Detection of Target Oligonucleotides

20230212651 · 2023-07-06

    Inventors

    Cpc classification

    International classification

    Abstract

    There is provided a method of detecting the presence of a nucleic acid target sequence in which two oligonucleotides are used to forma three-way junction with the target sequence to allow detection of the target sequence. Alternatively, three oligonucleotides can be used to form a four-way junction with the target sequence to allow detection of the target sequence.

    Claims

    1. A method of detecting the presence of a nucleic acid target sequence, the method comprising the steps of: a) adding a first, a second and a third oligonucleotide to a sample comprising nucleic acid sequences, wherein: i. the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of the target sequence; ii. the second oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the first portion of the first oligonucleotide and the second portion being complementary to a second portion of the target sequence; b) adding a polymerase to the sample, wherein when the target sequence is present in the sample: i. the polymerase initiates nucleic acid synthesis from the first oligonucleotide using the second oligonucleotide as a template strand to generate an extended first oligonucleotide; ii. the third oligonucleotide comprises a portion that is complementary and hybridises to the newly synthesised portion of the extended first oligonucleotide; and iii. the polymerase initiates nucleic acid synthesis from the third oligonucleotide using the extended first oligonucleotide as a template strand to generate a double stranded nucleic acid; c) detecting the double stranded nucleic acid.

    2. A method of detecting the presence of a nucleic acid target sequence, the method comprising the steps of: a) adding a first, a second, a third and a fourth oligonucleotide to a sample comprising nucleic acid sequences, wherein: i. the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of either the target sequence or the fourth oligonucleotide; ii. the second oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the first portion of the first oligonucleotide and the second portion being complementary to a first portion of either the fourth oligonucleotide or the target sequence; iii. the fourth oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the second portion of either the first or second oligonucleotide and the second portion being complementary to a second portion of the target sequence; b) adding a polymerase to the sample, wherein when the target sequence is present in the sample: i. the polymerase initiates nucleic acid synthesis from the first oligonucleotide using the second oligonucleotide as a template strand to generate an extended first oligonucleotide; ii. the third oligonucleotide comprises a portion that is complementary and hybridises to the newly synthesised portion of the extended first oligonucleotide; and iii. the polymerase initiates nucleic acid synthesis from the third oligonucleotide using the extended first oligonucleotide as a template strand to generate a double stranded nucleic acid; c) detecting the double stranded nucleic acid.

    3. The method according to claim 1, wherein the nucleic acid target sequence is an RNA target sequence.

    4. The method according to claim 1, wherein the polymerase added to the sample is a DNA polymerase.

    5. The method according to claim 1, wherein the double stranded nucleic acid is subjected to an amplification step prior to the detection step.

    6. The method according to claim 5, wherein the amplification step is performed using polymerase chain reaction.

    7. The method according to claim 2, wherein the second portion of the first oligonucleotide is complementary to the first portion of the fourth oligonucleotide, the second portion of the second oligonucleotide is complementary to the first portion of the target sequence, and the first portion of the fourth oligonucleotide is complementary to the second portion of the first oligonucleotide.

    8. The method according to claim 2, wherein the second portion of the first oligonucleotide is complementary to the first portion of the target sequence, the second portion of the second oligonucleotide is complementary to the first portion of the fourth oligonucleotide, and the first portion of the fourth oligonucleotide is complementary to the second portion of the second oligonucleotide.

    9. The method according to claim 1 comprising the steps of: a) adding a first, a second and a third oligonucleotide to a sample comprising RNA nucleic acid sequences, wherein: i. the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of the target sequence, wherein the first portion is positioned at the 3′ end of the first oligonucleotide and the second portion is on the 5′ side of the first portion; ii. the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a second portion of the target sequence, and the third portion being homologous to a portion of the third oligonucleotide, wherein the first portion is positioned on the 5′ side of the second portion and the third portion is positioned on the 5′ side of the first portion; b) adding a DNA polymerase to the sample, wherein when the RNA target sequence is present in the sample: i. the polymerase initiates nucleic acid synthesis from the 3′ end of the first oligonucleotide using the second oligonucleotide as a template strand to generate an extended first oligonucleotide; ii. the third oligonucleotide comprises a portion that is complementary and hybridises to the newly synthesised portion of the extended first oligonucleotide; and iii. the DNA polymerase initiates nucleic acid synthesis from the 3′ end of the third oligonucleotide using the extended first oligonucleotide as a template strand to generate a double stranded nucleic acid; c) amplifying the double stranded nucleic acid using a polymerase chain reaction; and d) detecting the double stranded nucleic acid.

    10. The method according to claim 2 comprising the steps of: a) adding a first, a second, a third and a fourth oligonucleotide to a sample comprising RNA nucleic acid sequences, wherein: i. the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of either the target sequence or the fourth oligonucleotide, wherein the first portion is positioned at the 3′ end of the first oligonucleotide and the second portion is on the 5′ side of the first portion; ii. the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a first portion of either the fourth oligonucleotide or the target sequence, and the third portion being homologous to a portion of the third oligonucleotide, wherein the first portion is positioned on the 5′ side of the second portion and the third portion is positioned on the 5′ side of the first portion; iii. the fourth oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the second portion of either the first or second oligonucleotide and the second portion being complementary to a second portion of the target sequence; b) adding a DNA polymerase to the sample, wherein when the RNA target sequence is present in the sample: i. the polymerase initiates nucleic acid synthesis from the 3′ end of the first oligonucleotide using the second oligonucleotide as a template strand to generate an extended first oligonucleotide; ii. the third oligonucleotide comprises a portion that is complementary and hybridises to the newly synthesised portion of the extended first oligonucleotide; and iii. the DNA polymerase initiates nucleic acid synthesis from the 3′ end of the third oligonucleotide using the extended first oligonucleotide as a template strand to generate a double stranded nucleic acid; c) amplifying the double stranded nucleic acid using a polymerase chain reaction; and d) detecting the double stranded nucleic acid.

    11. A first, second or third oligonucleotide for use in the method of claim 1, wherein: a) the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of the target sequence; b) the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a second portion of the target sequence, and the third portion being homologous to a portion of the third oligonucleotide; and/or c) the third oligonucleotide comprises a portion that is homologous to a third portion of the second oligonucleotide.

    12. A first, second, third or fourth oligonucleotide for use in the method of claim 2, wherein: a) the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of either the target sequence or the fourth oligonucleotide; b) the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a first portion of either the fourth oligonucleotide or the target sequence, and the third portion being homologous to a portion of the third oligonucleotide; c) the third oligonucleotide comprises a portion that is homologous to a third portion of the second oligonucleotide; and/or d) the fourth oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the second portion of either the first or second oligonucleotide and the second portion being complementary to a second portion of the target sequence.

    13. (canceled)

    14. (canceled)

    15. A kit for detecting the presence of a nucleic acid target sequence, the kit comprising a first, second and third oligonucleotide, wherein: a) the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of the target sequence; b) the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a second portion of the target sequence, and the third portion being homologous to a portion of the third oligonucleotide; and c) the third oligonucleotide comprises a portion that is homologous to a third portion of the second oligonucleotide.

    16. A kit for detecting the presence of a nucleic acid target sequence, the kit comprising a first, second, third and fourth oligonucleotide, wherein: a) the first oligonucleotide comprises a first portion and a second portion, the first portion being complementary to a first portion of the second oligonucleotide and the second portion being complementary to a first portion of either the target sequence or the fourth oligonucleotide; b) the second oligonucleotide comprises a first portion, a second portion and a third portion, the first portion being complementary to the first portion of the first oligonucleotide, the second portion being complementary to a first portion of either the fourth oligonucleotide or the target sequence, and the third portion being homologous to a portion of the third oligonucleotide; c) the third oligonucleotide comprises a portion that is homologous to a third portion of the second oligonucleotide; and d) the fourth oligonucleotide comprises a first portion and a second portion, the first portion being complementary to the second portion of either the first or second oligonucleotide and the second portion being complementary to a second portion of the target sequence.

    17. The method according to claim 2, wherein the nucleic acid target sequence is an RNA target sequence.

    18. The method according to 2, wherein the polymerase added to the sample is a DNA polymerase.

    19. The method according to 2, wherein the double stranded nucleic acid is subjected to an amplification step prior to the detection step.

    20. The method according to claim 19, wherein the amplification step is performed using polymerase chain reaction.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0105] The invention will now be described in detail by way of example only with reference to the figures in which:

    [0106] FIG. 1 shows a three-way junction system.

    [0107] FIG. 2 shows an exemplary step-by-step process used to detect a target nucleic acid.

    [0108] FIG. 3A shows the first of the four-way junction systems.

    [0109] FIG. 3B shows the second of the four-way junction systems.

    [0110] FIG. 4A shows the formation of the junction using the oligonucleotides detailed in Table 1 of the example.

    [0111] FIG. 4B shows the amplification curves generated in the example.

    DETAILED DESCRIPTION OF THE INVENTION

    [0112] The invention disclosed herein enables the detection of RNA in a sample without the need for a reverse transcription enzyme or cDNA transcription step. The invention is effected by use of a DNA/RNA junction with three or four branches or strands, where the target ribonucleic acid is an essential component without which the junction cannot be stably formed, at a suitable concentration and time for the step to occur, at the T.sub.a (annealing temperature—the temperature at which annealing and optionally extension of oligonucleotides occurs) of the reaction. The invention further comprises, as one element of the junction, a DNA polymer, approximately 60-200 bases in length comprising a ‘junction-forming’ portion, which is optionally target-specific, a universal sequence homologous to that of a DNA probe and a sequence that is complementary to a universal primer. This universal sequence element further allows use of a universal fluorescent probe, thus further reducing the cost of assay development. Multiplexing may be achieved by use of multiple universal target, primer and probe sequences. In some examples of the invention, it may be possible to multiplex by single primer sequence only, thus allowing sharing of probe and reverse primer between common targets. This is particularly relevant when used in combination with hybridisation probes and melting curve analysis.

    [0113] The removal of the need for a reverse transcription step in addition to use of a universal detection method compatible with multiple target assays has the potential to substantially simplify RNA detection in terms of both design and reaction composition, since it enables use of an off-the-shelf qPCR master mix and can use conserved oligonucleotide regions and probes.

    [0114] The invention disclosed herein enables the indirect specific detection of an RNA target through the amplification of a universal synthetic DNA element. The invention comprises the following components: [0115] 1) A ‘forward junction primer’ (FJP—the first oligonucleotide described above) comprising two elements, which, when both elements are hybridised to an appropriate nucleic acid has a Tm such that, under the conditions of the reaction, it is able to extend to form a complementary strand to the ‘universal target element’ (UTE). [0116] 2) A ‘universal target element’ (UTE—the second oligonucleotide described above) comprising, at its 5′ end, a universal sequence homologous to a ‘universal reverse primer’ (URP). The sequence further comprises a universal probe-specific sequence homologous to that of the ‘universal probe’ (UP) such that, when its complement is generated, the universal probe is able to hybridise. The sequence further comprises a target sequence to which the 3′ end of the FJP is able to hybridise when a junction is formed. The sequence further comprises a 3′ junction forming element that enables the UTE to hybridise to an additional nucleotide sequence. This 3′-sequence may be universal or may be a target-specific element. [0117] 3) A ‘universal reverse primer’ (URP—the third oligonucleotide described above), having a Tm such that, under amplification conditions provided, it is able to hybridise to the complementary strand to the UTE (i.e. the extended FJP) and be extended. [0118] 4) Optionally a universal probe homologous to a portion of the UTE to enable quantitative real-time detection. The universal probe is optionally labelled, for example with a fluorophore or for electrochemical detection, and is optionally a hydrolysis probe. [0119] 5) Optionally an additional (non-extending) blocked oligonucleotide (ABO—the fourth oligonucleotide described above) sequence that, when incorporated into the reaction under amplification conditions provided, is able to stabilise a four-way junction, said junction to be formed from the FJP, the UTE, the ABO and the specific target RNA. [0120] 6) Optionally, a label may be incorporated into the FJP as an alternative probing method.

    [0121] The components above are combined in a manner such that the universal element is amplified in the presence of the target nucleic acid but not in its absence under the amplification conditions provided. The reaction occurs in the manner detailed in the drawings and descriptions below.

    [0122] The reaction as described may be performed as a standard qPCR reaction in an off-the-shelf hydrolysis probe reaction mix. Example reagent concentrations are also described.

    [0123] This does not limit its applications to those explicitly described, nor does it limit the scope of the invention. Elements of the invention, for example the FJP and UTE may equally be incorporated into an isothermal amplification reaction. The invention may be improved by further modification of the oligonucleotides, for example by use of modified bases, LNA, PNA, etc. Alternative probe types may be used, for example hybridisation probes. Detection is not explicitly limited to fluorescence, and this method may be incorporated into alternative systems such as those performing detection by electrochemistry and hydrogen ion release. Similarly, this invention is not limited to the reaction mixtures and cycling conditions described. The invention may be improved by modification of salt and buffer conditions, addition of crowding agents, and use of additives capable of modifying the melting temperature of nucleic acids.

    [0124] FIG. 1 shows a three-way junction version of the junction system. The 3′-element of the FJP oligonucleotide is able to hybridise to its complementary portion of the UTE. In the absence of a target nucleotide sequence the T.sub.m (melting temperature) of this interaction is insufficient to produce stable hybridisation at the T.sub.a (annealing temperature) of the amplification reaction and the FJP is not extended. In the presence of the target nucleotide sequence, both the 5′-element of the FJP and the 3′-element of the UTE are able to hybridise to the target nucleotide and the junction becomes stable at the T.sub.a of the reaction. Once the junction is stable, the polymerase chain reaction is able to proceed in the following steps, as detailed in FIG. 2: [0125] 1) The FJP is extended along the UTE to generate a double-stranded universal target sequence with a mismatched tail at its 5′-end. [0126] 2) The URP hybridises to the sequence generated and is extended through the universal sequences to generate a double-stranded target sequence incorporating the entire FJP sequence. [0127] 3) From this point the amplicon generated performs as a standard PCR target and can be amplified independently of the RNA target. Detection may be performed by a standard hydrolysis or hybridisation probe.

    [0128] FIG. 3A shows the first of the four-way junction systems. The 3′-element of the FJP oligonucleotide is able to hybridise to its complementary portion of the UTE while the 5′-element is able to hybridise to the 3′-element of the ABO. In the absence of a target nucleotide sequence the T.sub.m (melting temperature) of the interaction between the ABO and the FJP is insufficient to produce stable hybridisation at the T.sub.a (annealing temperature) of the amplification reaction and the FJP is not extended. In the presence of the target nucleotide sequence, both the 5′-element of the ABO and the 3′-element of the UTE are able to hybridise to the target nucleotide and the four-way junction becomes stable at the T.sub.a of the reaction. Once the junction is stable, the polymerase chain reaction is able to proceed in the following steps: [0129] 1) The FJP is extended along the UTE to generate a double-stranded universal target sequence with a mismatched tail at its 5′-end. [0130] 2) The URP hybridises to the sequence generated and is extended through the universal sequences to generate a double-stranded target sequence incorporating the entire FJP sequence. [0131] 3) From this point the amplicon generated performs as a standard PCR target and can be amplified independently of the RNA target. Detection may be performed by a standard hydrolysis or hybridisation probe.

    [0132] FIG. 3B shows the second of the four-way junction systems. The 3′-element of the FJP oligonucleotide is able to hybridise to its complementary portion of the UTE. In the absence of a target nucleotide sequence the T.sub.m (melting temperature) of the interaction between the FJP and the UTE is insufficient to produce stable hybridisation at the T.sub.a (annealing temperature) of the amplification reaction and the FJP is not extended. In the presence of the target nucleotide sequence, the target sequence is hybridised to the 3′-element of the ABO and the 5′-element of the FJP. The 5′ element of the ABO is also able to hybridise to the 3′-element of the UTE and the four-way junction becomes stable at the T.sub.a of the reaction. Once the junction is stable, the polymerase chain reaction is able to proceed in the following steps: [0133] 1) The FJP is extended along the UTE to generate a double-stranded universal target sequence with a mismatched tail at its 5′-end. [0134] 2) The URP hybridises to the sequence generated and is extended through the universal sequences to generate a double-stranded target sequence incorporating the entire FJP sequence.

    [0135] From this point the amplicon generated performs as a standard PCR target and can be amplified independently of the RNA target. Detection may be performed by a standard hydrolysis or hybridisation probe.

    EXAMPLES

    [0136] This example details one example of the application of the three-way junction system.

    [0137] Promega GoTaq probe qPCR master mix (Promega, UK) was combined with the components below to produce a reaction mixture comprising 1× concentration Promega GoTaq master mix and the oligonucleotides at the concentrations described. Note that the FluB_target is an RNA oligonucleotide.

    TABLE-US-00001 TABLE 1 Concentration/ Oligo ID Oligo Sequence reaction FluB_FJP AGACTCCCACCGCAGTTTCTTTGGTCTGGCTGT 900 nM GATCTAGA (SEQ ID NO. 1) FluB_UTE GTCTGATCAACCTTCAAACAGATCTAGAGTCT  50 nM AAAACAGTGATCTCCTGCGTGCGAGATAGAA ATACTAGGTAACTACAGGGACTGCGACGTTCT AGATCACAGCCAGACCAAAAGCTGCTCGAAT TGGCTTTG (SEQ ID NO. 2) FluB_URP CAGATCTAGAGTCTAAAACAGTGATCTCCTG 900 nM CG (SEQ ID NO. 3) FluB_UP /56-FAM/CGAGATAGAAATACTAGGTAACTAC 300 nM AGGGACTGC/36-TAMSp/ (SEQ ID NO. 4) FluB_target CUGCAAAGCCAAUUCGAGCAGCUGAAACUG 8 pM-8 nM CGGUGGGAGUCUCUG (RNA) (SEQ ID NO. 5)

    [0138] FIG. 4A shows the formation of the three-way junction using the oligonucleotides detailed Table 1.

    [0139] The Promega GoTaq polymerase was activated using a two-minute hot start at 95° C. This was followed by forty amplification cycles comprising a 5 second hold at 95° C. followed by a 30 second hold at 60° C. with fluorescent detection. Amplification curves are depicted in FIG. 4B and C.sub.t values are shown in Table 2 below.

    TABLE-US-00002 TABLE 2 Concentration of FluB_target C.sub.t Mean 8 nM 28.2 800 pM  28.7 80 pM  31.0 8 pM 33.9 NTC 37.9

    [0140] The amplification data clearly shows a concentration-dependent amplification effect. At high concentrations, C.sub.t values are determined by the ability of the nucleotides to form a junction, while below this, C.sub.t is limited by target input concentration. Sensitivity and specificity may be further improved by modifications to reaction mixes, amplification conditions and oligonucleotide concentrations.