ROTAVIRUS-LIKE PARTICLE PRODUCTION IN PLANTS
20190345454 ยท 2019-11-14
Assignee
Inventors
Cpc classification
C12N2720/12322
CHEMISTRY; METALLURGY
C12N2720/12334
CHEMISTRY; METALLURGY
C12N2720/12351
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N7/04
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
A method of producing a rotavirus-like particle (RLP) in a plant is provided. The method comprises expressing within a host or host cell for example a plant, portion of a plant or plant cell one or more nucleic acid comprising one or more regulatory region operatively linked to a first, second and third nucleotide sequence, the regulatory region active in the host or host cell. The first nucleotide sequence encoding a first rotavirus protein, the second nucleotide sequence encoding a second rotavirus protein and the third nucleotide sequence encoding a third rotavirus protein. The first, second and third encode rotavirus protein NSP4 and VP2 or VP6 and VP4 or VP7. The host or host cell is incubated under conditions that permit the expression of the nucleic acids, so that NSP4 and either VP2 of VP6 and VP4 or VP7 are expressed, thereby producing the RLP. Hosts comprising the RLP, compositions comprising the RLP and method for using the composition are also provided.
Claims
1. A method of increasing incorporation of VP4, VP7, or both VP4 and VP7 into a rotavirus like particle (RLP) comprising: a) providing a host or host cell comprising one or more nucleic acid comprising a first nucleotide sequence encoding a first rotavirus protein, a second nucleotide sequence encoding a second rotavirus protein, a third nucleotide sequence encoding a third rotavirus protein and a fourth nucleotide sequence encoding a fourth rotavirus protein; the first, second, third and fourth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and the first, second, third and fourth nucleotide sequence encoding one of rotavirus protein VP7, VP4, NSP4 and VP2 or VP6; b) incubating the host or host cell under conditions that permit the expression of the one or more nucleic acid, so that each of the VP7, VP4, NSP4 and VP2 or VP6 are expressed, thereby producing the RLP with enhanced levels of VP4, VP7, or both VP4 and VP7 when compared to the level of VP4 or VP7 produced by a second host or host cell that expresses the one or more nucleic acid that does not comprise NSP4, under the same conditions.
2. The method of claim 1, wherein the one or more nucleic acid further comprises a fifth nucleotide sequence encoding a fifth rotavirus protein, the first, second, third, fourth and fifth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and the first, second, third, fourth and fifth nucleotide sequence encoding one of rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and wherein each of VP2, VP4, VP6, VP7 and NSP4 are expressed from the one or more nucleic acid.
3. The method of claim 1, wherein the host or host cell comprises insect cells, mammalian cells, plant, portion of a plant or plant cells.
4. The method of claim 1, wherein the host or host cell comprises plant, portion of plant or plant cells.
5. The method of claim 1, wherein the one or more nucleic acid comprises one or more expression enhancer.
6. The method of claim 5, wherein the expression enhancer is selected from the group consisting of CPMV HT, CPMV 160, CPMV 160+ and CPMV HT+.
7. The method of claim 1, further comprising the steps of: c) harvesting the host or host cell, and d) purifying the RLPs from the host or host cell, wherein the RLPs range in size from 70-110 nm.
8. An RLP produced by the method of claim 2, wherein the RLP is a triple layered RLP comprising rotavirus protein, the rotavirus protein consisting of VP2, VP4, VP6 and VP7.
9. A composition comprising an effective dose of the RLP of claim 8 for inducing an immune response in a subject, and a pharmaceutically acceptable carrier.
10. A method of inducing immunity to a rotavirus infection in a subject, comprising administering the composition of claim 9 to the subject.
11. The method of claim 10, wherein the composition is administered to a subject orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
12. The method of claim 1, wherein the first rotavirus protein, the second rotavirus protein, the third rotavirus protein and fourth rotavirus protein are obtained from any one rotavirus strain having a genotype G1 to G27.
13. The method of claim 1, wherein the first rotavirus protein, the second rotavirus protein, the third rotavirus protein and the fourth rotavirus protein are obtained from a rotavirus strain having a genotype G1 or G4.
14. A plant, portion of a plant, a plant cell, a plant matter, or a plant extract comprising an RLP produced by the method of claim 1.
15. The method of claim 1, wherein the host or host cell comprises Nicotiana benthamiana, portion of Nicotiana benthamiana or Nicotiana benthamiana cells.
16. The method of claim 2, wherein the nucleotide sequence encoding VP2 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO: 21, the nucleotide sequence encoding VP4 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:32, the nucleotide sequence encoding VP6 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:27, the nucleotide sequence encoding VP7 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:37, the nucleotide sequence encoding NSP4 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:42.
17. The method of claim 2, wherein the VP2 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:24, the VP4 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:34, the VP6 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:29, the VP7 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO: 39, the NSP4 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:44.
18. A method of increasing incorporation of VP4, VP7, or both VP4 and VP7 in a rotavirus like particle (RLP) comprising: a) introducing into a host or host cell one or more nucleic acid comprising a first nucleotide sequence encoding a first rotavirus protein, a second nucleotide sequence encoding a second rotavirus protein, a third nucleotide sequence encoding a third rotavirus protein, and a fourth nucleotide sequence encoding a fourth rotavirus protein the first, second, third and fourth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and the first, second, third and fourth nucleotide sequence encoding one of rotavirus protein VP7, VP4, NSP4 and VP2 or VP6; b) incubating the host or host cell under conditions that permit the expression of the one or more nucleic acid, so that each of VP7, VP4, NSP4 and VP2 or VP6 are expressed, thereby producing the RLP with enhanced levels of VP4, VP7, or both VP4 and VP7 when compared to the level of VP4 or VP7 produced by a second host or host cell that expresses the one or more nucleic acid that does not comprise NSP4, under the same conditions.
19. The method of claim 18, wherein the one or more nucleic acid further comprises a fifth nucleotide sequence encoding a fifth rotavirus protein, the first, second, third, fourth and fifth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and the first, second, third, fourth and fifth nucleotide sequence encoding one of rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and wherein each of VP2, VP4, VP6, VP7 and NSP4 are expressed from the one or more nucleic acid.
20. The method of claim 18, wherein the host or host cell comprises insect cells, mammalian cells, plant, portion of a plant or plant cells.
21. The method of claim 18, wherein the host or host cell comprises plant, portion of plant or plant cells.
22. The method of claim 18, wherein the one or more nucleic acid comprises one or more expression enhancer.
23. The method of claim 22, wherein the expression enhancer is selected from the group consisting of CPMV HT, CPMV 160, CPMV 160+ and CPMV HT+.
24. The method of claim 18, further comprising the steps of: c) harvesting host or host cell, and d) purifying the RLPs from the host or host cell, wherein the RLPs range in size from 70-110 nm.
25. An RLP produced by the method of claim 19, wherein the RLP is a triple layered RLP comprising rotavirus protein, the rotavirus protein consisting of VP2, VP4, VP6 and VP7.
26. A composition comprising an effective dose of the RLP of claim 25 for inducing an immune response in a subject, and a pharmaceutically acceptable carrier.
27. A method of inducing immunity to a rotavirus infection in a subject, comprising administering the composition of claim 26 to the subject.
28. The method of claim 27, wherein the composition is administered to a subject orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
29. The method of claim 18, wherein the first rotavirus protein, the second rotavirus protein, the third rotavirus protein and fourth rotavirus protein are obtained from any one rotavirus strain having a genotype G1 to G27.
30. The method of claim 18, wherein the first rotavirus protein, the second rotavirus protein, the third rotavirus protein and the fourth rotavirus protein are obtained from a rotavirus strain having a genotype G1 or G4.
31. A plant, portion of a plant, a plant cell, a plant matter, or a plant extract comprising an RLP produced by the method of claim 18.
32. The method of claim 18, wherein the host or host cell comprises Nicotiana benthamiana, portion of Nicotiana benthamiana or Nicotiana benthamiana cells.
33. The method of claim 19, wherein the nucleotide sequence encoding VP2 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO: 21, the nucleotide sequence encoding VP4 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:32, the nucleotide sequence encoding VP6 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:27, the nucleotide sequence encoding VP7 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:37, the nucleotide sequence encoding NSP4 comprises from 80% to 100% identity with a nucleotide sequence as defined by SEQ ID NO:42.
34. The method of claim 19, wherein the VP2 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:24, the VP4 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:34, the VP6 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:29, the VP7 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO: 39, the NSP4 comprises an amino acid sequence having from 80% to 100% identity with the amino acid sequence as defined by SEQ ID NO:44.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0128] These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
DETAILED DESCRIPTION
[0150] The following description is of a preferred embodiment.
[0151] The present invention relates to virus-like particles (VLPs) comprising one or more rotavirus structural protein (i.e. a rotavirus like particle, rotavirus VLP or RLP), and methods of producing rotavirus-like particle (RLPs) in any host, particularly in plants, a portion of a plant, or a plant cell. Other hosts might comprise, for example, insect cells and mammalian cells. The rotavirus like particle (RLP) may comprise one or more rotavirus structural protein. The RLP may triple layered. The RLP may be produced by co-expressing rotavirus structural and nonstructural proteins in plant, however, the RLP does not comprise any rotavirus nonstructural proteins.
[0152] The host or host cell may be from any source including plants, fungi, bacteria, insect and animals. In a preferred embodiment the host or host cell is a plant or plant cell.
[0153] The present invention in part provides further a method of producing a rotavirus-like particle (RLP) in a host, such as a plant, a portion of a plant, or a plant cell. The method may comprise introducing one or more nucleic acid comprising a regulatory region active in the host, such as a plant, a portion of a plant, or a plant cell, the regulatory region operatively linked to a nucleotide sequence encoding one or more rotavirus structural protein and one or more rotavirus nonstructural protein into the host, such as into a plant, portion of the plant, or plant cell. Followed by incubating the host, such as a plant, portion of the plant, or plant cell under conditions that permit the expression of the nucleic acids, thereby producing the RLP comprising one or more rotavirus structural protein. The one or more rotavirus structural protein may be rotavirus protein VP2, VP4, VP6 or VP7. The rotavirus nonstructural protein may be NSP4. The RLP may be triple layered. The RLP may comprise rotavirus structural protein VP2, VP4, VP6 and VP7, and does not comprise the nonstructural protein NSP4.
[0154] The present invention in part provides further a method of producing a rotavirus like particle (RLP) in a host or host cell, the method may comprise: [0155] providing a host or host cell comprising one or more nucleic acid comprising a first nucleotide sequence encoding a first rotavirus protein, a second nucleotide sequence encoding a second rotavirus protein and a third nucleotide sequence encoding a third rotavirus protein, the first, second and third nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and [0156] the first, second and third nucleotide sequence encoding NSP4 and one or two of rotavirus protein VP2 or VP6 and one or two of rotavirus protein VP7 or VP4; [0157] incubating the host or host cell under conditions that permit the expression of the one or more nucleic acid, so that NSP4 and either VP2, VP4 and VP7, or VP2, VP6 and VP7, or VP2, VP6 and VP4, or VP6, VP4 and VP7, are expressed, thereby producing the RLP.
[0158] Furthermore, the one or more nucleic acid may comprise a fourth nucleotide sequence encoding a fourth rotavirus protein. The first, second, third, and fourth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and the first nucleotide sequence, the second nucleotide sequence, the third and fourth nucleotide sequence encoding rotavirus protein VP2, or VP6, VP4 or VP7 and NSP4, wherein NSP4 and wherein either VP2 or VP6 and VP4 or VP7 are expressed from the one or more nucleic acid.
[0159] Furthermore, the present invention in part provides a method of producing a rotavirus-like particle (RLP) vaccine candidate in a host, such as a plant, a portion of the plant, or a plant cell. The method may comprise expressing in a host, such as in a plant or portion of a plant, one or more nucleic acid (R.sub.1-R.sub.5) comprising one or more regulatory region active in the host, such as in the plant, portion of a plant, or plant cell, the regulatory region operatively linked to nucleotide sequences R.sub.1-R.sub.5, wherein nucleotide sequence R.sub.1 encodes rotavirus protein X.sub.1, nucleotide sequence R.sub.2 encodes rotavirus protein X.sub.2, nucleotide sequence R.sub.3 encodes rotavirus protein X.sub.3, nucleotide sequence R.sub.4 encodes rotavirus protein X.sub.4 and nucleotide sequence R.sub.5 encodes rotavirus protein X.sub.5 and each of X.sub.1-X.sub.5 are selected from the group of rotavirus protein VP2, VP4, VP6, VP7 and NSP4, so that each of VP2, VP4, VP6, VP7 and NSP4 are expressed in the host, such as in the plant, portion of the plant, or plant cell (see Table 1). The RLP may comprise rotavirus structural protein VP2, VP4, VP6 and VP7. The RLP does not comprise nonstructural protein NSP4.
[0160] It has been found that by introducing and co-expressing rotavirus structural protein and a rotavirus non-structural protein in the host, such as a plant or portion of the plant that the yield of the RLP produced may be modulated. In particular, it has been found that by co-expressing rotavirus structural proteins along with a rotavirus non-structural protein NSP4 in the host, such as a plant, portion of the plant, or plant cell, that the incorporation of structural protein VP4 ,VP7 or both VP4 and VP7 into the RLP may be increased, when compared to the level of VP4 and VP7 produced by a second host, such as a second plant, portion of a second plant, or second plant cell that expresses the same rotavirus structural proteins but that does not express the rotavirus non-structural protein, under the same conditions.
[0161] For example a method of increasing incorporation of VP4, VP7, or both VP4 and VP7 in a rotavirus like particle (RLP) is provided. The method comprises: [0162] a) providing a host or host cell comprising one or more nucleic acid comprising [0163] a first nucleotide sequence encoding a first rotavirus protein, a second nucleotide sequence encoding a second rotavirus protein, a third nucleotide sequence encoding a third rotavirus protein and a fourth nucleotide sequence encoding a fourth rotavirus protein; the first, second, third and fourth nucleotide sequence being operatively linked to one or more regulatory region active in the host or host cell; and [0164] the first, second, third and fourth nucleotide sequence encoding one of rotavirus protein VP7, VP4, NSP4 and VP2 or VP6; [0165] b) incubating the host or host cell under conditions that permit the expression of the one or more nucleic acid, so that each of the VP7, VP4, NSP4 and VP2 or VP6 and are expressed, thereby producing the RLP with enhanced levels of VP4, VP7, or both VP4 and VP7 when compared to the level of VP4 or VP7 produced by a second host or host cell that expresses the one or more nucleic acid that does not comprise NSP4, under the same conditions.
[0166] Furthermore, an alternative method of increasing production of VP4 ,VP7 or both VP4 and VP7 in a rotavirus like particle (RLP) may comprises:
[0167] a) introducing into a plant, portion of a plant or plant cell one or more nucleic acid comprising one or more regulatory operatively linked to a first, second, third, fourth and fifth nucleotide sequence, the one or more regulatory region active in the plant, portion of the plant or the plant cell, the first nucleotide sequence encoding a first rotavirus protein, the second nucleotide sequence encoding a second rotavirus protein, the third nucleotide sequence encoding a third rotavirus protein, the fourth nucleotide sequence encoding a fourth rotavirus protein and the fifth nucleotide sequence encoding a fifth rotavirus protein, each of the first, second, third, fourth or fifth nucleotide sequence encoding one of VP2, VP4, VP6, VP7 or NSP4, and
[0168] b) incubating the plant, portion of a plant or plant cell under conditions that permit the transient expression of the one or more nucleic acid so that each of VP2, VP4, VP6, VP7 and NSP4 are transiently expressed, thereby producing the RLP with enhanced levels of VP4 and VP7 when compared to the level of VP4 and VP7 produced by a second plant, portion of a second plant, or second plant cell that expresses the one or more nucleic acid that does not comprise NSP4, under the same conditions.
[0169] If desired, the method may further comprises the steps of:
[0170] c) harvesting the plant, portion of a plant or plant cell, and
[0171] d) purifying the RLPs from the plant, portion of a plant or plant cell, wherein the RLPs range in size from 70-100 nm.
[0172] An alternate method of increasing production of VP4 ,VP7 or both VP4 and VP7 in a rotavirus like particle (RLP) is also provided, the method comprising:
[0173] a) providing a plant, portion of a plant or plant cell comprising one or more nucleic acid comprising one or more regulatory region operatively linked to a first, second, third, fourth and fifth nucleotide sequence, the one or more regulatory region active in the plant, portion of the plant or the plant cell, the first nucleotide sequence encoding a first rotavirus protein, the second nucleotide sequence encoding a second rotavirus protein, the third nucleotide sequence encoding a third rotavirus protein, the fourth nucleotide sequence encoding a fourth rotavirus protein and the fifth nucleotide sequence encoding a fifth rotavirus protein, each of the first, second, third, fourth and fifth nucleotide sequence encoding one of VP2, VP4, VP6, VP7 or NSP4, and
[0174] b) incubating the plant, portion of a plant or plant cell under conditions that permit the expression of the one or more nucleic acid, so that each of the VP2, VP4, VP6, VP7 and NSP4 are expressed, thereby producing the RLP with enhanced levels of VP4 and VP7 when compared to the level of VP4 and VP7 produced by a second plant, portion of a second plant, or second plant cell that expresses the one or more nucleic acid that does not comprise NSP4, under the same conditions.
[0175] It has been further found that by modulating the ratio between constructs comprising nucleic acids encoding rotavirus structural proteins and the non-structural protein NSP4 during transient expression in the host, such as a plant, portion of the plant, or plant cell, the yield of RLP production and the incorporation of structural proteins VP4 and VP7 into the RLP may be improved.
[0176] Without wishing to be bound by theory, the co-expression of a rotavirus non-structural protein for example NSP4 together with one or more rotavirus structural protein for example VP2, VP4, VP6 and/or VP7 may lead to an increase in incorporation of VP4 and/or VP7 into RLPs. This increase of incorporation of VP4 and/or VP7 into RLPs may occur via an increase of expression or production of the rotavirus proteins and/or because of an increase of the efficacy of the assembly of RLPs and/or an increase of recruiting of the rotavirus proteins at the RLP assembly site.
[0177] As shown in
[0178] The ratios of the constructs encoding the various structural and non-structural proteins that are transiently expressed in the host, such as a plant, portion of the plant, or plant cell, may be altered by providing constructs comprising nucleic acid sequences encoding rotavirus structural proteins and the non-structural protein NSP4 on two, three, four or five constructs and varying the amount of each construct during the step of introducing the construct in the host (using Agrobacterium to the plant, plant portion or plant cell). For example, five separate constructs, each encoding one structural protein and the non-structural protein, may be co-introduced at various ratios resulting co-expression of the nucleic acids at various ratios within a plant, plant portion, or plant cell. Alternatively, the nucleic acid sequences may be provided in various combinations on two, three or four constructs and the constructs co-introduced in the plant, portion of the plant, or plant cell, at various ratios, as described below.
[0179] Additionally, the nucleic acid sequences may be provided on the same construct.
[0180] Rotavirus protein may refer to rotavirus structural protein or rotavirus nonstructural proteins. A rotavirus structural protein may refer to all or a portion of a rotavirus structural protein isolated from rotavirus, present in any naturally occurring, or a variant of any naturally occurring, rotavirus strain or isolate. Thus, the term rotavirus structural protein includes a naturally occurring rotavirus structural protein, or a variant of a rotavirus structural protein that may be produced by mutation during the virus life-cycle or produced in response to selective pressure (e.g., drug therapy, expansion of host cell tropism, or infectivity, etc.). As one of skill in the art appreciates, such rotavirus structural proteins and variants thereof may be also produced using recombinant techniques. Rotavirus structural proteins may include capsid proteins such for example VP2 and VP6, surface proteins, for example VP4, or a combination of capsid and surface proteins. The structural protein may further include for example VP7.
[0181] By rotavirus non structural protein, nonstructural protein, non-structural protein, NSP or nonstructural rotavirus protein it is meant a protein that is encoded by the rotavirus genome, but not packaged into the viral particle. Non-limiting examples of rotavirus nonstructural proteins are rotavirus NSP4.
[0182] By co-expressed it is meant that two, or more than two, nucleotide sequences are expressed at about the same time within the plant, within the same tissue of the plant and within the same cells in the plant. The nucleotide sequences need not be expressed at exactly the same time. Rather, the two or more nucleotide sequences are expressed in a manner such that the encoded products have a chance to interact within a desired cellular compartment. For example, the non-structural protein may be preferably expressed either before or during the period when the structural proteins are expressed. The two or more than two nucleotide sequences can be co-expressed using a transient expression system, where the two or more sequences are introduced within the plant at about the same time, under conditions that the two or more sequences are expressed. The two or more than two sequences may be present on different constructs, and co-expression requires introduction of each of the constructs into the plant, portion of plant or plant cell, or the two or more than two sequences may be present on one construct and the construct introduced into the plant, portion of plant or plant cell.
[0183] The term virus-like particle (VLP), or virus-like particles or VLPs refers to structures that self-assemble and comprise one or more structural proteins such as for example rotavirus structural protein, for example but not limited to VP2, VP4, VP6, VP7, or a combination of VP2, VP4, VP6, VP7, structural protein. VLPs comprising rotavirus structural protein maybe also be referred to rotavirus VLP, rotavirus-like particle (RVLP), rotavirus-like particle (RLP), rotavirus-like particle, RVLP or RLP. VLPs or RLPs are generally morphologically and antigenically similar to virions produced in an infection, but lack genetic information sufficient to replicate and thus are non-infectious. VLPs may be produced in suitable eukaryotic host cells including plant host cells. Following extraction from the host cell and upon isolation and further purification under suitable conditions, VLPs may be recovered as intact structures. The RLP may be a single, double, or triple-layered RLP. Triple-layered RLPs may be obtained by the simultaneous expression of three or more rotavirus structural proteins, and as described herein, co-expression with one or more non-structural protein. For example, the co-expression of structural proteins VP2, VP6, VP7, VP4 and nonstructural protein NSP4 results in producing triple-layered RLPs.
[0184] Co-expression of VP4, along with VP2, VP6, VP7, and one or more non-structural protein as required, results in a particle with spikes that resembles native rotavirus. VP4 may be processed or cleaved to produce VP5 and VP8. This processing may take place within the host using endogenous proteases, or by co-expressing a suitable protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin. Alternatively, VP4 may be processed to produce VP5 and VP8 by adding a suitable protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin during any step of the RLP extraction procedure, or after RLP purification.
[0185] Each of the rotavirus structural proteins has different characteristics and size, and is required in different amounts for assembly into RLP. The term rotavirus VLP, rotavirus virus-like particle (RVLP), rotavirus virus-like particle (RLP), rotavirus virus-like particle, RVLP or RLP refers to a virus-like particle (VLP) comprising one or more rotavirus structural proteins. Example of rotavirus structural proteins may include, but are not limited to VP2, VP4 (or VP5 and VP8) VP6 and VP7 structural protein. The RLP may not comprise rotavirus nonstructural proteins.
[0186] The present invention provides for a method of producing RLPs in a plant, wherein one or more nucleic acid (N.sub.1-N.sub.5) comprising one or more regulatory region active in the plant are operatively linked to nucleotide sequences R.sub.1-R.sub.5, wherein nucleotide sequence R.sub.1 encodes rotavirus protein X.sub.1, nucleotide sequence R.sub.2 encodes rotavirus protein X.sub.2, nucleotide sequence R.sub.3 encodes rotavirus protein X.sub.3, nucleotide sequence R.sub.4 encodes rotavirus protein X.sub.4 and nucleotide sequence R.sub.5 encodes rotavirus protein X.sub.5 and wherein X.sub.1-X.sub.5 are selected from the group of rotavirus protein VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are each selected once (see Table 1). The final set, or combination, of nucleic acids used to transform the host results in the expression of each rotavirus protein within the host resulting in expression of VP2, VP4, VP6, VP7 and NSP4 and formation of an RLP.
[0187] For example, with reference to Table 1, 2 nucleic acids (N.sub.1 and N.sub.2), may be used to transform a host, (see example #2.1). In this case N.sub.1 comprises the R.sub.1 nucleotide sequence and R.sub.1 may encode one of VP2, VP4, VP6, VP7, or NSP4. The nucleic acid N.sub.2 comprises four sequences R.sub.2 to R.sub.5, each of R.sub.2 to R.sub.5 encoding one of VP2, VP4, VP6, VP7, or NSP4, but not the protein encoded by R.sub.1, so that each of the VP2, VP4, VP6, VP7 and NSP4 are expressed within the host, thereby producing the RLP. As a non-limiting example, N.sub.1 may comprise R.sub.1 which may encode VP2, and N.sub.2 may comprise R.sub.2 to R.sub.5 which may encode VP4, VP6, VP7 and NSP4 respectively.
[0188] Table 1, provides an overview of combinations, which is not to be considered limiting, of nucleic acids (N), and nucleotide sequences (R) that may be expressed or co-expressed within a host to produce an RLP comprising VP2, VP4, VP6, and VP7.
TABLE-US-00001 TABLE 1 Total # Nucleic Combination # Acids 1.1 Nucleic N.sub.1 1 1.2 Acids N.sub.1 1 1.3 N.sub.1 1 2.1 N.sub.1 N.sub.2 2 2.2 N.sub.1 N.sub.2 2 2.3 N.sub.1 N.sub.2 2 2.4 N.sub.1 N.sub.2 2 2.5 N.sub.1 N.sub.2 2 3.1 N.sub.1 N.sub.2 N.sub.3 3 3.2 N.sub.1 N.sub.2 N.sub.3 3 3.3 N.sub.1 N.sub.2 N.sub.3 3 3.4 N.sub.1 N.sub.2 N.sub.3 3 4.1 N.sub.1 N.sub.2 N.sub.3 N.sub.4 4 4.2 N.sub.1 N.sub.2 N.sub.3 N.sub.4 4 5 N.sub.2 N.sub.2 N.sub.3 N.sub.4 N.sub.5 5 Nucleotide Sequence R.sub.1 R.sub.2 R.sub.3 R.sub.4 R.sub.5 Rotavirus Protein Protein X.sub.1 X.sub.2 X.sub.3 X.sub.4 X.sub.5 type X.sub.(1-5) may VP2 VP2 VP2 VP2 VP2 Structural be* VP4 VP4 VP4 VP4 VP4 Structural VP6 VP6 VP6 VP6 VP6 Structural VP7 VP7 VP7 VP7 VP7 Structural NSP4 NSP4 NSP4 NSP4 NSP4 Non- structural *For combinations 1.1, 2.1, 2.2, 3.1, 3.2, 4.1 and 5: X.sub.1, X.sub.2, X.sub.3, X.sub.4 and X.sub.5 each have to be a different rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4. For combination 1.3, 2.5 and 3.4: X.sub.1, X.sub.2 and X.sub.3 each have to be a different rotavirus protein selected from either VP4, VP6 and NSP4 or VP7, VP6 and NSP4. For combination 1.2, 2.3, 2.4, 3.3 and 4.2: X.sub.1, X.sub.2, X.sub.3 and X.sub.4 each have to be a different rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, VP2, VP7, VP6 and NSP4 or VP4, VP7, VP6 and NSP4.
[0189] 1. One Construct
[0190] 1.1 Quintuple Gene Construct
[0191] As described herein, a method of producing RLPs in a plant is provided, wherein a nucleic acid (N.sub.1; a first nucleic acid) comprising a first, second, third, fourth and fifth nucleotide sequences (R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5) encoding a first, second, third, fourth and fifth rotavirus protein (X.sub.1, X.sub.2, X.sub.3, X.sub.4, X.sub.5) is expressed in a plant or portion of a plant (See Table 1, Combination #1.1).
[0192] Accordingly, nucleic acid N.sub.1 comprises nucleotide sequences R.sub.1, R.sub.2, R.sub.3, R.sub.4 and R.sub.5, wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that a nucleotide sequence encoding for each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 in the transformed host.
[0193] The nucleic acid may comprise a nucleotide sequence R.sub.1, wherein R.sub.1 may encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and nucleotide sequences R.sub.2-R.sub.5, wherein R.sub.2-R.sub.5 encode a rotavirus protein selected from VP2, VP4, VP6, VP7 or NSP4, and wherein the rotavirus protein is not encoded by R.sub.1. For example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP4. In yet another non-limiting example, nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP6. In yet another example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4, but R.sub.2-R.sub.5 may not encode VP7. In yet another example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7. but R.sub.2-R.sub.5 may not encode NSP4.
[0194] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP7, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP4, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein NSP4, a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein VP6 and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein, for example rotavirus protein VP2.
[0195] In a further non-limiting example the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP4, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP7, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein NSP4, a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein VP6 and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein, for example rotavirus protein VP2.
[0196] In a further non-limiting example the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP4, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP7, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein VP6, a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein VP2 and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein, for example rotavirus protein NSP4.
[0197] In another non-limiting example the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP7, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP4, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein VP6, a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein VP2 and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein, for example rotavirus protein NSP4. (see
[0198] The VP4 may be processed or cleaved to produce VP5 and VP8 within the host by co-expressing a nucleic acid encoding a suitable protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin. Alternatively, VP4 may be processed during any step of RLP extraction, or after RLP purification by adding a sutible protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin.
1.2. Quadruple Gene Construct
[0199] As described herein, a method of producing RLPs in a plant is provided, wherein a nucleic acid (N.sub.1; a first nucleic acid) comprising a first, second, third and fourth nucleotide sequences (R.sub.1, R.sub.2, R.sub.3, R.sub.4) encoding a first, second, third and fourth rotavirus protein (X.sub.1, X.sub.2, X.sub.3, X.sub.4) is expressed in a plant or portion of a plant (See Table 1, Combination #1.2).
[0200] Accordingly, nucleic acid N.sub.1 may comprises nucleotide sequences (R.sub.1, R.sub.2, R.sub.3, R.sub.4), wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that a nucleotide sequence encoding for each rotavirus protein VP2, VP4, VP6 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP2, VP4, VP6 and NSP4 in the transformed host.
[0201] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP6, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP4, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus proteinVP2, and a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein NSP4.
[0202] Further accordingly, nucleic acid N.sub.1 may comprises nucleotide sequences (R.sub.1, R.sub.2, R.sub.3, R.sub.4), wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that a nucleotide sequence encoding for each rotavirus protein VP2, VP7, VP6 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP2, VP7, VP6 and NSP4 in the transformed host.
[0203] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP6, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP7, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus proteinVP2, and a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein NSP4.
[0204] Further accordingly, nucleic acid N.sub.1 may comprises nucleotide sequences (R.sub.1, R.sub.2, R.sub.3, R.sub.4), wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP7, VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP7, VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP7, VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP7, VP4, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that a nucleotide sequence encoding for each rotavirus protein VP7, VP4, VP6 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP7, VP4, VP6 and NSP4 in the transformed host.
[0205] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP6, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP4, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus proteinVP7, and a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein, for example rotavirus protein NSP4.
1.3 Triple Gene Construct
[0206] As described herein, a method of producing RLPs in a plant is provided, wherein a nucleic acid (N.sub.1; a first nucleic acid) comprising a first, second and third nucleotide sequences (R.sub.1, R.sub.2, R.sub.3) encoding a first, second and third rotavirus protein (X.sub.1, X.sub.2, X.sub.3) is expressed in a plant or portion of a plant (See Table 1, Combination #1.3).
[0207] Accordingly, nucleic acid N.sub.1 may comprises nucleotide sequences (R.sub.1, R.sub.2, R.sub.3), wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that a nucleotide sequence encoding for each rotavirus protein VP4, VP6 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP4, VP6 and NSP4 in the transformed host.
[0208] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP6, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP4, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein.
[0209] Further accordingly, nucleic acid N.sub.1 may comprises nucleotide sequences (R.sub.1, R.sub.2, R.sub.3), wherein R.sub.1 encodes rotavirus protein X.sub.1, where X.sub.1 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that a nucleotide sequence encoding for each rotavirus protein VP7, VP6 and NSP4 is comprised on nucleic acid N.sub.1, thereby allowing for the expression of each rotavirus protein VP7, VP6 and NSP4 in the transformed host.
[0210] For example, which is not to be considered limiting, the nucleotide sequence (N.sub.1) comprises a first nucleotide sequences (R.sub.1) encoding a first rotavirus protein, for example rotavirus protein VP6, a second nucleotide sequences (R.sub.2) encoding a second rotavirus protein, for example rotavirus protein VP7, a third nucleotide sequences (R.sub.3) encoding a third rotavirus protein, for example rotavirus protein.
[0211] 2. Two Constructs
[0212] 2.1. Quadruple Gene Construct+Single Gene Construct
[0213] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), is co-expressed with a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein (X.sub.2-X.sub.5) (see Table 1, Combination #2.1), so that the first, second, third, fourth and fifth nucleotide sequence (R.sub.1-R.sub.5) are co-expressed in the plant.
[0214] In this non-limiting example, N.sub.1 comprises nucleotide sequence (R.sub.1) and N.sub.2 comprises nucleotide sequences (R.sub.2, R.sub.3, R.sub.4, R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 is encoded in the combination of both constructs N.sub.1 and N.sub.2, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0215] For example, which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP6. In yet another example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4, but R.sub.2-R.sub.5 may not encode VP7. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7, but R.sub.2-R.sub.5 may not encode NSP4.
[0216] The first nucleic acid (N.sub.1) and second nucleic acid (N.sub.2) may be introduced into the plant in the same step, or may be introduced to the plant sequentially.
[0217] For example, which is not to be considered limiting, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP7, VP4, VP6 and VP2, respectively (see
[0218] In another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP4, VP7, VP6 and VP2, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP7, VP4, VP2 and VP6, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP4, VP7, VP2 and VP6, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP6, VP2, VP4 and VP7, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP6, VP2, VP7 and VP4, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP2, VP4, VP6 and VP7, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example NSP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example VP7, VP6, VP4 and VP2, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example VP7, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example NSP4, VP2, VP6 and VP4, respectively. In yet another non-limiting example, a first nucleotide sequence (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example VP4, is co-expressed with a second nucleic acid (N.sub.2) comprising four sequential nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example NSP4, VP2, VP6 and VP7, respectively.
[0219] A plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), may be transformed with a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein (X.sub.2-X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Furthermore, a plant that expresses a first nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a rotavirus protein X.sub.2-X.sub.5 may be transformed with a second nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a rotavirus protein (X.sub.1), so that the first and second nucleotide sequences RI-R.sub.5 are co-expressed in the plant. The rotavirus protein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and rotavirus proteins X.sub.2-X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, but not X.sub.1, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed. Furthermore, a plant may be simultaneously co-transformed with a first nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a rotavirus protein X.sub.2-X.sub.5, and with a second nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a rotavirus protein (X.sub.1), so that the first and second nucleotide sequences R.sub.1-R.sub.5 are co-expressed in the plant. The rotavirus protein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and rotavirus proteins X.sub.2-X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, but not the protein selected for X.sub.1, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed. The first nucleic acid (N.sub.1) and second nucleic acid (N.sub.2) may be introduced in the plant in a transient manner, or in a stable manner.
[0220] For example, which is not to be considered limiting, a plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) for example NSP4, may be transformed with a second nucleic acid encoding (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein (X.sub.2-X.sub.5), for example VP7, VP4, VP6 and VP2, so that NSP4, VP7, VP4, VP6 and VP2 are co-expressed in the plant.
[0221] A first plant expressing a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), may be crossed with a second plant expressing the second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein (X.sub.2-X.sub.5) to produce a progeny plant (third plant) that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Furthermore, a first plant expressing a first nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a rotavirus protein X.sub.2-X.sub.5 may be crossed with a second plant expressing a second nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a rotavirus protein (X.sub.1), so that nucleotide sequences R.sub.1-R.sub.5 are co-expressed in the progeny plant. The rotavirus protein may be any rotavirus protein selected from the group of rotavirus protein VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the progeny plant.
[0222] The VP4 may be processed or cleaved to produce VP5 and VP8 within the host by co-expressing a nucleic acid encoding a suitable protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin. Alternatively, VP4 may be processed during any step of RLP extraction, or after RLP purification by adding a suitable protease, for example, trypsin, a trypsin-like protease, a serine protease, a chymotrypsin-like protease, subtilisin.
2.2 Triple Gene Construct+Dual Gene Construct
[0223] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising two nucleotide sequences (R.sub.1 and R.sub.2) encoding a first rotavirus protein (X.sub.1) and second rotavirus protein (X.sub.2) respectively, is co-expressed with a second nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a third, fourth and fifth rotavirus proteins (X.sub.3-X.sub.5) (see Table 1, Combination #2.2), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant.
[0224] In a non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequences (R.sub.3, R.sub.4, R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0225] Therefore, the first nucleic acid (N.sub.1) may comprise a nucleotide sequence R.sub.1, wherein R.sub.1 may encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and a second nucleotide sequence R.sub.2 which may encode any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, that is not encoded by R.sub.1. The second nucleic acid (N.sub.2) may comprise nucleotide sequences R.sub.3-R.sub.5, wherein R.sub.3-R.sub.5 encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not rotavirus protein that are encoded by R.sub.1 or R.sub.2. For example, which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4. In yet another example nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7.
[0226] A plant that expresses a first nucleic acid (N.sub.1) comprising a first and second nucleotide sequence (R.sub.1+R.sub.2) encoding a first and second rotavirus protein (X.sub.1+X.sub.2), may be transformed with a second nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a third, fourth and fifth rotavirus protein (X.sub.3-X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1) and second nucleic acid (N.sub.2) may be introduced in the plant in a transient manner, or in a stable manner.
[0227] Furthermore, a plant that expresses a first nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a first, second and third rotavirus protein (X.sub.3-X.sub.5) may be transformed with a second nucleic acid (N.sub.1) comprising a fourth nucleotide sequence (R.sub.1) encoding a fourth rotavirus protein (X.sub.1) and a fifth rotavirus protein (X.sub.2) so that the first and second nucleic acids R.sub.1-R.sub.5 are co-expressed in the plant. The rotavirus protein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and rotavirus proteins X.sub.2-X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, but not X.sub.1, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed. For example, which is not to be considered limiting, a plant that expresses a first nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a first, second and third rotavirus proteins (X.sub.3-X.sub.5), for example VP7, VP4 and VP6 may be transformed with a second nucleic acid encoding (N.sub.1) comprising a fourth and a fifth nucleotide sequences (R.sub.1-R.sub.2) encoding a fourth and a fifth rotavirus protein (X.sub.1-X.sub.2) for example VP2 and NSP4, so that NSP4, VP7, VP4, VP6 and VP2 are co-expressed in the plant. Furthermore, a plant may be simultaneously co-transformed with a first nucleic acid (N.sub.1) comprising a first and second nucleotide sequence (R.sub.1+R.sub.2) encoding a first and second rotavirus protein (X.sub.1+X.sub.2), and a second nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a third, fourth and fifth rotavirus protein (X.sub.3-X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1) and second nucleic acid (N.sub.2) may be introduced in the plant in a transient manner, or in a stable manner.
[0228] A first plant expressing a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) and a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), may be crossed with a second plant expressing the second nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a third, fourth and fifth rotavirus protein (X.sub.3-X.sub.5) to produce a progeny plant (third plant) that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Furthermore, a first plant expressing a first nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.3-R.sub.5) encoding a rotavirus protein X.sub.3-X.sub.5 may be crossed with a second plant expressing a second nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a rotavirus protein (X.sub.1) and a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), so that nucleotide sequences R.sub.1-R.sub.5 are co-expressed in the progeny plant. The rotavirus protein may be any rotavirus protein selected from the group of rotavirus protein VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the progeny plant.
2.3. Triple Gene Construct+Single Gene Construct
[0229] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising one nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), is co-expressed with a second nucleic acid (N.sub.2) comprising three nucleotide sequences (R.sub.2-R.sub.4) encoding a second, third and fourth rotavirus proteins (X.sub.2-X.sub.4), so that the first, second, third and fourth nucleotide sequence are co-expressed in the plant (See Table 1, Combination #2.3).
[0230] In a non-limiting example, N.sub.1 comprises nucleotide sequence (R.sub.1) and N.sub.2 comprises nucleotide sequences (R.sub.2, R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP4, VP6 and NSP4 is expressed in the host.
[0231] In a further non-limiting example, N.sub.1 comprises nucleotide sequence (R.sub.1) and N.sub.2 comprises nucleotide sequences (R.sub.2, R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP7, VP6 and NSP4 is expressed in the host.
[0232] In yet a further non-limiting example, N.sub.1 comprises nucleotide sequence (R.sub.1) and N.sub.2 comprises nucleotide sequences (R.sub.2, R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP4, VP7, VP6 and NSP4 is expressed in the host.
2.4 Two Double Gene Constructs
[0233] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising nucleotide sequences (R.sub.1-R.sub.2) encoding a first and a second rotavirus proteins (X.sub.1-X.sub.2), is co-expressed with a second nucleic acid (N.sub.2) comprising two nucleotide sequences (R.sub.3-R.sub.4) encoding a third and fourth rotavirus proteins (X.sub.3-X.sub.4), so that the first, second, third and fourth nucleotide sequences are co-expressed in the plant (See Table 1, Combination #2.4).
[0234] In a non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequences (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP4, VP6 and NSP4 is expressed in the host.
[0235] In a further non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequences (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP7, VP6 and NSP4 is expressed in the host.
[0236] In yet a further non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequences (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP4, VP7, VP6 and NSP4 is expressed in the host.
2.5 Double Gene Construct+Single Gene Construct
[0237] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising nucleotide sequences (R.sub.1-R.sub.2) encoding a first and a second rotavirus proteins (X.sub.1-X.sub.2), is co-expressed with a second nucleic acid (N.sub.2) comprising a nucleotide sequence (R.sub.3) encoding a third rotavirus proteins (X.sub.3), so that the first, second and third nucleotide sequences are co-expressed in the plant (See Table 1, Combination #2.5).
[0238] In a non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequence (R.sub.3), wherein each rotavirus protein selected from the group of VP4, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that each rotavirus protein VP4, VP6 and NSP4 is expressed in the host.
[0239] In a further non-limiting example, N.sub.1 comprises nucleotide sequences (R.sub.1, R.sub.2) and N.sub.2 comprises nucleotide sequence (R.sub.3), wherein each rotavirus protein selected from the group of VP7, VP6 and NSP4 is encoded and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that each rotavirus protein VP7, VP6 and NSP4 is expressed in the host.
[0240] 3. Three Constructs
[0241] 3.1 Two Dual Gene Constructs+One Single Gene Construct
[0242] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) and a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), is co-expressed with a second nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3) and a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a third nucleic acid (N.sub.3) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) (see Table 1, Combination #3.1) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant.
[0243] In this non-limiting example, N.sub.1 comprises (R.sub.1, R.sub.2), N.sub.2 comprises (R.sub.3, R.sub.4) and N.sub.3 comprises (R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0244] For example, the first nucleic acid (N.sub.1) may comprise a nucleotide sequence R.sub.1, wherein R.sub.1 may encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and a second nucleotide sequence R.sub.2 which may encode any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 that is not encoded by R.sub.1. The second nucleotide sequence may comprise nucleotide sequences R.sub.3 and R.sub.4, wherein R.sub.3 encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1 or R.sub.2, and R.sub.4 encodes rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1, R.sub.2 or R.sub.3. The third nucleotide sequence may comprise nucleotide sequences R.sub.5, wherein R.sub.5 encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1, R.sub.2, R.sub.2 or R.sub.4, so that each of VP2, VP4, VP6, VP7 or NSP4 are expressed in a host.
[0245] For example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another example nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4. In yet another example nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7.
[0246] For example, which is not to be considered limiting, a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example VP6 and a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein, for example VP2, is co-expressed with a second nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein for example VP7 and a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein, for example VP4 and a third nucleic acid (N.sub.3) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein for example NSP4. (see
[0247] A plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) and a second rotavirus protein (X.sub.2), may be transformed with a second nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3) and a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4). The plant may be further transformed with a third nucleic acid (R.sub.3) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant. Furthermore, a plant may be simultaneously co-transformed with a first nucleic acid (N.sub.1) comprising a first and second nucleotide sequence (R.sub.1+R.sub.2) encoding a first and second rotavirus protein (X.sub.1+X.sub.2), a second nucleic acid (N.sub.2) comprising a third and a fourth nucleotide sequences (R.sub.3+R.sub.4) encoding a third and a fourth rotavirus protein (X.sub.3+X.sub.4), and a third nucleic acid (N.sub.3) comprising a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein (X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1), second nucleic acid (N.sub.2) and third nucleic acid (N.sub.3) may be introduced in the plant in a transient manner, or in a stable manner.
3.2 Two Single Gene Constructs+One Triple Gene Construct
[0248] An alternated method of producing RLPs in a plant is also provided, wherein a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) and a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) (see Table 1, Combination #3.2) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant.
[0249] In an alternate example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3, R.sub.4, R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0250] For example which is not to be considered limiting, the first nucleic acid (N.sub.1) may comprise a nucleotide sequence R.sub.1, wherein R.sub.1 may encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4 and a second nucleotide sequence R.sub.2 which may encode any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 that is not encoded by R.sub.1. The second nucleotide sequence may comprise nucleotide sequences R.sub.3 and R.sub.4, wherein R.sub.3 encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1 or R.sub.2 and R.sub.4 encodes rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1, R.sub.2 or R.sub.3. The third nucleotide sequence may comprise nucleotide sequences R.sub.5, wherein R.sub.5 encode rotavirus protein VP2, VP4, VP6, VP7 or NSP4, but not a rotavirus protein that are encoded by R.sub.1, R.sub.2, R.sub.3 or R.sub.4, and wherein VP2, VP4, VP6, VP7 or NSP4 are encoded once. For example nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another example nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4. In yet another example nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4. In yet another example nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4. In yet another example nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7.
[0251] A plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) may be transformed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2). The plant may be further transformed with a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant. Furthermore, a plant may be simultaneously co-transformed with a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), and a third nucleic acid (N.sub.3) comprising a third, a fourth and a five nucleotide sequences (R.sub.3-R.sub.5) encoding a third, a fourth and a fifth rotavirus protein (X.sub.3-X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1), second nucleic acid (N.sub.2) and third nucleic acid (N.sub.3) may be introduced in the plant in a transient manner, or in a stable manner.
[0252] For example, a first plant expressing a first nucleic acid (N.sub.1) comprising a first, second and third nucleotide sequence (R.sub.1, R.sub.2, and R.sub.3) encoding a first, second and third rotavirus protein (X.sub.1, X.sub.2, and X.sub.3) may be crossed with a second plant expressing a second nucleic acid (N.sub.2) comprising a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) to produce a progeny plant (third plant). The third plant may be crossed with a fourth plant expressing a third nucleic acid (N.sub.3) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) to produces a progeny plant that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Furthermore, a first plant expressing a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) may be crossed with a second plant expressing a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a rotavirus protein (X.sub.2) to produce a progeny plan (third plant). The third plant may be crossed with a fourth plant expressing a third nucleic acid (N.sub.3) comprising a third, fourth and fifth nucleotide sequence (R.sub.3, R.sub.4 and R.sub.5) encoding a third, fourth and fifth rotavirus protein (X.sub.3, X.sub.4, and X.sub.5) to produce a progeny plant that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant.
3.3 Two Single Gene Constructs+One Dual Gene Construct
[0253] An alternated method of producing RLPs in a plant is also provided, wherein a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) and a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), and a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein (X.sub.4), so that the first, second, third and fourth nucleotide sequence are co-expressed in the plant (See Table 1, Combination #3.3).
[0254] As a non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP4, VP6, and NSP4 is expressed in the host.
[0255] As another non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP7, VP6, and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP7, VP6, and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP7, VP6, and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP7, VP6, and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP7, VP6, and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP6, VP7 and NSP4 is expressed in the host.
[0256] As a further non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3, R.sub.4), wherein each rotavirus protein selected from the group of VP4, VP7, VP6, and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP7, VP6, and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP7, VP6, and NSP4, and wherein R.sub.1 and R.sub.3-Ra encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP7, VP6, and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP4, VP7, VP6, and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP4, VP7, VP6, and NSP4 is expressed in the host.
3.4 Three Single Gene Constructs
[0257] An alternated method of producing RLPs in a plant is also provided, wherein a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) and a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), so that the first, second and third nucleotide sequence are co-expressed in the plant (See Table 1, Combination #3.4).
[0258] As a non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3), wherein each rotavirus protein selected from the group of VP4, VP6, and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP6, and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP6, and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP6, and NSP4, and wherein R.sub.1 and R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that each rotavirus protein VP4, VP6, and NSP4 is expressed in the host.
[0259] As a further non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2) and N.sub.3 comprises (R.sub.3), wherein each rotavirus protein selected from the group of VP7, VP6, and NSP4 is encoded once and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP7, VP6, and NSP4, and wherein R.sub.2-R.sub.3 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP7, VP6, and NSP4, and wherein R.sub.1 and R.sub.3 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP7, VP6, and NSP4, and wherein R.sub.1 and R.sub.2 encode a rotavirus protein that is not X.sub.3, with the result that each rotavirus protein VP7, VP6, and NSP4 is expressed in the host.
4. Four Constructs
4.1. Three Single Gene Constructs+One Dual Gene Construct
[0260] Also provided herein is a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), and fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) (see Table 1, Combination #4.1) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant.
[0261] In this example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2), N.sub.3 comprises (R.sub.3), and N.sub.4 comprises (R.sub.4, and R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4 is encoded, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0262] The four nucleic acids may be introduced into a plant in any order. For example, which is not be considered limiting, a plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) may be transformed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2). The plant may be further transformed with a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3). The plant then may be further be transformed with a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Furthermore, a plant may be simultaneously co-transformed with a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), and a fourth nucleic acid (N.sub.4) comprising a fourth and a fifth nucleotide sequences (R.sub.4-R.sub.5) encoding a fourth and a fifth rotavirus protein (X.sub.4-X.sub.5) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1), second nucleic acid (N.sub.2), third nucleic acid (N.sub.3) and fourth nucleic acid (N.sub.4) may be introduced in the plant in a transient manner, or in a stable manner.
[0263] Furthermore, a plant that expresses a first nucleic acid (N.sub.4) comprising a first nucleotide sequence (R.sub.4) encoding a first rotavirus protein (X.sub.4) and a second nucleotide sequence (R.sub.5) encoding a second rotavirus protein (X.sub.5) may be transformed with a second nucleic acid (N.sub.1) comprising a third nucleotide sequence (R.sub.1) encoding a third rotavirus protein (X.sub.1). The plant may be further transformed with a third nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.2) encoding a fourth rotavirus protein (X.sub.3). The plant then may be further be transformed with a fourth nucleic acid (N.sub.3) comprising a fifth nucleotide sequences (R.sub.3) encoding a fifth rotavirus protein and a fifth nucleotide sequence (R.sub.3) encoding a fifth rotavirus protein (X.sub.3), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant. The first nucleic acid (N.sub.4), second nucleic acid (N.sub.1), third nucleic acid (N.sub.2) and fourth nucleic acid (N.sub.3) may be introduced in the plant in a transient manner, or in a stable manner.
[0264] A first plant expressing a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), may be crossed with a second plant expressing a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) to produce a progeny plant (third plant). The third plant may be crossed with a fourth plant expressing a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3) to produces a progeny plant (fifth plant). The fifth plant may be crossed with a sixth plant expressing a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) to produce a progeny plant that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5).
[0265] Furthermore, a first plant expressing a first nucleic acid (N.sub.4) comprising a first nucleotide sequence (R.sub.4) encoding a first rotavirus protein (X.sub.4) and a second nucleotide sequence (R.sub.5) encoding a second rotavirus protein (X.sub.5) may be crossed with a second plant expressing a second nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.1) encoding a third rotavirus protein (X.sub.1) to produce a progeny plan (third plant). The third plant may be crossed with a fourth plant expressing a third nucleic acid (N.sub.2) comprising a fourth nucleotide sequence (R.sub.2) encoding a fourth rotavirus protein (X.sub.2) to produce a progeny plant (fifth plant). The fifth plant may be crossed with a sixth plant expressing a fifth nucleotide sequence (R.sub.3) encoding a fifth rotavirus protein (X.sub.3) to produce a progeny plant that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant.
4.2 Four Single Gene Constructs
[0266] Also provided herein is a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), and a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant (See Table 1, Combination #4.2).
[0267] In a non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2), N.sub.3 comprises (R.sub.3), and N.sub.4 comprises (R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4 is encoded, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP4, VP6 and NSP4 is expressed in the host.
[0268] In another non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2), N.sub.3 comprises (R.sub.3), and N.sub.4 comprises (R.sub.4), wherein each rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4 is encoded, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP2, VP7, VP6 and NSP4 is expressed in the host.
[0269] In a further non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2), N.sub.3 comprises (R.sub.3), and N.sub.4 comprises (R.sub.4), wherein each rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4 is encoded, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.2-R.sub.4 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.4 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1 R.sub.2, and R.sub.4 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP4, VP7, VP6 and NSP4, and wherein R.sub.1-R.sub.3 encode a rotavirus protein that is not X.sub.4, with the result that each rotavirus protein VP4, VP7, VP6 and NSP4 is expressed in the host.
5. Five Constructs
5. Five Single Gene Constructs
[0270] The present invention also provides for a method of producing RLPs in a plant, wherein a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) and a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3) and fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) and a fifth nucleic acid (R.sub.5) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) (see Table 1, Combination #5) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant.
[0271] In this non-limiting example, N.sub.1 comprises (R.sub.1), N.sub.2 comprises (R.sub.2), N.sub.3 comprises (R.sub.3), N.sub.4 comprises (R.sub.4) and Ns comprises (R.sub.5), wherein each rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 encodes rotavirus protein X.sub.1, wherein X.sub.1 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.2-R.sub.5 encode a rotavirus protein that is not X.sub.1, where X.sub.2 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 and R.sub.3-R.sub.5 encode a rotavirus protein that is not X.sub.2, where X.sub.3 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1 R.sub.2, R.sub.4, and R.sub.5 encode a rotavirus protein that is not X.sub.3, where X.sub.4 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.3 and R.sub.5 encode a rotavirus protein that is not X.sub.4, where X.sub.5 may be any rotavirus protein selected from the group of VP2, VP4, VP6, VP7 and NSP4, and wherein R.sub.1-R.sub.4 encode a rotavirus protein that is not X.sub.5, with the result that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the host.
[0272] For example, which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP2 and nucleotide sequence R.sub.2-R.sub.5 may encode in any order rotavirus protein VP4, VP6, VP7 and NSP4, but R.sub.2-R.sub.5 may not encode VP2. In another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP6, VP7 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein VP6 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP7 and NSP4. In yet another example which is not to be considered limiting, nucleotide sequence R.sub.1 may encode rotavirus protein VP7 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and NSP4. In yet another non-limiting example nucleotide sequence R.sub.1 may encode rotavirus protein NSP4 and nucleotide sequences R.sub.2-R.sub.5 may encode in any order rotavirus protein VP2, VP4, VP6 and VP7.
[0273] For example, which is not to be considered limiting, a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein, for example VP2 is co-expressed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein, for example VP6, a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein for example VP4, a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein, for example VP7 and a fifth nucleic acid (N.sub.5) comprising a fifth nucleotide sequence (R.sub.5) encoding a fifth rotavirus protein for example NSP4 (see
[0274] The five nucleic acids may be introduced into a plant in any order. For example, which is not to be considered limiting, a plant that expresses a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1) may be transformed with a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2). The plant may be further transformed with a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3). The plant then may be further transformed with a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4). The plant then may be further transformed with a fifth nucleic acid (N.sub.5) comprising a fourth nucleotide sequences (R.sub.5) encoding a fourth rotavirus protein (X.sub.5), so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant. Furthermore, a plant may be co-transformed simultaneously with a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2), a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3), a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth and a fifth rotavirus protein (X.sub.4), and a fifth nucleic acid (N.sub.5) comprising a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) so that the first, second, third, fourth and fifth nucleotide sequence are co-expressed in the plant. The first nucleic acid (N.sub.1), second nucleic acid (N.sub.2), third nucleic acid (N.sub.3), fourth nucleic acid (N.sub.4) and fifth nucleic acid (N.sub.5) may be introduced in the plant in a transient manner, or in a stable manner.
[0275] A first plant expressing a first nucleic acid (N.sub.1) comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein (X.sub.1), may be crossed with a second plant expressing a second nucleic acid (N.sub.2) comprising a second nucleotide sequence (R.sub.2) encoding a second rotavirus protein (X.sub.2) to produce a progeny plant (third plant). The third plant may be crossed with a fourth plant expressing a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein (X.sub.3) to produces a progeny plant (fifth plant). The fifth plant may be crossed with a sixth plant expressing a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequences (R.sub.4) encoding a fourth rotavirus protein (X.sub.4) to produce a progeny plant (seventh plant). The seventh plant may be crossed with an eight plant expressing a fifth nucleic acid (N.sub.5) comprising a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein (X.sub.5) to produce a progeny plant that co-expresses the first, second, third, fourth and fifth rotavirus protein (X.sub.1-X.sub.5). Rotavirus protein X.sub.1-X.sub.5 may be selected from the group of VP2, VP4, VP6, VP7 and NSP4, wherein VP2, VP4, VP6, VP7 and NSP4 are selected once, so that each rotavirus protein VP2, VP4, VP6, VP7 and NSP4 is expressed in the plant.
Ratio of Nucleic Acids (N) Used to Transform a Host
[0276] As may be seen in
[0277] The ratio of rotavirus structural protein to nonstructural protein may be varied for example by introducing different ratios of Agrobacterium containing the one or more nucleic acid (N) comprising one or more nucleotide sequence (R) encoding the rotavirus structural and non-structural proteins (X) into the plant, portion of the plant or plant cell. Alternatively, if the rotavirus structural proteins and nonstructural proteins are present on the same construct, and therefore are introduced into the plant, plant portion or plant cell, using one Agrobacterium, they may be differentially expressed within the plant, portion of the plant or plant cell using suitable promoters so that the desired ratio of rotavirus structural proteins and nonstructural proteins is obtained.
[0278] Therefore as described herein, a method is provided for increasing RLP production yield, increasing VP4 and VP7 yield, or increasing both RLPS and VP4 and VP7 yield, by modulating the ratio between the one or more nucleic acid (N) comprising one or more nucleotide sequence (R) encoding the rotavirus structural proteins (X) and the one or more nucleic acid (N) comprising one or more nucleotide sequence (R) encoding the rotavirus nonstructural proteins (X).
[0279] For example, the percentage of the Agrobacterium containing rotavirus nonstructural protein may be between 20% to 60% or any amount therebetween, of total amount of Agrobacterium use to infiltrate the plant, plant portion or plant cell. For example the percent ratio of Agrobacterium containing rotavirus nonstructural protein may be 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48% , 49% 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, or any amount therebetween of the total Agrobacterium use to infiltrate the plant, plant portion or plant cell. Similarly, the percentage of Agrobacterium containing structural protein within the total amount of Agrobacterium infiltrated may be 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%, 51%, 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41% or 40% or any amount therebetween, of the total Agrobacterium use to infiltrate the plant, plant portion or plant cell.
[0280] For example, the percentage ratio of Agrobacterium containing rotavirus structural protein to Agrobacterium containing nonstructural protein may be 70%:30%, 60%:40%, 50%:50%, 40%:60% or any percentage ratio amount therebetween. For example, the percentage ratio between Agrobacterium containing structural protein and Agrobacterium containing nonstructural protein may be 50%:50%, 51%:49%, 52%:48%, 53%:47%, 54%:46%, 55%:45%, 56%:44%, 57%:43%, 58%:42%, 59%: 41%, 60%:40%, or any percentage ratio in between.
[0281] As described below, the ratio of rotavirus structural protein to rotavirus nonstructural protein may further be varied for example by differentially expressing the rotavirus structural protein and the rotavirus nonstructural protein. Expression may be varied by modulating for example replication, transcription, translation, or a combination thereof, of the rotavirus structural protein , the rotavirus nonstructural protein , or both the rotavirus structural protein and the rotavirus nonstructural protein. For example different regulatory elements, including promoters, amplification elements, enhancers or a combination thereof, may be used in addition to varying the ratio of the rotavirus structural protein-containing Agrobacterium to rotavirus nonstructural protein-containing Agrobacterium infiltrated as described above. A first set or combination of regulatory elements may be used to regulate the replication, transcription or a combination thereof, of the one or more nucleic acid comprising one or more nucleotide sequence encoding rotavirus structural protein and a second set or combination of regulatory elements may be used to regulate the replication, transcription or a combination thereof, of the one or more nucleotide sequence encoding rotavirus nonstructural protein. The first set or combination of regulatory elements is different from the second set or combination of regulatory elements and permits differential expression of the one or more nucleic acid comprising one or more nucleotide sequence encoding rotavirus structural protein and the one or more nucleic acid comprising one or more nucleotide sequence encoding rotavirus nonstructural protein to permit modulating the ratio of rotavirus structural protein:rotavirus nonstructural protein in vivo.
[0282] For example, which is not to be considered limiting, one set or combination of regulatory elements, for example the first set, may include an enhancer element for example elements obtained from CPMV, such as CPMV HT, or CPMV 160 (see
[0283] For example, the ratio of rotavirus structural protein to nonstructural protein may be varied for example by introducing different ratios of Agrobacterium containing a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding first rotavirus protein for example rotavirus nonstructural protein NSP4 to Agrobacterium containing a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein, for example in any order rotavirus structural proteins VP2, VP4, VP6 and VP7. For example the ratio of the Agrobacterium containing a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding rotavirus nonstructural protein NSP4 to the Agrobacterium containing a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding rotavirus structural proteins VP2, VP4, VP6 and VP7 may be 0.8:1 and 1:2 (Agrobacterium containing N.sub.1 to N.sub.2) or any amount there between for example 1:1.5 (Agrobacterium containing N.sub.1 to N.sub.2).
[0284] Furthermore, the ratio of rotavirus structural protein to nonstructural protein may be varied by differentially expressing within the plant, portion of the plant or plant cell the rotavirus structural protein to nonstructural protein using enhancer elements. For example, the ratio of rotavirus structural protein to nonstructural protein may be varied for example by co-expressing within the plant, portion of the plant or plant cell a first nucleic acid (N.sub.1) comprising a nucleotide sequence (R.sub.1) encoding a first rotavirus protein for example a nonstructural protein NSP4 with a second nucleic acid (N.sub.2) comprising four nucleotide sequences (R.sub.2-R.sub.5) encoding a second, third, fourth and fifth rotavirus protein for example in any order rotavirus structural proteins VP2, VP4, VP6 and VP7, wherein the second, third, fourth and fifth nucleotide sequence are operatively linked to an enhancer sequence for example CPMV HT, CPM 160, CPMV 160+ and CPMV HT+ (described in U.S. 61/971,274, and U.S. 61/925,852, respectively which are incorporated herein by reference), as described below. In another example, the ratio of rotavirus structural protein to nonstructural protein may be varied for example by co-expressing within the plant, portion of the plant or plant cell a first nucleic acid (N.sub.1) comprising first nucleotide sequence (R.sub.1) encoding a first rotavirus protein for example structural protein VP6 or VP7 and second nucleotide sequence (R.sub.2) encoding a second rotavirus protein for example structural protein VP2 or VP4, second nucleic acid (N.sub.2) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein for example structural protein VP7 or VP6 and a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein for example structural protein VP4 or VP2 and a third nucleic acid (N.sub.3) comprising fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein for example nonstructural protein NSP4, wherein the first, second, third and fourth nucleotide sequence are operatively linked to an enhancer sequence for example CPMV HT, CPMV 160, CPMV 160+ and CPMV HT+, as described below.
[0285] In another example, the ratio of rotavirus structural protein to nonstructural protein may be varied for example by co-expressing within the plant, portion of the plant or plant cell one or more nucleic acids comprising a first nucleotide sequence (R.sub.1) encoding a first rotavirus protein for example structural protein VP6 or VP7 and second nucleotide sequence (R.sub.2) encoding a second rotavirus protein for example structural protein VP2 or VP4, a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein for example structural protein VP7 or VP6 and a fourth nucleotide sequence (R.sub.4) encoding fourth rotavirus protein for example structural protein VP4 or VP2, and a fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein for example nonstructural protein NSP4, wherein the first, second, third and fourth nucleotide sequence are operatively linked to an enhancer sequence for example CPM 160, CPMV 160+ and CPMV HT+, as described below and the fifth nucleotide sequence is operatively linked to CPMV HT as described below.
[0286] In another example, the ratio of rotavirus structural protein to nonstructural protein may be varied for example by co-expressing within the plant, portion of the plant or plant cell a first nucleic acid (N.sub.1) comprising first nucleotide sequence (R.sub.1) encoding a first rotavirus protein for example structural protein VP6 or VP7, a second nucleic acid (N.sub.2) comprising second nucleotide sequence (R.sub.2) encoding a second rotavirus protein for example structural protein VP2 or VP4, a third nucleic acid (N.sub.3) comprising a third nucleotide sequence (R.sub.3) encoding a third rotavirus protein for example structural protein VP7 or VP6, a fourth nucleic acid (N.sub.4) comprising a fourth nucleotide sequence (R.sub.4) encoding a fourth rotavirus protein for example structural protein VP4 or VP2 and a fifth nucleic acid (N.sub.5) comprising fifth nucleotide sequences (R.sub.5) encoding a fifth rotavirus protein for example nonstructural protein NSP4, wherein the first, second, third and fourth nucleotide sequence are operatively linked to an enhancer sequence for example CPMV HT, CPMV 160, CPMV 160+ and CPMV HT+, as described below.
Amplification Elements and Enhancer Elements/Regulatory Elements
[0287] The rotavirus protein or polypeptide may be expressed in an expression system comprising a viral based, DNA or RNA, expression system, for example but not limited to, a comovirus-based expression cassette and geminivirus-based amplification element.
[0288] Enhancer elements may be used to achieve high level of transient expression of rotavirus structural and nonstructural proteins. Enhancer elements may be based on RNA plant viruses, including comoviruses, such as Cowpea mosaic virus (CPMV; see, for example, WO2007/135480; WO2009/087391; US 2010/0287670, Sainsbury F. et al., 2008, Plant Physiology; 148: 121-1218; Sainsbury F. et al., 2008, Plant Biotechnology Journal; 6: 82-92; Sainsbury F. et al., 2009, Plant Biotechnology Journal; 7: 682-693; Sainsbury F. et al. 2009, Methods in Molecular Biology, Recombinant Proteins From Plants, vol. 483: 25-39).
CPMV 160 (CPMVX) and CPMV 160+ (CPMVX+)
[0289] In an embodiment the enhancer Elements are CPMVX (also referred as CPMV 160) and/or CPMVX+ (also referred to as CPMV 160+) and are described in U.S. 61/925,852 (which is incorporated herein by reference).
[0290] Expression enhancer CPMVX comprises a comovirus cowpea mosaic virus (CPMV) 5 untranslated region (UTR). The 5UTR from nucleotides 1-160 of the CPMV RNA -2 sequence (SEQ ID NO: 1), starts at the transcription start site to the first in frame initiation start codon (at position 161), which serve as the initiation site for the production of the longer of two carboxy coterminal proteins encoded by a wild-type comovirus genome segment. Furthermore a third initiation site at (or corresponding to) position 115 in the CPMV RNA-2 genomic sequence may also be mutated, deleted or otherwise altered. It has been shown that removal of AUG 115 in addition to the removal of AUG 161 enhances expression when combined with an incomplete M protein (Sainsbury and Lomonossoff, 2008, Plant Physiology; 148: 1212-1218; WO 2009/087391; which are incorporated herein by reference).
[0291] CPMVX comprises X nucleotides of SEQ ID NO:1, where X=160, 155, 150, or 114 of SEQ ID NO:1, or a sequence that comprises between 80% to 100% sequence similarity with CPMVX, where X=160, 155, 150, or 114 of SEQ ID NO:93. This expression enhancer is generally referred to as CPMVX (see
[0292] The expression enhancer CPMVX, where X=160, consists of nucleotides 1-160 of SEQ ID NO: 1:
TABLE-US-00002 (SEQIDNO:1) 1tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgcgtgagc 121gatcttcaacgttgtcagatcgtgcttcggcaccagtaca
[0293] The CPMVX enhancer sequence may further be fused to a stuffer sequence, wherein the CMPVX comprises X nucleotides of SEQ ID NO:1, where X=160, 155, 150, or 114 of SEQ ID NO:1, or a sequence that comprises between 80 to 100% sequence similarity with CPMVX, where X=160, 155, 150, or 114 of SEQ ID NO:1, and the stuffer sequence comprises from 1-100 nucleotides fused to the 3 end of the CMPVX sequence. For example, the stuffer sequence may comprise from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides, or any number of nucleotides therebetween.
[0294] If the CMPVX sequence comprises a stuffer fragment, then this expression enhancer may be referred to as CPMVX+ (see
[0295] The stuffer sequence may be modified by truncation, deletion, or replacement of the native CMPV5UTR sequence that is located 3to nucleotide 160. The modified stuffer sequence may be removed, replaced, truncated or shortened when compared to the initial or unmodified (i.e. native) stuffer sequence associated with the 5UTR (as described in Sainsbury F., and Lomonossoff G. P., 2008, Plant Physiol. 148: pp. 1212-1218). The stuffer sequence may comprise a one or more restriction sites (polylinker, multiple cloning site, one or more cloning sites), one or more plant kozak sequences, one or more linker sequences, one or more recombination sites, or a combination thereof. For example, which is not to be considered limiting, a stuffer sequence may comprise in series, a multiple cloning site of a desired length fused to a plant kozak sequence. The stuffer sequence does not comprise a nucleotide sequence from the native 5UTR sequence that is positioned 3 to nucleotide 160 of the native CPMV 5UTR, for example nucleotides 161 to 512 as shown in
[0296] Plant Kozak consensus sequences are known in the art (see for example Rangan et al. Mol. Biotechnol., 2008, July 39(3), pp. 207-213). Both naturally occurring and synthetic Kozak sequences may be used in the expression enhancer or may be fused to the nucleotide sequence of interest as described herein.
[0297] The plant kozak sequence may be any known plant kozak sequences (see for example L. Rangan et. al. Mol. Biotechnol. 2008), including, but not limited to the following plant consensus sequences:
TABLE-US-00003 (SEQIDNO:2;plantkingdom) caA(A/C)a (SEQIDNO:3;dicots) aaA(A/C)a (SEQIDNO:4;arabidopsis) aa(A/G)(A/C)a
The plant kozak sequence may also be selected from the group of:
TABLE-US-00004 (SEQIDNO:5) AGAAA (SEQIDNO:6) AGACA (SEQIDNO:7) AGGAA (SEQIDNO:8) AAAAA (SEQIDNO:9) AAACA (SEQIDNO:10) AAGCA (SEQIDNO:11) AAGAA (SEQIDNO:12) AAAGAA (SEQIDNO:13) AAAGAA (SEQIDNO:14;Consensussequence) (A/)A(A/G)(A/G)(A/C)A.
[0298] The expression enhancer CPMVX, or CPMVX+, may be operatively linked at the 5end of the enhancer sequence with a regulatory region that is active in a plant, and operatively linked to a nucleotide sequence of interest at the 3end of the expression enhancer (
CPMV HT+, CPMV HT+ [WT115], CPMV HT+ [511]
[0299] In another embodiment the enhancer elements is CPMV HT+ which is described in U.S. 61/971,274 (which is incorporated herein by reference). Expression enhancer CPMV HT+ (see
[0300] A plant expression system comprising a first nucleic acid sequence comprising a regulatory region, operatively linked with one or more than one expression enhancer as described herein (e.g. CPMV HT+, CPMV HT+ [WT115], CPMV HT+ [511]), and a nucleotide sequence encoding a rotavirus structural or nonstructural proteins is also provided. Furthermore, a nucleic acid comprising a promoter (regulatory region) sequence, an expression enhancer (e.g. CPMV HT+ or CPMV HT+ [WT115]) comprising a comovirus 5UTR and a stuffer sequence with a plant kozak sequence fused to one or more nucleic acid sequences encoding a rotavirus structural or nonstructural proteins are described. The nucleic acid may further comprise a sequence comprising a comovirus 3 untranslated region (UTR), for example, a plastocyanin 3 UTR, or other 3UTR active in a plant, and a terminator sequence, for example a NOS terminator, operatively linked to the 3end of the nucleotide sequence encoding a rotavirus structural or nonstructural proteins (referred to as nucleotide of interest in
[0301] SEQ ID NO:15 comprises a CPMV HT expression enhancer as known in the prior art (e.g.
TABLE-US-00005 SEQIDNO:15 1tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgcgtgagc 121gatcttcaacgttgtcagatcgtgcttcggcaccagtaca ttttctttcactgaagc 181gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481taagcttctgtatattctgcccaaatttgtcgggccc
[0302] CPMV HT+ with a plant kozak consensus sequence is provided in SEQ ID NO:16 (nucleotide 1-160, 5UTR, including modified ATG at positions 115 (GTG) lower case bold and italics; stuffer fragment comprising: an incomplete M protein underlined, nucleotides 161-509, with modified nucleotide at 162 (ACG); a multiple cloning site, italics, nucleotides 510-528; and a consensus plant kozak sequence, caps and bold, nucleotides 529-534).
TABLE-US-00006 (SEQIDNO:16) 1tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgc agc 121gatcttcaacgttgtcagatcgtgcttcggcaccagtaca
ttttctttcactgaagc 181gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481taagcttctgtatattctgcccaaatttgttcgggcccaataccgcgg
[0303] SEQ ID NO:17 (CPMV HT+ 511) comprises a segment of the native sequence of the CPMV RNA 2 genome from nucleotides 1-154. The 5UTR sequence from nucleotides 1-511 of SEQ ID NO:17 comprises modified atg sequences at positions 115 (g in place of a; italics bold) and 162 (c in place of t; italics bold), and an incomplete M protein (underlined) from nucleotides 161-511. CPMV HT+ 511 comprises a native M protein kozak consensus sequence (nucleotides 508-511; bold):
TABLE-US-00007 SEQIDNO:17 1tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgc agc 121gatcttcaacgttgtcagatcgtgcttcggcaccagtaca
ttttctttcactgaagc 181gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481taagcttctgtatattctgcccaaatttgaa...
[0304] Another non-limiting example of a CPMV HT+ enhancer sequence is provided by the sequence of SEQ ID NO:18 (CPMV HT+ [WT115]). Expression cassettes or vectors comprising CPMV HT+ and including a plant regulatory region in operative association with the expression enhancer sequence of SEQ ID NO: 18, and the transcriptional start site (ATG) at the 3 end fused to a nucleotide sequence encoding rotavirus structural or nonstructural protein are also part o the present invention.
[0305] SEQ ID NO: 18 (CPMV HT+ [WT115]) nucleotide 1-160, 5UTR, with an ATG at position 115-117, lower case bold; stuffer fragment comprising: an incomplete M protein underlined, nucleotides 161-509; with a modified ATG at position 161-153 lower case bold, and underlined, a multiple cloning site, italics, nucleotides 510-528; and a plant kozak sequence, caps and bold, nucleotides 529-534).
TABLE-US-00008 (SEQIDNO:18) 1tattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttc 61ttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgc agc 121gatcttcaacgttgtcagatcgtgcttcggcaccagtaca
ttttctttcactgaagc 181gaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtc 241ctattcttgtcggtgtggtcttgggaaaagaaagcttgctggaggctgctgttcagcccc 301atacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgctt 361gacgaggtattgttgcctgtacttctttcttcttcttcttgctgattggttctataagaa 421atctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgt 481taagcttctgtatattctgcccaaatttgttcgggcccaataccgcgg
[0306] The plant kozak sequence of SEQ ID NO:18 may be any plant kozak sequence, including but not limited, to one of the sequences of SEQ ID NO's: 2-14.
[0307] A plant expression system comprising a first nucleic acid sequence comprising a regulatory region, operatively linked with one or more than one expression enhancer as described herein (e.g. CPMV HT+, CPMV HT+ [WT115], CPMV HT+ [511]), and a nucleotide sequence encoding a rotavirus structural or nonstructural protein is also provided. Furthermore, a nucleic acid comprising a promoter (regulatory region) sequence, an expression enhancer (e.g. CPMV HT+ or CPMV HT+ [WT115]) comprising a comovirus 5UTR and a stuffer sequence with a plant kozak sequence fused to one or more nucleic acid sequences encoding rotavirus structural or nonstructural protein are described. The nucleic acid may further comprise a sequence comprising a comovirus 3 untranslated region (UTR), for example, a plastocyanin 3 UTR, or other 3UTR active in a plant, and a terminator sequence, for example a NOS terminator, operatively linked to the 3end of the nucleotide sequence encoding rotavirus structural or nonstructural protein (referred to as nucleotide of interest in
[0308] The occurrence of RLPs produced using the methods described herein may be detected using any suitable method for example density gradient centrifugation or size exclusion chromatography. RLPs may be assessed for structure and size, for example by electron microscopy, size exclusion chromatography, or other techniques that would be evident to one of skill in the art.
[0309] For size exclusion chromatography, total soluble proteins may be extracted from plant tissue by homogenizing (Polytron) sample of frozen-crushed plant material in extraction buffer, and insoluble material removed by centrifugation. Precipitation with ice cold acetone or PEG may also be of benefit. The soluble protein is quantified, and the extract passed through a Sephacryl column, for example a Sephacryl S500 column. Blue Dextran 2000 may be used as a calibration standard. Following chromatography, fractions may be further analyzed by immunoblot to determine the protein complement of the fraction.
[0310] The separated fraction may be for example a supernatant (if centrifuged, sedimented, or precipitated), or a filtrate (if filtered), and is enriched for proteins, or suprastructure proteins, and include higher molecular weight, particles such as single-layered (sl), double-layered (dl) or triple-layered (tl) RLPs.
[0311] The separated fraction may be further processed to isolate, purify, concentrate or a combination thereof, the proteins, suprastructure proteins or higher-order particles by, for example, additional centrifugation steps, precipitation, chromatographic steps (e.g. size exclusion, ion exchange, affinity chromatography), tangential flow filtration, or a combination thereof. The presence of purified proteins, suprastructure proteins or higher-order particles such as RLPs, may be confirmed by, for example, native or SDS-PAGE, Western analysis using an appropriate detection antibody, capillary electrophoresis, electron microscopy, or any other method as would be evident to one of skill in the art.
[0312] The RLP's produced according to the present invention may be purified, partially purified from a plant, portion of a plant or plant matter, or may be administered as an oral vaccine, using methods as know to one of skill in the art.
[0313] RLP purification may involve gradient centrifugation, for example sucrose, iodixanol, OptiPrep or cesium chloride (CsCl) density gradients may be used to purify or partially purify the RLPs from transformed plant biomass. As shown for example in
[0314] Calcium (Ca2+) concentration has been shown to be important for the triple-layer particle (TLP) to double layer particle (DLP) transformation and is strain dependent (see for example Martin et al. Journal of Virology, January 2002, which is incorporated herein by reference). Complete loss of the outer-capsid proteins from TLPs (TLP decapsidation) takes place in the nanomolar range of [Ca2+]. Therefore the extraction and/or purification of RLP may be performed in the presence of calcium, and the step of gradient centrifugation may be performed in the presence of calcium, for example in the present of CaCl2. The concentration of CaCl2 maybe between for example, 1 mM and 1000 mM, or any amount there between, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 50, 600, 650, 700, 750, 800, 850, 900, 950 mM or any amount therebetween.
[0315] The plants, or plant fragments may be minimally processed. By the term minimal processing it is meant plant matter, for example, a plant or portion thereof comprising a protein of interest and/or the RLP which is partially purified to yield a plant extract, homogenate, fraction of plant homogenate or the like (i.e. minimally processed). Partial purification may comprise, but is not limited to disrupting plant cellular structures thereby creating a composition comprising soluble plant components, and insoluble plant components which may be separated for example, but not limited to, by centrifugation, filtration or a combination thereof. In this regard, proteins secreted within the extracellular space of leaf or other tissues could be readily obtained using vacuum or centrifugal extraction, or tissues could be extracted under pressure by passage through rollers or grinding or the like to squeeze or liberate the protein free from within the extracellular space. Minimal processing could also involve preparation of crude extracts of soluble proteins, since these preparations would have negligible contamination from secondary plant products. Further, minimal processing may involve aqueous extraction of soluble protein from leaves, followed by precipitation with any suitable salt. Other methods may include large scale maceration and juice extraction in order to permit the direct use of the extract. The RLPs may be purified or extracted using any suitable method for example mechanical or biochemical extraction.
[0316] The one or more rotavirus structural protein may be synthesized at an amount up to 2 g per kilogram of plant fresh weight. For example, the amount of synthesized structural protein maybe between 1 and 2 g per kilogram of fresh weight, or any amount there between, such as 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 g per kilogram of fresh weight or any amount therebetween. For example, the structural protein may be synthesized at an amount up to 1.54 g per kilogram of plant fresh weight.
[0317] The size (i.e. the diameter) of the above-defined RLPs, maybe measures for example by dynamic light scattering (DLS) or electron microscope (EM) techniques, is usually between 50 to 110 nm, or any size therebetween. For example, the size of the intact RLP structure may range from about 70 nm to about 110 nm, or any size therebetween, such as 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm or any size therebetween.
Nucleotide Sequences
[0318] The present invention further provides a nucleic acid comprising a nucleotide sequence encoding one or more rotavirus structural protein operatively linked to a regulatory region active in a plant. The nucleotide sequence may be optimized for example for human codon usage or plant codon usage. Furthermore one or more rotavirus structural protein may be operatively linked to one or more than one amplification elements. In addition one or more rotavirus structural protein may be operatively linked to one or more than one compartment targeting sequence. The one or more rotavirus structural protein encoded by the nucleotide sequence may be for example VP2, VP4, VP6 or VP7. Furthermore the one or more rotavirus structural protein encoded by the nucleotide sequence may be for example from any rotavirus group A to G, but more preferably from rotavirus group A. Furthermore, the one or more rotavirus structural protein encoded by the nucleotide sequence maybe from any rotavirus strain having a genotype of any combinations of G- and P-types from G1 to G27 and from P1 to P34, and more preferably from G1 to G19 and from P1 to P27, including, but not limited to G1P[8], G2P[4], G2P[8], G3P[8], G4P[8], G9P[6], G9P[8], rotavirus A WA strain, rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain or rotavirus SA11 strain.
[0319] A nucleic acid sequence referred to in the present invention, may be substantially homologous, substantially similar or substantially identical to a sequence, or a compliment of the sequence if the nucleic acid sequence hybridize to one or more than one nucleotide sequence or a compliment of the nucleic acid sequence as defined herein under stringent hybridization conditions. Sequences are substantially homologous substantially similar substantially identical when at least about 70%, or between 70 to 100%, or any amount therebetween, for example 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100%, or any amount therebetween, of the nucleotides match over a defined length of the nucleotide sequence providing that such homologous sequences exhibit one or more than one of the properties of the sequence, or the encoded product as described herein.
[0320] For example the present invention provides an isolated polynucleotide comprising a nucleotide sequence which encodes one or more rotavirus protein, for example a structural or nonstructural rotavirus protein, that is at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 100% or any amount therebetween identical to sequences as defines for example in SEQ ID NOs: 21, 27, 32, 37 or 42. The polynucleotide may be human codon optimized by any of the methods known in the art. The nucleotide sequence may enclode for example a rotavirus protein that is at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 100% or any amount therebetween identical the amino acid sequence of SEQ ID NOs: 24, 29, 34, 39 or 44.
[0321] Furthermore, the present invention provides RLPS that comprise rotavirus structural proteins that are for example encoded by nucleic acids that are at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 100% or any amount therebetween identical to sequences as defines for example in SEQ ID NOs: 21, 27, 32, 37 or 42.
[0322] Such a sequence similarity or identity may be determined using a nucleotide sequence comparison program, such as that provided within DNASIS (using, for example but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k tuple 2, floating gap 10, and window size 5). However, other methods of alignment of sequences for comparison are well-known in the art for example the algorithms of Smith & Waterman (1981, Adv. Appl. Math. 2:482), Needleman & Wunsch (J. Mol. Biol. 48:443, 1970), Pearson & Lipman (1988, Proc. Nat'l. Acad. Sci. USA 85:2444), and by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and BLAST, available through the NIH.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 supplement), or using Southern or Northern hybridization under stringent conditions (see Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982). Preferably, sequences that are substantially homologous exhibit at least about 80% and most preferably at least about 90% sequence similarity over a defined length of the molecule.
[0323] An example of one such stringent hybridization conditions may be overnight (from about 16-20 hours) hybridization in 4SSC at 65 C., followed by washing in 0.1SSC at 65 C. for an hour, or 2 washes in 0.1SSC at 65 C. each for 20 or 30 minutes. Alternatively an exemplary stringent hybridization condition could be overnight (16-20 hours) in 50% formamide, 4SSC at 42 C., followed by washing in 0.1SSC at 65 C. for an hour, or 2 washes in 0.1SSC at 65 C. each for 20 or 30 minutes, or overnight (16-20 hours), or hybridization in Church aqueous phosphate buffer (7% SDS; 0.5M NaPO4 buffer pH 7.2; 10 mM EDTA) at 65 C., with 2 washes either at 50 C. in 0.1SSC, 0.1% SDS for 20 or 30 minutes each, or 2 washes at 65 C. in 2SSC, 0.1% SDS for 20 or 30 minutes each for unique sequence regions.
[0324] A nucleic acid encoding a rotavirus structural polypeptide may be described as a rotavirus nucleic acid, a rotavirus nucleotide sequence, a rotavirus nucleic acid, or a rotavirus nucleotide sequence. For example, which is not to be considered limiting, a virus-like particle comprising one or more rotavirus structural protein or rotavirus structural polypeptide, may be described as a rotavirus VLP, RVLP or RLP.
[0325] Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. The process of optimizing the nucleotide sequence coding for a heterologously expressed protein can be an important step for improving expression yields. The optimization requirements may include steps to improve the ability of the host to produce the foreign protein.
[0326] Codon optimization is defined as modifying a nucleic acid sequence for enhanced expression in cells of interest by replacing at least one, more than one, or a significant number, of codons of the native sequence with codons that may be more frequently or most frequently used in the genes of another organism or species. Various species exhibit particular bias for certain codons of a particular amino acid.
[0327] The present invention includes synthetic polynucleotide sequences that have been codon optimized for example the sequences have been optimized for human codon usage or plant codon usage. The codon optimized polynucleotide sequences may then be expressed in plants. More specifically the sequences optimized for human codon usage or plant codon usage may be expressed in plants. Without wishing to be bound by theory, it is believed that the sequences optimized for human codon increases the guanine-cytosine content (GC content) of the sequence and improves expression yields in plants.
[0328] There are different codon-optimisation techniques known in the art for improving, the translational kinetics of translationally inefficient protein coding regions. These techniques mainly rely on identifying the codon usage for a certain host organism. If a certain gene or sequence should be expressed in this organism, the coding sequence of such genes and sequences will then be modified such that one will replace codons of the sequence of interest by more frequently used codons of the host organism.
Amino Acid Sequences
[0329] Non-limiting examples of rotavirus structural protein are rotavirus protein VP2, VP4, VP6 and VP7, and a fragment of VP2, VP4, VP6 and VP7. Non-limiting examples of VP2, VP4, VP6 and VP7, or fragments of VP2, VP4, VP6 and VP7 protein that may be used according to the present invention include those VP2, VP4 VP6 and VP7 protein from rotavirus strain G9 P[6], rotavirus A WA strain, rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain and rotavirus SA11 strain. For example, but not limited to Rotarix-A41CB052A: VP4 (accession #JN849113), VP7: (accession #JN849114), rotavirus A WA strain: VP2 (accession #X14942), VP4: (accession #L34161), VP6 (accession #K02086), VP7: (accession #GU723327), NSP4 (accession #K02032), rotavirus SA11 strain: VP2 (accession #NC_011506), VP4 (accession #NC_011510), VP6 (accession #NC_011509), VP7 (accession #NC_011503) and NSP4 (accession #NC_011504).
[0330] An example of a VP2 structural protein, which is not to be considered limiting, is set forth in the amino acid sequence of SEQ ID NO: 24. Furthermore, the VP2 structural protein may comprise the sequence set forth in SEQ ID NO: 24, or a sequence having at least about 90-100% sequence similarity thereto, including any percent similarity within these ranges, such as 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto. In addition, a VP2 structural protein may be encoded by a nucleotide sequence as set forth in SEQ ID NO:21 or a sequence having at least about 80-100% sequence similarity thereto, including any percent similarity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto.
[0331] An example of a VP4 structural protein, which is not to be considered limiting, is set forth in the amino acid sequence of SEQ ID NO: 34. Furthermore, the VP4 structural protein may comprise the sequence set forth in SEQ ID NO: 34, or a sequence having at least about 90-100% sequence similarity thereto, including any percent similarity within these ranges, such as 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto. In addition, a VP4 structural protein may be encoded by a nucleotide sequence as set forth in SEQ ID NO: 32 or a sequence having at least about 80-100% sequence similarity thereto, including any percent similarity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto.
[0332] An example of a VP6 structural protein, which is not to be considered limiting, is set forth in the amino acid sequence of SEQ ID NO: 29. Furthermore, the VP6 structural protein may comprise the sequence set forth in SEQ ID NO: 29, or a sequence having at least about 90-100% sequence similarity thereto, including any percent similarity within these ranges, such as 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto. In addition, a VP6 structural protein may be encoded by a nucleotide sequence as set forth in SEQ ID NO:27 or a sequence having at least about 80-100% sequence similarity thereto, including any percent similarity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto.
[0333] An example of a VP7 structural protein, which is not to be considered limiting, is set forth in the amino acid sequence of SEQ ID NO: 39. Furthermore, the VP7 structural protein may comprise the sequence set forth in SEQ ID NO: 39, or a sequence having at least about 90-100% similarity thereto, including any percent similarity within these ranges, such as 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto. In addition, a VP7 structural protein may be encoded by a nucleotide sequence as set forth in SEQ ID NO:37 or a sequence having at least about 80-100% sequence similarity thereto, including any percent similarity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto.
[0334] An example of a NSP4 structural protein, which is not to be considered limiting, is set forth in the amino acid sequence of SEQ ID NO: 44. Furthermore, the NSP4 nonstructural protein may comprise the sequence set forth in SEQ ID NO: 44, or a sequence having at least about 90-100% similarity thereto, including any percent similarity within these ranges, such as 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto. In addition, a NSP4 nonstructural protein may be encoded by a nucleotide sequence as set forth in SEQ ID NO: 42 or a sequence having at least about 80-100% sequence similarity thereto, including any percent similarity within these ranges, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence similarity thereto.
[0335] Amino acid sequence similarity or identity may be computed by using the BLASTP and TBLASTN programs which employ the BLAST (basic local alignment search tool) 2.0 algorithm. Techniques for computing amino acid sequence similarity or identity are well known to those skilled in the art, and the use of the BLAST algorithm is described in ALTSCHUL et al. (1990, J Mol. Biol. 215: 403-410) and ALTSCHUL et al. (1997, Nucleic Acids Res. 25: 3389-3402).
[0336] Without wishing to be bound by theory, the protein concentration and ratio of the different rotavirus structural proteins may be important for the assembly efficiency of RLPs. Therefore multiplicity and time of infection, may be important to manipulate protein concentration and the overall assembly efficiency of RLPs in plants.
[0337] The construct of the present invention may be transiently expressed in a plants or portion of a plant. A transient expression system relying on the epichromosomal expression of recombinant Agrobacterium tumefaciens in a plant, portion of a plant or plant cell may be used to express the rotavirus structural protein, targeted to various cell compartments or sub-compartments. A transient expression system allows for a high production speed. Furthermore, large amounts of protein can be attained within a few days after infiltration of recombinant Agrobacterium in plants (Rybicki, 2010; Fischer et al., 1999). It is also possible to express long gene sequences and have more than one gene simultaneously expressed in the same cell, allowing for efficient assembly of multimeric proteins (Lombardi et al., 2009).
[0338] The nucleotide sequences encoding for the rotavirus structural proteins and nonstructural proteins may be transferred into the plant host using 1, 2, 3, 4 or 5 transformed Agrobacterium tumefaciens strains (as described in Table 1 and accompanying text
[0339] During transient expression post-transcriptional gene silencing may limit the expression of the heterologous proteins in plants. The co-expression of a suppressor of silencing, for example, but not limited to Nss from Tomato spotted wilt virus may be used to counteract the specific degradation of transgene mRNAs (Brigneti et al., 1998). Alternate suppressors of silencing are well known in the art and may be used as described herein (Chiba et al., 2006, Virology 346:7-14; which is incorporated herein by reference), for example but not limited to HcPro, TEV-p1/HC-Pro (Tobacco etch virus-p1/HC-Pro), BYV-p21, p19 of Tomato bushy stunt virus (TBSV p19), capsid protein of Tomato crinkle virus (TCV-CP), 2b of Cucumber mosaic virus; CMV-2b), p25 of Potato virus X (PVX-p25), p11 of Potato virus M (PVM-p11), p11 of Potato virus S (PVS-p11), p16 of Blueberry scorch virus, (BScV-p16), p23 of Citrus tristexa virus (CTV-p23), p24 of Grapevine leafroll-associated virus-2, (GLRaV-2 p24), p10 of Grapevine virus A, (GVA-p10), p14 of Grapevine virus B (GVB-p14), p10 of Heracleum latent virus (HLV-p10), or p16 of Garlic common latent virus (GCLV-p16). Therefore, a suppressor of silencing, for example HcPro, TEV-p1/HC-Pro, BYV-p21, TBSV p19, TCV-CP, CMV-2b, PVX-p25, PVM-p11, PVS-p11, BScV-p16, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10, may be co-expressed along with one or more rotavirus structural or non structural protein for example VP2, VP4, VP6, VP7 and NSP4 or a combination thereof, to further ensure high levels of protein production within a plant or portion of a plant.
[0340] The present invention also provides a methods as described above, wherein an additional (second, third, fourth, fifth or sixth) nucleotide sequence is expressed within the plant, the additional (second, third, fourth, fifth or sixth) nucleotide sequence encoding a suppressor of silencing is operatively linked with an additional (second, third, fourth, fifth or sixth) regulatory region that is active in the plant. The nucleotide sequence encoding a suppressor of silencing may be, for example Nss, HcPro, TEV-p1/HC-Pro, BYV-p21, TBSV p19, TCV-CP, CMV-2b, PVX-p25, PVM-p11, PVS-p11, BScV-p16, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10.
[0341] As described below, transient expression methods may be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343-348; which is incorporated herein by reference). Alternatively, a vacuum-based transient expression method, as described by Kapila et al., 1997, which is incorporated herein by reference) may be used. These methods may include, for example, but are not limited to, a method of Agro-inoculation or Agro-infiltration, syringe infiltration, however, other transient methods may also be used as noted above. With Agro-inoculation, Agro-infiltration, or syringe infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enter the intercellular spaces of a tissue, for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant. After crossing the epidermis the Agrobacteria infect and transfer t-DNA copies into the cells. The t-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA inside the nucleus is transient.
[0342] To aid in identification of transformed plant cells, the constructs of this invention may be further manipulated to include plant selectable markers. Useful selectable markers include enzymes that provide for resistance to chemicals such as an antibiotic for example, gentamycin, hygromycin, kanamycin, or herbicides such as phosphinothrycin, glyphosate, chlorosulfuron, and the like. Similarly, enzymes providing for production of a compound identifiable by colour change such as GUS (beta-glucuronidase), or luminescence, such as luciferase or GFP, may be used.
[0343] Also considered part of this invention are transgenic plants, plant cells or seeds containing the constructs as described herein. Methods of regenerating whole plants from plant cells are also known in the art. In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques. Transgenic plants can also be generated without using tissue cultures.
[0344] The use of the terms regulatory region, regulatory element or promoter in the present application is meant to reflect a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association, or operatively linked, with a gene of interest, this may result in expression of the gene of interest. A regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation. A regulatory region may includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. Regulatory region, as used herein, may also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
[0345] In the context of this disclosure, the term regulatory element or regulatory region typically refers to a sequence of DNA, usually, but not always, upstream (5) to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within introns, or 3 of the sequence may also contribute to the regulation of expression of a coding region of interest. An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site. A promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression.
[0346] There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. A regulatory region that is developmentally regulated, or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well. Examples of tissue-specific regulatory regions, for example see-specific a regulatory region, include the napin promoter, and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). An example of a leaf-specific promoter includes the plastocyanin promoter (see U.S. Pat. No. 7,125,978, which is incorporated herein by reference).
[0347] An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor that binds specifically to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, L R. P., 1998, Trends Plant Sci. 3, 352-358; which is incorporated by reference). Examples, of potential inducible promoters include, but not limited to, tetracycline-inducible promoter (Gatz, C.,1997, Ann. Rev. Plant Physiol. Plant Mol. Bicd. 48,89-108; which is incorporated by reference), steroid inducible promoter (Aoyama. T. and Chua, N. H., 1997, Plant 1. 2, 397-404; which is incorporated by reference) and ethanol-inducible promoter (Salter, M. G., et al, 1998, Plant Journal 16, 127-132; Caddick, M. X., et al, 1998, Nature Biotech. 16, 177-180, which are incorporated by reference) cytokinin inducible IB6 and CKI 1 genes (Brandstatter, I. and K.ieber, 1.1., 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274,982-985; which are incorporated by reference) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971; which is incorporated by reference).
[0348] A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript (Odell et al, 1985, Nature, 313: 810-812), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121), or tms 2 (U.S. Pat. No. 5,428,147, which is incorporated herein by reference), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995, Plant Mol. Biol. 29: 995-1004).
[0349] The term constitutive as used herein does not necessarily indicate that a gene under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types even though variation in abundance is often observed. Constitutive regulatory elements may be coupled with other sequences to further enhance the transcription and/or translation of the nucleotide sequence to which they are operatively linked. For example, the CPMV-HT system is derived from the untranslated regions of the Cowpea mosaic virus (CPMV) and demonstrates enhanced translation of the associated coding sequence. By native it is meant that the nucleic acid or amino acid sequence is naturally occurring, or wild type. By operatively linked it is meant that the particular sequences, for example a regulatory element and a coding region of interest, interact either directly or indirectly to carry out an intended function, such as mediation or modulation of gene expression. The interaction of operatively linked sequences may, for example, be mediated by proteins that interact with the operatively linked sequences.
[0350] The RLP produced within a plant may produce a rotavirus VP7 structural protein comprising plant-specific N-glycans. Therefore, this invention also provides for a RLP comprising VP7 having plant specific N-glycans.
[0351] Furthermore, modification of N-glycan in plants is known (see for example U.S. 60/944,344; which is incorporated herein by reference) and VP7 having modified N-glycans may be produced. VP7 comprising a modified glycosylation pattern, for example with reduced fucosylated, xylosylated, or both, fucosylated and xylosylated, N-glycans may be obtained, or VP7 having a modified glycosylation pattern may be obtained, wherein the protein lacks fucosylation, xylosylation, or both, and comprises increased galactosylation. Furthermore, modulation of post-translational modifications, for example, the addition of terminal galactose may result in a reduction of fucosylation and xylosylation of the expressed VP7 when compared to a wild-type plant expressing VP7.
[0352] For example, which is not to be considered limiting, the synthesis of VP7 having a modified glycosylation pattern may be achieved by co-expressing VP7 along with a nucleotide sequence encoding beta-1.4 galactosyltransferase (GalT), for example, but not limited to mammalian GalT, or human GalT however GalT from another sources may also be used. The catalytic domain of GalT may also be fused to a CTS domain (i.e. the cytoplasmic tail, transmembrane domain, stem region) of N-acetylglucosaminyl transferase (GNT1), to produce a GNT1-GalT hybrid enzyme, and the hybrid enzyme may be co-expressed with VP7. The VP7 may also be co-expressed along with a nucleotide sequence encoding N-acetylglucosaminyl transferase III (GnT-III), for example but not limited to mammalian GnT-III or human GnT-III, GnT-III from other sources may also be used. Additionally, a GNT1-GnT-III hybrid enzyme, comprising the CTS of GNT1 fused to GnT-III may also be used. Therefore the present invention also provides RLPs comprising VP7 having modified N-glycans.
[0353] Without wishing to be bound by theory, the presence of plant N-glycans on VP7 may stimulate the immune response by promoting the binding of VP7 by antigen presenting cells. Stimulation of the immune response using plant N glycan has been proposed by Saint-Jore-Dupas et al. (2007).
[0354] Table 2 lists sequences provided in various embodiments of the invention.
TABLE-US-00009 TABLE 2 SEQ ID Page/ NO Description Figure 1 expression enhancer CPMVX 2 plant kingdom kozak consensus sequence 3 Dicots kozak consensus sequence 4 Arabidopsis kozak consensus sequence 5-13 plant kozak sequences 14 Kozak consensus sequence 15 CPMV HT 16 CPMV HT+ 17 CPMV HT+ 511 18 CPMV HT+[WT115] 19 IF-WA_VP2(opt).s1+3c FIG. 7A 20 IF-WA_VP2(opt).s14r FIG. 7B 21 Optimized coding sequence of Rotavirus A VP2 from FIG. 7C strain WA 22 Construct 1191 FIG. 7E 23 Expression cassette number 1710 FIG. 7F 24 Amino acid sequence of VP2 from Rotavirus A WA FIG. 7G strain 25 IF-WA_VP6(opt).s1+3c FIG. 8A 26 IF-WA_VP6(opt).s14r FIG. 8B 27 Optimized coding sequence of Rotavirus A VP6 from FIG. 8C strain WA 28 Expression cassette number 1713 FIG. 8D 29 Amino acid sequence of VP6 from Rotavirus A WA FIG. 8E strain 30 IF-Rtx_VP4(opt).s1+3c FIG. 9A 31 IF-Rtx_VP4(opt).s14r FIG. 9B 32 Optimized coding sequence of Rotavirus A VP4 from FIG. 9C strain RVA/Vaccine/USA/Rotarix- A41CB052A/1988/G1P1A[8] 33 Expression cassette number 1730 FIG. 9D 34 Amino acid sequence of VP4 from Rotavirus A FIG. 9E Rotarix strain 35 IF-TrSP+Rtx_VP7(opt).s1+3c FIG. 10A 36 IF-Rtx_VP7(opt).s14r FIG. 10B 37 Optimized coding sequence of Rotavirus A VP7 from FIG. 10C strain RVA/Vaccine/USA/Rotarix- A41CB052A/1988/G1P1A[8] 38 Expression cassette number 1734 FIG. 10D 39 Amino acid sequence of TrSp-VP7 from Rotavirus A FIG. 10E vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain 40 IF-WA_NSP4.s1+3c FIG. 11A 41 IF-WA_NSP4.s14r FIG. 11B 42 Coding sequence of Rotavirus A NSV4 from FIG. 11C strain WA 43 Expression cassette number 1706 FIG. 11D 44 Amino acid sequence of NSP4 from Rotavirus A WA FIG. 11E strain 45 IF(C160)-WA_VP2(opt).c FIG. 12A 46 Construct 1190 FIG. 12C 47 Expression cassette number 1108 FIG. 12D 48 IF(C160)-WA_VP6(opt).c FIG. 13A 49 Expression cassette number 1128 FIG. 13B 50 IF(C160)-Rtx_VP4(opt).c FIG. 14A 51 Expression cassette number 1178 FIG. 14B 52 IF(C160)-TrSP+Rtx_VP7(opt).c FIG. 15A 53 Expression cassette number 1199 FIG. 15B
[0355] The present invention will be further illustrated in the following examples.
EXAMPLES
Example 1
Materials and Methods
[0356]
TABLE-US-00010 TABLE 3 Constructs Constr. # Description FIG. Constr. # Description FIG. 1108 160-VP2 3A/3B 1706 CPMV-HT NSP4 3A/3B 4A/4B 1128 160-VP6 3A/3B 1708 CPMV-HT VP6/2 3A/3B 4A/4B 1178 160-VP4 3A/3B 2408 160-VP7/4 3A/3B 4A/4B 1199 160-VP7 3A/3B 1769 CPMV-HT VP7/4/6/2 3A/3B/5 1710 CPMV-HT VP2 4A/4B 2441 CPMV-HT VP4/7/NSP4/6/2 5 1713 CPMV-HT VP6 4A/4B 2400 160-VP6/2 4A/4B 1730 CPMV-HT VP4 4A/4B 1719 CPMV-HT VP7/4 4A/4B 1734 CPMV-HT VP7 4A/4B
1. 2X35S/CPMV-HT/RVA(WA) VP2(opt)/NOS (Construct Number 1710)
[0357] An optimized sequence encoding VP2 from Rotavirus A WA strain was cloned into 2X35S-CPMV-HT-NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP2 coding sequence was amplified using primers IF-WA_VP2(opt).s1+3c (
2. 2X35S/CPMV-HT/RVA(WA) VP6(opt)/NOS (Construct Number 1713)
[0358] An optimized sequence encoding VP6 from Rotavirus A WA strain was cloned into 2X35S-CPMV-HT-NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP6 coding sequence was amplified using primers IF-WA_VP6(opt).s1+3c (
3. 2X35S/CPMV-HT/RVA(Rtx) VP4(opt)/NOS (Construct Number 1730)
[0359] An optimized sequence encoding VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain was cloned into 2X35S/CPMV-HT/NOS in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP4 coding sequence was amplified using primers IF-Rtx_VP4(opt).s1+3c (
4. 2X35S/CPMV-HT/TrSp-RVA(Rtx) VP7(opt)/NOS (Construct Number 1734)
[0360] An optimized sequence encoding VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain was cloned into 2X35S-CPMV-HT-NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP7 coding sequence was amplified using primers IF-TrSP+Rtx_VP7(opt).s1+3c (
5. 2X35S/CPMV-HT/RVA(WA) NSP4/NOS (Construct Number 1706)
[0361] A sequence encoding NSP4 from Rotavirus A WA strain was cloned into 2X35S-CPMV-HT-NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the NSP4 coding sequence was amplified using primers IF-WA_NSP4.s1+3c (
6. 2X35S/CPMV-160/RVA(WA) VP2(opt)/NOS (Construct Number 1108)
[0362] An optimized sequence encoding VP2 from Rotavirus A WA strain was cloned into 2X35S/CPMV-160/NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP2 coding sequence was amplified using primers IF(C160)-WA_VP2(opt).c (
7.-2X35S/CPMV-160/RVA(WA) VP6(opt)/NOS (Construct Number 1128)
[0363] An optimized sequence encoding VP6 from Rotavirus A WA strain was cloned into 2X35S/CPMV-160/NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP6 coding sequence was amplified using primers IF(C160)-WA_VP6(opt).c (
8. X35S/CPMV-160/RVA(Rtx) VP4(opt)/NOS (Construct Number 1178)
[0364] An optimized sequence encoding VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain was cloned into 2X35S/CPMV-160/NOS in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP4 coding sequence was amplified using primers IF(C160)-Rtx_VP4(opt).c (
9. 2X35S/CPMV-160/TrSp-RVA(Rtx) VP7(opt)/NOS (Construct Number 1199)
[0365] An optimized sequence encoding VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain was cloned into 2X35S/CPMV-160/NOS expression system in a plasmid containing Plasto_pro/P19/Plasto_ter expression cassette using the following PCR-based method. A fragment containing the VP7 coding sequence was amplified using primers IF(C160)-TrSP+Rtx_VP7(opt).c (
10. Double Gene Construct for the Expression of VP6 and VP2 Under CPMV-HT Expression Cassette (Construct Number 1708)
[0366] A single vector for the co-expression of VP6 from Rotavirus A WA strain and VP2 from Rotavirus A WA strain under the control of CPMV-HT expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1710; 2X35S/CPMV-HT/RVA(WA) VP2(opt)/NOS) (
11. Double Gene Construct for the Expression of VP7 and VP4 Under CPMV-HT Expression Cassette (Construct Number 1719)
[0367] A single vector for the co-expression of VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain and VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain under the control of CPMV-HT expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1730; 2X35S/CPMV-HT/RVA(Rtx) VP4(opt)/NOS) (
12. Double Gene Construct for the Expression of VP6 and VP2 Under CPMV-160 Expression Cassette (Construct Number 2400)
[0368] A single vector for the co-expression of VP6 from Rotavirus A WA strain and VP2 from Rotavirus A WA strain under the control of CPMV-160 expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1108; 2X35S/CPMV-160/RVA(WA) VP2(opt)/NOS) (
13. Double Gene Construct for the Expression of VP7 and VP4 Under CPMV-160 Expression Cassette (Construct Number 2408)
[0369] A single vector for the co-expression of VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain and VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain under the control of CPMV-160 expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1178; 2X35S/CPMV-160/RVA(Rtx) VP4(opt)/NOS) (
14. Quadruple Gene Construct for the Expression of VP7, VP4, VP6 and VP2 Under CPMV-HT Expression Cassette (Construct Number 1769)
[0370] A single vector for the co-expression of VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain, VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain, VP6 from Rotavirus A WA strain and VP2 from Rotavirus A WA strain under the control of CPMV-HT expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1730; 2X35S/CPMV-HT/RVA(Rtx) VP4(opt)/NOS) (
15. Quintuple Gene Construct for the Expression of VP4, VP7, NSP4, VP6 and VP2 Under CPMV-HT Expression Cassette (Construct Number 2441)
[0371] A single vector for the co-expression of VP4 from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain, VP7 with a truncated version of the native signal peptide from Rotavirus A vaccine USA/Rotarix-A41CB052A/1988/G1P1A[8] strain, NSP4 from Rotavirus A WA strain, VP6 from Rotavirus A WA strain and VP2 from Rotavirus A WA strain under the control of CPMV-HT expression system was assembled using the following restriction enzyme/ligase-based method. Donor plasmid DNA (construct number 1734; 2X35S/CPMV-HT/TrSp-RVA(Rtx) VP7(opt)/NOS) (
Example 2
Co-Expression of NSP4 Increases VP4 and VP4 Incorporation into RLPs
[0372] The rotavirus VP2, VP4, VP6 and VP7 structural antigens were transiently co-expressed in Nicotiana benthamiana plants in the presence or absence of a NSP4 expression construct using agroinfiltration as described in example 1. Crude protein extracts from RLP producing plants contain large amounts of host protein as shown by the banding pattern in Coomassie-stained SDS-PAGE (
[0373] RLP-containing fraction 2 from the same experiments were analyzed by western blot to evaluate the impact of NSP4 co-expression on VP4 and VP7 incorporation. For that comparison, equal amounts of RLPS were loaded on the gel. The western blot results obtained showed stronger signals for VP4 and VP7 on the RLPs produced in the presence of NSP4 (
[0374] The genes encoding the four rotavirus antigens and the non-structural protein NSP4 were cloned into CPMV-HT and CPMV160 for comparison of expression. Co-expression studies followed by extraction and purification by ultracentrifugation in iodixanol density gradient showed that both expression efficiently produced RLPs, as demonstrated by the amount of VP6 in fractions 2 and 3 of the gradient (
[0375] A quintuple gene construct (comprising 5 genes on the same plasmid) has been evaluated for the co-expression of the four structural antigens with NSP4. As shown in
Agrobacterium Transformation
[0376] All plasmids were used to transform Agrobacterium tumefaciens (AGL1; ATCC, Manassas, Va. 20108, USA) by electroporation (Mattanovich et al., 1989, Nucleic Acid Res. 17:6747) alternatively, heat shock using CaCl2-prepared competent cells (XU et al., 2008, Plant Methods 4) may be used. The integrity of the plasmids in the A. tumefaciens strains created was confirmed by restriction mapping.
Preparation of Plant Biomass, Inoculum, Agroinfiltration, and Harvesting
[0377] Nicotiana benthamiana plants were grown from seeds in flats filled with a commercial peat moss substrate. The plants were allowed to grow in the greenhouse under a 16/8 photoperiod and a temperature regime of 25 C. day/20 C. night. Three weeks after seeding, individual plantlets were picked out, transplanted in pots and left to grow in the greenhouse for three additional weeks under the same environmental conditions.
[0378] Agrobacteria transfected with each construct were grown in a LB medium from vegetal origin and supplemented with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES) and 50 g/ml kanamycin pH5.6 until they reached an OD600 between 0.6 and 2.5. Agrobacterium suspensions were mixed to reach appropriate ratio for each construct and brought to 2.5X OD600 with infiltration medium (10 mM MgCl2 and 10 mM MES pH 5.6). A. tumefaciens suspensions were stored overnight at 4 C. On the day of infiltration, culture batches were diluted with infiltration medium and allowed to warm before use. Whole plants of N. benthamiana were placed upside down in the bacterial suspension in an air-tight stainless steel tank under a vacuum of 20-40 Torr for 2-min. Following infiltration, plants were returned to the greenhouse for a 9 day incubation period until harvest. Harvested biomass was kept frozen (80 C.) until use for purification of particles.
Extraction and Screening by Ultracentrifugation of Rotavirus-Like Particles
[0379] Proteins were extracted from frozen biomass by mechanical extraction in a blender with 2 volumes of extraction buffer (TNC: 10 mM Tris pH 7.4, 140 mM NaCl, 10 mM CaCl2). The slurry was filtered through a large pore nylon filter to remove large debris and centrifuged 5000 g for 5 min at 4 C. The supernatant was collected and centrifuged again at 5000 g for 30 min (4 C.) to remove additional debris. The supernatant is then loaded on a discontinuous iodixanol density gradient.
[0380] Analytical density gradient centrifugation was performed as follows. 38 ml tubes containing discontinuous iodixanol density gradient in TNC buffer (1.2 ml at 45%, 2 ml at 35%, 5 ml at 30% and 5 ml at 25% of iodixanol) were prepared and overlaid with 25 ml of the extracts containing the rotavirus-like particles. The gradients were centrifuged at 120 000 g for 4 hours (4 C.). After centrifugation, 1 ml fractions were collected from the bottom to the top and fractions 2 and 3 (corresponding to 35% iodixanol) were analysed by SDS-PAGE combined to protein staining or Western blot.
SDS-PAGE and Immunoblotting
[0381] Protein concentrations were determined by the BCA protein assay (Pierce Biochemicals, Rockport, Ill.). Proteins were separated by SDS-PAGE under reducing conditions using Criterion TGX Stain-Free precast gels (Bio-Rad Laboratories, Hercules, Calif.) and proteins were visualized with Gel Doc EZ imaging system (Bio-Rad Laboratories, Hercules, Calif.).
[0382] For immunoblotting, electrophoresed proteins were electrotransferred onto polyvinylene difluoride (PVDF) membranes (Roche Diagnostics Corporation, Indianapolis, Ind.). Prior to immunoblotting, the membranes were blocked with 5% skim milk and 0.1% Tween-20 in Tris-buffered saline (TBS-T) for 16-18 h at 4 C.
[0383] Immunoblotting was performed by incubation with a suitable antibody (Table 4) in 2% skim milk in TBS-Tween 20 0.1%. Secondary antibodies used for chemiluminescence detection were as indicated in Table 4, diluted as indicated in 2% skim milk in TBS-Tween 20 0.1%. Immunoreactive complexes were detected by chemiluminescence using luminol as the substrate (Roche Diagnostics Corporation, Indianapolis, Ind.).
TABLE-US-00011 TABLE 4 Electrophoresis conditions, antibodies, and dilutions for immunoblotting of rotavirus antigens. Rotavirus Electrophoresis Secondary antigen condition Primary antibody Dilution antibody Dilution VP4 Reducing Rabbit serum from 1:30 000 Goat anti- 1:10 000 immunized Rabbit rabbit (JIR with recombinant VP4 111-035-144) (in house) VP7 Reducing Rabbit serum from 1:50 000 Goat anti- 1:10 000 immunized Rabbit rabbit (JIR with recombinant VP7 111-035-144) (in house)
[0384] All citations are hereby incorporated by reference.
[0385] The present invention has been described with regard to one or more embodiments. However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims.