ANDROGEN RECEPTOR ANTISENSE OLIGONUCLEOTIDES
20190345202 ยท 2019-11-14
Inventors
- Shin Chung (Yongin-si, KR)
- Daram Jung (Hwaseong-Si, KR)
- Bongjun Cho (Yongin-Si, KR)
- Kangwon Jang (Yongin-Si, KR)
- Heungsik Yoon (Seongnam-Si, KR)
Cpc classification
C07K7/02
CHEMISTRY; METALLURGY
Y02P20/55
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07K14/00
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
A61K9/0014
HUMAN NECESSITIES
International classification
C07K14/00
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C07K7/02
CHEMISTRY; METALLURGY
Abstract
Provided are peptide nucleic acid derivatives targeting the 5 splice site of exon 5 within the human androgen receptor pre-mRNA. The peptide nucleic acid derivatives potently induce splice variants of the androgen receptor mRNA in cells, and are useful to safely treat dermatological indications or conditions involving androgenic activity upon topical administration.
Claims
1. A peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: ##STR00011## wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 9-mer complementary overlap with a 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human androgen receptor pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
2. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 10 and 21; the compound of Formula I possesses at least a 9-mer complementary overlap with a 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human androgen receptor pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and at least three of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV: ##STR00012## wherein, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety: ##STR00013## wherein, Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and m is an integer between 1 and 15.
3. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 10 and 18; the compound of Formula I possesses at least a 9-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, or substituted or non-substituted aryloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and m is an integer between 1 and 11.
4. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 16; the compound of Formula I possesses at least a 11-mer complementary overlap with the 17-mer AR pre-mRNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA; the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and m is an integer between 1 and 10.
5. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 16; the compound of Formula I possesses at least a 12-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA; the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen radical; and m is an integer between 1 and 10.
6. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 16; the compound of Formula I possesses at least a 12-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA; the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and m is an integer between 1 and 8.
7. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 15; the compound of Formula I possesses at least a 11-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA; the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X is hydrido radical; Y represents substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O(CH.sub.2).sub.5 with the right end being directly linked to the basic amino group; and, L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, (CH.sub.2).sub.2O(CH.sub.2).sub.3, (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, and (CH.sub.2).sub.8 with the right end being directly linked to the basic amino group.
8. The peptide nucleic acid derivative according to claim 1, which is selected from the group of peptide nucleic acid derivatives provided below, or a pharmaceutically acceptable salt thereof: (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Ac-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Benzoyl-GA(5)A-GC(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Piv-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Methyl-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) n-Propyl-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fmoc-Lys-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fmoc-Lys-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2 (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) Fmoc-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fmoc-Lys-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) Fmoc-Val-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fmoc-GA(6)A-GC(1O2)C-A(6)GG-C(1O2)AA(6)-G-NH.sub.2; (N.fwdarw.C) Fmoc-G(6)AA(5)-GC(103)C-A(7)GG(5)-CA(5)A-G-NH.sub.2; (N.fwdarw.C) Fmoc-GA(5)A-GC(2O2)C-A(6)GG-C(1O5)AA(6)-G-NH.sub.2; (N.fwdarw.C) Fmoc-TG(6)C(1O5)-GGA(6)-AG(6)C-CA(6)G-GC(1O2)A-A(6)GG(6)-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-Lys-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(5)GG-C(103)AA(5)-G-Val-Lys-NH.sub.2; (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2; (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) HC(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) HCTT-A(5)C(103)C-A(5)G(3)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) n-Propyl-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) n-Propyl-CTT-A(5)C(2O2)C-A(3)G(203)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) p-Toluenesulfonyl-CTT-A(5)C(1O2)C-A(8)G(5)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Benzoyl-Lys-Val-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Benzoyl-CTT-A(5)C(1O5)C-A(5)G(2O2)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-Lys-Leu-CTT-A(5)C(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O5)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GT-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)A(5)A-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-AG(5)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG-C(1O2)AA(3)-G-NH.sub.2; (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-Arg-NH.sub.2; (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)G-G(6)-NH.sub.2; (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)G-G(6)-NH.sub.2; (N.fwdarw.C) Fethoc-GA(5)T-AC(1O2)C-A(5)GG(6)-CAA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-TA(5)C-CAG(6)-GC(1O2)A-A(5)GG(6)-CNH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) Benzyl-C(1O2)TT-A(2O2)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) Phenyl-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG(5)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(6)GG(2O2)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Val-Lys-NH.sub.2; (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fmoc-Lys-Val-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) HC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2; (N.fwdarw.C) Piv-Arg-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2; (N.fwdarw.C)N-Phenyl-N-methyl-CTT-A(5)C(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-CTT-A(5)C(1O2)C-A(4)G(5)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Benzoyl-Leu-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-C(103)TT-A(5)CC-A(5)GG(5)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(6)GG(6)-CA(6)A-NH.sub.2; (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2; (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CC(103)A(6)-G-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2; (N.fwdarw.C) Me-Gly-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2; (N.fwdarw.C) Fethoc-Lys-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)CNH.sub.2; and (N.fwdarw.C) Fethoc-Arg-TCC(1O2)-TTA(5)-CCA(6)-GG(5)C-Lys-NH.sub.2: wherein, A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively; C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively; ##STR00014## wherein, p and q are integers; and, the abbreviations for the N- and C-terminus substituents are as specifically described as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy] carbonyl; Ac for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; Methyl- for methyl-; n-Propyl- for 1-(n-propyl)-; H for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N-1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; and NH for non-substituted -amino group.
9. The peptide nucleic acid derivative according to claim 1, which is selected from the group of compounds provided below, or a pharmaceutically acceptable salt thereof: (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fmoc-GA(6)A-GC(1O2)C-A(6)GG-C(1O2)AA(6)-G-NH.sub.2; (N.fwdarw.C) Fmoc-G(6)AA(5)-GC(103)C-A(7)GG(5)-CA(5)A-G-NH.sub.2; (N.fwdarw.C) Fmoc-GA(5)A-GC(2O2)C-A(6)GG-C(1O5)AA(6)-G-NH.sub.2; (N.fwdarw.C) Fethoc-TG(6)C(1O2)-GGA(6)-AG(6)C-CA(6)G-GC(1O2)A-A(6)GG(6)-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(5)GG-C(103)AA(5)-G-Val-Lys-NH.sub.2; (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2; (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) HCTT-A(5)C(103)C-A(5)G(3)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) n-Propyl-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) n-Propyl-CTT-A(5)C(2O2)C-A(3)G(203)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) p-Toluenesulfonyl-CTT-A(5)C(1O2)C-A(8)G(5)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Benzoyl-CTT-A(5)C(1O5)C-A(5)G(2O2)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-Lys-Leu-CTT-A(5)C(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O5)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG-C(1O2)AA(3)-G-NH.sub.2; (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)G-G(6)-NH.sub.2; (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)G-G(6)-NH.sub.2; (N.fwdarw.C) Fethoc-GA(5)T-AC(1O2)C-A(5)GG(6)-CAA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-TA(5)C-CAG(6)-GC(1O2)A-A(5)GG(6)-CNH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG(5)-CA(5)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(6)GG(2O2)-CA(5)A-NH.sub.2; (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2; (N.fwdarw.C)N-Phenyl-N-methyl-CTT-A(5)C(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2; (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-CTT-A(5)C(1O2)C-A(4)G(5)G-C(1O2)AA(5)-G-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(6)GG(6)-CA(6)A-NH.sub.2; (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2; (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CC(103)A(6)-G-Lys-NH.sub.2; and (N.fwdarw.C) Fethoc-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2.
10. A method to treat a dermatological indication or condition involving androgenic activity comprising topically administering the peptide nucleic acid derivative according to claim 1.
11. A method to treat androgenic alopecia comprising topically administering the peptide nucleic acid derivative according to claim 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
SUMMARY OF INVENTION
[0071] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00004##
[0072] wherein,
[0073] n is an integer between 10 and 21;
[0074] the compound of Formula I possesses at least a 9-mer complementary overlap with a 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human androgen receptor pre-mRNA;
[0075] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0076] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;
[0077] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0078] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0079] The compound of Formula I induces alternative splicing of the human AR pre-mRNA, yields AR mRNA splice variant(s) lacking exon 5, and therefore is useful to safely treat dermatological indications or conditions involving androgenic activity upon topical administration.
DESCRIPTION OF INVENTION
[0080] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00005##
[0081] wherein,
[0082] n is an integer between 10 and 21;
[0083] the compound of Formula I possesses at least a 9-mer complementary overlap with a 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human androgen receptor pre-mRNA;
[0084] S.sub.1, S.sub.2, . . . , S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0085] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;
[0086] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0087] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0088] The compound of Formula I induces alternative splicing of the human AR pre-mRNA, yields AR mRNA splice variant(s) lacking exon 5, and therefore is useful to safely treat dermatological indications or conditions involving androgenic activity upon topical administration.
[0089] The condition that n is an integer between 10 and 21 literally states that n is an integer selectable from a group of integers of 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20.
[0090] The compound of Formula I tightly binds to the 5 splice site of exon 5 of the human AR pre-mRNA transcribed from the human AR gene. [NCBI Reference Sequence: NC_000023.11] The 40-mer AR pre-mRNA sequence consisting of a 20-mer from exon 5 and a 20-mer from intron 5 unequivocally reads [(5.fwdarw.3) GUGGGCCAAGGCCUUGCCUG-GUAAGGAAAAGGGAAGUGGG (SEQ ID NO: 2)], although the exon and intron number may vary depending on AR mRNA transcript. The 40-mer pre-mRNA sequence may be alternatively denoted as [(5.fwdarw.3) GUGGGCCAAGGCCUUGCCUG|guaaggaaaagggaaguggg (SEQ ID NO: 2)], wherein the exon and intron sequences are expressed with capital and small letters, respectively, and the exon/intron junction is expressed with |.
[0091] The 17-mer pre-mRNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] adopted to describe the compound of Formula I in this invention consists of 9-mer in the AR exon 5 and 8-mer in the AR intron 5. Thus the 17-mer pre-mRNA sequence may alternatively read [(5.fwdarw.3) CCUUGCCUG|guaaggaa (SEQ ID NO: 1)].
[0092] The compound of Formula I tightly binds to the target 5 splice site of exon 5 in the human AR pre-mRNA, and interferes with the formation of splicesome early complex involving the compound's target exon. Since the compound of this invention sterically inhibits the formation of splicesome early complex, the AR exon 5 is spliced out to yield an AR mRNA splice variant or variants lacking exon 5. Consequently the compound of this invention induces the skipping of exon 5.
[0093] The compound of Formula I tightly binds to the complementary DNA as exemplified in the prior art [PCT/KR2009/001256]. The duplex between the PNA derivative of Formula I and its full-length complementary DNA or RNA shows a T.sub.m value too high to be reliably determined in aqueous buffer. The PNA compound of Formula I still yields high T.sub.m values with complementary DNAs of shorter length, for example, 10-mer.
[0094] Owing to the high binding affinity, the PNA derivative of this invention potently induces the skipping of exon 5 in cells even with a complementary overlap of as small as 9-mer with the 5 splice site of exon 5, although such a small number of overlap may increase the risk of cross reactivity with other pre-mRNAs. If the PNA derivative of this invention is used for topical therapeutic purposes, the risk of the cross reactivity is predicted to be considerably attenuated.
[0095] The chemical structures of natural or unnatural nucleobases in the PNA derivative of Formula I are exemplified in
[0096] The substituents adopted to describe the PNA derivative of Formula I are exemplified in
[0097] The compound of Formula I possesses good cell permeability and can be readily delivered into cell if treated as naked oligonucleotide as exemplified in the prior art [PCT/KR2009/001256]. Thus the compound of this invention induces the skipping of exon 5 in the human AR pre-mRNA to yield AR mRNA splice variant(s) lacking AR exon 5 in cells treated with the compound of Formula I as naked oligonucleotide. The compound of Formula I does not require any means or formulations for delivery into cell to potently induce the skipping of the target exon in cells. The compound of Formula I readily induces the skipping of the AR exon 5 in cells treated with the compound of this invention as naked oligonucleotide at sub-femtomolar concentration.
[0098] Owing to the good cell or membrane permeability, the PNA derivative of Formula I can be topically administered as naked oligonucleotide to induce the skipping of the AR exon 5 in target skin. The compound of Formula I does not require a formulation to increase trans-dermal delivery for a topical therapeutic or biological activity. Usually the compound of Formula I is dissolved in water and co-solvent, and topically or trans-dermally administered at sub-picomolar concentration to elicit the desired therapeutic or biological activity in the target skin. The compound of this invention does not need to be heavily or invasively formulated to elicit the topical therapeutic activity.
[0099] The compound of Formula I may be used as combined with a pharmaceutically acceptable acid or base including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and so on.
[0100] The PNA derivative of Formula I or a pharmaceutically acceptable salt thereof can be administered to a subject in combination with a pharmaceutically acceptable adjuvant including but not limited to citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethyleneglycol, polypropyleneglycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), and so on.
[0101] The compound of the present invention can be topically administered to a subject at a therapeutically or biologically effective concentration ranging from 1 aM to higher than 1 nM, which would vary depending on the dosing schedule, conditions or situations of the subject, and so on.
[0102] Preferred is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0103] wherein,
[0104] n is an integer between 10 and 21;
[0105] the compound of Formula I possesses at least a 9-mer complementary overlap with a 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human androgen receptor pre-mRNA;
[0106] S.sub.1, S.sub.2, . . . , S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0107] X and Y independently represent hydrido [H], formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;
[0108] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0109] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and
[0110] at least three of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV:
##STR00006##
[0111] wherein,
[0112] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0113] L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety:
##STR00007##
[0114] wherein,
[0115] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group;
[0116] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and m is an integer between 1 and 15.
[0117] Of interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0118] wherein,
[0119] n is an integer between 10 and 18;
[0120] the compound of Formula I possesses at least a 9-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA;
[0121] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0122] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, or substituted or non-substituted aryloxycarbonyl radical;
[0123] Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0124] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0125] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0126] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0127] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and m is an integer between 1 and 11.
[0128] Of particular interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0129] wherein,
[0130] n is an integer between 11 and 16;
[0131] the compound of Formula I possesses at least a 11-mer complementary overlap with the 17-mer AR pre-mRNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA;
[0132] the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA;
[0133] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0134] X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0135] Z represents substituted or non-substituted amino radical;
[0136] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine and cytosine, and unnatural nucleobases;
[0137] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0138] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0139] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0140] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and
[0141] m is an integer between 1 and 10.
[0142] Of high interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0143] wherein,
[0144] n is an integer between 11 and 16;
[0145] the compound of Formula I possesses at least a 12-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA;
[0146] the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA;
[0147] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0148] X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0149] Z represents substituted or non-substituted amino radical;
[0150] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0151] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0152] R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical;
[0153] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0154] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen radical; and
[0155] m is an integer between 1 and 10.
[0156] Of higher interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0157] wherein,
[0158] n is an integer between 11 and 16;
[0159] the compound of Formula I possesses at least a 12-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA;
[0160] the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA;
[0161] S.sub.1, S.sub.2, . . . , S.sub.n-1, T.sub.1, T.sub.2, . . . , and T.sub.n are hydrido radical;
[0162] X and Y independently selected from hydrido, substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0163] Z represents substituted or non-substituted amino radical;
[0164] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0165] at least five of B.sub.1, B.sub.2, . . . , and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0166] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0167] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0168] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and
[0169] m is an integer between 1 and 8.
[0170] Of highest interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0171] wherein,
[0172] n is an integer between 11 and 15;
[0173] the compound of Formula I possesses at least a 11-mer complementary overlap with the 17-mer RNA sequence of [(5.fwdarw.3) CCUUGCCUGGUAAGGAA (SEQ ID NO: 1)] within the human AR pre-mRNA;
[0174] the compound of Formula I is fully complementary to a pre-mRNA sequence within the human AR pre-mRNA;
[0175] S.sub.1, S.sub.2, . . . , S.sub.n-1, T.sub.1, T.sub.2, . . . , and T.sub.n are hydrido radical;
[0176] X is hydrido radical;
[0177] Y represents substituted or non-substituted alkylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0178] Z represents substituted or non-substituted amino radical;
[0179] B.sub.1, B.sub.2, B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0180] at least five of B.sub.1, B.sub.2, B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0181] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0182] L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O(CH.sub.2).sub.5 with the right end being directly linked to the basic amino group; and,
[0183] L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, (CH.sub.2).sub.2O(CH.sub.2).sub.3, (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, and (CH.sub.2).sub.8 with the right end being directly linked to the basic amino group.
[0184] Of specific interest is a PNA derivative of Formula I which is selected from the group of compounds provided below, or a pharmaceutically acceptable salt thereof:
[0185] (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0186] (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0187] (N.fwdarw.C) Ac-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0188] (N.fwdarw.C) Benzoyl-GA(5)A-GC(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-NH.sub.2;
[0189] (N.fwdarw.C) Piv-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0190] (N.fwdarw.C) Methyl-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0191] (N.fwdarw.C) n-Propyl-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0192] (N.fwdarw.C) Fmoc-Lys-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0193] (N.fwdarw.C) Fmoc-Lys-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2
[0194] (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0195] (N.fwdarw.C) Fmoc-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0196] (N.fwdarw.C) Fmoc-Lys-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0197] (N.fwdarw.C) Fmoc-Val-Gly-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0198] (N.fwdarw.C) Fmoc-GA(6)A-GC(1O2)C-A(6)GG-C(1O2)AA(6)-G-NH.sub.2;
[0199] (N.fwdarw.C) Fmoc-G(6)AA(5)-GC(103)C-A(7)GG(5)-CA(5)A-G-NH.sub.2;
[0200] (N.fwdarw.C) Fmoc-GA(5)A-GC(2O2)C-A(6)GG-C(1O5)AA(6)-G-NH.sub.2;
[0201] (N.fwdarw.C) Fmoc-TG(6)C(1O5)-GGA(6)-AG(6)C-CA(6)G-GC(1O2)A-A(6)GG(6)-NH.sub.2;
[0202] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0203] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-Lys-Lys-NH.sub.2;
[0204] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0205] (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(5)GG-C(103)AA(5)-G-Val-Lys-NH.sub.2;
[0206] (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2;
[0207] (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0208] (N.fwdarw.C) HC(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0209] (N.fwdarw.C) HCTT-A(5)C(103)C-A(5)G(3)G-C(1O2)AA(5)-G-NH.sub.2;
[0210] (N.fwdarw.C) n-Propyl-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0211] (N.fwdarw.C) n-Propyl-CTT-A(5)C(2O2)C-A(3)G(203)G-C(1O2)AA(5)-G-NH.sub.2;
[0212] (N.fwdarw.C) p-Toluenesulfonyl-CTT-A(5)C(1O2)C-A(8)G(5)G-C(1O2)AA(5)-G-NH.sub.2;
[0213] (N.fwdarw.C) Benzoyl-Lys-Val-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0214] (N.fwdarw.C) Benzoyl-CTT-A(5)C(1O5)C-A(5)G(2O2)G-C(1O2)AA(5)-G-NH.sub.2;
[0215] (N.fwdarw.C) Fethoc-Lys-Leu-CTT-A(5)C(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0216] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O5)AA(5)-G-NH.sub.2;
[0217] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GT-C(1O2)AA(5)-G-NH.sub.2;
[0218] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2;
[0219] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)A(5)A-G-NH.sub.2;
[0220] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-AG(5)G-C(1O2)AA(5)-G-NH.sub.2;
[0221] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG-C(1O2)AA(3)-G-NH.sub.2;
[0222] (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-NH.sub.2;
[0223] (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-Arg-NH.sub.2;
[0224] (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)G-G(6)-NH.sub.2;
[0225] (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)G-G(6)-NH.sub.2;
[0226] (N.fwdarw.C) Fethoc-GA(5)T-AC(1O2)C-A(5)GG(6)-CAA(5)-G-NH.sub.2;
[0227] (N.fwdarw.C) Fethoc-TA(5)C-CAG(6)-GC(1O2)A-A(5)GG(6)-CNH.sub.2;
[0228] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0229] (N.fwdarw.C) Benzyl-C(1O2)TT-A(2O2)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0230] (N.fwdarw.C) Phenyl-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0231] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG(5)-CA(5)A-NH.sub.2;
[0232] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(6)GG(2O2)-CA(5)A-NH.sub.2;
[0233] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Val-Lys-NH.sub.2;
[0234] (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0235] (N.fwdarw.C) Fmoc-Lys-Val-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0236] (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0237] (N.fwdarw.C) HC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2;
[0238] (N.fwdarw.C) Piv-Arg-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2;
[0239] (N.fwdarw.C) N-Phenyl-N-methyl-CTT-A(5)C(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0240] (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-CTT-A(5)C(1O2)C-A(4)G(5)G-C(1O2)AA(5)-G-NH.sub.2;
[0241] (N.fwdarw.C) Benzoyl-Leu-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-Lys-NH.sub.2;
[0242] (N.fwdarw.C) Fethoc-C(103)TT-A(5)CC-A(5)GG(5)-CA(5)A-NH.sub.2;
[0243] (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(6)GG(6)-CA(6)A-NH.sub.2;
[0244] (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2;
[0245] (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CC(103)A(6)-G-Lys-NH.sub.2;
[0246] (N.fwdarw.C) Fethoc-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2;
[0247] (N.fwdarw.C) Me-Gly-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2;
[0248] (N.fwdarw.C) Fethoc-Lys-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)CNH.sub.2; and
[0249] (N.fwdarw.C) Fethoc-Arg-TCC(1O2)-TTA(5)-CCA(6)-GG(5)C-Lys-NH.sub.2:
[0250] wherein,
[0251] A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively;
[0252] C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively;
##STR00008##
[0253] wherein,
[0254] p and q are integers; and,
[0255] the abbreviations for the N- and C-terminus substituents are as specifically described as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy] carbonyl; Ac for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; Methyl- for methyl-; n-Propyl- for 1-(n-propyl)-; H for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N-1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; and NH.sub.2 for non-subsituted -amino group.
[0256]
[0257]
[0258] In order to illustrate the abbreviations for the PNA derivatives, the chemical structure for the PNA derivative abbreviated as (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2 is provided in
[0259] The 13-mer PNA sequence of (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) GAA-GCC-AGG-CAA-G (SEQ ID NO: 3) in binding to its complementary binding with pre-mRNA. The 13-mer PNA has a 9-mer complementary overlap with the 9-mer sequence marked as bold and underlined in the 20-mer RNA sequence
TABLE-US-00001 [(5.fwdarw.3)GCCUUGCCUG|guaaggaaaa (SEQIDNO:4)]
spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA. It is noted that the four single mismatches in intron 5 is marked as uaag.
[0260] The 13-mer PNA sequence of (N.fwdarw.C) Benzoyl-Lys-Val-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) CTT-ACC-AGG-CAA-G (SEQ ID NO:5), which has a 13-mer complementary overlap with the 13-mer sequence marked as bold and underlined in the 20-mer RNA sequence
TABLE-US-00002 [(5.fwdarw.3) GCCUUGCCUG|guaaggaaaa(SEQIDNO:4)]
spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA.
[0261] The 13-mer PNA sequence of (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) CTT-ACC-AGG-CTA-G (SEQ ID NO: 6), which has a 12-mer complementary overlap with the 12-mer sequence as marked bold and underlined in the 20-mer RNA sequence [(5.fwdarw.3) GCCUUGCCUG|guaaggaaaa (SEQ ID NO: 4)] spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA. It is noted that the single mismatch in exon 5 is marked as U.
[0262] The 17-mer PNA sequence of (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) TTT-TCC-TTA-CCA-GGC-AA (SEQ ID NO: 7), which has a 17-mer complementary overlap with the 17-mer sequence marked as bold and underlined in the 20-mer RNA sequence
TABLE-US-00003 [(5.fwdarw.3) GCCUUGCCUG|guaaggaaaa(SEQIDNO:4)]
spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA.
[0263] The present invention provides a PNA derivative of Formula I which is selected from the group of specifically preferred compounds enlisted below, or a pharmaceutically acceptable salt thereof:
[0264] (N.fwdarw.C) Fmoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0265] (N.fwdarw.C) Fethoc-GA(5)A-GC(1O2)C-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0266] (N.fwdarw.C) Fmoc-GA(6)A-GC(1O2)C-A(6)GG-C(1O2)AA(6)-G-NH.sub.2;
[0267] (N.fwdarw.C) Fmoc-G(6)AA(5)-GC(103)C-A(7)GG(5)-CA(5)A-G-NH.sub.2;
[0268] (N.fwdarw.C) Fmoc-GA(5)A-GC(2O2)C-A(6)GG-C(1O5)AA(6)-G-NH.sub.2;
[0269] (N.fwdarw.C) Fethoc-TG(6)C(1O2)-GGA(6)-AG(6)C-CA(6)G-GC(1O2)A-A(6)GG(6)-NH.sub.2;
[0270] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0271] (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(5)GG-C(103)AA(5)-G-Val-Lys-NH.sub.2;
[0272] (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG-C(1O2)TA(5)-G-NH.sub.2;
[0273] (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0274] (N.fwdarw.C) HCTT-A(5)C(103)C-A(5)G(3)G-C(1O2)AA(5)-G-NH.sub.2;
[0275] (N.fwdarw.C) n-Propyl-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2;
[0276] (N.fwdarw.C) n-Propyl-CTT-A(5)C(2O2)C-A(3)G(203)G-C(1O2)AA(5)-G-NH.sub.2;
[0277] (N.fwdarw.C) p-Toluenesulfonyl-CTT-A(5)C(1O2)C-A(8)G(5)G-C(1O2)AA(5)-G-NH.sub.2;
[0278] (N.fwdarw.C) Benzoyl-CTT-A(5)C(1O5)C-A(5)G(2O2)G-C(1O2)AA(5)-G-NH.sub.2;
[0279] (N.fwdarw.C) Fethoc-Lys-Leu-CTT-A(5)C(1O2)C-A(2O2)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0280] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O5)AA(5)-G-NH.sub.2;
[0281] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG-C(1O2)AA(3)-G-NH.sub.2;
[0282] (N.fwdarw.C) Fethoc-CTT-A(5)C(1O2)C-A(5)GT-C(1O2)TA(5)-G-NH.sub.2;
[0283] (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)G-G(6)-NH.sub.2;
[0284] (N.fwdarw.C) Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)G-G(6)-NH.sub.2;
[0285] (N.fwdarw.C) Fethoc-GA(5)T-AC(1O2)C-A(5)GG(6)-CAA(5)-G-NH.sub.2;
[0286] (N.fwdarw.C) Fethoc-TA(5)C-CAG(6)-GC(1O2)A-A(5)GG(6)-CNH.sub.2;
[0287] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0288] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(7)GG(5)-CA(5)A-NH.sub.2;
[0289] (N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(6)GG(2O2)-CA(5)A-NH.sub.2;
[0290] (N.fwdarw.C) Piv-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0291] (N.fwdarw.C) AcC(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2;
[0292] (N.fwdarw.C)N-Phenyl-N-methyl-CTT-A(5)C(1O2)C-A(5)GG-C(1O2)AA(5)-G-Lys-NH.sub.2;
[0293] (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-CTT-A(5)C(1O2)C-A(4)G(5)G-C(1O2)AA(5)-G-NH.sub.2;
[0294] (N.fwdarw.C) Fethoc-C(1O2)TT-A(6)CC-A(6)GG(6)-CA(6)A-NH.sub.2;
[0295] (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2;
[0296] (N.fwdarw.C) Fethoc-TTT-TCC(1O2)-TTA(6)-CC(103)A(6)-G-Lys-NH.sub.2; and
[0297] (N.fwdarw.C) Fethoc-TC(2O2)C-TTA(6)-CCA(6)-GG(6)C-A(6)A-NH.sub.2.
DETAILED DESCRIPTION OF INVENTION
General Procedures for Preparation of PNA Oligomers
[0298] PNA oligomers were synthesized by solid phase peptide synthesis (SPPS) based on Fmoc-chemistry according to the method disclosed in the prior art [U.S. Pat. No. 6,133,444; WO96/40685] with minor but due modifications. The solid support employed in this study was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Fmoc-PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications. Such Fmoc-PNA monomers with a modified nucleobase and Fmoc-PNA monomers with a naturally occurring nucleobase were used to synthesize the PNA derivatives of the present invention. PNA oligomers were purified by C.sub.18-reverse phase HPLC (watre/acetonitrile or water/methanol with 0.1% TFA) and characterized by mass spectrometry.
[0299] Scheme 1 illustrates a typical monomer elongation cycle adopted in the SPPS of this invention, and procedural details are provided below. To a skilled person in the field, however, lots of minor variations are obviously possible in effectively running such SPPS reactions on an automatic peptide synthesizer or manual peptide synthesizer. Each reaction step in Scheme 1 is briefly provided as follows.
##STR00009##
[0300] [Activation of H-Rink-ChemMatrix Resin] 0.01 mmol (ca 20 mg resin) of the ChemMatrix resin in 1.5 mL 20% piperidine/DMF was vortexed in a libra tube for 20 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL methylene chloride (MC), 1.5 mL dimethylformamide (DMF), 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were subjected to coupling either with an Fmoc-PNA monomer or with an Fmoc-protected amino acid derivative.
[0301] [DeFmoc] The resin was vortexed in 1.5 mL 20% piperidine/DMF for 7 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were immediately subjected to coupling with an Fmoc-PNA monomer.
[0302] [Coupling with Fmoc-PNA Monomer] The free amines on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of PNA monomer, 0.05 mmol HBTU, and 10 mmol DIEA were incubated for 2 min in 1 mL anhydrous DMF, and added to the resin with free amines. The resin solution was vortexed for 1 hour and the reaction medium was filtered off. Then the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The chemical structures of Fmoc-PNA monomers with a modified nucleobase used in this invention are provided in
[0303] [Capping] Following the coupling reaction, the unreacted free amines were capped by shaking for 5 min in 1.5 mL capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered off and washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.
[0304] [Introduction of Fethoc- Radical in N-Terminus] Fethoc- radical was introduced to the N-terminus by reacting the free amine on the resin with Fethoc-OSu under basic coupling conditions. The chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C.sub.20H.sub.17NO.sub.5, MW 351.36] is provided as follows.
##STR00010##
[0305] [Cleavage from Resin] PNA oligomers bound to the resin were cleaved from the resin by shaking for 3 hours in 1.5 mL cleavage solution (2.5% tri-isopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure. The residue was triturated with diethylether, and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.
[0306] [HPLC Analysis and Purification] Following a cleavage from resin, the crude product of a PNA derivative was purified by C.sub.18-reverse phase HPLC eluting water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA.
Synthetic Examples for PNA Derivatives of Formula I
[0307] PNA derivatives of this invention were prepared according to the synthetic procedures provided above or with minor modifications. Table 1 provides examples of AR ASOs of the present invention along with structural characterization data by mass spectrometry. Provision of the AR ASOs in Table 1 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.
TABLE-US-00004 TABLE 1 PNA derivatives of Formula I and structural identification by mass spectrometry. PNA Exact Mass, m/z Example PNA Sequence (N .fwdarw. C) theor..sup.a obs..sup.b ASO 1 Fmoc-GA(5)A-GC(1O2)C- 4317.91 4317.96 A(5)GG-C(1O2)AA(5)-G-NH.sub.2 ASO 2 Fethoc-GA(5)A-GC(1O2)C- 4331.93 4331.97 A(5)GG-C(1O2)AA(5)-G-NH.sub.2 ASO 3 Fmoc-TG(6)C(1O2)-GGA(6)- 6047.80 6047.76 AG(6)C-CA(6)G-GC(1O2)A- A(6)GG(6)-NH.sub.2 ASO 4 Fmoc-GA(6)A-GC(1O2)C- 4359.96 4356.96 A(6)GG-C(1O2)AA(6)-G-NH.sub.2 ASO 5 Fethoc-C(1O2)TT-A(5)CC- 4257.90 4257.92 A(5)GG-C(1O2)AA(5)-G-NH.sub.2 ASO 6 Fethoc-TC(1O2)C-TTA(6)- 5207.37 5207.42 CCA(6)-GGC(1O2)-AA(6)G- G(6)-NH.sub.2 ASO 7 Fethoc-TC(1O2)C-TTA(5)- 5165.32 5165.31 CCA(5)-GGC(1O2)-AA(5)G- G(6)-NH.sub.2 ASO 8 Fethoc-GA(5)T-AC(1O2)C- 4308.97 4308.98 A(5)GG(6)-CAA(5)-G-NH.sub.2 ASO 9 Fethoc-TA(5)C-CAG(6)- 4283.97 4283.96 GC(1O2)A-A(5)GG(6)-CNH.sub.2 ASO 10 Fethoc-C(1O2)TT-A(5)CC- 3968.85 3968.86 A(5)GG(6)-CA(5)A-NH.sub.2 ASO 11 Fethoc-C(1O2)TT-A(5)CC- 3982.86 3982.88 A(6)GG(6)-CA(5)A-NH.sub.2 ASO 12 Ac-C(1O2)TT-A(5)CC- 3774.77 3774.83 A(5)GG(6)-CA(5)A-NH.sub.2 ASO 13 Fethoc-C(1O2)TT-A(6)CC- 4010.89 4010.93 A(6)GG(6)-CA(6)A-NH.sub.2 ASO 14 H-CTT-A(5)C(1O3)C- 4092.89 4092.90 A(5)G(3)G-C(1O2)AA(5)-G-NH.sub.2 ASO 15 Benzoyl-CTT-A(5)C(1O5)C- 4254.96 4254.99 A(5)G(2O2)G-C(1O2)AA(5)-G-NH.sub.2 ASO 16 n-Propyl-CTT-A(5)C(2O2)C- 4150.93 4150.93 A(3)G(2O3)G-C(1O2)AA(5)-G-NH.sub.2 ASO 17 p-Toluenesulfonyl-CTT- 4302.96 4302.90 A(5)C(1O2)C-A(8)G(5)G- C(1O2)AA(5)-G-NH.sub.2 ASO 18 Fethoc-Lys-Leu-CTT- 4629.16 4629.16 A(5)C(1O2)C-A(2O2)GG- C(1O2)AA(5)-G-Lys-NH.sub.2 ASO 19 Fethoc-CTT-A(5)C(1O2)C- 4223.88 4223.93 A(5)GT-C(1O2)TA(5)-G-NH.sub.2 ASO 20 N-Phenyl-N-methyl-CTT- 4239.96 4240.00 A(5)C(1O2)C-A(5)GG- C(1O2)AA(5)-G-Lys-NH.sub.2 ASO 21 [N-(2-Phenylethyl)amino]carbonyl- 4239.96 4239.95 CTT-A(5)C(1O2)C-A(4)G(5)G- C(1O2)AA(5)-G-NH.sub.2 .sup.atheoretical exact mass, .sup.bobserved exact mass
Binding Affinity of PNA for 10-Mer Complementary DNA
[0308] The PNA derivatives in Table 1 were evaluated for their binding affinity for 10-mer DNAs complementarily targeting either the N-terminal or C-terminal. The binding affinity was assessed by T.sub.m value for the duplex between PNA and 10-mer complementary DNA. The duplex between PNA derivatives in Table 1 and fully complementary DNAs show T.sub.m values too high to be reliably determined in aqueous buffer solution, since the buffer solution tends to boil off during the T.sub.m measurement.
[0309] T.sub.m values were determined on an UV/Vis spectrometer as follows. A mixed solution of 4 M PNA oligomer and 4 M complementary 10-mer DNA in 4 mL aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in 15 mL polypropylene falcon tube was incubated at 90 C. for a minute and slowly cooled down to ambient temperature over several minutes. Then the solution was transferred into a 3 mL quartz UV cuvette equipped with an air-tight cap, and subjected to a T.sub.m measurement at 260 nm on an Agilent 8453 UV/Visible spectrophotometer or a similar one as described in the prior art [PCT/KR2009/001256] or with minor modifications. The 10-mer complementary DNAs for T.sub.m measurement were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.
[0310] Observed T.sub.m values of the PNA derivatives of Formula I are very high for a complementary binding to 10-mer DNA, and provided in Table 2. For example, ASO 5 showed a T.sub.m value of 86.1 C. for the duplex with the 10-mer complementary DNA targeting the N-terminal 10-mer within the PNA marked as bold and underlined in [(N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2]. In the meantime, ASO 5 showed a T.sub.m of 81.3 C. for the duplex with the 10-mer complementary DNA targeting the C-terminal 10-mer within the PNA marked as bold and underlined in [(N.fwdarw.C) Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2].
TABLE-US-00005 TABLE 2 T.sub.m values between PNAs in Table and 10-mer complementary DNA targeting either the N-terminal or the C-terminal of PNA. T.sub.m Value, C. 10-mer DNA against 10-mer DNA against PNA N-Terminal C-Terminal ASO 5 86.1 81.3 ASO 8 87.4 86.0 ASO 9 84.3 84.5 ASO 10 84.4 78.4 ASO 13 83.0 87.0
Examples for Biological Activities for PNA Derivatives of Formula I
[0311] PNA derivatives of Formula I were evaluated for their biological activities in vitro and in vivo. The biological examples provided below are provided as examples to illustrate the biological profiles of such PNA derivatives of Formula I, and therefore should not be interpreted to limit the scope of the current invention.
Example 1. Exon Skipping Induced by ASO 5
[0312] ASO 5 specified in Table 1 is a 13-mer antisense oligonucleotide which has a 13-mer full complementary overlap with the 13-mer sequence marked as bold and underlined in the 20-mer RNA sequence
TABLE-US-00006 [(5.fwdarw.3)GCCUUGCCUG|guaaggaaaa (SEQIDNO:4)]
spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA.
[0313] ASO 5 was evaluated by AR nested PCR for its ability to induce the skipping of AR exon 5 in MCF7 cells (Cat. Number: HTB-22, ATCC). The employed procedures are detailed as follows.
[0314] [Cell Culture & ASO Treatment] MCF7 cells were grown in EMEM medium supplemented with 10% FBS, 1% streptomycin/penicillin, and 0.01 mg/ml bovine insulin under 5% CO.sub.2 atmosphere at 37 C. Cells were sub-cultured in 60 mm culture dish prior to treatment with ASO 5 at 3 aM to 3 fM.
[0315] [RNA Extraction] MCF7 cells were incubated with or without ASO 5 for 3 hours. Total RNA was extracted from cells in 60 mm culture dish using Universal RNA Extraction Kit (Cat. No. 9767, Takara) according to the manufacturer's instructions [cDNA Synthesis by One-step PCR] 100 ng of RNA template was used in a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. No. 10928-042, Invitrogen) against a set of gene-specific primers [exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 8), and exon 9_reverse: (5.fwdarw.3) GGGTGT-GGAAATAGATGGG (SEQ ID NO: 9)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, followed by 39 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0316] [Nested PCR Amplification] Throughout the amplification process, was used a unique amplification technique (touch up as increasing annealing temperature per cycle) that worked efficiently and specifically over a temperature range, rather than at one specific annealing temperature (i.e. conventional PCR method). 1 L of cDNA was further amplified in a 20 L nested PCR (Invitrogen) reaction against a set of primers [exon 3_forward: (5.fwdarw.3) TGGGTG-TCACTATGGAGC (SEQ ID NO: 8), and exon 7n_reverse: (5.fwdarw.3) GGGGTGATTTGGAGCCAT (SEQ ID NO: 10)] according to the following cycle conditions: initial 10 cycles [94 C. for 30 sec, 47 C. for 40 sec (+0.5 C. every cycle), 72 C. for 40 sec], followed by 20 cycles [94 C. for 30 sec, 50 C. for 30 sec, and 72 C. for 40 sec].
[0317] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing. In
Example 2. qPCR Evaluation of AR mRNA Level in MCF7 Cells Treated with ASO 5
[0318] ASO 5 was evaluated for its ability to down-regulate the human AR mRNA by qPCR with SYBR Green detection.
[0319] MCF7 cells were sub-cultured in 5 mL culture medium in 60 mm culture dish, and treated or with ASO 5 at 0 zM (negative control) to 1 aM (2 culture dishes per each concentration). 5 hours later, total RNA was extracted with MiniBEST Universal RNA Extraction Kit according to the manufacturer's instructions (Cat. No. 9767, Takara). 500 ng of RNA template were used to synthesize cDNA for a 50 L reverse transcription reaction using Oligo-dT according to the manufacturer's instructions (Cat. No. 6110A, Takara). cDNA was then subjected to the 1.sup.st PCR against a set of primers covering exon 3 to exon 9 [Exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 8), and Exon 9_reverse: (5.fwdarw.3) GGGTG-TGGAAATAGAT-GGG (SEQ ID NO: 9)] according to the following cycle conditions: 94 C. for 2 min followed by 15 cycles of 15 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0320] The 1.sup.st PCR products were diluted by 2,000 times, and 1 L of each diluted PCR product was subjected to a 20 L Real-Time PCR reaction against sets of exon specific primers sets [Exon 4_forward(q): (5.fwdarw.3) GACCATGTTTTGCCCATTG (SEQ ID NO: 11) and Exon 4_reverse(q): (5.fwdarw.3) GGCTCTTTTGAAGAAGACC (SEQ ID NO: 12) for exon 4; Exon 5_forward(q): (5.fwdarw.3) GAAACAGAAGTA-CCTGTGC (SEQ ID NO: 13) and Exon 5_reverse(q): (5.fwdarw.3) GTCATCCCTGCTTCATAAC (SEQ ID NO: 14) for exon 5; and Exon 6_forward(q): (5.fwdarw.3) CGGAAGCTGAAGAAACTTG (SEQ ID NO: 15) and Exon 6_reverse(q): (5.fwdarw.3) CACTTGACCACGTGTACAAG (SEQ ID NO: 16) for exon 6]. The PCR reactions were monitored by SYBR Green (Takara, Japan). Cycle Conditions: 95 C. for 3 min followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C.
[0321]
Example 3. qPCR Evaluation of AR mRNA Level in MCF Cells Treated with ASO 1
[0322] Although ASO 1 specified in Table 1 is a 13-mer antisense oligonucleotide originally designed to complementarily target the junction of exon 5 and exon 6 within the human AR mRNA. ASO 1 has a 9-mer complementary overlap with the 9-mer sequence as marked bold and underlined in the 20-mer RNA sequence
TABLE-US-00007 [(5.fwdarw.3)GCCUUGCCUG|guaaggaaaa (SEQIDNO:4)]
spanning the junction of exon 5 and intron 5 within the human AR pre-mRNA. It is noted that the four single mismatches in intron 5 are marked as uaag. Thus ASO 1 may be regarded as an antisense oligonucleotide targeting the human AR pre-mRNA, although only with a 9-mer complementary overlap out of the 13-mer sequence.
[0323] ASO 1 was evaluated for its ability to down-regulate the human AR mRNA by qPCR according to the protocol described in Example 2.
[0324]
Example 4. qPCR Evaluation of AR mRNA Level in MCF Cells Treated with ASO 10
[0325] ASO 10 specified in Table 1 is a 12-mer antisense oligonucleotide which has a 12-mer full complementary overlap with the 12-mer sequence as marked bold and underlined in the 20-mer pre-mRNA sequence [(5.fwdarw.3) GCCUUGCCUG|guaaggaaaa (SEQ ID NO: 4)] spanning the junction of exon 5 and intron 5 of the human AR pre-mRNA.
[0326] ASO 10 was evaluated for its ability to down-regulate the human AR mRNA (full-length) by qPCR according to the protocol described in Example 2.
[0327]
Example 5. Western Blot Analysis of AR Downregulation by ASO 1
[0328] MCF7 cells were sub-cultured in 60 mm culture dish containing 5 ml culture medium, and treated with ASO 1 at 0 zM (negative control), or 100 zM to 300 aM. 4 culture dishes were used for 4 negative controls. 48 hours later, cells were washed 2 times with cold PBS, and then subjected to lysis with 200 L 1 cell lysis buffer (Cat. No. 9803, Cell Signaling Tech) supplemented with 1 protease inhibitor (Cat. No. P8340, Sigma). The lysates were collected in 1.5 ml e-tube. 200 L of each lysate was mixed with 100 L 3 sample buffer, and boiled for 5 min at 100 . 20 L of each lysate (12 lysates in total). 4 negative controls and 8 ASO treatment samples) was subjected to electrophoretic separation on a 8% SDS-PAGE gel, and transferred onto a 0.2 m PVDF membrane. The membrane was probed with anti-AR antibody (Cat. No. 5153, Cell Signaling Tech) and anti--actin antibody (Cat. No. sc4778, Santa Cruz).
Example 6. Western Blot Analysis of AR Downregulation by ASO 5
[0329] ASO 5 was evaluated for its ability to inhibit AR protein expression at 10 zM to 30 aM in MCF7 cells according to the procedures described in Example 5.
[0330]
Example 7. Hair Growth Promoted by Topical Administration of ASO 1 in Mice
[0331] ASO 1 was evaluated for its ability to promote hair growth in C57BL/6 mice upon topical administration as follows. The target sequence of ASO 1 in the human AR pre-mRNA is conserved in the mouse AR pre-mRNA. Thus the in vivo therapeutic findings in mice may be extrapolated to human cases without much ambiguity.
[0332] [Hair Removal and Grouping] In Day 0, 7 week old female C57BL/6 mice were anesthetized with zoletil/rompun, and the hair in the back was cut and removed with a clipper and wax, respectively. Mice with flawless (i.e. spotless) hair removal were selected and randomly assigned into three groups (7 animals per group).
[0333] [Topical Administration] The topical solutions of ASO 1 were prepared by diluting a mother stock solution of ASO 1 to 0.2 fM or 1 fM in aqueous 30% (v/v) ethanol supplemented with 3% (v/v) glycerin. About 100 L of 0 (negative control), 0.2, or 1 fM ASO 1 was topically administered in the back of each animal using a cotton ball in Days 3, 7, 10, and 14.
[0334] [Digital Image Scoring for Hair Growth] For scoring the hair growth, the animals were anesthetized and photographed by group as shown in
[0335] [Scoring by Hair Weight] In Day 21, the animals were anesthetized and the hair in the back was cut with a clipper. The hair samples from individual animals were combined by group, and weighed to evaluate the hair growth between Day 0 and Day 21. The average hair weight was 70.5 mg/animal for the control group, 90.8 mg/animal for the 0.2 fM treatment group, and 94.4 mg/animal for the 1 fM treatment group. Thus ASO 1 was concluded to promote hair growth upon topical administrations at 0.2 fM as well as 1 fM.
[0336] [AR IHC of Skin Sample] Following the shaving in Day 21, the mice received a single topical administration of either vehicle or ASO 1 according to the group. In Day 24, the skin of the area with hair removal was sampled for immunohistochemistry (IHC) analysis against androgen receptor. The skin samples were cryo-sectioned and subjected to immunostaining in series with a primary anti-AR antibody (Cat. No. sc-816, Santa Cruz) at 1:100 dilution, with a secondary anti-IgG (Cat No. BA-1100, Vector) at 1:200 dilution, and then with Dylight 594-steptavidin (Cat No. SA-5594, Vector, Calif., USA) at 1:200 dilution for red fluoresence tagging. The IHC images were captured on an Olympus fluorescence microscope for changes in the AR expression level upon topical treatment with ASO 1.
[0337]
Example 8. Hair Growth Promoted by Topical Administration of ASO 5 in Mice
[0338] ASO 5 was evaluated for its ability to promote hair growth in C57BL/6 mice upon topical administration as detailed below. The target sequence of ASO 5 in the human AR pre-mRNA is conserved in the mouse AR pre-mRNA. Thus the in vivo therapeutic findings in mice may be extrapolated to human cases without much ambiguity.
[0339] [Hair Removal and Grouping] In Day 0, 7 week old female C57BL/6 mice were anesthetized with zoletil/rompun, and the hair in the back was cut and removed with a clipper and wax, respectively. Mice with flawless (i.e. spotless) hair removal were selected and randomly assigned into three groups (10 animals per group).
[0340] [Topical Administration] The topical solutions of ASO 5 were prepared by diluting a mother stock solution of ASO 5 to 1, 5, or 25 fM in aqueous 30% (v/v) ethanol supplemented with 3% (v/v) glycerin. About 100 L of each ASO solution or vehicle (negative control) was topically administered to in the back of an animal using a cotton ball in Days 3, 7, 10, 14 and 21.
[0341] [Digital Image Scoring for Hair Growth]
[0342] [Scoring by Hair Weight] In Day 21, the animals were anesthetized and the hair in the back was cut and collected. The hair samples from individual animals were combined by group, and weighed to evaluate the hair growth between Day 0 and Day 21. The treatment groups yielded marked increases in the hair weight compared to the control group. The average hair weights of the 1 fM, 5 fM, and 25 fM groups were 293%, 306%, and 278% of the negative control group, respectively. Thus ASO 5 was concluded to promote hair growth upon topical administrations at 1 to 25 fM.
[0343] Following the shaving in Day 21, the animals received a single topical administration of either vehicle or ASO 5 at 1 fM, 5 fM, or 25 fM. In Day 53, the hair in the back was collected by shaving with a clipper to determine the total amount of hair growth between Days 21 and 53. The average hair weights of the 1 fM, 5 fM, and 25 fM groups were 1,630%, 1,450%, and 771% of the non-treated group, respectively. Thus ASO 5 was concluded to promote hair growth upon topical administrations at 1 to 25 fM.
Example 9. Hair Growth Promoted by Topical Administration of ASO 10 in Mice
[0344] ASO 10 was evaluated for its ability to promote hair growth in C57BL/6 mice upon topical administration as detailed below. The target sequence of ASO 10 in the human AR pre-mRNA is conserved in the mouse AR pre-mRNA. Thus the in vivo therapeutic findings in mice may be extrapolated to human cases without much ambiguity.
[0345] [Hair Removal and Grouping] In Day 0, 7 week old female C57BL/6 mice were anesthetized with zoletil/rompun, and the hair in the back was cut and removed with a clipper and wax, respectively. Mice with flawless (i.e. spotless) hair removal were selected and randomly assigned into three groups (9 animals per group).
[0346] [Topical Administration] The topical solutions of ASO 10 were prepared by diluting a mother stock solution of ASO 10 to 1, 5, or 25 fM in aqueous 30% (v/v) ethanol supplemented with 3% (v/v) glycerin. About 100 L of each ASO solution or vehicle (negative control) was topically administered to in the back of an animal using a cotton ball in Day 2.
[0347] [Digital Image Scoring for Hair Growth]
[0348] [Scoring by Hair Weight] In Day 27, the animals were anesthetized and the hair in the back was cut and collected. The hair samples from individual animals were combined by group, and weighed to evaluate the hair growth between Day 0 and Day 27. The treatment groups yielded modest increases in the hair weight compared to the control group. The average hair weights of the 1 fM, 5 fM, and 25 fM groups were 115%, 114%, and 119% of the non-treated group, respectively. Thus ASO 10 was concluded to promote hair growth upon topical administrations at 1 to 25 fM.
[0349] [AR Immunohistochemistry of Skin Samples] After the hair cut in Day 27, The animals topically received further either vehicle or ASO 10 at 1, 5, or 25 fM in Days 27 and 29. Skin samples of the back were collected in Day 30 for immunohistochemical analysis against androgen receptor. The skin samples were subjected to immunostaining against androgen receptor as described in Example 7. IHC images were captured on a Zeiss slide scanner.
Example 10. qPCR Evaluation of AR mRNA Level by TaqMan Assay in MCF7 Cells Treated with ASO 10
[0350] ASO 10 was evaluated for its ability to down-regulate the human AR mRNA by qPCR adopting a TaqMan probe.
[0351] MCF7 cells sub-cultured in 5 mL culture medium in 60 mm culture dish, and treated or with ASO 10 at 0 zM (negative control) to 1 aM (2 culture dishes per each concentration). 24 hours later, total RNA was extracted by MiniBEST Universal RNA Extraction Kit according to the manufacturer's instructions (Cat. No. 9767, Takara).
[0352] 400 ng of RNA template were used to synthesize cDNA for a 20 L reverse transcription reaction using One-Step RT-PCR kit (Invitrogen) against a set of exon specific primers of [exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 8); and exon 9_reverse: (5.fwdarw.3) GGGTGT-GGAAATAGATGGG (SEQ ID NO: 9)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, followed by 15 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0353] The cDNA solutions were diluted by 50 times, and 1 L of each diluted PCR product was subjected to a 20 L Real-Time PCR reaction against a set of exon specific primers of [exon 4_forward: (5.fwdarw.3) TTGTCCATCTTGTCGTCTT (SEQ ID NO: 17); and exon 5_reverse: (5.fwdarw.3) CCTCTC-CTTCCTCCTGTA (SEQ ID NO: 18)] according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles 15 sec at 95 C., and 30 sec at 60 C. The qPCR reaction was monitored with a TaqMan probe of [(5.fwdarw.3) TTTCTTCAG-ZEN-CTTCCGGGCTC-3IABkFQ (SEQ ID NO: 19)].
[0354]
Example 11. Down-Regulation of AR Expression by IHC in Mice Subcutaneously Administered with ASO 10
[0355] ASO 10 was evaluated for its ability to inhibit AR expression in mice as follows.
[0356] 12 weeks old male C57BL/6 mice were randomly assigned to 3 groups of negative control (no ASO treatment), 0.01 pmole/Kg ASO 10 and 0.1 pmole/Kg ASO 10. (3 animals per group) Mice subcutaneously received either vehicle or ASO dissolved in vehicle (PBS) 2 per week for 4 weeks according to the dosing group. Three days post the final dosing, the animals were anesthetized with zoletil/rompun and subjected to tissue or organ sampling for AR IHC by paraffin blolck.
[0357] The AR protein was probed in series with a primary antibody (Cat. No. sc-816, Santa Cruz) at 1:100 dilution, a secondary anti-rabbit IgG (Cat. No. BA-1100, VECTOR) at 1:200 dilution, and Dylight 594-Streptavidin (Cat. No. SA-5594, VECTOR) at 1:200. Nucleus was stained with DAPI. IHC fluorescence images were captured on a Zeiss slide scanner.
[0358]