. 49 150080 G A 0/0 0/0 ./. ./. 50 150585 T A 0/0 0/0 ./. ./. 51 153975 T C 0/0 0/0 ./. ./. 52 159146 A G 0/0 0/0 ./. ./. 53 162586 C T 0/0 0/0 ./. ./. 54 163446 G A 0/0 0/0 ./. ./. 55 163641 T C 0/0 0/0 ./. ./. 56 167356 T C 0/0 0/0 ./. ./. 57 171095 A T 0/0 0/0 ./. ./. 58 181539 A G 0/0 0/0 ./. ./. 59 182327 C T 0/0 0/0 ./. ./. 60 190959 C T 0/0 0/0 ./. ./. 61 198368 G A 0/0 0/0 ./. ./. 62 198393 A G 0/0 0/0 ./. ./. 63 204573 G C 0/0 0/0 ./. ./. 64 205220 A G 0/0 0/0 ./. ./. 65 205252 C T 0/0 0/0 ./. ./. 66 206301 C A 0/0 0/0 ./. ./. 67 206500 G A 0/0 0/0 ./. ./. 68 206634 A C 0/0 0/0 ./. ./. 69 207061 A G 0/0 0/0 ./. ./. 70 207101 G A 0/0 0/0 ./. ./. 71 207131 T G 0/0 0/0 ./. ./. 72 207181 T A 0/0 0/0 ./. ./. 73 207204 C G 0/0 0/0 ./. ./. 74 207512 C A 0/0 0/0 ./. ./. 75 208518 A C 0/0 0/0 ./. ./. 76 208522 C T 0/0 0/0 ./. ./. 77 208556 T C 0/0 0/0 ./. ./. 78 208572 T C 0/0 0/0 ./. ./. 79 209297 T C 0/0 0/0 ./. ./. 80 209315 C T 0/0 0/0 ./. ./. 81 209661 C T 0/0 0/0 ./. ./. 82 209674 T C 0/0 0/0 ./. ./. 83 210485 T G 0/0 0/0 ./. ./. 84 211269 T C 0/0 0/0 ./. ./. 85 216116 C T 0/0 0/0 ./. ./. 86 222130 G A 0/0 0/0 ./. ./. 87 224309 G T 0/0 0/0 ./. ./. 88 224568 C T 0/0 0/0 ./. ./. 89 232343 C T 0/0 0/0 ./. ./. 90 238580 C T 0/0 0/0 ./. ./. 91 239069 T A 0/0 0/0 ./. ./. 92 242812 A T 0/0 0/0 ./. ./. 93 243675 A G 0/0 0/0 ./. ./. 94 244449 A G 0/0 0/0 ./. ./. 95 244950 T C 0/0 0/0 ./. ./. 96 245176 A G 0/0 0/0 ./. ./. 97 254755 G A 0/0 0/0 ./. ./. 98 255169 C T 0/0 0/0 ./. ./. 99 259166 G A 0/0 0/0 ./. ./. 100 271206 G A 0/0 0/0 ./. ./. 101 272201 T C 0/0 0/0 ./. ./. 102 273944 T C 0/0 0/0 ./. ./. 103 276518 C T 0/0 0/0 ./. ./. 104 276838 T A 0/0 0/0 ./. ./. 105 281675 G T 0/0 0/0 ./. ./. 106 284726 G T 0/0 0/0 ./. ./. 107 286609 C T 0/0 0/0 ./. ./. 108 286915 A G 0/0 0/0 ./. ./. 109 286966 T A 0/0 0/0 ./. ./. 110 286987 A G 0/0 0/0 ./. ./. 111 293036 A G 0/0 0/0 ./. ./. 112 300478 G T 0/0 0/0 ./. ./. 113 300631 C T 0/0 0/0 ./. ./. 114 300759 A T 0/0 0/0 ./. ./. 115 301119 G A 0/0 0/0 ./. ./. 116 303538 A C 0/0 0/0 ./. ./. 117 304744 A G 0/0 0/0 ./. ./. 118 306236 C T 0/0 0/0 ./. ./. 119 308259 C A 0/0 0/0 ./. ./. 120 313448 A G 0/0 0/0 ./. ./. 121 317046 C G 0/0 0/0 ./. ./. 122 318876 GGGG G 0/0 0/0 ./. ./. GGT 123 320878 G T 0/0 0/0 ./. ./. 124 321339 T G 0/0 0/0 ./. ./. 125 321361 A G 0/0 0/0 ./. ./. 126 321363 C T 0/0 0/0 ./. ./. 127 321532 A C 0/0 0/0 ./. ./. 128 324556 A G 0/0 0/0 ./. ./. 129 324990 G A 0/0 0/0 ./. ./. 130 329545 T A 0/0 0/0 ./. ./. 131 349886 T C 0/0 0/0 ./. ./. 132 350146 A C 0/0 0/0 ./. ./. 133 350163 A G 0/0 0/0 ./. ./. 134 350515 T G 0/0 0/0 ./. ./. 135 351620 A C 0/0 0/0 ./. ./. 136 353656 A G 0/0 0/0 ./. ./. 137 354639 CT C 0/0 0/0 ./. ./. 138 366150 AG A 0/0 0/0 ./. ./. 139 388388 T G 0/0 0/0 ./. ./. 140 390555 G A 0/0 0/0 ./. ./. 141 391708 C T 0/0 0/0 ./. ./. 142 392358 G C 0/0 0/0 ./. ./. 143 392712 T C 0/0 0/0 ./. ./. 144 401096 G T 0/0 0/0 ./. ./. 145 401445 G C 0/0 0/0 ./. ./. 146 404189 A C 0/0 0/0 ./. ./. 147 406610 T G 0/0 0/0 ./. ./. 148 407131 C T 0/0 0/0 ./. ./. 149 411268 A C 0/0 0/0 ./. ./. 150 412538 T A 0/0 0/0 ./. ./. 151 412550 G T 0/0 0/0 ./. ./. 152 413003 A C 0/0 0/0 ./. ./. 153 413373 A T 0/0 0/0 ./. ./. 154 413437 C T 0/0 0/0 ./. ./. 155 415425 A G 0/0 0/0 ./. ./. 156 415449 A C 0/0 0/0 ./. ./. 157 415458 T G 0/0 0/0 ./. ./. 158 417103 A C 0/0 0/0 ./. ./. 159 418099 G A 0/0 0/0 ./. ./. 160 418558 A G 0/0 0/0 ./. ./. 161 423778 T C 0/0 0/0 ./. ./. 162 430030 G T 0/0 0/0 ./. ./. 163 437935 T C 0/0 0/0 ./. ./. 164 440647 G A 0/0 0/0 ./. ./. 165 440664 C T 0/0 0/0 ./. ./. 166 442849 T A 0/0 0/0 ./. ./. 167 445778 A G 0/0 0/0 ./. ./. 168 446871 T C 0/0 0/0 ./. ./. 169 447998 A T 0/0 0/0 ./. ./. 170 450145 A G 0/0 0/0 ./. ./. 171 452523 A G 0/0 0/0 ./. ./. 172 452968 G A 0/0 0/0 ./. ./. 173 452987 T C 0/0 0/0 ./. ./. 174 453033 C T 0/0 0/0 ./. ./. 175 453112 G A 0/0 0/0 ./. ./. 176 453174 T C 0/0 0/0 ./. ./. 177 453188 G A 0/0 0/0 ./. ./. 178 454399 T C 0/0 0/0 ./. ./. 179 456245 A C 0/0 0/0 ./. ./. 180 466990 T C 0/0 0/0 ./. ./. 181 473415 C T 0/0 0/0 ./. ./. 182 479185 G A 0/0 0/0 ./. ./. 183 481321 T C 0/0 0/0 ./. ./. 184 481329 T C 0/0 0/0 ./. ./. 185 481922 T C 0/0 0/0 ./. ./. 186 485778 G A 0/0 0/0 ./. ./. 187 486466 A G 0/0 0/0 ./. ./. 188 487632 G A 0/0 0/0 ./. ./. 189 495057 TA T 0/0 0/0 ./. ./. 190 496107 G A 0/0 0/0 ./. ./. 191 496129 G T 0/0 0/0 ./. ./. 192 498389 C T 0/0 0/0 ./. ./. 193 502623 G T 0/0 0/0 ./. ./. 194 515727 T C 0/0 0/0 ./. ./. 195 517529 C T 0/0 0/0 ./. ./. 196 521866 T C 0/0 0/0 ./. ./. 197 525885 AAAA A 0/0 0/0 ./. ./. AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA CTTT (SEQID NO:71) 198 528989 A G 0/0 0/0 ./. ./. 199 542757 A G 0/0 0/0 ./. ./. 200 542859 C A 0/0 0/0 ./. ./. 201 543285 T C 0/0 0/0 ./. ./. 202 543440 G C 0/0 0/0 ./. ./. 203 543565 G A 0/0 0/0 ./. ./. 204 543749 C T 0/0 0/0 ./. ./. 205 543771 T C 0/0 0/0 ./. ./. 206 543941 C A 0/0 0/0 ./. ./. 207 543958 G C 0/0 0/0 ./. ./.
TABLE-US-00004 TABLE4 PolymorphicsitesinaNic2deletionsegment, NT1.0-Scaffold0000549.REFreferstothesequence ofareferenceTN90allele.ALTreferstoa sequencepolymorphismfoundinK326,NarrowLeaf Madole,orOrientaltype.0/0 refersto homozygousforthereferenceTN90alleleto missingdata(e.g.,deletion). while./. refers Nic2 Marker No. POS REF ALT BU21 HI LI LA 1 8514 T A 0/0 ./. 0/0 ./. 2 12287 A C 0/0 ./. 0/0 ./. 3 15020 C T 0/0 ./. 0/0 ./. 4 20105 C T 0/0 ./. 0/0 ./. 5 21133 G T 0/0 ./. 0/0 ./. 6 21182 A C 0/0 ./. 0/0 ./. 7 25267 T C 0/0 ./. 0/0 ./. 8 27211 A G 0/0 ./. 0/0 ./. 9 27965 T A 0/0 ./. 0/0 ./. 10 28780 A G 0/0 ./. 0/0 ./. 11 28800 G A 0/0 ./. 0/0 ./. 12 28976 T A 0/0 ./. 0/0 ./. 13 29013 G A 0/0 ./. 0/0 ./. 14 31000 C T 0/0 ./. 0/0 ./. 15 31074 T C 0/0 ./. 0/0 ./. 16 31118 A G 0/0 ./. 0/0 ./. 17 31136 G A 0/0 ./. 0/0 ./. 18 31930 T G 0/0 ./. 0/0 ./. 19 32523 A G 0/0 ./. 0/0 ./. 20 33617 A C 0/0 ./. 0/0 ./. 21 33661 A T 0/0 ./. 0/0 ./. 22 35656 T C 0/0 ./. 0/0 ./. 23 35674 C T 0/0 ./. 0/0 ./. 24 44008 C T 0/0 ./. 0/0 ./. 25 62895 T C 0/0 ./. 0/0 ./. 26 62916 G A 0/0 ./. 0/0 ./. 27 64381 A G 0/0 ./. 0/0 ./. 28 77284 A T 0/0 ./. 0/0 ./. 29 77363 A G 0/0 ./. 0/0 ./. 30 77909 G C 0/0 ./. 0/0 ./. 31 77975 A T 0/0 ./. 0/0 ./. 32 77985 A G 0/0 ./. 0/0 ./. 33 80196 C T 0/0 ./. 0/0 ./. 34 87731 C T 0/0 ./. 0/0 ./. 35 87799 G A 0/0 ./. 0/0 ./. 36 89358 G T 0/0 ./. 0/0 ./. 37 92022 T C 0/0 ./. 0/0 ./. 38 92542 C A 0/0 ./. 0/0 ./. 39 92675 C T 0/0 ./. 0/0 ./. 40 92695 G A 0/0 ./. 0/0 ./. 41 94612 C G 0/0 ./. 0/0 ./. 42 94683 C T 0/0 ./. 0/0 ./. 43 103131 G T 0/0 ./. 0/0 ./. 44 108577 A G 0/0 ./. 0/0 ./. 45 108967 G A 0/0 ./. 0/0 ./. 46 113914 T C 0/0 ./. 0/0 ./. 47 118142 A T 0/0 ./. 0/0 ./. 48 118151 T C 0/0 ./. 0/0 ./. 49 119780 A T 0/0 ./. 0/0 ./. 50 121195 G A 0/0 ./. 0/0 ./. 51 135236 G T 0/0 ./. 0/0 ./. 52 135239 C T 0/0 ./. 0/0 ./. 53 135401 T C 0/0 ./. 0/0 ./. 54 135683 T A 0/0 ./. 0/0 ./. 55 136546 C T 0/0 ./. 0/0 ./. 56 136553 T G 0/0 ./. 0/0 ./. 57 137241 G A 0/0 ./. 0/0 ./. 58 137643 CT C 0/0 ./. 0/0 ./. 59 138384 C G 0/0 ./. 0/0 ./. 60 138450 T C 0/0 ./. 0/0 ./. 61 138457 G A 0/0 ./. 0/0 ./. 62 138663 T C 0/0 ./. 0/0 ./. 63 138791 G A 0/0 ./. 0/0 ./. 64 152981 C T 0/0 ./. 0/0 ./. 65 152994 G A 0/0 ./. 0/0 ./. 66 158500 C T 0/0 ./. 0/0 ./. 67 159059 G A 0/0 ./. 0/0 ./. 68 159855 A C 0/0 ./. 0/0 ./. 69 162242 C A 0/0 ./. 0/0 ./. 70 162272 T C 0/0 ./. 0/0 ./. 71 162616 T C 0/0 ./. 0/0 ./. 72 162698 A T 0/0 ./. 0/0 ./. 73 163071 T C 0/0 ./. 0/0 ./. 74 163389 T A 0/0 ./. 0/0 ./. 75 163549 C T 0/0 ./. 0/0 ./. 76 169105 A C 0/0 ./. 0/0 ./. 77 169578 A G 0/0 ./. 0/0 ./. 78 170180 G A 0/0 ./. 0/0 ./. 79 170221 G T 0/0 ./. 0/0 ./. 80 170292 A G 0/0 ./. 0/0 ./. 81 176741 TG T 0/0 ./. 0/0 ./. 82 177610 G A 0/0 ./. 0/0 ./. 83 189973 C A 0/0 ./. 0/0 ./. 84 190622 T C 0/0 ./. 0/0 ./. 85 192179 T C 0/0 ./. 0/0 ./. 86 192203 A G 0/0 ./. 0/0 ./. 87 192520 G A 0/0 ./. 0/0 ./. 88 198596 A T 0/0 ./. 0/0 ./. 89 210148 C T 0/0 ./. 0/0 ./. 90 211238 A G 0/0 ./. 0/0 ./. 91 211276 G A 0/0 ./. 0/0 ./. 92 211298 C T 0/0 ./. 0/0 ./. 93 213281 C G 0/0 ./. 0/0 ./. 94 221865 T G 0/0 ./. 0/0 ./. 95 224164 T A 0/0 ./. 0/0 ./. 96 226470 A G 0/0 ./. 0/0 ./. 97 228965 C A 0/0 ./. 0/0 ./. 98 230571 G A 0/0 ./. 0/0 ./. 99 232100 C G 0/0 ./. 0/0 ./. 100 232459 G A 0/0 ./. 0/0 ./. 101 234537 C T 0/0 ./. 0/0 ./. 102 241822 G A 0/0 ./. 0/0 ./. 103 244741 C T 0/0 ./. 0/0 ./. 104 246403 G A 0/0 ./. 0/0 ./. 105 246519 C T 0/0 ./. 0/0 ./. 106 247174 G A 0/0 ./. 0/0 ./. 107 252132 G A 0/0 ./. 0/0 ./. 108 252717 T C 0/0 ./. 0/0 ./. 109 252728 T C 0/0 ./. 0/0 ./. 110 255099 A G 0/0 ./. 0/0 ./. 111 257486 C T 0/0 ./. 0/0 ./. 112 258008 C A 0/0 ./. 0/0 ./. 113 258101 G A 0/0 ./. 0/0 ./. 114 260634 C T 0/0 ./. 0/0 ./. 115 260944 C T 0/0 ./. 0/0 ./. 116 261816 T C 0/0 ./. 0/0 ./. 117 264558 T C 0/0 ./. 0/0 ./. 118 265660 G A 0/0 ./. 0/0 ./. 119 275884 A G 0/0 ./. 0/0 ./. 120 277012 A G 0/0 ./. 0/0 ./. 121 278708 A G 0/0 ./. 0/0 ./. 122 278762 T C 0/0 ./. 0/0 ./. 123 278781 G T 0/0 ./. 0/0 ./. 124 281156 A C 0/0 ./. 0/0 ./. 125 282192 G T 0/0 ./. 0/0 ./. 126 285956 A G 0/0 ./. 0/0 ./. 127 286075 A G 0/0 ./. 0/0 ./. 128 290957 G T 0/0 ./. 0/0 ./. 129 295851 C A 0/0 ./. 0/0 ./. 130 297396 G C 0/0 ./. 0/0 ./. 131 298942 G T 0/0 ./. 0/0 ./. 132 299095 A G 0/0 ./. 0/0 ./. 133 300592 C T 0/0 ./. 0/0 ./. 134 301121 C G 0/0 ./. 0/0 ./. 135 301147 C T 0/0 ./. 0/0 ./. 136 306986 G A 0/0 ./. 0/0 ./. 137 310002 C T 0/0 ./. 0/0 ./. 138 314892 C T 0/0 ./. 0/0 ./. 139 324211 G A 0/0 ./. 0/0 ./. 140 327796 T G 0/0 ./. 0/0 ./. 141 330726 A G 0/0 ./. 0/0 ./. 142 331046 G A 0/0 ./. 0/0 ./. 143 332636 T C 0/0 ./. 0/0 ./. 144 336046 G C 0/0 ./. 0/0 ./. 145 338147 C A 0/0 ./. 0/0 ./. 146 340868 C T 0/0 ./. 0/0 ./. 147 341170 T A 0/0 ./. 0/0 ./. 148 359439 T A 0/0 ./. 0/0 ./. 149 359447 C A 0/0 ./. 0/0 ./. 150 362131 A G 0/0 ./. 0/0 ./. 151 363467 G A 0/0 ./. 0/0 ./. 152 365467 T A 0/0 ./. 0/0 ./. 153 367311 A G 0/0 ./. 0/0 ./. 154 370267 G A 0/0 ./. 0/0 ./. 155 384941 A G 0/0 ./. 0/0 ./. 156 393244 G T 0/0 ./. 0/0 ./. 157 394169 T C 0/0 ./. 0/0 ./. 158 394200 A G 0/0 ./. 0/0 ./. 159 394213 A C 0/0 ./. 0/0 ./. 160 394228 G A 0/0 ./. 0/0 ./. 161 396927 C T 0/0 ./. 0/0 ./. 162 404142 T C 0/0 ./. 0/0 ./. 163 404761 A G 0/0 ./. 0/0 ./. 164 406475 G A 0/0 ./. 0/0 ./. 165 406481 T A 0/0 ./. 0/0 ./. 166 410940 G A 0/0 ./. 0/0 ./. 167 411032 G A 0/0 ./. 0/0 ./. 168 411069 T A 0/0 ./. 0/0 ./. 169 411317 GA G 0/0 ./. 0/0 ./. 170 413027 C A 0/0 ./. 0/0 ./. 171 413058 C T 0/0 ./. 0/0 ./. 172 414268 C G 0/0 ./. 0/0 ./. 173 416798 T C 0/0 ./. 0/0 ./. 174 417540 G C 0/0 ./. 0/0 ./. 175 420742 A G 0/0 ./. 0/0 ./. 176 421259 T C 0/0 ./. 0/0 ./. 177 426709 A G 0/0 ./. 0/0 ./. 178 427690 G C 0/0 ./. 0/0 ./. 179 430705 G A 0/0 ./. 0/0 ./. 180 431773 G A 0/0 ./. 0/0 ./. 181 433900 A G 0/0 ./. 0/0 ./. 182 442372 T C 0/0 ./. 0/0 ./. 183 451131 G A 0/0 ./. 0/0 ./. 184 454572 C A 0/0 ./. 0/0 ./. 185 460976 G A 0/0 ./. 0/0 ./. 186 461460 C T 0/0 ./. 0/0 ./. 187 464177 A G 0/0 ./. 0/0 ./. 188 465089 T C 0/0 ./. 0/0 ./. 189 465495 T G 0/0 ./. 0/0 ./. 190 468266 C A 0/0 ./. 0/0 ./. 191 474980 C T 0/0 ./. 0/0 ./. 192 480131 A T 0/0 ./. 0/0 ./. 193 483164 T C 0/0 ./. 0/0 ./. 194 484777 A G 0/0 ./. 0/0 ./. 195 485948 G A 0/0 ./. 0/0 ./. 196 486626 G C 0/0 ./. 0/0 ./. 197 494004 C T 0/0 ./. 0/0 ./. 198 494393 T C 0/0 ./. 0/0 ./. 199 495953 C T 0/0 ./. 0/0 ./. 200 496552 A G 0/0 ./. 0/0 ./. 201 499298 A G 0/0 ./. 0/0 ./. 202 499947 T C 0/0 ./. 0/0 ./. 203 501352 G A 0/0 ./. 0/0 ./. 204 505470 A G 0/0 ./. 0/0 ./. 205 509926 G A 0/0 ./. 0/0 ./. 206 511336 A G 0/0 ./. 0/0 ./. 207 513808 TC T 0/0 ./. 0/0 ./. 208 515055 C T 0/0 ./. 0/0 ./. 209 516444 A G 0/0 ./. 0/0 ./. 210 519420 A T 0/0 ./. 0/0 ./. 211 521028 G C 0/0 ./. 0/0 ./. 212 521834 T C 0/0 ./. 0/0 ./. 213 524240 A C 0/0 ./. 0/0 ./. 214 524256 T C 0/0 ./. 0/0 ./. 215 524317 A G 0/0 ./. 0/0 ./. 216 524986 G A 0/0 ./. 0/0 ./. 217 526266 A C 0/0 ./. 0/0 ./. 218 526905 C T 0/0 ./. 0/0 ./. 219 526987 C A 0/0 ./. 0/0 ./. 220 530341 A G 0/0 ./. 0/0 ./. 221 531695 A T 0/0 ./. 0/0 ./. 222 541587 T C 0/0 ./. 0/0 ./. 223 541648 G A 0/0 ./. 0/0 ./. 224 544386 A G 0/0 ./. 0/0 ./. 225 545716 T C 0/0 ./. 0/0 ./. 226 546047 C A 0/0 ./. 0/0 ./. 227 546372 A G 0/0 ./. 0/0 ./. 228 546416 A G 0/0 ./. 0/0 ./. 229 546434 T A 0/0 ./. 0/0 ./. 230 546775 C T 0/0 ./. 0/0 ./. 231 547015 A G 0/0 ./. 0/0 ./. 232 554248 A G 0/0 ./. 0/0 ./. 233 554496 C T 0/0 ./. 0/0 ./. 234 556239 A G 0/0 ./. 0/0 ./. 235 558480 C T 0/0 ./. 0/0 ./. 236 562524 C T 0/0 ./. 0/0 ./. 237 563642 A T 0/0 ./. 0/0 ./. 238 563802 T A 0/0 ./. 0/0 ./. 239 563862 G T 0/0 ./. 0/0 ./. 240 573521 C T 0/0 ./. 0/0 ./. 241 573552 T C 0/0 ./. 0/0 ./. 242 574370 C A 0/0 ./. 0/0 ./. 243 576866 C T 0/0 ./. 0/0 ./. 244 577137 C T 0/0 ./. 0/0 ./. 245 582336 T A 0/0 ./. 0/0 ./. 246 585822 G A 0/0 ./. 0/0 ./. 247 586808 A G 0/0 ./. 0/0 ./. 248 592379 A C 0/0 ./. 0/0 ./. 249 594088 T C 0/0 ./. 0/0 ./. 250 594122 T A 0/0 ./. 0/0 ./. 251 594128 C A 0/0 ./. 0/0 ./. 252 596697 T C 0/0 ./. 0/0 ./. 253 599034 G C 0/0 ./. 0/0 ./. 254 609636 T C 0/0 ./. 0/0 ./. 255 610500 C T 0/0 ./. 0/0 ./. 256 610533 T A 0/0 ./. 0/0 ./. 257 610938 A G 0/0 ./. 0/0 ./. 258 614216 A G 0/0 ./. 0/0 ./. 259 614885 TTA T 0/0 ./. 0/0 ./. 260 617065 G A 0/0 ./. 0/0 ./. 261 621974 G A 0/0 ./. 0/0 ./. 262 623585 T G 0/0 ./. 0/0 ./. 263 645256 C G 0/0 ./. 0/0 ./. 264 645263 T C 0/0 ./. 0/0 ./. 265 646476 C T 0/0 ./. 0/0 ./. 266 652446 AT A 0/0 ./. 0/0 ./. 267 660505 C T 0/0 ./. 0/0 ./. 268 667339 G A 0/0 ./. 0/0 ./. 269 668081 A G 0/0 ./. 0/0 ./. 270 669231 T G 0/0 ./. 0/0 ./. 271 680482 G A 0/0 ./. 0/0 ./. 272 680899 T C 0/0 ./. 0/0 ./. 273 681503 A G 0/0 ./. 0/0 ./. 274 681579 TA T 0/0 ./. 0/0 ./. 275 685669 G A 0/0 ./. 0/0 ./. 276 687781 T C 0/0 ./. 0/0 ./. 277 690142 C T 0/0 ./. 0/0 ./. 278 696619 G A 0/0 ./. 0/0 ./. 279 696973 C T 0/0 ./. 0/0 ./. 280 699014 T C 0/0 ./. 0/0 ./. 281 699059 A G 0/0 ./. 0/0 ./. 282 699441 A G 0/0 ./. 0/0 ./. 283 699482 A G 0/0 ./. 0/0 ./. 284 699507 A C 0/0 ./. 0/0 ./. 285 699568 AC A 0/0 ./. 0/0 ./. 286 699991 C T 0/0 ./. 0/0 ./. 287 701221 G A 0/0 ./. 0/0 ./. 288 701338 C T 0/0 ./. 0/0 ./. 289 704968 A G 0/0 ./. 0/0 ./. 290 705347 C T 0/0 ./. 0/0 ./. 291 708907 T C 0/0 ./. 0/0 ./. 292 710281 C T 0/0 ./. 0/0 ./. 293 711996 T C 0/0 ./. 0/0 ./. 294 714019 C A 0/0 ./. 0/0 ./. 295 714445 T C 0/0 ./. 0/0 ./. 296 714483 T C 0/0 ./. 0/0 ./. 297 714491 T C 0/0 ./. 0/0 ./. 298 716492 A G 0/0 ./. 0/0 ./. 299 716551 A G 0/0 ./. 0/0 ./. 300 721681 G A 0/0 ./. 0/0 ./. 301 722271 T A 0/0 ./. 0/0 ./. 302 723002 G C 0/0 ./. 0/0 ./. 303 732955 T C 0/0 ./. 0/0 ./. 304 734117 T G 0/0 ./. 0/0 ./. 305 743601 TA T 0/0 ./. 0/0 ./. 306 745383 C T 0/0 ./. 0/0 ./. 307 745938 C T 0/0 ./. 0/0 ./. 308 747238 T C 0/0 ./. 0/0 ./. 309 750673 A G 0/0 ./. 0/0 ./. 310 751683 G T 0/0 ./. 0/0 ./. 311 751702 C T 0/0 ./. 0/0 ./. 312 762212 A G 0/0 ./. 0/0 ./. 313 762934 C T 0/0 ./. 0/0 ./. 314 765864 C T 0/0 ./. 0/0 ./. 315 768978 G A 0/0 ./. 0/0 ./. 316 770377 T A 0/0 ./. 0/0 ./. 317 773111 G A 0/0 ./. 0/0 ./. 318 773112 T A 0/0 ./. 0/0 ./. 319 773155 A T 0/0 ./. 0/0 ./. 320 778101 C A 0/0 ./. 0/0 ./. 321 778231 T A 0/0 ./. 0/0 ./. 322 779756 C T 0/0 ./. 0/0 ./. 323 780381 A G 0/0 ./. 0/0 ./. 324 780398 A C 0/0 ./. 0/0 ./. 325 782275 A C 0/0 ./. 0/0 ./. 326 782502 T G 0/0 ./. 0/0 ./. 327 788379 A G 0/0 ./. 0/0 ./. 328 788416 T A 0/0 ./. 0/0 ./. 329 789721 C T 0/0 ./. 0/0 ./. 330 795120 G A 0/0 ./. 0/0 ./. 331 797627 G A 0/0 ./. 0/0 ./. 332 799891 A C 0/0 ./. 0/0 ./. 333 800525 A G 0/0 ./. 0/0 ./. 334 801525 T C 0/0 ./. 0/0 ./. 335 802686 ATGC A 0/0 ./. 0/0 ./. CATG TGGT TTAT ATTA TTGG CACG TGAG TTGT CCGT GCGA GTCC AGAT ATTT ATAC TATA GC (SEQ ID NO: 72) 336 802777 A T 0/0 ./. 0/0 ./. 337 807008 T C 0/0 ./. 0/0 ./. 338 808634 T G 0/0 ./. 0/0 ./. 339 813994 G A 0/0 ./. 0/0 ./. 340 817957 A G 0/0 ./. 0/0 ./.
Example 3: Confirmation of the Identified Nic1 Locus by Genetic Segregation Analysis
[0307] To help confirm the identity of the region identified as Nic1 locus, an F.sub.2 population segregating for Nic1 and Nic2 loci was developed with the aim of observing markers for nic1 and nic2 segregating with the phenotype. The F.sub.2 population was developed from a cross between TN90 with LA BU21, and has a population size of 173. DNA was extracted from green leaf tissue of individual F.sub.2 plants as well as the parental lines and the four known Burley lines (BU21, HI BU21, LI BU21, and LA BU21) using a customized sbeadex maxi plant kit (LGC genomics, LLC, Beverly, Mass.) on the automated DNA extraction instrument, Oktopure (LGC genomics, LLC, Beverly, Mass.). Ninety (90) out of the 173 individuals were randomly chosen from this population to be genotyped at both Nic1 and Nic2 locus along with a control locus. The identified Nic1 deletion was confirmed by PCR amplification of a selected region of the identified deletion. PCR primers were designed for the Nic1 locus using Primer3 web V. 4.0.0 and are shown in Table 5. Primer sequences for Nic2 locus, and the control locus were obtained from Shoji et al. (2010), and are also provided in Table 5.
[0308] PCR was performed in a 30 L reaction with 5 l of 10 ng/l DNA, 15 l of 2 AmpliTaq Gold 360 MasterMix (Applied Biosystems, Foster City, Calif.), 1.2 l of 10 M Forward primer, 1.2 l of 10 M Reverse primer, and 7.6 l of ddH.sub.2O. PCR reactions proceeded with an initial denaturation at 95 C. for 5 min, followed by 35 cycles, with a temperature profile of 94 C. for 20 s, 20 s at the optimal annealing temperature (Table 5), and 72 C. for 1 minute. This was followed by a 7-minute final elongation period at 72 C., and an indefinite hold at 4 C.
TABLE-US-00005 TABLE5 TablelistingprimersequencesandannealingtemperatureusedforPCR PCR Locus SpecificGene Primer PrimerSequence(SEQID) Tm Nic1 g100614_ F CAACCTAGCCACTGGTCCAT 62 Scaffold0002504 (SEQIDNo:3) R TCAAACCAAGAGCGAGGAGT (SEQIDNo:4) Nic2 ERF189 F GGGCAATGGAAATGAATCTAGC 55 (SEQIDNo:5) R CTTCCTTCCTTTCACATAG (SEQIDNo:6) Control ERF199 F CCATTCATTTTCATCCAAACCC 55 (SEQIDNo:7) R CGGAGTACTTTTCATGGGATTC (SEQIDNo:8)
[0309] PCR products were then visualized on eGene (Qiagen N. V., Venlo, Netherlands), with presence of a PCR product band of desirable size scored as presence of a locus and its absence noted as deletion of the locus. The primer for gene ERF199 (Table 5) served as control, and its absence indicated issues with DNA quality and if absent the sample was removed from further analyses. Alkaloid measurements of nicotine, nornicotine, anatabine and anabasin were also made on each individual plant from leaf samples collected 2 weeks after topping (Table 6), using a GC-FID method based on CORESTA Recommended Methods (CRM NO. 7) and ISO Standards (ISO TC 126N 394 E.). Alkaloid measurements served as an additional confirmation for the nic1 and nic2 genotype.
[0310] All 90 F.sub.2 individuals as well as TN90, BU21, HI BU21, LI BU21 and LA BU21 showed successful amplification of the control ERF 199 primers. A deletion of Nic2 locus was observed in 19 out of the 90 F.sub.2 individuals, as well as in HI BU21 and LA BU21. A deletion of Nic1 locus was seen in 21 out of the 90 F.sub.2 individuals, as well as in LI BU21 and LA BU21. Also, both Nic1 and Nic2 loci were seen to be deleted in 5 out of the 90 F.sub.2 plants, along with LA BU21. Table 6 provides information on the genotype calls for 90 out of the 173 F.sub.2 individual. Table 7 provides the observed and expected number of plants for each genotype given a segregation ratio of 9:3:3:1 for the two loci. Average percent total alkaloid levels for each of the four genotypes observed in the F.sub.2 segregating population ((LA Burley 21TN 90 LC) (X)) are shown in Table 8.
TABLE-US-00006 TABLE 6 Nic1 and Nic 2 genotypes and alkaloid measurements of individual plants of the F.sub.2 population segregating for nic1 and nic2 ((LA Burley 21 TN 90 LC) (X)). Nic1 Genotype Nic2 Genotype Percent (Present = 1, (Present = 1, Total Percent Plant Absent = 0) Absent = 0) Alkaloid Nicotine Plant 1 1 0 3.0011 2.8628 Plant 2 1 1 2.6729 2.5628 Plant 3 0 1 2.2933 2.2051 Plant 4 0 0 BLQ BLQ Plant 5 1 1 3.1597 3.0139 Plant 6 1 1 2.9731 2.8266 Plant 7 0 0 BLQ BLQ Plant 8 1 1 2.8809 2.763 Plant 9 1 1 4.1221 3.9034 Plant 10 1 1 3.994 3.8198 Plant 11 1 1 3.7119 3.5467 Plant 12 1 1 3.6687 3.5089 Plant 13 1 1 4.2203 4.0304 Plant 14 1 0 3.2027 3.0498 Plant 15 1 1 3.7481 3.5971 Plant 16 0 1 BLQ BLQ Plant 17 1 1 4.422 4.1744 Plant 18 1 1 2.8292 2.7127 Plant 19 1 0 2.7538 2.6094 Plant 20 1.9167 1.8179 Plant 21 1 1 4.3081 4.0381 Plant 22 1 1 3.6128 3.4443 Plant 23 1 1 BLQ BLQ Plant 24 1 1 BLQ BLQ Plant 25 0 1 1.9377 1.8346 Plant 26 1 1 2.8042 2.6369 Plant 27 1 1 3.2544 3.1033 Plant 28 1 1 3.4886 3.3306 Plant 29 1 1 2.7115 2.5954 Plant 30 1 1 BLQ BLQ Plant 31 1 1 4.1091 3.9219 Plant 32 1 1 3.2426 3.1062 Plant 33 0 1 1.9005 1.7845 Plant 34 BLQ BLQ Plant 35 0 1 3.0363 2.8753 Plant 36 1 1 3.6491 3.4489 Plant 37 0 1 1.7179 1.6199 Plant 38 1 0 2.8954 2.7684 Plant 39 1 1 3.5936 3.4294 Plant 40 0 1 2.8582 2.7421 Plant 41 1 0 BLQ BLQ Plant 42 4.4196 4.2055 Plant 43 BLQ BLQ Plant 44 0 1 1.6122 1.5324 Plant 45 1 1 2.4573 2.3326 Plant 46 1 1 3.4145 3.1655 Plant 47 1 1 3.5314 3.3588 Plant 48 1 1 3.7216 3.5305 Plant 49 1 0 3.9067 3.7233 Plant 50 1 0 3.0601 2.9073 Plant 51 1 1 3.8504 3.6463 Plant 52 0 1 BLQ BLQ Plant 53 1 1 4.759 4.47 Plant 54 3.6204 3.4389 Plant 55 0 0 0.5823 0.5489 Plant 56 1 1 3.5092 3.3467 Plant 57 4.107 3.9257 Plant 58 0 1 2.4405 2.3477 Plant 59 0 0 0.4188 0.3927 Plant 60 1 1 3.8854 3.7403 Plant 61 1 1 5.0457 4.8093 Plant 62 0 1 2.1401 2.0358 Plant 63 1 1 3.5212 3.3729 Plant 64 1 1 5.1868 4.9157 Plant 65 2.1012 1.9855 Plant 66 1 0 0.3436 0.3282 Plant 67 2.3158 2.2265 Plant 68 1 1 4.5611 4.3195 Plant 69 1 0 3.5517 3.4176 Plant 70 1 1 3.945 3.7651 Plant 71 0 1 3.8097 3.6456 Plant 72 1 0 4.1787 3.9818 Plant 73 1 0 5.8965 5.5549 Plant 74 3.5723 3.393 Plant 75 1 1 5.6703 5.3808 Plant 76 1 1 3.1131 2.9747 Plant 77 1 1 4.2168 4.0215 Plant 78 0 1 2.9419 2.79 Plant 79 1 1 4.2109 3.9834 Plant 80 4.3812 4.1685 Plant 81 1 0 0.7258 0.6868 Plant 82 1 0 4.0284 3.8092 Plant 83 0 1 2.076 1.9724 Plant 84 1 1 5.1348 4.8334 Plant 85 1 1 5.6781 5.3311 Plant 86 1 1 4.3462 4.1069 Plant 87 1 1 4.0997 3.8974 Plant 88 1 1 3.47 3.3158 Plant 89 0 1 2.7871 2.6465 Plant 90 3.5846 3.4166 Plant 91 2.3103 2.187 Plant 92 2.8975 2.7746 Plant 93 3.5385 3.3521 Plant 94 5.2231 4.9531 Plant 95 0.5855 0.5538 Plant 96 2.6133 2.4813 Plant 97 4.3772 4.1254 Plant 98 5.453 5.0786 Plant 99 3.5055 3.2963 Plant 100 2.0902 1.9902 Plant 101 4.5207 4.2845 Plant 102 2.0429 1.943 Plant 103 BLQ BLQ Plant 104 3.448 3.3 Plant 105 4.3806 4.1605 Plant 106 4.3696 4.1293 Plant 107 4.0754 3.8637 Plant 108 4.1516 3.8525 Plant 109 3.6425 3.4421 Plant 110 4.5431 4.3192 Plant 111 4.4435 4.1513 Plant 112 3.9523 3.737 Plant 113 3.4997 3.3269 Plant 114 3.8171 3.638 Plant 115 3.4582 3.3031 Plant 116 1 1 3.5845 3.4243 Plant 117 3.945 3.7507 Plant 118 0 1 2.5889 2.4632 Plant 119 1 1 3.5472 3.3747 Plant 120 0 1 2.4497 2.3085 Plant 121 1 1 4.1965 3.9772 Plant 122 1 0 3.8719 3.6731 Plant 123 1 1 4.5964 4.3886 Plant 124 1 1 3.8232 3.667 Plant 125 4.7023 4.4466 Plant 126 3.4026 3.2343 Plant 127 3.2645 3.1016 Plant 128 2.842 2.7461 Plant 129 3.8524 3.6496 Plant 130 4.7094 4.4891 Plant 131 0.4548 0.4254 Plant 132 3.3652 3.211 Plant 133 3.2598 3.1137 Plant 134 BLQ BLQ Plant 135 3.3438 3.2074 Plant 136 3.7641 3.5279 Plant 137 3.6367 3.4453 Plant 138 0 0 0.4207 0.3995 Plant 139 2.2626 2.0909 Plant 140 4.102 3.8806 Plant 141 4.4366 4.2298 Plant 142 4.386 4.1759 Plant 143 5.7992 5.4971 Plant 144 BLQ BLQ Plant 145 2.8282 2.6992 Plant 146 2.7978 2.6543 Plant 147 3.6949 3.5188 Plant 148 2.3355 2.2257 Plant 149 1.7436 1.6735 Plant 150 BLQ BLQ Plant 151 1.2908 1.2512 Plant 152 2.09 1.999 Plant 153 3.2661 3.1309 Plant 154 BLQ BLQ Plant 155 2.9794 2.8095 Plant 156 5.3031 5.0703 Plant 157 3.6654 3.4826 Plant 158 3.7191 3.5198 Plant 159 3.5148 3.359 Plant 160 3.0729 2.9446 Plant 161 4.0171 3.8311 Plant 162 2.4201 2.3083 Plant 163 4.4837 4.2994 Plant 164 3.5759 3.4229 Plant 165 3.8303 3.6354 Plant 166 4.0415 3.8397 Plant 167 2.3684 2.2563 Plant 168 3.5194 3.3464 Plant 169 4.3816 4.1756 Plant 170 3.7741 3.5736 Plant 171 2.1715 2.0453 Plant 172 6.5454 6.1323 Plant 173 6.9723 6.6948 The absence of Nic1 and Ni2 genotype information indicate that those plants were not genotyped. BLQ: below level of quantification.
TABLE-US-00007 TABLE 7 The observed segregation ratio for nic1 and nic2 in the studied F.sub.2 population are not significantly different from the expected segregation ratio of 9:3:3:1 at a significance threshold of 0.05 (.sup.2 = 0.9827, df = 3, P value = 0.1944). Number Number Ratio of Plants of Plants Genotype Expected Expected Observed Nic1 Nic2 9/16 50.625 55 Nic1 nic2 3/16 16.875 14 nic1 Nic2 3/16 16.875 16 nic1 nic2 1/16 5.625 5
TABLE-US-00008 TABLE 8 Average percent total alkaloid levels for each of the four genotypes observed in the F.sub.2 segregating population ((LA Burley 21 TN 90 LC) (X)). Both the mean and standard deviation are shown. Number indicates the number of plants for each genotype for which alkaloid levels were measured. The number of plants for each genotype differs from those listed in Table 7 because plants with alkaloid levels below level of quantification (BLQ) are excluded here. Std Err Lower Upper Genotype Number Mean Std Dev Mean 95% 95% Nic1 Nic2 49 3.8419 0.74094 0.10585 3.6291 4.0547 Nic1 nic2 13 3.18588 1.43233 0.39726 2.3203 4.0514 nic1 Nic2 15 2.43933 0.58525 0.15111 2.1152 2.7634 nic1 nic2 3 0.47393 0.09385 0.05419 0.2408 0.7071
Example 4: Identification of Genes in Nic1 Deletion Based on the Expression Pattern of Genes in the Identified Nic1 Deletion Segment
[0311] The identified Nic1 deletion segment, NT1.0-Scaffold0002504, has at least 20 annotated genes. Their expression patterns were analyzed in tobacco roots based on a Root RNASeq dataset. The Root RNASeq dataset were constructed based on RNA-sequencing and transcriptional profiling of root tissues from four varieties: BU21, HI BU21, LI BU21 and LA BU21.
[0312] Tobacco plants of these four varieties were grown in the greenhouse until a majority of the lines started budding, and then root and leaf tissue samples were harvested. Root tissue (100 mg) from 15 plants each of the four varieties, from untopped plants and topped plants were collected. Table 9 provides details of the number of samples, time points and conditions at which sample was collected from these plants. Roots from each genotype were harvested at various time points. RNA was extracted from the roots and pooled together to form two separate pooled samples for each genotype; one before topping and one after. Specifically, tobacco roots were flash frozen in liquid nitrogen and then macerated using 2000 Geno/Grinder Spex sample prep. The macerated tissue was further used for RNA extraction on the automated Maxwell 16 systems (Promega, Madison, Wis.), using the tissue RNA extraction kit (Promega, Madison, Wis.). The isolated RNA was quantified using a Nanodrop1000 to confirm that all samples met the minimum yield required for 2100 bp paired end sequencing using HiSeq2000.
[0313] After sequencing, the raw RNASeq reads were trimmed and further filtered. The filtered RNASeq reads were then mapped to ALCS's proprietary tobacco genome using the transcriptome mapping application in CLC genomics workbench v.7.1 (Qiagen, N.V., Velno, The Netherlands). The raw expression of a gene is measured as the number of mapped reads for each of the 204,695 annotated genes within the tobacco genome. The gene expression value for each gene was then normalized using the reads per kilobase of transcript per million mapped reads (RPKM) values to obtain relative levels of gene expression.
[0314] Among the 20 genes annotated in the identified Nic1 deletion segment, NT1.0-Scaffold0002504, 18 genes show no expression in any of the varieties at any condition. Only 2 genes were expressed in the root (Table 10). They are g100614_Scaffold0002504 and g100631 Scaffold0002504 (having genomic sequences of SEQ ID NOs: 28 and 13, cDNA sequences of SEQ ID NOs: 48 and 33, protein sequences of SEQ ID NOs: 68 and 53, respectively). Both expressed genes are annotated as late blight resistance protein homolog. Similar expression patterns were also observed for genes at Nic2 locus (Table 11).
TABLE-US-00009 TABLE 9 Tissue sampling designs for RNAseq-based transcriptional profiling of tobacco roots. Number of plants sampled Time point Genotype Condition 30 mins 2 hrs 6 hrs 24 hrs 72 hrs Burley 21 Before Topping 3 3 3 3 3 After Topping 3 3 3 3 3 HI Before Topping 3 3 3 3 3 Burley 21 After Topping 3 3 3 3 3 LI Before Topping 3 3 3 3 3 Burley 21 After Topping 3 3 3 3 3 LA Before Topping 3 3 3 3 3 Burley 21 After Topping 3 3 3 3 3
Example 5: Identification of Genes Regulated by Nic1 and Nic2
[0315] The Root RNASeq dataset from Example 4 also allowed the identification of genes, the expression of which is regulated by Nic1 or Nic2. Pairwise comparisons of gene expression in four varieties: BU21, HI BU21, LI BU21 and LA BU21 were performed.
[0316] The comparisons of BU21 vs LA BU21 and that of HI BU21 vs LA BU21 are the most informative, with identification of all genes in the Nicotine biosynthesis pathway post formation of Putrescine. The effects of Nic1 locus (present in BU21 and HI BU21, but absent in LA BU21) were also confirmed.
Example 6: Development of Molecular Markers at or Near Nic1 and Nic2 Deletion Segments
[0317] The identified Nic1 deletion segment, NT1.0-Scaffold0002504, has a length of at least 544,860 bps. Within this segment, at least 207 variant sites were detected between a reference TN90 genome sequence and BU21 lines representing a pattern of deletion (Table 3)
[0318] The identified Nic2 deletion segment within scaffoldNT1.0-Scaffold0000549 (total length of NT1.0-Scaffold0000549=1,142,469 bps), has a length of at least 820,000 bps. Within this segment, at least 340 polymorphic sites were detected between a reference TN90 genome sequence and Burley 21 lines representing a pattern of deletion (Table 4)
Example 7: Breeding of Tobacco Varieties Containing Low Nicotine
[0319] The identified nic1 deletion segment, genes within, and molecular markers associated therewith are used to breed and produce low nicotine tobacco hybrids, varieties, and lines which comprise a nic1 deletion or partial deletion. These genes and markers are also used to screen for additional nic1 and nic2 alleles from various Nicotiana germplasm, for example, different Nicotiana species or Nicotiana tabacum lines. A collection of forty-three Nicotiana species, forty-nine Nicotiana rustica lines, and approximately six hundred Nicotiana tabacum lines that can be screened is provided in Table 8 of U.S. Pat. No. 7,700,834.
[0320] Germplasm identified as having novel nic1 or nic2 alleles is used as source material for breeding with cultivated tobaccos. Interspecific or intraspecific hybridization methods combined with standard breeding methods, such as backcrossing or the pedigree method, may be used to transfer a desirable nic1 or nic2 mutant allele from the donor source to cultivated tobaccos. For example, a low-nicotine variety comprising a nic1, nic2, or both mutant alleles (e.g., a donor parent such as LA Burley 21) is crossed to an elite high-nicotine variety having a desirable genetic background and agronomically elite traits. F.sub.1 progeny plants from this cross is optionally assayed for one or more molecular markers exemplified in Tables 9 and 10. An F.sub.1 progeny plant is then backcrossed with the parent elite high-nicotine variety (recurrent parent). Plants from the BC1 generation are genotyped using molecular markers exemplified in Tables 9 and 10 to select for tobacco plants with smaller nic1 or nic2 deletion segments. After multiple rounds of backcrossing (e.g., 5-7 generations), an new elite tobacco variety is obtained comprising both a low-nicotine trait and other desirable traits from the recurrent parent elite line. This new elite tobacco variety is also free to any genetic drag associated with the low-nicotine trait due to genetic recombination events around Nic1 and Nic2 loci. These recombination events unlink nic1 and nic2 mutations from any associated detrimental mutations and thus reduce or avoid genetic drag. Using the above breeding and marker-assisted selection strategy, one can also achieve the pyramiding or stacking of a low-nicotine trait with other transgenes or natural alleles that reduce nicotine or nornicotine levels.
[0321] Low-nicotine tobacco hybrids, varieties, or lines can be made as a Burley type, a dark type, a flue-cured type, a Maryland type or an Oriental type tobacco, or can be essentially derived from BU 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL 939, GL 973, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY 10, KY 14, KY 160, KY 17, KY 171, KY 907, KY907LC, KTY14L8 LC, Little Crittenden, McNair 373, McNair 944, msKY 14L8, Narrow Leaf Madole, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129, NC 2002, Neal Smith Madole, OXFORD 207, Perique tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN 86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, or VA359, Maryland 609, HB3307PLC, HB4488PLC, KT206LC, KT209LC, KT210LC, KT212LC, R610LC, PVH2310, NC196, KTD14LC, KTD6LC, KTD8LC, PD7302LC, PD7305LC, PD7309LC, PD7318LC, PD7319LC, PD7312LC, ShireyLC, or any commercial tobacco variety according to standard tobacco breeding techniques known in the art.
TABLE-US-00010 TABLE 10 Genes annotated in a Nic1 deletion scaffold, NT1.0-Scaffold0002504 (SEQ ID No. 1). Refined Amino Genomic genomic cDNA acid sequence sequence sequence sequence Gene Blast Hit Description Start End (SEQ ID) (SEQ ID) (SEQ ID) (SEQ ID) g100624_Scaffold0002504 gi|113205363|gb|AAT66771.2| Putative polyprotein, 23574 44762 9 29 49 identical [Solanum demissum] g100616_Scaffold0002504 gi|113205363|gb|AAT66771.2| Putative polyprotein, 49007 62258 10 30 50 identical [Solanum demissum] g100619_Scaffold0002504 gi|460410342|ref|XP_004250589.1| PREDICTED: 63561 67079 11 31 51 uncharacterized protein LOC101263780 [Solanum lycopersicum] g100629_Scaffold0002504 gi|113205363|gb|AAT66771.2| Putative polyprotein, 72790 84448 12 32 52 identical [Solanum demissum] g100631_Scaffold0002504 gi|460370553|ref|XP_004231117.11| PREDICTED: 124722 127361 13 33 53 putative late blight resistance protein homolog R1A-10-like [
] g100627_Scaffold0002504 gi|113205316|gb|ABI34339.1| Polyprotein, 3- 130345 131552 14 34 54 partial, putative [Solanum demissum] g100630_Scaffold0002504 gi|113205316|gb|ABI34339.1| Polyprotein, 3- 146435 147770 15 35 55 partial, putative [Solanum demissum] g100633_Scaffold0002504 gi|113205316|gb|ABI34339.1| Polyprotein, 3- 174793 179215 16 36 56 partial, putative [Solanum demissum] g100620_Scaffold0002504 NA 186534 189120 17 37 57 g100625_Scaffold0002504 gi|460395064|ref|XP_004243109.1| PREDICTED: 247160 250636 18 38 58 uncharacterized protein LOC101263429 [Solanum lycopersicum] g100615_Scaffold0002504 gi|113205363|gb|AAT66771.2| Putative polyprotein, 263965 268932 19 39 59 identical [Solanum demissum] g100618_Scaffold0002504 gi|460410504|ref|XP_004250667.1| PREDICTED: 282902 284495 20 40 60 uncharacterized protein LOC101267192 [Solanum lycopersicum] g100622_Scaffold0002504 NA 305097 306605 21 75 41 61 g100617_Scaffold0002504 gi|113205345|gb|AAT38783.2| hypothetical 351391 354310 22 76 42 62 protein SDM1_46t00006 [Solanum demissum] g100621_Scaffold0002504 gi|113205363|gb|AAT66771.2| Putative polyprotein, 385927 388324 23 77 43 63 identical [Solanum demissum] g100632_Scaffold0002504 NA 421150 422045 24 78 44 64 g100628_Scaffold0002504 NA 427647 432434 25 79 45 65 gl00623_Scaffold0002504 gi|89179421|gb|ABD63156.1| Retrotransposon gag 471868 472786 26 80* 46 66 protein [Asparagus officinalis] g100626_Scaffold0002504 gi|147845547|emb|CAN78493.1| hypothetical 477222 483825 27 81 47 67 protein VITISV_037041 [Vitis vinifera] g100614_Scaffold0002504 gi|460406698|ref|XP_004248798.1| PREDICTED: 530011 535390 28 82 48 68 putative late blight resistance protein homolog R1B-14-like [
] Start and End denote the starting and ending nucleotide positions of the annotated genes on scaffold NT1.0-Scaffold0002504. Only two bolded genes (g100631_Scaffold0002504 and g100614_Scaffold0002504) were observed to express in the root of BU21 and HI BU21 both before and after topping. No expression of these two genes were detected in LI BU21 or LA BU21 roots. All other listed genes show no root expression in BU21, HI BU21, LI BU21, or LA BU21 based on the Root RNASeq dataset. The asterisk (*) indicates that SEQ ID Nos. 83 and 84 correspond to refined cDNA and amino acid sequences of SEQ ID NO. 80, respectively.
TABLE-US-00011 TABLE 11 Genes annotated in a Nic2 deletion scaffold, NT1.0-Scaffold0000549 (SEQ ID No. 2). Start and End denote the starting and ending nucleotide positions of the annotated genes on scaffold NT1.0-Scaffold0002504. Only three bolded genes (g38885_Scaffold0000549, g38878_Scaffold0000549 and g38864_Scaffold0000549) were observed to express in the root of BU21 and LI BU21 both before and after topping. No expression of these three genes were detected in HI BU21 or LA BU21 roots. All other listed genes show no root expression in BU21, HI BU21, LI BU21, or LA BU21 based on the Root RNASeq dataset. Gene Blast Hit Description Start End g38875_Scaffold0000549 gi|47824950|gb|AAT38724.1| Putative retrotransposon protein, identical [Solanum 1064 2604 demissum] g38854_Scaffold0000549 gi|460414233|ref|XP_004252477.1| PREDICTED: uncharacterized protein 12488 12827 LOC101245629 [Solanum lycopersicum] g38847_Scaffold0000549 gi|460407027|ref|XP_004248959.1| PREDICTED: uncharacterized protein 40706 42338 LOC101266468 [Solanum lycopersicum] g38857_Scaffold0000549 gi|460410342|ref|XP_004250589.1| PREDICTED: uncharacterized protein 63740 66314 LOC101263780 [Solanum lycopersicum] g38861_Scaffold0000549 gi|460395064|ref|XP_004243109.1| PREDICTED: uncharacterized protein 69289 71053 LOC101263429 [Solanum lycopersicum] g38873_Scaffold0000549 gi|460407027|ref|XP_004248959.1| PREDICTED: uncharacterized protein 71359 78187 LOC101266468 [Solanum lycopersicum] g38871_Scaffold0000549 gi|460415745|ref|XP_004253217.1| PREDICTED: uncharacterized protein 99417 112568 LOC101263890 [Solanum lycopersicum] g38850_Scaffold0000549 NA 136925 137758 g38855_Scaffold0000549 NA 141858 144628 g38872_Scaffold0000549 NA 147982 150752 g38849_Scaffold0000549 gi|147865536|emb|CAN81563.1| hypothetical protein VITISV_019697 [Vitis vinifera] 151800 153027 g38866_Scaffold0000549 gi|460407027|ref|XP_004248959.1| PREDICTED: uncharacterized protein 159812 161152 LOC101266468 [Solanum lycopersicum] g38853_Scaffold0000549 gi|460407027|ref|XP_004248959.1| PREDICTED: uncharacterized protein 165374 166727 LOC101266468 [Solanum lycopersicum] g38868_Scaffold0000549 NA 205238 206813 g38884_Scaffold0000549 gi|460406842|ref|XP_004248867.1| PREDICTED: putative ribonuclease H protein 223785 228636 At1g65750-like [Solanum lycopersicum] g38876_Scaffold0000549 NA 246679 246970 g38856_Scaffold0000549 NA 263028 264922 g38859_Scaffold0000549 NA 267551 269920 g38848_Scaffold0000549 gi|460410377|ref|XP_004250606.1| PREDICTED: uncharacterized protein 274617 278325 LOC101247390 [Solanum lycopersicum] g38885.sub.Scaffold0000549 gi|296278604|gb|ADH04266.1| ERF1 [ ] 279007 279583 g38862_Scaffold0000549 NA 281949 283475 g38877_Scaffold0000549 gi|147773804|emb|CAN60970.1| hypothetical protein VITISV_026408 [Vitis vinifera] 313840 316312 g38869_Scaffold0000549 gi|147775355|emb|CAN65719.1| hypothetical protein VITISV_020846 [Vitis vinifera] 320254 322003 g38881_Scaffold0000549 gi|460410342|ref|XP_004250589.1| PREDICTED: uncharacterized protein 336602 338552 LOC101263780 [Solanum lycopersicum] g38852_Scaffold0000549 gi|113205363|gb|AAT66771.2| Putative polyprotein, identical [Solanum demissum] 352315 358329 g38886_Scaffold0000549 gi|460387720|ref|XP_004239522.1| PREDICTED: uncharacterized protein 359255 372066 LOC101244956 [Solanum lycopersicum] g38878.sub.Scaffold0000549 gi|296278604|gb|ADH04266.1| ERF1 [
] 372621 375461 g38860_Scaffold0000549 gi|460366233|ref|XP_004228993.1| PREDICTED: uncharacterized protein 386045 387443 LOC101255727 [Solanum lycopersicum] g38864.sub.Scaffold0000549 gi|296278604|gb|ADH04266.1| ERF1 [
] 416812 419577 g38863_Scaffold0000549 NA 449315 449560 g38865_Scaffold0000549 NA 449684 449943 g38879_Scaffold0000549 gi|470132088|ref|XP_004301918.1| PREDICTED: uncharacterized protein 456673 458830 LOC101298139 [Fragaria vesca subsp. vesca] g38867_Scaffold0000549 gi|460395064|ref|XP_004243109.1| PREDICTED: uncharacterized protein 550298 551726 LOC101263429 [Solanum lycopersicum] g38883_Scaffold0000549 NA 666517 668921 g38846_Scaffold0000549 NA 679387 681160 g38843_Scaffold0000549 gi|113205316|gb|ABI34339.1| Polyprotein, 3-partial, putative [Solanum demissum] 696597 697503 g38880_Scaffold0000549 gi|4406792|gb|AAD20101.1| putative retroelement pol polyprotein [Arabidopsis thaliana] 748082 752804 g38870_Scaffold0000549 gi|156603850|ref|XP_001618917.1| hypothetical protein NEMVEDRAFT_v1g68789 766567 768613 [Nematostella vectensis]gi|156200895|gb|EDO26817.1| predicted protein [Nematostella vectensis] g38874_Scaffold0000549 gi|460415871|ref|XP_004253277.1| PREDICTED: uncharacterized protein 769094 773060 LOC101244169 [Solanum lycopersicum] g38844_Scaffold0000549 gi|460415745|ref|XP_004253217.1| PREDICTED: uncharacterized protein 781866 785313 LOC101263890 [Solanum lycopersicum]
Example 8: Development of Tobacco Varieties with Desirable Nicotine Levels Via a Transgenic Approach
[0322] Both overexpression and suppression approaches are taken to investigate the function of Nic1 genes. Two sets of transgenic plants are generated, one using the full length coding sequence and the other using an RNAi sequence. For expression of the full length coding sequence or the RNAi sequence, an expression vector can be constructed to have a CsVMV promoter and a NOS terminator, as well as a cassette having a Kanamycin selection marker (NPT II) under direction of an actin2 promoter and having a NOS terminator. Exemplary transformation cassette sequences of RNAi constructs targeting genes in Nic deletion segment can be found in SEQ ID Nos: 69 and 70. One of ordinary skill in the art understands that other target sequences can be used in constructing RNAi constructs or other transgenic approach for gene silencing (e.g., artificial microRNA, trans-acting siRNA, etc.).
[0323] Nucleic acid constructs carrying transgenes of interest are introduced into tobacco leaf disc using DNA bombardment or a biolistic approach. See, for example, Sanford et al., 1993, Methods Enzymol., 217:483-510; and Okuzaki and Tabei, 2012, Plant Biotechnology, 29:307-310. Briefly, the plasmid DNA containing the transformation cassette is coated on 1 m gold particles (DNA/gold) as follows. The 1 m gold particles are baked at 180 C. for 12 hours, and a stock solution (40 mg/ml) is prepared. To make a mixture for 10 shots, 100 l of the stock solution is mixed with 40 l of expression vector DNA (1 g/l), 100 l of 2.5 M CaCl.sub.2, and 40 l of 0.1 M spermidine in a 1.5-ml tube. The mixture is centrifuged for 30 s at 13,000g, and the pellet is washed with 500 l 100% ethanol. The DNA/gold mixture is suspended in 100 l of water, and 10 l is applied onto a macrocarrier, dried, and then bombarded. Two shots are bombarded per plate using a 1,100 psi rupture disc under partial vacuum (711 mmHg) in a PDS-1000/He system (Bio-Rad Laboratories, Hercules, Calif., USA). Narrow Leaf Madole (NLM) and Tennessee 90 (TN90) tobacco leaf discs are used for transformation with the RNAi constructs, and with the full length gene constructs. Whole tobacco leaf (about 4530 mm in length) is placed on the MS medium overnight, and the leaf disc is bombarded with the construct on the second day. Leaves are then cut into small pieces (about 55 mm) and replaced on the TOM medium (MS medium with 20 g sucrose/L; 1 mg/L IAA and 2.5 mg/L BAP) to grow at 27 C. for 3-5 days, then transferred to TOM medium to grow, which contains 300 mg/l Kanamycin (TOM-Kan). Tissues are transferred to new TOM-Kan plates every 2-3 weeks for 4-6 weeks (27 C., 16 h light). Kanamycin-resistant primary shoots are regenerated at 4-6 weeks after bombardment. Shoots are transferred to MS-Kanamycin plates to grow root. The leaves and/or roots from T1 plants (and subsequent generations) are then evaluated to determine the amount of one or more alkaloids and/or one or more TSNAs.
Example 9: Development of Novel Nic1 Mutations Via Random Mutagenesis
[0324] Random mutagenesis of tobacco plants are performed using Ethyl methanesulfonate (EMS) mutagenesis or fast neutron bombardment. EMS mutagenesis consists of chemically inducing random point mutations over the length of the genome. Fast neutron mutagenesis consists of exposing seeds to neutron bombardment which causes large deletions through double stranded DNA breakage.
[0325] For EMS mutagenesis, one gram (approximately 10,000 seeds) of Tennessee 90 tobacco (TN90) seeds are washed in 0.1% Tween for fifteen minutes and then soaked in 30 ml of ddH2O for two hours. One hundred fifty (150) l of 0.5% EMS (Sigma, Catalogue No. M-0880) is then mixed into the seed/ddH2O solution and incubated for 8-12 hours (rotating at 30 rpm) under a hood at room temperature (RT; approximately 20 C.). The liquid then is removed from the seeds and mixed into 1 M NaOH overnight for decontamination and disposal. The seeds are then washed twice with 100 ml ddH2O for 2-4 hours. The washed seeds were then suspended in 0.1% agar solution.
[0326] The EMS-treated seeds in the agar solution are evenly spread onto water-soaked Carolina's Choice Tobacco Mix (Carolina Soil Company, Kinston, N.C.) in flats at 2000 seeds/flat. The flats are then covered with plastic wrap and placed in a growth chamber. Once the seedlings emerge from the soil, the plastic wrap is punctured to allow humidity to decline gradually. The plastic wrap is completely removed after two weeks. Flats are moved to a greenhouse and fertilized with NPK fertilizer. The seedlings re plugged into a float tray and grown until transplanting size. The plants are subsequently transplanted into a field. During growth, the plants self-pollinate to form M1 seeds. At the mature stage, five capsules are harvested from each plant and individual designations are given to the set of seeds from each plant. This forms the M1 population. A composite of M1 seed from each M0 plant are grown, and leaves from M1 plants are collected for DNA extraction. Target genes are amplified and sequenced for mutation identification.
Example 10: Development of Novel Nic1 Mutations Via Targeted Mutagenesis
[0327] Tobacco lines with low nicotine while maintaining high leaf quality are produced by introducing mutations into Nic1 locus via precise genome engineering technologies, for example, Transcription activator-like effector nucleases (TALENs), meganuclease, zinc finger nuclease, and CRISPR. Genome modifications are made in commercial tobacco varieties such as TN90, K326 and Narrow Leaf Madole.
[0328] For example, specific target sequences from Nic1 genes can serve as TALEN target binding regions. The TALEN sites are specific for the single gene or a DNA segment from Nic1 locus. TALEN regions 1 and 2 would be used to disrupt a critical region of Nic1 and partial fuse together to create long stretch deletion but smaller than entire Nic1 deletion region. The plants created will be expected to have low nicotine contents but high leaf quality.
[0329] Based on target DNA sequences, sequences for transcription activator like (TAL) effector proteins are synthesized and cloned into plant expression vectors to serve as entry vectors. Depending on the purpose, different protocols are used to generate mutagenic tobacco lines: 1) one or more entry vectors (pALCS1 containing the target TALs) are directly transformed into tobacco protoplasts to generate random sequence deletion or insertion mutagenic tobacco lines; 2) a donor sequence (e.g., a reporter gene, e.g., the GUS gene) flanked on the left and right side with sequences that are homologous with the target insertion sequence is co-transformed into tobacco protoplasts with one or more entry vectors (pALCS1 containing the target TALs) to generated mutagenic tobacco lines containing a reporter gene; and 3) a donor sequence containing target TALs that have a point mutation is co-transformed into tobacco protoplasts with one or more entry vectors (pALCS1 containing the target TALs) to generated mutagenic tobacco lines having a point mutation; 4) a donor sequence containing a tissue specific promoter sequence to generate mutant tobacco lines that express the endogenous gene in a tissue specific manner; and 5) a donor sequence containing a combination of the aforementioned donor sequences with a reporter gene construct to facilitate mutant tobacco screening.
[0330] Tobacco protoplasts are isolated from TN90 tobacco leaves growing in Magenta boxes in a growth chamber. Well-expanded leaves (5 cm) from 3-4-week-old plants are cut into 0.5 to 1-mm leaf strips from the middle part of a leaf. Leaf strips are transferred into the prepared enzyme solution (1% cellulase R10, 0.25% macerozyme R10, 0.4 M mannitol, 20 mM KCl, 20 mM MES (pH 5.7), 10 mM CaCl2, 0.1% BSA) by dipping both sides of the strips. Leaf strips are vacuum infiltrated for 30 min in the dark using a desiccator with continuing digestion in the dark for 4 hour to overnight at room temperature without shaking. Protoplasts are filtered in 100 m nylon filter and purified with 3 ml Lymphoprep. Protoplasts are centrifuged and washed with W5n solution (154 mM NaCl, 125 mM CaCl.sub.2, 5 mM KCl, 2 mM MES, 991 mg/l glucose pH 5.7) and suspended in W5n solution at the concentration of 5105/ml. Protoplasts are kept on ice for 30 min to settle at the bottom of the tube by gravity. W5n solution was moved and protoplasts were re-suspended in P2 solution at room temperature. 50 l DNA (10-20 g of plasmid), 500 l protoplasts (2105 protoplasts) and 550 l of PEG solution (40%, v/v 10 ml 4 g PEG4000, 0.2 M mannitol, 0.1 M CaCl2) are mixed gently in a 15-ml microfuge tube, and the mixture incubated at room temperature for 5 min.
[0331] Protoplasts are pelleted and re-suspended with 1 ml 28EN1 (8EN1: MS salt without NH.sub.4NO.sub.3, MS vitamin, 0.2% myo-Inositol, 4 mM MES, 1 mg/l NAA, 1 mg/l IAA, 0.5 M mannitol, 0.5 mg/l BAP, 1.5% sucrose). Transformed protoplasts are jellified with equal amount of low-meting agarose (LMA), and 0.2 ml of protoplast-LAM is dropped to form a bead. 10 ml 8EN1 is added to the bead, and in 7 days, 5 ml 8EN1 is taken out and 5 ml 8EN2 (8EN1 with 0.25 M mannitol) is added; after another 7 days (14 day), 10 ml 8EN2 is taken out and 10 ml 8EN2 is added; in another 7 days (21 day), 5 ml 8EN2 is taken out and 5 ml 8EN3 (8EN1 with 3% sucrose and without mannitol) is added; after another 7 days (28 day), 10 ml 8EN3 is taken out and 10 ml 8EN3 is added. Protoplasts are kept for two weeks until micro-callus growth. Callus is transferred to NCM solid media until it reaches about 5 mm (usually about two weeks). Callus was transferred to TOM-Kan solid media to grow shoots, and transformed tobacco plants were regenerated using the methods described herein.
Example 11: Further Genetic Confirmation of the Identified Nic1 Lesion
[0332] A genetic segregation analysis was conducted in an F.sub.2 population of 522 plants from a cross between TN90 with LA BU21 (Table 12). This F.sub.2 population ((LA Burley 21TN 90 LC) (X)) was subject to PCR-based genotyping of the Nic1 and Nic2 loci as described in Example 3. The percent total alkaloid and percent nicotine levels of each plant were also measured as in Example 3. Briefly, tobacco samples were collected at an intermediate growth stage (layby stage) for genotyping. The plants were topped at an elongated bud stage. Samples for chemistry analysis were taken two weeks after topping of the plants.
[0333] The genotypic data again confirm a segregation ratio of 9:3:3:1 for the Nic1 and Nic2 loci in the F.sub.2 population. Average percent total alkaloid and average percent nicotine levels in each of the four genotypes are also consistent with the segregation data and the earlier observation that nic1 has a stronger effect than nic2 over the total alkaloid and nicotine levels (Tables 13 and 14). The genotype and chemistry data of this F.sub.2 population are further shown in
[0334] Moreover, groups of isogenic BU21 low alkaloid series germplasm (LA BU21, LI BU21, HI BU21, and BU21) were tested across two years. The low alkaloid trait is not affected by year-to-year variations in leaf alkaloid levels. Shown is
TABLE-US-00012 TABLE 12 Nic1 and Nic2 genotypes and alkaloid measurements of individual plants of a larger F.sub.2 population segregating for nic1 and nic2 ((LA Burley 21 TN 90 LC) (X)). Nic1 Nic2 Percent Plant (Present = 1, (Present = 1, Percent Total No. Deleted = 0) Deleted = 0) Nicotine Alkaloids 1 1 1 1.33 1.389 2 1 1 1.59 1.66 3 0 1 0.72 0.7511 4 1 1 2.59 2.753 5 1 0 0.81 0.8422 6 1 1 1.04 1.096 7 1 1 1.76 1.843 8 1 1 1.07 1.121 9 1 0 1.85 1.938 10 1 1 1.58 1.662 11 1 0 1.1 1.147 12 1 0 0.68 0.7045 13 1 1 1.33 1.39 14 1 0 1.77 1.828 15 1 1 1.83 1.93 16 1 1 3.34 3.513 17 0 0 0.059 0.0643 18 1 1 3.36 3.543 19 0 0 0.062 0.0661 20 1 1 2.31 2.437 21 1 0 1.23 1.286 22 1 0 1.61 1.701 23 1 1 1.18 1.241 24 0 0 0.106 0.1099 25 0 1 1.41 1.487 26 1 1 2.47 2.6 27 1 1 2.16 2.245 28 1 1 2.22 2.334 29 1 0 2.54 2.667 30 1 1 1.37 1.429 31 1 1 1.86 1.956 32 1 1 1.68 1.762 33 1 0 1.91 1.996 34 1 1 2.89 3.051 35 0 1 1.15 1.205 36 1 1 2.92 3.064 37 1 0 2.84 3.005 38 0 1 1.49 1.566 39 0 0 0.17 0.1796 40 1 0 3.02 3.211 41 1 0 1.29 1.35 42 1 1 1.73 1.805 43 1 0 1.37 1.469 44 1 1 2.18 2.279 45 0 0 0.16 0.1719 46 1 0 2.38 2.495 47 1 1 2.34 2.455 48 1 0 1.39 1.455 49 1 0 2.9 3.044 50 0 1 2.18 2.307 51 0 1 1.34 1.393 52 1 0 1.9 1.98 53 1 1 1.49 1.566 54 1 1 2.22 2.347 55 1 1 3.21 3.359 56 1 1 3.67 3.862 57 1 1 2.07 2.17 58 0 1 0.83 0.8704 59 1 1 2.37 2.492 60 1 1 2.25 2.395 61 1 1 2.53 2.678 62 1 1 2.19 2.326 63 1 1 1.92 1.997 64 1 1 3.06 3.229 65 1 1 3.2 3.369 66 1 1 2.83 2.997 67 1 1 4.07 4.257 68 1 1 2.4 2.498 69 0 1 1.66 1.734 70 1 1 1.93 2.045 71 1 1 3.79 3.99 72 0 0 0.079 0.0849 73 1 1 2.17 2.289 74 1 0 3.58 3.778 75 1 1 2.63 2.76 76 0 1 1.52 1.603 77 1 1 3.04 3.211 78 1 1 2.82 2.979 79 1 1 2.6 2.74 80 1 1 2.48 2.597 81 1 1 1.88 1.977 82 1 1 2.98 3.106 83 0 1 0.99 1.0255 84 0 0 0.3 0.3194 85 1 1 1.79 1.873 86 1 1 2.37 2.477 87 1 1 2.79 2.932 88 1 1 2.14 2.301 89 1 1 4.35 4.588 90 0 0 0.09 0.0972 91 0 1 1.59 1.67 92 1 0 1.71 1.789 93 1 1 3.94 4.114 94 1 1 2.65 2.755 95 0 1 1.14 1.211 96 1 0 2.14 2.248 97 1 1 2.62 2.743 98 1 0 0.95 0.9865 99 1 1 2.61 2.729 100 1 1 3.33 3.485 101 1 0 2.77 2.878 102 1 1 2.31 2.424 103 0 1 0.49 0.5099 104 1 1 2.5 2.611 105 0 1 0.97 1.012 106 1 1 2.29 2.404 107 1 1 1.11 1.16 108 1 0 1.87 1.947 109 0 1 0.95 1 110 1 1 3.05 3.209 111 1 0 3.28 3.437 112 1 0 3.46 3.637 113 1 1 4.33 4.594 114 1 1 4.35 4.552 115 1 1 3.56 3.746 116 0 1 1.85 1.93 117 1 1 5.94 6.305 118 0 1 1.47 1.559 119 1 1 3.8 4.028 120 0 1 1.9 2.007 121 1 0 3.38 3.573 122 0 0 0.3 0.3191 123 1 1 4.04 4.245 124 1 1 3.4 3.622 125 0 1 1.09 1.141 126 1 0 2.71 2.828 127 1 1 4.93 5.178 128 1 0 2.65 2.801 129 1 1 1.62 1.693 130 1 0 2.13 2.232 131 0 1 2.64 2.789 132 1 1 3.17 3.329 133 0 1 1.99 2.108 134 1 1 2.28 2.377 135 1 1 3.85 4.019 136 1 1 3.62 3.792 137 1 0 3.19 3.355 138 0 1 1.49 1.565 139 1 1 4.33 4.516 140 1 1 3.88 4.097 141 1 1 5.68 6.003 142 1 1 3.15 3.292 143 1 0 2.35 2.456 144 1 0 3.63 3.786 145 1 1 3.32 3.532 146 1 1 3.26 3.407 147 1 1 3.37 3.507 148 1 0 3.21 3.388 149 1 1 3.7 3.873 150 0 0 0.4 0.4279 151 1 1 1.41 1.482 152 1 1 2.18 2.273 153 1 1 2.58 2.725 154 0 1 2.89 3.088 155 1 1 1.51 1.593 156 0 1 2.03 2.143 157 0 1 2.03 2.151 158 1 0 1.27 1.323 159 1 1 1.62 1.734 160 1 1 4.48 4.67 161 1 1 1 1.045 162 1 1 3.17 3.309 163* 1 1 0.18 0.1906 164* 0 1 2.38 2.493 165 1 1 3.62 3.745 166 1 1 N/S N/S 167 1 0 2.62 2.717 168 1 1 2.31 2.428 169 1 0 2.52 2.645 170 1 1 4.35 4.527 171 1 0 1.66 1.741 172 1 0 3.03 3.159 173 1 0 3.2 3.343 174* 1 1 0.059 0.0653 175* 0 0 4.03 4.197 176 1 1 2.85 3.01 177 1 1 2.91 3.086 178 1 1 4.21 4.395 179 1 1 1.09 1.154 180 0 1 1.15 1.206 181 1 0 3.2 3.345 182 1 1 3.28 3.406 183 1 1 3.17 3.324 184 1 0 3.24 3.392 185 1 1 0.94 0.987 186 1 1 3.95 4.123 187 1 0 0.68 0.7094 188 0 1 1.94 2.007 189 1 1 0.46 0.4809 190 0 1 2.28 2.356 191 1 1 2.25 2.336 192 1 0 2.74 2.842 193 1 1 3.9 4.091 194 1 1 3.39 3.578 195 1 0 2.59 2.698 196 0 0 0.131 0.1383 197 1 1 2.28 2.365 198 1 0 2.27 2.395 199 0 0 0.1 0.1063 200 1 1 2.39 2.496 201 0 1 1.02 1.09 202 1 1 1.99 2.09 203 1 1 3.44 3.594 204 1 1 3.05 3.167 205 0 1 0.85 0.8839 206 0 1 2.18 2.331 207 1 1 1.89 1.971 208 1 1 1.37 1.445 209 1 1 3.26 3.432 210 1 1 1.28 1.3224 211 0 1 1.86 1.966 212 1 1 1.53 1.59 213 0 0 0.142 0.1513 214 1 1 2.22 2.331 215 1 1 2.94 3.075 216 0 1 1.72 1.801 217 1 1 3.89 4.044 218 1 1 4.47 4.691 219 0 1 1.63 1.696 220 1 0 3.28 3.432 221 1 0 1.14 1.193 222 1 1 3.91 4.089 223 1 0 0.87 0.9002 224 1 1 1.8 1.891 225 1 1 2.25 2.369 226 1 0 2.59 2.738 227 0 1 0.89 0.933 228 0 1 0.64 0.669 227B 1 1 1.38 1.439 228B 1 1 3.25 3.421 229 1 0 3.57 3.71 230 0 1 2.43 2.583 231 1 1 3.23 3.398 232 1 1 4.85 5.187 233 0 1 1.09 1.138 234 0 0 0.24 0.2521 235 1 1 2.49 2.597 236 1 1 4.07 4.327 237 0 1 1.17 1.235 238 0 0 0.16 0.1683 239 1 1 3.18 3.323 240 1 0 2.39 2.5 241 1 1 1.72 1.805 242 0 1 0.95 0.992 243 0 1 0.75 0.787 244 1 1 2.28 2.398 245 1 1 1.89 1.989 246 1 0 3.91 4.084 247 1 0 2.53 2.648 248 0 1 0.68 0.7146 249 1 1 2.82 2.966 250 1 1 1.76 1.841 251 0 0 0.18 0.1936 252 1 1 1.39 1.452 253 1 1 3.54 3.722 254 1 1 4.05 4.247 255 1 1 2.09 2.192 256 1 1 1.47 1.551 257 1 0 2.54 2.677 258 1 1 3.83 4.002 259 1 0 1.23 1.301 260 1 1 1.92 2.017 261 1 1 2.17 2.323 262 1 0 2.41 2.552 263 1 0 2.3 2.435 262B 1 0 1.34 1.408 263B 1 1 3.39 3.577 264 0 1 1.98 2.093 265 0 1 0.8 0.854 266 1 1 1.76 1.863 267 1 1 1.87 1.989 268 0 0 0.19 0.2031 269 0 0 0.12 0.1293 270 0 1 0.57 0.607 271 0 0 0.139 0.1481 272 1 0 1.81 1.893 273 1 0 2.13 2.244 274 0 1 0.52 0.5523 275 0 1 1.7 1.805 276 1 0 1.83 1.922 277 1 1 2 2.101 278 0 1 0.91 0.9535 279 1 1 3.25 3.439 280 1 1 3.45 3.586 281 1 1 4.62 4.807 282 1 1 3.41 3.566 283 0 1 1.34 1.407 284 1 1 2.43 2.556 285 1 1 1.44 1.514 286 1 1 2.49 2.614 287 0 0 0.137 0.1445 288 1 1 1.78 1.863 289 0 1 0.53 0.5681 290 1 1 N/S N/S 291 0 1 0.73 0.775 292 1 1 1.43 1.504 293 1 1 1.92 2.012 294 0 1 0.51 0.5388 295 1 0 2.07 2.181 296 1 1 1.4 1.463 297 1 1 4.21 4.548 298 1 0 3.11 3.225 299 1 1 3.93 4.158 300 1 1 1.99 2.062 301 0 1 0.56 0.5858 302 1 1 1.93 2.018 303 1 1 1.06 1.114 304 1 1 6.89 7.302 305 1 0 2.25 2.366 306 1 0 1.42 1.479 307 1 0 2.39 2.591 308 1 1 2.52 2.635 309 1 0 1.84 1.933 310 1 1 2.29 2.412 311 1 1 1.62 1.707 312 0 1 1.89 1.988 313 1 1 2.48 2.577 314 0 0 1.01 1.056 315 1 1 2.21 2.334 316 1 1 1.54 1.617 317 1 1 N/S N/S 318 0 1 0.65 0.6821 319 1 1 3.32 3.493 320 1 0 2.68 2.8 321 1 1 2.71 2.835 322 1 0 1.97 2.068 323 1 1 2.76 2.905 324 1 0 3.92 4.122 325 1 0 2.56 2.724 326 1 1 3.18 3.355 327 0 1 2.08 2.165 328 1 0 2.77 2.89 329 1 1 2.11 2.216 330 1 0 1.81 1.878 331 0 0 0.2 0.2096 332 1 1 1.8 1.894 333 0 1 0.75 0.7875 334 1 0 2.78 2.92 335 0 0 0.19 0.2044 336 1 1 2.2 2.31 337 1 1 1.54 1.606 338 0 0 0.19 0.1986 339 1 1 2.05 2.153 340 1 0 1.57 1.644 341 1 1 2.64 2.768 342 1 1 2.4 2.522 343 1 1 2.1 2.213 344 1 1 2.83 2.989 345 1 0 2.77 2.899 346 1 1 1.44 1.509 347 2.89 3.042 348 1 1 1.76 1.841 349 0 1 0.59 0.6235 350 1 1 3.62 3.804 351 0.67 0.707 352 1 0 2.25 2.352 353 1 1 1.7 1.786 354 1 1 2.36 2.463 355 1 1 N/S N/S 356 1 1 3.36 3.549 357 1 1 1.63 1.706 358 0 1 0.84 0.887 359 0 1 0.5 0.5223 360 1 1 2.44 2.568 361* 0 1 1.86 1.931 362* 0 0 2.98 3.122 363 0 0 0.072 0.0754 364 0 1 1.64 1.739 365 1 1 3.4 3.602 366 1 0 2.72 2.872 367 0 1 1.12 1.205 368 1 1 3 3.207 369 1 1 1.45 1.542 370 1 1 4.65 4.975 371 1 1 3.1 3.271 372 1 1 1.2 1.252 373 1 1 1.94 2.049 374 0 0 0.24 0.2523 375 1 1 3.4 3.528 376 1 0 2.73 2.863 377 0 1 0.57 0.5979 378 1 1 2.34 2.447 379 1 1 2.9 3.073 380 1 1 2.03 2.156 381 1 1 2.07 2.177 382 0 1 1.23 1.301 383 1 1 2.42 2.554 384 1 1 3.32 3.518 385 1 1 2.18 2.293 386 1 1 1.58 1.668 387 0 1 1.21 1.285 388 0 0 0.074 0.0789 389 1 1 1.65 1.725 390 1 1 2.36 2.507 391 1 1 1.94 2.055 392 1 1 2 2.102 393 1 1 2.61 2.705 394 0 1 1 1.06 395 1 1 2.53 2.641 396 1 1 1.03 1.081 397 0 0 0.136 0.1417 398 1 1 0.99 1.033 399 1 1 1.96 2.062 400 0 0 0.113 0.1193 401 1 1 1.75 1.841 402 1 1 2.34 2.442 403 1 1 1.92 2.002 404 1 1 3.87 4.06 405 1 1 2.94 3.068 406 1 1 1.15 1.204 407 1 1 3.15 3.359 408 1 1 1.83 1.923 409 1 1 2.28 2.402 410 1 1 2.76 2.906 411 1 1 1.88 1.994 412 1 1 1.28 1.342 413 1 1 1.12 1.175 414 0 1 1.28 1.341 415 1 1 2.22 2.334 416 0 1 1.05 1.099 417 1 1 3.01 3.148 418 1 1 3.27 3.444 419 1 1 1.77 1.86 420 1 1 1.44 1.497 421 0 1 0.55 0.5777 422 1 0 2.7 2.825 423 1 1 1.24 1.315 424 1 1 2.95 3.106 425 0 1 0.63 0.6607 426 1 1 2.88 3.014 427 1 1 2.31 2.455 428 1 0 1.92 1.994 429 1 1 3.05 3.232 430 1 1 1.76 1.88 431 0 0 0.11 0.1164 432 0 1 0.78 0.8129 433 0 1 2.01 2.134 434 1 1 1.98 2.095 435 1.71 1.801 436 1 0 3.27 3.447 437 0 1 0.89 0.944 438 1 1 2.9 3.049 439 0 0 0.18 0.1905 440 1 1 4.12 4.367 441 0 1 1.53 1.623 442 1 1 4.07 4.315 443 0 1 1.35 1.429 444 1 0 2.98 3.12 445 1 1 4.98 5.272 446 0 1 1.22 1.288 447 1 1 4.34 4.578 448 1 1 2.89 3.028 449 1 1 5.8 6.135 450 1 1 4.34 4.553 451 1 0 3.6 3.791 452 1 1 4.67 4.947 453 0 1 1.83 1.918 454 1 1 2.6 2.692 455 1 1 5.03 5.301 456 1 1 4.41 4.695 457 1 0 2.62 2.741 458 0 0 0.133 0.1425 459 0 1 0.53 0.5534 460 0 1 0.63 0.6663 461 0 1 2.78 2.943 462 1 1 2.64 2.785 463 0 1 1.23 1.296 464 0 1 1.55 1.629 465 1 1 2.49 2.626 466 1 1 2.8 2.936 467 0 0 0.19 0.2026 468 0 1 1.91 2.029 469 1 1 1.37 1.442 470 0 1 1.29 1.375 471 1 1 3.74 3.919 472 0 1 1.67 1.78 473 1 1 1.39 1.479 474 1 1 0.88 0.926 475 2.53 2.679 476 1 1 3.59 3.756 477 1 1 3.96 4.196 478 1 1 1.59 1.679 479 0 1 2.27 2.385 480 0 0 0.108 0.1147 481* 0 1 2.21 2.363 482* 1 1 0.54 0.5726 483 1 1 1.76 1.854 484 1 1 3.34 3.512 485 1 1 1.4 1.468 486 1 0 0.87 0.9085 487 0 1 0.38 0.3976 488 1 1 2.53 2.662 489 0 1 1.34 1.412 490 0 1 1.17 1.246 491 0 1 0.43 0.4505 492 1 0 3.55 3.741 493 0 1 2.16 2.294 494 1 1 2.6 2.736 495 1 1 2.73 2.905 496 1 1 2.46 2.591 497 1 1 1.8 1.906 498 0 1 0.75 0.7913 499 1 1 1.37 1.461 500 1 0 1.63 1.731 501 1 1 1.34 1.417 502 1 0 0.98 1.0156 503 1 1 0.79 0.8276 504 1 0 1.75 1.812 505 1 1 1.49 1.571 506 0 0 0.084 0.0892 507 1 1 1.2 1.247 508 1 0 1.98 2.081 509 1 0 1.03 1.0704 510 1 0 1.4 1.475 511 1 0 0.76 0.791 512 1 1 1.4 1.491 513 1 1 2.29 2.402 514 1 1 1.14 1.19 515 1 1 1 1.044 516 1 1 1.26 1.356 517 0 1 0.52 0.5535 518 1 1 0.45 0.4786 519 1 0 1.59 1.651 520 1 1 1.59 1.667 521 0 1 0.46 0.4803 522 1 0 1.1 1.162 N/S represent no sample. Asterisks represent four pairs (8 total having plant Nos: 163 and 164, 174 and 175, 361 and 362, 481 and 482, also in bold) of adjacent plants where DNA or leaf samples were likely switched during either sampling, processing or analysis stage. Each of the four pairs of plants were side by side in the field.
TABLE-US-00013 TABLE 13 Genetic segregation of an F.sub.2 segregating population ((LA Burley 21 TN 90 LC) (X)) and average percent total alkaloid and percent nicotine levels in each of the four segregating genotypes. Both the mean and standard deviation are shown. Three plants with missing samples are excluded rendering the total number of plants analyzed to be 518. Average Number Number Average Percent Std Dev Ratio of Plants of Plants Percent Std Dev Total (Total Genotype Expected Expected Observed Nicotine (Nicotine) Alkaloid Alkaloid) Nic1 Nic2 9/16 291.9 288 2.55 1.08 2.68 1.14 Nic1 nic2 3/16 97.3 96 2.25 0.83 2.36 0.87 nic1 Nic2 3/16 97.3 97 1.30 0.61 1.37 0.65 nic1 nic2 1/16 32.4 37 0.36 0.78 0.38 0.81
TABLE-US-00014 TABLE 14 A re-analysis of the segregation population in Table 12 further excluding the four plant pairs which were likely switched (plant Nos: 163 and 164, 174 and 175, 361 and 362, 481 and 482) and rendering the total plant number to be 510. Average Number Number Average Percent Std Dev Ratio of Plants of Plants Percent Std Dev Total (Total Genotype Expected Expected Observed Nicotine (Nicotine) Alkaloid Alkaloid) Nic1 Nic2 9/16 286.88 285 2.57 1.06 2.71 1.11 Nic1 nic2 3/16 95.63 96 2.25 0.83 2.36 0.87 nic1 Nic2 3/16 95.63 95 1.28 0.60 1.35 0.64 nic1 nic2 1/16 31.88 34 0.18 0.16 0.19 0.17
Example 12: Genome Re-Sequencing to Validate and Refine Sequences in the Identified Nic1 Lesion
[0335] Genomic sequences of the identified Nic1 scaffold and annotated genes were re-sequenced using PacBio's SMRT sequencing technology (NT2.0). Sequence quality of Nic1 locus region (NT1.0-Scaffold0002504) was improved. Briefly, base pairs (bps) 1 to 133,550 of NT2.0-Scaffold4274 (SEQ ID No: 73) correspond to and replace NT1.0-Scaffold0002504 between bps 384,701 to 542,313 in the minus orientation. Base pairs 1 to 59,671 of NT2.0-Scaffold14415 (SEQ ID No: 74) correspond to and replace NT1.0-Scaffold0002504 between bps 288,601 to 363,040 in the minus orientation.
[0336] Additional genomic sequence data are provided in SEQ ID Nos: 75 to 82 for the 8 genes previously identified in SEQ ID Nos: 21 to 28, respectively. A new set of cDNA and protein sequences of g100623_Scaffold0002504 are also identified (new sequences of SEQ ID No: 83 and 84 relative to previous sequences of SEQ ID No: 46 and 66, respectively).
[0337] Each and every U.S. or foreign patent, publication of patent application, non-patent literature or any other reference mentioned in this application is incorporated by reference in its entirety.
Example 13: Complete Sequencing of the Nic1 Lesion Region Using Bacteria Artificial Chromosome Sequencing
[0338] A bacterial artificial chromosomes (BAC) walking method was used to generate the complete sequence around the Nic1 locus and further identify boundary sequences of the genomic deletion. Briefly, 21 BAC clones associated with whole-genome profiling (WGP) contigs were identified and pooled to form 3 pools of 7 BACs each. Each pool was sequenced separately on separate SMRT cells (PacBio). The sequences were assembled into 14 contigs, which were further assembled into one contig based on overlapping sequence information obtained by blasting 1000 bps on either end of each contig. The resulting reference contig was used to re-map resequencing data from BU21, HI, LI, and LA BU21 lines. A contiguous 425,001 bp region (SEQ ID NO: 85) that spans the entire Nic1 deletion was identified. Table 15 provides details of the fifteen identified gene models with functional information for the encoded proteins based on the best BLAST hit. The relative position of these fifteen genes on SEQ ID NO: 85 can be found in
Example 14: Development of Additional SNP Markers for Selecting Nic1 and Nic2
[0339] To provide more efficient selection of plants that harbor nic1 and nic2 mutations, 12 SNPs (6 SNPs for each locus) flanking nic1 and nic2 deletions were identified to develop co-dominant markers. Three SNPs upstream and 3 SNPs downstream of each deletion region are used. Each of the SNP polymorphisms is less than 100 kb from the corresponding deleted region. Table 16 provides more details on the relative location and sequence polymorphism for each SNP, and also provides sequence information for 60 bps upstream and downstream of each SNP. High throughput Kompetetive Allele Specific PCR or KASP assays (LGC Genomics, Beverly, Mass.) are designed based on the identified SNPs for genotyping. These SNP markers can be used to detect plants that are heterozygous for a nic1 or nic2 deletion and can also distinguish a true homozygous deletion from a bad PCR reaction. The effectiveness of two SNP markers (Seq ID Nos. 135 and 137) for genotyping the F.sub.2 population ((LA Burley 21TN 90 LC) (X)) of Example 11 (see plant No. 1 to 72 of Table 12) is shown in Table 18.
Example 15: Identification of an ERF Gene Associated with Nic1
[0340] An ERF gene, named as ERF-39 like was identified 307,823 bps downstream of the Nic1 deletion region. Given this gene's close proximity, two adjoining SNP markers (SEQ ID Nos. 143 and 144) were identified for genotyping and tracking purposes. The details of the two SNPs are provided in Table 17. The genomic, cDNA, and protein sequence of the ERF-39 like gene are provided in SEQ ID Nos: 145 to 147, respectively. Plants that overexpress or downregulate the ERF-39 gene (e.g., via RNAi, artificial miRNA, chemical mutagenesis, or targeted genome editing) are made and assess the effect of this gene on plant nicotine levels.
Example 16: Development of Low-Alkaloid Tobacco Plants Via Gene Silencing and Genome Editing
[0341] Tobacco lines with low nicotine while maintaining high leaf quality are produced by introducing loss-of-function or null mutations into Nic1 locus or Nic2 locus via targeted genome editing technologies. Examples of genome editing techniques are Transcription activator-like effector nucleases (TALENs), meganuclease, zinc finger nuclease, and CRISPR, as described in Example 10. Genome modifications are made in commercial tobacco varieties such as TN90, K326 and Narrow Leaf Madole. Additional tobacco lines with suppressed expression of one or more NDGs, one or more ERF genes at Nic2 locus, or a combination thereof are generated via gene silencing (e.g., RNAi, artificial/synthetic microRNA or other small RNA-mediated techniques). Exemplary RNAi cassette sequences targeting NDG1 to NDG15 are listed in Table 15.
[0342] For example, protoplasts are prepared as described in Example 10. One or more entry vectors containing sequences for transcription activator like effector proteins, specific for the target sequences of Nic1 (e.g., NDG1 or NDG2), ERF-39 like, and Nic2 (e.g., ERF189 or another ERF gene from Table 11) are synthesized and transformed into the isolated protoplasts. Protoplasts are cultured into calli. Alternatively, Nic1 and Nic2 loci mutations are achieved through CRISPR and without the use of plasmids. In this case, protoplasts are transformed with Cas9, guide RNA and polyethylene glycol (PEG).
[0343] The plants created contain a gene mutation (e.g., null mutation or deletion) in Nic1, Nic2, or both loci, and constitute a low-nicotine variety. Alternatively, a variety containing a Nic1 mutant allele is crossed to another variety containing a Nic2 mutant allele. This cross will result in cultivars with desirable genetic backgrounds having an even lower nicotine content but high leaf quality. As an alternate option, gene silencing and genome editing techniques can be utilized as described in Example 10 to introduce Nic1 and Nic2 mutations or deletions at the same time.
TABLE-US-00015 TABLE 15 Details of the location of the coding sequence (CDS) within Nic1 locus, and BLAST hit with the lowest E-value of the corresponding protein are provided in this Table. Amino RNAi Genomic cDNA acid Corresponding cassette Position coordinates sequence sequence sequence genes from sequence Name on SEQ ID NO: 85 BLAST Hit Description Blast Hit ID (SEQ ID) (SEQ ID) (SEQ ID) Table 10 (SEQ ID) NDG1 join(385015 . . . 385449, PREDICTED: putative late XP_009624787.1 86 101 116 g100614_Scaf- 148 and 387135 . . . 387299, blight resistance protein fold0002504 149 387383 . . . 387795, homolog R1A-3 387857 . . . 389264) [
] NDG2 complement(join PREDICTED: putative late XP_009589795.1 87 102 117 g100631_Scaf- 150 and (73886. . . 74311, blight resistance protein fold0002504 151 74491 . . . 74680, homolog R1B-16 74794 . . . 74934, [
] 75026 . . . 76149, 76285 . . . 76524)) NDG3 join(323943 . . . 323949, PREDICTED: XP_009594228.1 88 103 118 152 324085 . . . 324464) uncharacterized protein LOC104090758 [Nicotiana tomentosiformis] NDG4 315634 . . . 316095 PREDICTED: XP_009613372.1 89 104 119 153 uncharacterized protein LOC104106516 [Nicotiana tomentosiformis] NDG5 complement(join PREDICTED: XP_009595504.1 90 105 120 g100618_Scaf- 154 (179863. . . 179982, uncharacterized fold0002504 180074 . . . 180152, protein LOC104091789 180839 . . . 181455)) [Nicotiana tomentosiformis] NDG6 complement(join PREDICTED: XP_009597352.1 91 106 121 g100617_Scaf- 155 (233956. . . 234093, uncharacterized fold0002504 234729 . . . 235030, protein LOC104093328 235166 . . . 235378, [Nicotiana tomentosiformis] 235496 . . . 236068, 236374 . . . 236438, 236633 . . . 236874)) NDG7 join(36266 . . . 36629, PREDICTED: XP_015054850.1 92 107 122 g100619_Scaf- 156 36753 . . . 36911, uncharacterized fold0002504 37083 . . . 37384, protein LOC107001234 37655 . . . 37736, [Solanum pennellii] 37857 . . . 38347, 39697 . . . 39783) NDG8 join(114418 . . . 114612, PREDICTED: XP_009589152.1 93 108 123 g100620_Scaf- 157 115436 . . . 115956, uncharacterized fold0002504 116268 . . . 116427, protein LOC104086561 116558 . . . 116749, [Nicotiana tomentosiformis] 116833 . . . 117003) NDG9 complement(join PREDICTED: XP_015086886.1 94 109 124 g100621_Scaf- 158 (262599. . . 262791, uncharacterized fold0002504 264178 . . . 264595, protein LOC107029976 264677 . . . 264995)) [Solanum pennellii] NDG10 335270 . . . 336187 PREDICTED: XP_009766114.1 95 110 125 g100623_Scaf- 159 uncharacterized fold0002504 protein LOC104217532 [Nicotiana sylvestris] NDG11 complement(join PREDICTED: XP_009615097.1 96 111 126 g100622_Scaf- 160 (196787. . . 197330, uncharacterized fold0002504 197459 . . . 197772, protein LOC104107887 197860 . . . 198026, [Nicotiana tomentosiformis] 198131 . . . 198293)) NDG12 complement(join PREDICTED: XP_009775660.1 97 112 127 g100626_Scaf- 161 (340626. . . 340850, uncharacterized fold0002504 340943 . . . 341242, protein LOC104225535 341377 . . . 342443, [Nicotiana sylvestris] 342827 . . . 342891, 345833 . . . 346446, 346782 . . . 347228)) NDG13 join(79509 . . . 79744, PREDICTED: XP_009599950.1 98 113 128 g100627_Scaf- 162 79863 . . . 80141, uncharacterized fold0002504 80301 . . . 80715) protein LOC104095512 [Nicotiana tomentosiformis] NDG14 complement(join PREDICTED: XP_009764210.1 99 114 129 g100628_Scaf- 163 (297606. . . 297727, uncharacterized fold0002504 299439 . . . 299551, protein LOC104215965 300249 . . . 300331, [Nicotiana sylvestris] 300629 . . . 300802, 301088 . . . 301258, 301326 . . . 301450, 301535 . . . 301636, 301731 . . . 301859, 301942 . . . 302392)) NDG15 join(291110 . . . 291242, PREDICTED: XP_009785055.1 100 115 130 g100632_Scaf- 164 291376 . . . 291556, DNA ligase 1- fold0002504 291665 . . . 292004) like [Nicotiana sylvestris] Sequences of inverted repeat-containing RNAi cassettes are listed as SEQ ID Nos. The T-DNA cassette sequences of the RNAi vector can be found in SEQ ID Nos. 69 and 70.
TABLE-US-00016 TABLE16 SNPmarkersflankingNic1orNic2deletionregion.REFreferstothesequenceofareferenceTN90allele.ALT referstoanalternativealleleassociatedwiththecorrespondingdeletionregion.Genotypeinthe4 varieties(BU21,HI,LI,andLA)areshownwhere00 referstohomozygousforthereferenceTN90allele while11 referstohomozygousfortheALTallele.Thepolymorphicsiteinthesequenceisdenotedbyan X. SNP Marker Relative (SEQID Assc'd Positionto No.) Locus thedeletion REF ALT BU21 HI LI LA Sequence 131 Nic1 Upstream C A 00 00 11 11 ATCATGTCTAATTGATTTAATTGCTGTATTTGCTCAAACTGCCTT ATTTGGACTATGTGAXACATGCTAGGTTAGAAATATATGTTTTA ACTTGGTGTGAAATTTAATTTAATTGAGTATT(SEQIDNO.131) 132 Nic1 Upstream C T 00 00 11 11 GCGGCTGTATACCATTTTGTACGGACCGCAGTGGGCTCACCGTG GCCTCAATCGAGTTTGXGCGGTTCATAAAGATGGGGGTTCAGA GAGTTGGGAGTTTAGAGATTAAGACCAATACGGT(SEQIDNO. 132) 133 Nic1 Upstream T G 00 00 11 11 GGAAGCACTCAAGCATCCACTCTTGGAGGTGGTGGGGGAGGGT CTGGAATATTATCATTGXCCTGGTGGCTTCTCCTTTGTCTTTGAG GTACAATAGGAACCTCATCATCAATATTGTCAT(SEQIDNO.133) 134 Nic1 Downstream T C 00 00 11 11 ACGAAGGATAAAGTGTTTGGGTAGCAGAACAAAATGCCTTCGT CATTCCAGTCTTTAACAXATGCCAAGTGCAAACAATACAATTTA AATTTGTAGTCTCTTCTGATGGTGTTGGACTTAC(SEQIDNO. 134) 135 Nic1 Downstream C T 00 00 11 11 ACACCTTCTTCCGGGTTAACAGAATTCCATACTCGGATTTCTGG TTCGCAGACTGTAATAXGGAGTCAATCTTTTCCTCGATTTGGGA TTTGAACCGGTGATTTGGGAAATCATAATTATC(SEQIDNO.135) 136 Nic1 Downstream A G 00 00 11 11 TAGCTAACAAGGAATTGGATCAATTGAGAGATTGATTAACCCA ATTAAAGAGTTTAACCTXGAGATAGTAACAACATGACTTGAGCT CTTATCAACAGTTTTGGTTGATACCTTTTGGTCT(SEQIDNO.136) 137 Nic2 Upstream T C 00 11 00 11 TTACATAAATATAAAGGTTTAATTGAAAGTTATACTTTTTGGTC AAACACAAATACCGTAXCAAAATAGTTCGATACGGTTAGGTAT TTTCTTGTTTGGTTCGGTACGGCTTCGATATTAT(SEQIDNO.137) 138 Nic2 Upstream G A 00 11 00 11 GAAAATACCGACCGAAAACGGTCGAAAATAACATATTTTTTAA TTATTCCAACCGACTTCXGTCGGTTTGTTAAGATTTAAAAAGAA ATGCAAAATTATCACATAATTATATTTCCGACCG(SEQIDNO. 138) 139 Nic2 Upstream G A 00 11 00 11 GTCTGCACTTTTCTTATTGCTTATTGTTTACCCGAAAAATGGATA GAGTTGAATTTATACXTAGTTTTAAGGGTATGTGGTATAATTTA ATACAAATCGTAAGAATAAGTAGAAATATCAA(SEQIDNO.139) 140 Nic2 Downstream G A 00 11 00 11 TAGGATTTTGACCGTGGTTGGGAACTATGTGAAGACAACTCCGG AATAGAGTTATGTCGXTTCTGTTAGCTCCATTAGATGATTTTGG ACTTAGGGGCGTGTCCGGATTATGTTTTGGAG(SEQIDNO.140) 141 Nic2 Downstream A G 00 11 00 11 GTCCCTTACGAATTTGTCTTCAAATTGATACTTCTCCTTGCTAAA ACACCACGATCCTTAXCCACAACTCACCCCACGAACCCTAGCAT AGAACCACAACACCCTACGGCCCTTAAGAAAC(SEQIDNO.141) 142 Nic2 Downstream T C 00 11 00 11 GCCTCCCAGCTTAGCAAGAGTTCATCCGGCATTTCATTTTTCGAT GCTACAAAGGTATCAXGGCAATCCGTCTCATGTGTTGGATTTCA GCTCAGTCCAGTTGGACAAGGATCTATCTTAT(SEQIDNO.142)
TABLE-US-00017 TABLE17 SNPmarkersflankingtheERF-39likegenewhichisassociatedwithNic1deletion region.Listedarerelativeposition(Pos,Upstream/Downstream),Referenceallelein TN90(REF),Alternateallele(ALT),Genotypeinthe4varieties(BU21,HI,LIandLA BU21),andsequenceoftheSNPwithflankingpositionareprovidedinthistable. 00 referstohomozygousforthereferenceTN90allelewhile11 refersto homozygousfortheALTalleleand01 referstoheterozygous.Thepolymorphicsite inthesequenceisdenotedbyanX. SNP Marker Relative (SEQID Assc'd Positionto No.) Locus thedeletion REF ALT BU21 HI LI LA Sequence 143 ERF-39 Upstream A G 00 00 01 01 CCAAATTATTTTTGACTGTTTGACCA AAATAGCGACCAACGTTGGTCGCCA TTTTTGATCXTTTGACCAAAATGGCG ACCAACTTTGGTCGCTATATTTGAA AATAAATAAATAAAATAAT(SEQID NO.143) 144 ERF-39 Downstream TG T 00 00 11 11 TTGTTTCTCAAGAAAATCAGCATCG ATCTTTTTCTTTATTATAAAGGTAAT ATAGATGCTXXGGGTATTAAAAGAG GACAAAATATTCTGGCATCATTTGA GATTTGCTGAGTGCAATAACA(SEQ IDNO.144)
TABLE-US-00018 TABLE 18 A comparison of gene-specific primers and flanking SNP markers for genotyping the F.sub.2 population of Example 11 (segregating for nic1 and nic2 ((LA Burley 21 TN 90 LC) (X)), F2_1 to F2_72 plants refer to plant No. 1 to 72 of Table 12). 1 2 3 4 5 6 7 8 9 Genotyping of Nic1 locus using gene-specific primers for g100614_Scaffold0002504 as in Table 5. A F2_1 F2_9 F2_17 .sup.a, c F2_25 .sup.a, c F2_33 F2_41 F2_49 F2_57 F2_65 B F2_2 F2_10 F2_18 F2_26 F2_34 F2_42 F2_50 .sup.a, c F2_58 .sup.a, c F2_66 C F2_3 .sup.a, c F2_11 F2_19 .sup.a, c F2_27 F2_35 .sup.a, c F2_43 F2_51 .sup.a, c F2_59 F2_67 D F2_4 F2_12 F2_20 F2_28 F2_36 F2_44 F2_52 F2_60 F2_68 E F2_5 F2_13 F2_21 F2_29 F2_37 F2_45 .sup.a, c F2_53 F2_61 F2_69 .sup.a, c F F2_6 F2_14 F2_22 F2_30 F2_38 .sup.a, c F2_46 F2_54 F2_62 F2_70 G F2_7 F2_15 F2_23 F2_31 F2_39 .sup.a, c F2_47 F2_55 F2_63 F2_71 H F2_8 F2_16 F2_24 .sup.a F2_32 F2_40 F2_48 F2_56 F2_64 F2_72 .sup.a, c KASP genotyping of Nic 1using SNP marker SEC ID No. 135 A F2_1* F2_9 .sup.b F2_17 .sup.a, c F2_25 .sup.a, c F2_33 F2_41 .sup.b F2_49 F2_57 .sup.b F2_65* B F2_2 .sup.b F2_10 .sup.b F2_18 F2_26 F2_34 F2_42 .sup.b F2_50 .sup.a, c F2_58 .sup.a, c F2_66 .sup.b C F2_3 .sup.a, c F2_11 .sup.b F2_19 .sup.a, c F2_27 F2_35 .sup.a, c F2_43 .sup.b F2_51 .sup.a, c F2_59 .sup.b F2_67 .sup.b D F2_4 F2_12 .sup.b F2_20 F2_28 .sup.b F2_36 .sup.b F2_44 .sup.b F2_52 .sup.b F2_60 .sup.b F2_68 .sup.b E F2_5 .sup.b F2_13 .sup.b F2_21 .sup.b F2_29 .sup.b F2_37 F2_45 .sup.a, c F2_53 .sup.b F2_61 .sup.b F2_69 .sup.a, c F F2_6 .sup.b F2_14 F2_22 .sup.b F2_30 F2_38 .sup.a, c F2_46 .sup.b F2_54 .sup.b F2_62 F2_70 .sup.b G F2_7* F2_15 .sup.b F2_23 .sup.b F2_31 .sup.b F2_39 .sup.a, c F2_47 .sup.b F2_55 .sup.b F2_63 .sup.b F2_71 .sup.b H F2_8 .sup.b F2_16* F2_24* F2_32 .sup.b F2_40 .sup.b F2_48 .sup.b F2_56* F2_64 .sup.b F2_72 .sup.a, c Genotyping of Nic2 locus using gene-specific primers for ERF 189 as in Table 5. A F2_1 F2_9 .sup.a, c F2_17 .sup.a, c F2_25 F2_33 .sup.a, c F2_41 .sup.a, c F2_49 .sup.a, c F2_57 F2_65 B F2_2 F2_10 F2_18 F2_26 F2_34 F2_42 F2_50 F2_58 F2_66 C F2_3 F2_11 .sup.a, c F2_19 .sup.a, c F2_27 F2_35 F2_43 .sup.a, c F2_51 F2_59 F2_67 D F2_4 F2_12 .sup.a, c F2_20 F2_28 F2_36 F2_44 F2_52 .sup.a, c F2_60 F2_68 E F2_5 .sup.a, c F2_13 F2_21 .sup.a, c F2_29 .sup.a, c F2_37 .sup.a F2_45 .sup.a, c F2_53 F2_61 F2_69 F F2_6 F2_14 .sup.a, c F2_22 .sup.a, c F2_30 F2_38 F2_46 .sup.a, c F2_54 F2_62 F2_70 G F2_7 F2_15 F2_23 F2_31 F2_39 .sup.a, c F2_47 F2_55 F2_63 F2_71 H F2_8 F2_16 F2_24 .sup.a F2_32 F2_40 .sup.a F2_48 .sup.a, c F2_56 F2_64 F2_72 .sup.a KASP genotyping of Nic2 using SNP marker SEQ ID No. 137 A F2_1* F2_9 .sup.a, c F2_17 .sup.a, c F2_25 F2_33 .sup.b F2_41 .sup.a, c F2_49 .sup.a, c F2_57 .sup.b F2_65 B F2_2 .sup.b F2_10 .sup.b F2_18 .sup.b F2_26 .sup.b F2_34 .sup.a, c F2_42 .sup.b F2_50 .sup.b F2_58 .sup.b F2_66 .sup.b C F2_3 .sup.b F2_11 .sup.a, c F2_19 .sup.a, c F2_27 F2_35 F2_43 .sup.a, c F2_51 .sup.b F2_59 .sup.b F2_67 .sup.b D F2_4 F2_12 .sup.a, c F2_20 .sup.b F2_28 F2_36 .sup.b F2_44 .sup.b F2_52 .sup.a, c F2_60 F2_68 .sup.b E F2_5 .sup.a, c F2_13 .sup.b F2_21 .sup.a, c F2_29 .sup.a, c F2_37 .sup.b F2_45 .sup.a, c F2_53 .sup.b F2_61 F2_69 F F2_6* F2_14 .sup.a, c F2_22 .sup.a, c F2_30 .sup.b F2_38 F2_46 .sup.a, c F2_54 .sup.b F2_62 .sup.b F2_70 G F2_7 F2_15 .sup.b F2_23 .sup.b F2_31 F2_39 .sup.a, c F2_47 .sup.b F2_55 .sup.b F2_63 F2_71 .sup.b H F2_8 .sup.b F2_16 .sup.b F2_24* F2_32 .sup.b F2_40 .sup.b F2_48 .sup.a, c F2_56* F2_64 .sup.b F2_72*