MONOCLONAL IGM ANTIBODIES FROM ENTIRELY CARBOHYDRATE CONSTRUCTS
20190345255 ยท 2019-11-14
Assignee
Inventors
- Peter Andreana (Toledo, OH, US)
- Kevin Trabbic (Toledo, OH, US)
- Mengchao Shi (Toledo, OH, US)
- Jean Paul Bourgault (Toledo, OH, US)
Cpc classification
A61K47/61
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K39/39
HUMAN NECESSITIES
A61K47/6855
HUMAN NECESSITIES
International classification
A61K47/61
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K39/39
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K47/68
HUMAN NECESSITIES
Abstract
Entirely carbohydrate immunogens, monoclonal antibodies generated from immune responses to entirely carbohydrate immunogens, vaccine compositions, pharmaceutical compositions, and methods of making and using the same, are described.
Claims
1. A monoclonal antibody comprising: TABLE-US-00006 alightchainaminoacidsequenceof: [SEQIDNO:1] CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGA GAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGCACT GGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACA TCCAAACTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGG GACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCA CTTATTACTGCCAGCAGTGGAGTAGTAACCCGCTCACGTTCGGTGCTGGG ACCAAGCTGGAGCTGAAA; and aheavychainaminoacidsequenceof: [SEQIDNO:2] CAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGAC AGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACCTATGGAA TGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGG ATAAACACCTACTCTGGAGTGCCAACATATGCTGATGACTTCAAGGGACG GTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCA ACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAAGACATTAC TACGGAGGGGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA.
2. A composition comprising a murine monoclonal antibody which (i) binds to a glycoside portion of a Tn antigen, and (ii) has the IgM isotype.
3. The composition of claim 2, wherein the composition is substantially free of additional peptides or proteins.
4. A composition comprising an antibody raised against an entirely carbohydrate immunogen.
5. The composition of claim 4, wherein the antibody is a mononclonal IgM antibody.
6. A test device, kit, or strip comprising the monoclonal antibody of claim 1.
7. The test device, kit, or strip of claim 6, wherein the monoclonal antibody is labeled with one of an enzyme, a fluorescent material, a chemiluminescent material, biotin, avidin, or a radioactive isoptope.
8. A pharmaceutical composition comprising: a monoclonal antibody of claim 1; and a pharmaceutically acceptable carrier, diluent, or adjuvant.
9. A composition comprising a STn-PS A1 construct having Formula I: ##STR00005## and salts, stereoisomers, racemates, hydrates, solvates, and polymorphs thereof.
10. A composition comprising a carbohydrate immunogen having Formula II: ##STR00006## wherein X is selected from the group consisting of TF, Tn-TF, Gb3, and Globo H; and salts, stereoisomers, racemates, hydrates, solvates, and polymorphs thereof.
11. A vaccine composition comprising: an entirely carbohydrate immunogen comprising a zwitterionic polysaccharide conjugated to an STn antigen, a TF antigen, a Globo H antigen, or a conjugate of TF and Tn antigens; and a pharmaceutically acceptable carrier, diluent, or adjuvant.
12. A method of treating, preventing, or ameliorating a cancer, the method comprising administering an effective amount of a pharmaceutical composition of claim 8 to a subject in need thereof, and treating, preventing, or ameliorating a cancer in the subject.
13. The method of claim 12, wherein the cancer is breast cancer.
14. A method of treating, preventing, or ameliorating a cancer, the method comprising administering an effective amount of a vaccine composition of claim 11 to a subject in need thereof, and treating, preventing, or ameliorating a cancer in the subject.
15. The method of claim 14, wherein the cancer is breast cancer.
16. A method of treating, preventing, or ameliorating a cancer, the method comprising administering monoclonal antibodies to a subject in need thereof, and treating, preventing, or ameliorating a cancer in the subject, wherein the monoclonal antibodies are generated from an immune response to an entiretly carbohydrate immunogen, and the monoclonal antibodies are specific and selective for glycosides of a tumor-associated carbohydrate antigen (TACA).
17. The method of claim 16, wherein the monoclonal antibodies are IgM antibodies.
18. The method of claim 16, wherein the cancer is breast cancer.
19. A method of generating monoclonal antibodies comprising: administering an immunogen comprising an entirely carbohydrate construct to an animal to provoke an immune response in the animal and generate antibodies against the entirely carbohydrate construct, wherein the entirely carbohydrate construct comprises a zwitterionic polysaccharide conjugated to a tumor-associated carbohydrate antigen (TACA); harvesting B cells from the animal; fusing the harvested B cells with B cell cancer cells to produce hybridoma cells; culturing the hybridoma cells; and harvesting monoclonal antibodies from the cultured hybridoma cells, wherein the monoclonal antibodies are selective for glycosides of the TACA.
20. The method of claim 19, wherein the monoclonal antibodies are selective for a Tn antigen.
21. The method of claim 19, wherein the animal is a mouse.
22. The method of claim 19, wherein the entirely carbohydrate construct is a Tn-PS A1 construct.
23. The method of claim 19, further comprising humanizing the monoclonal antibodies.
24. The method of claim 19, further comprising producing an antibody chimera from the monoclonal antibodies.
25. The method of claim 19, further comprising converting the monoclonal antibodies into IgG antibodies.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The patent or application file may contain one or more drawings executed in color and/or one or more photographs. Copies of this patent or patent application publication with color drawing(s) and/or photograph(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fees.
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
DETAILED DESCRIPTION OF THE INVENTION
[0069] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents, and published patent specifications are hereby incorporated by reference into the present disclosure in their entirety to more fully describe the state of the art to which this invention pertains.
[0070] Most of the FDA approved antibodies approved are IgG. However, IgM antibodies are useful because of their industrial purification and for their ability to initiate complement directed cytotoxicity (CDC) as the main mechanism of cytotoxicity. Additionally, targeting specific glycosides on carcinomas, including the Tn antigen, has therapeutic benefit for binding monoclonal IgM antibodies due to greater avidity towards glycosides. There are numerous examples of mAbs (IgG and IgM) that can recognize TACAs and specifically the Tn antigen, but they lack accurate specificity to glycosides. Thus, provided herein are monoclonal IgM antibodies from entirely carbohydrate constructs that bind to the Tn (alpha-D-GalNAc) cancer antigen. The Tn antigen is a tumor associated carbohydrate antigen (Tn) and is present on a majority of all cancers (80-90%).
[0071] Monoclonal antibodies (mAb) are an infinite source of a specific antibody that come from immunized mice and immortalized spleen cells. Monoclonal antibodies are useful in cancer therapeutics, namely immunotherapy by specifically binding to cancer cells. The IgM antibodies described herein have the ability to bind to known cancer cells in flow cytometry and demonstrate complement mediated killing of cancer cells, in vivo and in vitro. These mAbs can be produced in large scale from entirely carbohydrate-based antigens.
[0072] Provided is a monoclonal IgM antibody, named Kt-IgM-8, specific and selective for the TACA Tn antigen. The heavy and light chain sequences of Kt-IgM-8 are shown in
TABLE-US-00003 [SEQIDNO:1] CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGA GAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGCACT GGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACA TCCAAACTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGG GACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCA CTTATTACTGCCAGCAGTGGAGTAGTAACCCGCTCACGTTCGGTGCTGGG ACCAAGCTGGAGCTGAAA,
and a heavy chain amino acid sequence of
TABLE-US-00004 [SEQIDNO:2] CAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGAC AGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACCTATGGAA TGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGG ATAAACACCTACTCTGGAGTGCCAACATATGCTGATGACTTCAAGGGACG GTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCA ACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAAGACATTAC TACGGAGGGGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA.
This mAb has demonstrated exceptional binding to the glycoside portion of the Tn antigens in ELISA. To illustrate the effectiveness of Kt-IgM-8, a commercial mAb (clone Tn-218) was compared and determined to be less effective at recognizing the Tn antigen than Kt-IgM-8 (
[0073] Amino acid sequence variants of the mAb Kt-IgM-8 are also encompassed within the present disclosure. Modifications to the mAb can be introduced by peptide synthesis. Such modifications include, for example, deletions from, insertions into, and/or substitutions within the amino acid sequence of Kt-IgM-8. Any combination of deletion, insertion, and substitution can be made to arrive at the final amino acid sequence of the antibody, provided that the final antibody possesses the desired biological activity, namely, the binding characteristics of Kt-IgM-8 (i.e., selectivity and specificity for the glycoside portion of the Tn antigen). Accordingly, provided herein are variants of the monoclonal antibodies described. In some embodiments, the variants include an antibody variant having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of Kt-IgM-8. Reference to a % sequence identity with respect to a reference polypeptide is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
[0074] It is understood that IgM antibodies can be converted into IgG antibodies through methods known in the art. For example, a reductant can be used to cleave the disulfide bridges of the IgM antibody, though other methods are also possible. IgG antibodies produced by such conversion from Kt-IgM-8 are therefore encompassed within the scope of the present disclosure. Humanized versions of the Kt-IgM-8 antibody are also encompassed within the present disclosure. Humanized antibodies are antibodies from non-human species whose protein sequences have been modified to increase their similarity to antibody variants produced naturally in humans. Humanized antibodies can be produced through methods known in the art, such as by utilizing insect-cell expression systems. Furthermore, antibody chimerasthat is, chimeric versions of the Kt-IgM-8 antibodysuch as half-human half-murine antibodies, are also encompassed within the present disclosure. One non-limiting example of a chimeric antibody includes a mouse Fab spliced to a human Fc.
[0075] As noted above, Kt-IgM-8 is an IgM antibody. Monoclonal IgMs have often been demonstrated to bind oligomers better than their IgG counterparts through higher avidity. IgM antibodies have demonstrated recognition of carbohydrate antigens greater than their IgG counterparts through higher avidity. Since TACAs are present on almost all cancers, having an immunotherapy that can recognize specific glycosides is an efficient strategy against cancer. More importantly, IgM antibodies have been shown to be effective at mediating complement directed killing of tumor cells. Thus, using a specific mIgM for aberrant glycosylation patterns such as those found on tumor cells is a unique therapeutic approach to targeting carbohydrates and malignant cells. The advantage of this approach is specifically targeting the carbohydrate portions of TACAs using a mIgM that is specific for the surface modification of tumors. Because TACAs are present on the surface of most tumors, having a mAb that can recognize specific glycosides is a useful therapeutic strategy in light of most mAbs targeting proteins that are concealed beneath the glycocalyx. Since mIgM antibodies described herein have been shown to be efficient at mediating complement directed (CDC) (
[0076] The mAbs described herein are generated from entirely carbohydrate immunogen constructs, which are administered into an animal to provoke an immune response. Then, a hybridoma method is used to produce large numbers of monoclonal antibodies. For example, B cells are harvested from the animal and fused with B cell cancer cells to produce hybridoma cells that produce the antibodies. In the examples herein, the Tn antigen was conjugated to the zwitterionic polysaccharide PS A1, via a linkerless strategy, to create an entirely carbohydrate vaccine/immunotherapy (Tn-PS A1). The rationale behind a carbohydrate-based construct is to fine-tune the immune response to target carbohydrates exclusively, a long outstanding problem in immunity. To take advantage of the unique immune response from this construct, monoclonal antibodies that recognized the Tn antigen exclusively and not a heterogeneous combination of carbohydrate/peptide moieties were generated. The mAb generated from this particular example is Kt-IgM-8. One difference in this approach from traditional methods (i.e., Tn conjugated to immunogenic proteins such as BSA, TT, or KLH) is epitopic suppression of the carbohydrate moiety due to the overwhelming immunogenicity of proteins of peptide immunogens. Additionally, mAbs generated from Tn containing peptides/proteins often recognize the peptide portion better than the glycan. However, the mAbs generated from an entirely carbohydrate moiety specifically recognize Tn without assistance from peptide binding.
[0077] Zwitterionic polysaccharides (ZPSs) are compounds having both positive and negative charges on adjacent monosaccharide units, and are known as being T cell stimulatory independent of peptides, proteins, or lipids. ZPSs are alternatives to protein carriers for vaccines and immunotherapeutics, and have been shown to initiate a CD4+ T cell response. ZPSs are processed by antigen presenting cells (APCs) and presented as MHCII-ZPS complexes on the surface for ?/?-TCR recognition of CD4+ T-cells that can promote immunoglobulin class switching from IgM to IgG. Using ZPSs as immunogenic carriers for TACAs can augment the immune response by generating entirely carbohydrate specific antibodies. As one example, PS A1 from Bacteroides fragilis (ATCC 25285/NTTC 9343) is a naturally occurring polysaccharide that can generate a CD4+ T-cell mediated immune response. Due to this unique feature, PS A1 is useable as a carrier for tumor associated carbohydrate antigen (TACA) Thomsen-nouveau (Tn-?-2-NAc-D-galactose).
[0078] In accordance with the present disclosure, TACAs are conjugated to ZPSs to produce entirely carbohydrate immunogens, for example to raise antibodies. Suitable ZPSs include, but are not limited to, ZPSs isolated from pathogenic bacteria, such as PS A1 from Bacteroides fragilis, PS B from Bacteroides fragilis, SP1 from Streptococcus pneumonia, CP5 from Staphylococcus aureus (CP5 has partial deactylation of NHAc on L-FucNAc), CP8 from Staphylococcus aureus (CP8 has partial deacetylation of NHAc on L-FucNAc), and PS from Morganella morganii. (
[0079] Suitable TACAs include, but are not limited to, the O-linked mucins Tn, TF (Gal?1.fwdarw.3GalNAc?1.fwdarw.Ser/Thr), and STn; the Lewis antigens Le.sup.y, Le.sup.x, SLe.sup.x, Le.sup.a, SLe.sup.a, and Le.sup.b; the globosides Globo H and SSEA4; the gangliosides GD2, GD3, and GM3; and conjugates of two or more thereof. As one non-limiting example, conjugation of the antigen to the ZPS can be accomplished via oxime bond formation. However, other orthogonal conjugation chemistries, such as click chemistry forming triazoles, are possible.
[0080] In some embodiments, the Thomsen-nouveau (Tn) antigen (?-D-GalNAc) is conjugated to PS A1, creating an entirely carbohydrate vaccine or immunotherapeutic (Tn-PS A1). Tn-PS A1 (GalNAc-PS A1) (
[0081] Tn can be conjugated to PS A1 by, for instance, synthesizing the Tn-aminooxy sugar to form an oxime linkage with oxidized PS A1 (
[0082] Utilizing a synthetically prepared Tn-hydroxyl amine conjugated to oxidized galactofuranose, the formation of an oxime bond provides a unique entirely carbohydrate immunogen without the need of bulky immunogenic linkers. The advantage of this structure is to emphasize the immune response on 0-linked carbohydrates by the linker-free oxime ligation and not on O-linked glycopeptides. For example, when examining mAbs towards glycopeptides, binding tends to be influenced by the original peptide sequence and is thus not glycan-specific. Traditional methods for mAb production have used naturally occurring TACAs (i.e., cancer cells and glycosylated proteins), and have led to many non-specific and commercially available mAbs such as B1.1 and Tn218 (IgM). These two mAbs were generated from ovine submaxillary mucin and screened for Tn binding. The complication that is associated with glycoproteins is carrier-induced epitopic suppression that is due to the greater immunogenicity of the protein carrier. This leads to mAbs dependent upon natural linkages. Therefore, most mAbs generated from glycopeptides/proteins/linkers will have a varying sensitivity towards the peptide/linker portion, which is one of the reasons an entirely carbohydrate immunogen was used to assist in mAb development. The use of Tn-PS A1 to generate mAbs produces superior antibodies specifically for glycosides, which leads to sufficient anti-tumor responses.
[0083] In some embodiments, the Thomsen Friedenreich (TF) antigen (?-D-Gal-(1,3)-?-D-GalNAc) is conjugated to PS B or PS A1. As described in the examples herein, TF-PS B conjugate was immunized in Jax C57BL/6 mice to produce both IgG and IgM antibody responses specific for the TF antigen. Enhanced binding to the TF-containing MCF-7 breast cancer cell line was shown by fluorescence activated cell sorting (FACS). Additionally, TF-PS A1 elicits similar augmented immune responses to the TF antigen, which enables in vitro cytotoxicity of tumor cells. In comparison to Tn-PS A1, both the TF-PS B and TF-PS A1 immunogens generate substantially decreased IgG antibody production, which is a main component of the mechanism for tumor elimination. However, the IgG immune responses to the TF antigen can be increased by using a bivalent PS A1 construct.
[0084] In some embodiments, the sialyl Tn antigen is conjugated to PS A1, producing a construct having the following Formula I:
##STR00003##
[0085] In some embodiments, the construct is a bivalent immunogen, such as a Tn-TF-PS A1 bivalent immunogen. This immunogen significantly increases immunogenicity of the TF antigen. This additive Tn adjuvanting effect also generates enhanced pIgG binding to tumor cell lines MCF-7 and OVCAR-5 in FACS analysis and in a complement dependent cytotoxicity (CDC) assay monitoring lactate dehydrogenase (LDH) release from these tumor cells. The results from a CDC assay demonstrated increased tumor cell lysis from Tn-TF-PS A1 sera compared to sera from monovalent vaccines Tn-PS A1 and TF-PS A1. Furthermore, a macrophage galactose lectin 2 (MGL2) assay was used, in conjunction with designed biotinylated probes, to study binding interactions of Tn and TF conjugated to PS A1 vaccine constructs. The results showed that, in the case of the TF antigen, when a unimolecular bivalent Tn-TF-PS A1 immunogen was used, immunogenicity of the TF antigen was increased 50 times over a monovalent TF-PS A1 construct and resulted in a more potent and selective immune response. This not only validates a MGL2 targeted vaccine design, but also indicates that incorporating a Tn antigen can influence other peptide, protein, or lipid vaccine designs. To show the usefulness of unimolecular bivalent immunogens, this model was adapted to a Globo H-PS A1 construct consisting of Globo H and Tn. Similar to the biological results of Tn-TF-PS A1, the Tn-Globo H-PS A1 immunogen produced a robust IgG immune response with cytotoxicity towards both MCF-7 and HCT-116 cancer cells.
[0086] The entirely carbohydrate constructs provided herein are carbohydrate immunogen compositions that can be used for purposes other than producing monoclonal antibodies, and can assist in both tumor binding and killing. For example, these constructs can be used as vaccines to treat or prevent cancers. Such vaccine compositions can include Formula I, or the following Formula II:
##STR00004##
where X is Tn, TF, Tn-TF, Gb3, Globo H, or conjugates thereof. Either Formula I or Formula II can be produced by oxime bond formation. Alternatively, these entirely carbohydrate immunogens can be produced by reductive amination. In any event, the generation of monoclonal antibodies from these constructs can provide entirely carbohydrate recognition without the influence from peptides or proteins.
[0087] The detection, or quantitative determination, or both, of analytes based upon reactions with immunological reagents has gained considerable importance in the field of medical testing. These methods commonly involve contacting a sample suspected of containing the analyte with a material which exhibits specific immunologic reactivity with the analyte, for example, an antibody directed to an epitope present on the analyte. If the analyte is present in the sample, it specifically conjugates with the antibody to form a complex. A wide range of developer or reporter mechanisms are known for indicating whether the conjugation reaction occurs. Such methods are especially important with monoclonal antibodies because of the unique specificity for the analytes with which they conjugate. These methods can be practiced through a range of test devices, test kits, and the like, for instance with devices that utilize flow through membrane procedures for rapid testing (e.g., 5-10 minutes). Thus, provided herein are test devices, test kits, or test strips which utilize the monoclonal antibodies described herein (produced from entiretly carbohydrate immunogens) to test for the presence of an analyte, such as a TACA, in a sample. The antibody is generally labeled, for example, with a radioactive isotope, fluorophore, chromophore, or a ligand which can be used with an enzyme that catalyzes a chemical reaction which produces a detectable product that can be further amplified in a secondary reaction. Suitable labeling agents generally include, but are not limited to: enzymes, such as peroxidase, alkaline phosphatase, ?-D-galactosidase, glucose oxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, malate dehydrogenase, penicillinase, catalase, apo-glucose oxidase, urease, luciferase or acetylcholinesterase; fluorescent materials, such as fluorescein isothiocyanate, phycobiliprotein, chelating compounds of rare-earth metals, dansyl chloride, or tetramethylrhodamine isothiocyanate; chemiluminescent materials; biotin; avidin; or radioactive isotopes.
[0088] Further provided are pharmaceutical compositions containing monoclonal antibodies described herein. Pharmaceutical compositions of the present disclosure comprise an effective amount of a monoclonal antibody, and/or additional agents, dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases pharmaceutical or pharmacologically acceptable refer to molecular entities and compositions that produce no adverse, allergic, or other untoward reaction when administered to an animal, such as, for example, a human. The preparation of a pharmaceutical composition that contains at least one compound or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it is understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biological Standards.
[0089] A composition disclosed herein may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. Compositions disclosed herein can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, intraosseously, periprosthetically, topically, intramuscularly, subcutaneously, mucosally, intraosseosly, periprosthetically, in utero, orally, topically, locally, via inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference).
[0090] The actual dosage amount of a composition disclosed herein administered to an animal or human patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0091] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of a monoclonal antibody. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of monoclonal antibody in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the antibody. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0092] In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
[0093] In certain embodiments, a composition herein and/or additional agent is formulated to be administered via an alimentary route Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually. As such, these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft-shell gelatin capsules, they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
[0094] In further embodiments, a composition described herein may be administered via a parenteral route. As used herein, the term parenteral includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered, for example but not limited to, intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally.
[0095] Solutions of the compositions disclosed herein as free bases or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In some cases, the form should be sterile and should be fluid to the extent that easy injectability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and/or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, such as, but not limited to, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate or gelatin.
[0096] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, Remington's Pharmaceutical Sciences 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
[0097] Sterile injectable solutions are prepared by incorporating the compositions in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized compositions into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, some methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. A powdered composition is combined with a liquid carrier such as, but not limited to, water or a saline solution, with or without a stabilizing agent.
[0098] In other embodiments, the compositions may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.) and/or via inhalation.
[0099] Pharmaceutical compositions for topical administration may include the compositions formulated for a medicated application such as an ointment, paste, cream, or powder. Ointments include all oleaginous, adsorption, emulsion, and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only. Topically administered medications may contain a penetration enhancer to facilitate adsorption of the active ingredients through the skin. Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones, and luarocapram. Possible bases for compositions for topical application include polyethylene glycol, lanolin, cold cream, and petrolatum, as well as any other suitable absorption, emulsion, or water-soluble ointment base. Topical preparations may also include emulsifiers, gelling agents, and antimicrobial preservatives as necessary to preserve the composition and provide for a homogenous mixture. Transdermal administration of the compositions may also comprise the use of a patch. For example, the patch may supply one or more compositions at a predetermined rate and in a continuous manner over a fixed period of time.
[0100] In certain embodiments, the compositions may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in their entirety). Likewise, the delivery of drugs using intranasal microparticle resins and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts and could be employed to deliver the compositions described herein. Likewise, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No. 5,780,045 (specifically incorporated herein by reference in its entirety), and could be employed to deliver the compositions described herein.
[0101] It is further envisioned the compositions disclosed herein may be delivered via an aerosol. The term aerosol refers to a colloidal system of finely divided solid or liquid particles dispersed in a liquefied or pressurized gas propellant. The typical aerosol for inhalation consists of a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary according to the pressure requirements of the propellant. Administration of the aerosol will vary according to subject's age, weight, and the severity and response of the symptoms.
[0102] In particular embodiments, the compositions described herein are useful for treating, preventing, or ameliorating a cancer, such as breast cancer.
[0103] Furthermore, the compositions herein can be used in combination therapies. That is, the compositions can be administered concurrently with, prior to, or subsequent to one or more other desired therapeutic or medical procedures or drugs. The particular combination of therapies and procedures in the combination regimen will take into account compatibility of the therapies and/or procedures and the desired therapeutic effect to be achieved. Combination therapies include sequential, simultaneous, and separate administration of the active ingredients in a way that the therapeutic effects of the first administered procedure or drug is not entirely disappeared when the subsequent procedure or drug is administered.
[0104] By way of a non-limiting example of a combination therapy, a composition herein can be administered in combination with one or more suitable chemotherapeutic agents including, but not limited to: platinum coordination compounds; taxane compounds; topoisomerase I inhibitors, such as camptothecin compounds; topoisomerase II inhibitors, such as anti-tumor podophyllotoxin derivatives; anti-tumor vinca alkaloids; anti-tumor nucleoside derivatives; alkylating agents; anti-tumor anthracycline derivatives; HER2 antibodies; estrogen receptor antagonists or selective estrogen receptor modulators; aromatase inhibitors; differentiating agents, such as retinoids, and retinoic acid metabolism blocking agents (RAMBA); DNA methyl transferase inhibitors; kinase inhibitors; farnesyltransferase inhibitors; HDAC inhibitors; other inhibitors of the ubiquitin-proteasome pathway; or combinations thereof.
[0105] Further provided is a method of determining health insurance reimbursement or payments, the method comprising denying coverage or reimbursement for a treatment, where the treatment comprises a monoclonal antibody, or a vaccine comprising an entirely carbohydrate immunogen, described herein.
EXAMPLES
Example 1STn-PS A1 as an Entirely Carbohydrate Immunogen: Synthesis and Immunological Evaluation
[0106] Sialyl Tn (STn) is a tumor associated carbohydrate antigen (TACA) that is overexpressed in a variety of carcinomas such as breast, ovarian, and colon cancer. In normal tissue, STn is not detectable, which is important for opportunities in developing cancer immunotherapies. An entirely carbohydrate, semi-synthetic STn-PS A1 conjugate was prepared and evaluated in C57BL/6 mice. STn-PS A1 was combined with commercially available monophosphoryl lipid A (MPL)-based adjuvant and after immunization, ELISA indicated a strong immune response for inducing both anti-STn IgM/IgG antibodies. The specificity of these antibodies was concomitantly investigated using FACS analysis and the results indicated excellent cell surface binding events to STn-expressing cancer cell lines MCF-7 and OVCAR-5. Most importantly, the raised antibodies conferred complement-dependent cellular cytotoxicity against MCF-7 and OVCAR-5 cells.
[0107] The STn antigen (Neu5Ac?2-6GalNAc?-O-Ser/Thr) is an O-linked mucin TACA that is overexpressed in human carcinomas and negligible in fetal and adult tissues. In cancer cells, the biosynthesis of STn is catalyzed by sialyltransferase ST6GalNAc I, which outcompetes other O-glycan elongating glycosyltransferases and promotes the generation of truncated sialylated O-glycans on cancer cell surfaces. Detection of STn is associated with various types of cancers, such as breast and ovarian, and high levels of STn correlate with a poor prognosis for patients. Therefore, STn is a relevant target for tumor immunotherapy. In the past few decades, many synthetic chemists, immunologists, and vaccinologists alike have been dedicated to the development of effective cancer vaccines that target STn or STn-related mucins.
[0108] Utilization of the zwitterionic polysaccharide PS A1 as a carrier for a Thomsen-nouveau (Tn)-PS A1 entirely carbohydrate immunogen has been demonstrated. This construct invoked a T cell dependent immune response capable of binding the Tn antigen and less concern of possible epitope suppression to the carbohydrate antigens. Provided in this Example is a more synthetically challenged conjugation, STn-PS A1, and more detailed immunological studies of STn-PS A1 as an entirely carbohydrate vaccine construct in combatting breast and ovarian tumors.
[0109] Results and Discussion
[0110] Synthesis of Aminooxy STn and Alpha-Selective Sialylation
[0111] Challenges in the chemical syntheses of sialyl-containing oligosaccharides are stereo-selective sialylation and rate enhancement. In order to improve reactivity and selectivity of ?-sialylation, previous attempts have focused on the development of activating groups at the anomeric position, installation of auxiliary groups at C-1 and C-3, incorporation of strong electron-withdrawing groups on the nitrogen atom at C-5, and the use of stereo-directing nitrile solvents. Utilizing a 4N 5O trans-fused oxazolidinone moiety at the C-4 and C-5 positions has led to excellent alpha selectivity because of the strong electron-withdrawing nature and trans orientation of the oxazolidinone group. These effects created a dipolar moment that greatly diminished the anomeric effect, which subsequently led to a new equilibrium favoring the formation of ?-sialyl glycosides. Phosphate esters have been used as anomeric-leaving groups in many glycosylation reactions, and benefits include augmented reactivity as well as facile activation, especially when compared to the widely applied thiol-leaving group. The combination of oxazolidinones and phosphates in sialylation reactions leads to highly alpha-selective and highly reactive sialyl donors, which have been proven to be an optimized solution for O-, S-, and C-sialylation.
[0112] Based on the above, the synthesis of ?-aminooxy STn (1) was conducted as shown in Scheme 1 (
[0113] Based on this glycosylation strategy, early stage synthetic efforts focused on the investigation of the optimized acceptors for sialylation as shown in Table 1 (
[0114] As noted in Table 1 (
[0115] As shown in Scheme 2 (
[0116] The deprotection of the oxazolidinone (8.fwdarw.13) was performed before installation of the oxysuccinimide group. The purpose for this sequence was to avoid any possible conflicts between the oxysuccinimide and oxazolidinone in later-stage deprotection steps. In order to achieve selective removal of the oxazolidinone, sodium methoxide was used. However, since the oxysuccinimide group is base label, caution was taken in view of the embedded imide bond, which is known to immediately cleave and convert to an amide plus a methyl ester under conditions of sodium methoxide. Moreover, removal of the amide bond can be very challenging in such circumstances because a strong acidic environment and heat is required, which can compromise the stereo integrity of the disaccharide itself. Furthermore, the Krapcho demethylation of sialyl methyl ester should be conducted prior to that of oxysuccinimide installation. There are two predominant reasons for this sequence of reaction conditions: 1) the nucleophilic hydrazine can attack the sialyl methyl ester and convert it to the carboxamide, and 2) the Krapcho reaction is highly specific to methyl esters and therefore the succinimide group will stay intact. This strategy can be adapted to other carbohydrate syntheses, especially for those containing both sialyl and aminooxy moieties.
[0117] Aminooxy STn Links to PS A1 Via Oxime
[0118] As shown in Scheme 3 (
[0119] Immunological Studies: Antibody Response(s) Against the STn Antigen
[0120] The utilization of natural STn-expressing mucins for serological assays can lead to more clinically relevant data compared to that of synthetic STn glycoprotein conjugates. It is known that the linkers of synthetic conjugates will exhibit a certain level of influence on antibody-antigen recognition events. Both ovine submaxillary mucin (OSM) and bovine submaxillary mucin (BSM) predominantly contain STn moieties, and have become the preferred choices for serological assays. In order to determine the specificity of the antibody induced by STn-PS A1 (16), sera from Jax C57BL/6 mice were collected and tested on BSM as shown in
[0121] Based on the IgG and IgM ELISA results, there is clearly a benefit to utilizing suitable adjuvants. First, adjuvant effects can be beneficial for antigen-antibody binding events. The antibody titers of both adjuvanting groups, SAS and TMG, are multiple folds greater as observed in
[0122] The safety of KLH protein has been shown previously. However, KLH is a very potent carrier protein. A very plausible concern of utilizing STn-KLH vaccine is epitope suppression, which is a result of overwhelming carrier-specific T cell response over that of conjugated antigens. Increased exposure of STn-KLH may lead to increased antibody response to KLH and diminished response to conjugated STn antigens. In order to properly evaluate the immunity of STn-PS A1 conjugate, it is necessary to determine the carrier response, especially anti-PS A1 antibody level after animal immunization. Based on the primary ELISA analysis (
[0123] Analysis of pIgG Subclasses
[0124] IgGs are high affinity and long-term antibodies that target many pathogens. Their subclasses exhibit slightly different immunological functions, but remain essential for complement recruitment. The subclasses of IgG induced by STn-PS A1 (16) vaccine were analyzed by a serological assay with BSM coating (
[0125] The high IgG2b/IgG1 ratio in both STn-PS A1 plus SAS and STn-PS A1 plus TMG groups is a strong indication that a Th1-type dominated immune response was being activated. Furthermore, the enhanced IgG2b production in the STn-PS A1 SAS murine group can be attributed to MPL as an additive adjuvant. The recognition of MPL by TLR4 on antigen presenting cells is a key event in the activation of those cells and initiation of adaptive immunity. MPL is known as a Th1-favored adjuvant and therefore can promote a Th1 response that leads to an increase in IgG2 subclass production. Since STn-PS A1 is an entirely carbohydrate construct void of proteins, peptides or lipids, the ELISA data fit into the expected immunological profile of STn-PS A1. Consequently, it is very possible that these IgG2b antibodies are specifically targeting the disaccharides moiety (Neu5Ac?2-6GalNAc?) on BSM.
[0126] Antibody Binding to Cancer Cell Surfaces
[0127] Utilization of fluorescence-activated cell sorting (FACS) is a useful method when studying the immunological potential of STn-PS A1 as a vaccine designed to target the STn antigen. Based on the serological assay and IgG subclass analyses, antisera induced by the STn-PS A1+SAS formulation was chosen for a cell surface binding test on several cancer cell lines. Cancer cells treated with anti-PS A1 serum were used as a substance control and cancer cells treated with only secondary anti-IgG (FITC) or anti-IgM (Alexa Fluor? 647) antibody were used as an isotype control. The flow cytometry results are described in
[0128] Antibody-Mediated Complement-Dependent Cytotoxicity (CDC)
[0129] Based on the conclusion from the FACS assay that both IgM and IgG antibodies can be raised against the STn-PS A1+SAS formulation and are very specific in targeting STn-positive cancer cells, CDC studies were conducted. Antibody-mediated cytolysis studies are important to determine the therapeutic value of vaccine candidates. The STn-PS A1 construct was examined One of the effector killing mechanisms is through complement-dependent cytotoxicity (CDC) of certain class/subclass of antibodies, which leads to compromised tumor cell membrane integrity. The ELISA and FACS assays gave positive data regarding target validation, but did not provide an understanding of antibody function as a direct correlation to antibodies raised from STn-PS A1+SAS immunizations. First, the anti-STn-PS A1 serum contains a moderate amount of anti-STn IgM, which can be particularly effective in CDC due to the pentameric nature of IgMs. Second, there was a substantial amount of IgG2b observed in the ELISA data, which has been demonstrated to be highly potent in activating CDC compared to that of other IgG subclasses.
[0130] The results of the CDC employing MCF-7 and OVCAR-5 STn positive cell lines are summarized in
SUMMARY
[0131] In this Example, the preparation and immunological evaluation of an entirely carbohydrate STn-PS A1 conjugate that mimics STn-KLH is described. A highly chemo-selective and adaptive synthetic route for aminooxy-STn antigen was developed. The aminooxy sugar was conjugated to aldehyde-functionalized PS A1 through an extremely economical oxime linker. The structure of STn-PS A1 was unambiguously characterized using NMR analysis. The combination of STn-PS A1 plus Sigma Adjuvant System demonstrated a capability of inducing anti-STn antibodies in C57BL/6 mice as indicated by ELISA. FACS was also employed to study the binding events on STn expressing MCF-7 and OVCAR-5 cancer cell lines. The results from both assays further confirmed the excellent specificity and selectivity of antibodies raised against the STn-PS A1 immunogen for binding the tumor cell surface STn antigen. Moreover, data collected in an in vitro LDH tumor killing assay exhibited the therapeutic ability of anti-STn antibodies in inducing complement-dependent cytotoxicity. Combined, the results from the three assays demonstrate an approach for the development of a cancer vaccine.
Example 2Increasing Immunogenicity of the TF-Antigen by Targeting MGL2 Receptors Using a Bivalent Tn-TF-PS A1 Conjugate
[0132] In this Example, the importance of cancer vaccine design and development is demonstrated through an immunological investigation of monovalent Tn- and TF-PS A1 constructs, leading to a unimolecular Tn-TF-PS A1 bivalent immunogen which significantly increases immunogenicity towards the TF antigen. This additive Tn effect was also demonstrated to have enhanced IgG binding to tumor cell lines MCF-7 and OVCAR-5 in FACS analysis, and very good cytotoxicity in a CDC assay that monitored the expulsion of LDH. The enhanced immunogenicity was deciphered through studying the interaction of Tn-TF-PS A1 biotinylated probes binding to C-type lectin receptor MGL2.
[0133] PS A1, a zwitterionic capsular polysaccharide isolated from the commensal bacteria Bacteroides fragilis ATCC 25285/NCTC 9343, initiates CD4+ T cell responses. The current understanding of zwitterionic polysaccharides as immune stimulants is to rival the protein paradigm for T cell activation, bridging the innate and adaptive immune gap. Innate immunological mechanistic studies of PS A1 show interactions with toll-like receptor 2 (TLR-2)/CD282 and DC-SIGN, which are important for efficient uptake by antigen-presenting cells (APCs) or dendritic cells (DCs). While PS A1 is an immunogenic stimulant and a possible alternative to protein-based cancer vaccines, it can additionally contribute to the production of Th17 immunity. The production of Th17 cells has been shown to be important in protection against Staphylococcus aureus, Mycobacterium tuberculosis, and, in particular, cancer. The activation of Th17 immunity is bifunctional in that the production of TGF-? can influence the valuable Th17 immune response but can also influence the production of T regulatory cells (Tregs). Therefore, investigating ZPSs as carriers in vaccine development requires strategies to decrease the regulatory immune responses through selective modifications that allow for interactions with other innate immune receptors.
[0134] The design and development of carbohydrate-based vaccines remains important for targeting diseased states where unique sugar antigens are normally the first-line in immune surveillance. Carbohydrates, however, have long been known to be weakly immunogenic in eliciting valued T cell responses. One strategy for improving immunogenicity involves tailoring the immunogen to target specific innate immune receptors found on APCs or DCs. These immune response receptors have evolved to differentiate self-versus pathogen-associated molecular patterns (PAMPs). PAMPs are often composed of diverse glycan structures that can be broadly recognized by C-type lectin receptors (CLRs) and TLRs. CLRs are best characterized as calcium-dependent proteins expressed on myeloid cells to promote efficient antigen uptake which ultimately leads to presentation to CD4+ T cells. Fortunately, CLRs are selective for conserved carbohydrate recognition domains concomitantly leading to pathogen clearance.
[0135] A specific CLR, macrophage galactose binding lectin 2 (MGL2), serves as a valuable surface receptor for vaccine development due to selectivity towards N-acetylgalactosamine (GalNAc), the sugar component of the Thomsen nouveau (Tn) cancer antigen. The Tn antigen is an important tumor associated carbohydrate antigen (TACA) involved in the onset and progression of tumors. Since carbohydrate/TACA conjugates are known for being weakly immunogenic, targeting CLRs with a simple covalently linked sugar is useful for enhanced phagocytosis and increased immunogenicity. Therefore, attaching N-acetylgalactosamine (GalNAc) as a small molecule activator for innate and adaptive immune responses can result in an increased uptake of TACA-based vaccine constructs.
[0136] The Tn antigen has only recently been investigated for its ability to bind MGL2. A correlation between increased Tn density on MUC-6 (15 amino acid peptide fragment) and enhanced antigen uptake by APCs in comparison to a peptide fragment alone has been demonstrated. This result is believed to be the consequence of improved binding to MGL2. Furthermore, others have engineered a comprehensive polyvalent vaccine mix composed of six monomeric TACA conjugates: 1) a MUC 1-G5 peptide containing 8 conjugated Tns, 2) a Tn cluster, 3) an STn cluster, 4) a TF cluster, 5) one consisting of Globo-H, 6) one consisting of GM3, and 7) a Lewis Y immunogen. The polyvalent mixture proved to be effective in the recognition of respective TACAs, but there was no discernible immunological titer difference between the majority of monovalent (single TACA) to heptavalent (mixture of TACAs) immunizations with keyhole limpet hemocyanin (KLH) conjugates. However, there was a noted two-fold increase in IgG titer values when peptide MUC1-G5 was used in monovalent to polyvalent immunizations. The likely rationale for Tn not contributing to an adjuvant effect to other TACAs is the notion of super cross-linking CLRs, which can decrease antigen uptake and presentation and impair proper immune recognition. This effect is also observed in the natural setting with microorganisms and endogenous glycosylated MUC-1 clearance, leading to tumor evasion. The perplexity of the Tn antigen to either increase antigen uptake or increase specific antibody generation has been shown. Therefore, with the aforementioned issues in over stimulating CLRs with regards to vaccine design, incorporating Tn on a unimolecular construct with another TACA can help promote efficient antigen uptake through MGL2 and subsequently increase immunogenicity.
[0137] In addition to targeting CLRs such as MGL2, a balanced immune response is important for overall efficacy in which Th1, Th2, and Th17 can assist in antibody production. In that regard, C-type lectins have the ability to influence cytokine production and are targets for self-adjuvanting vaccine constructs. Cytokines are often associated with an induction of suppressive Treg responses initiated through interactions with TLR-2. The presence of proinflammatory markers such as IL-6, IL-4, and IFN-? can negate side effects of Tregs. One reagent that leads to the production of IL-6 is adjuvant monophosphoryl lipid A (MPLA), which can overcome a decrease in suppressive immune responses (T regs). Although the mechanistic function of MGL2 remains elusive, a similar signalling event belongs to the family of the asialoglycoprotein receptors (ASGP-R), which initiate pro-inflammatory cytokines. Tn-PS A1 cytokine data has shown a reduced IL-10 and increased IL-4/IL-17 expression, which was found to be distinct from PS A1 alone. Furthermore, interaction with MGL2 is known to produce IL-4. It is possible that this switch in cytokine profiles can be explained as Tn interacting with MGL2, thereby providing access to an alternate processing pathway as opposed to one for PS A1 alone. Since MGL2 skews the immune response to Th2, targeting this receptor with the Tn antigen is a viable strategy to increase immunogenicity of various TACA-PS A1 constructs.
[0138] Therefore, an immunogen with dual functionality was created through: 1) an ability to increase the immune response towards TACA Thomsen-Friedenreich (TF=D-Gal?1,3-D-GalNAc) by conjugating both Tn and TF to PS A1, and 2) the use of Tn to target the MGL2 receptor. This approach has the advantage of using ZPS PS A1 (21) (
[0139] Results and Discussion
[0140] The synthesis of Tn-TF-PS A1 (24c) (
[0141] To evaluate the immunological potency of compounds 24a-24c, Jax C57BL/6 mice were vaccinated using two separate adjuvants: 1) TiterMax Gold? (TMG) and 2) Sigma adjuvant System? (SAS) to evaluate antibody binding in ELISA. Additionally, binding specificity of polyclonal antibodies towards either Tn-BSA or TF-BSA were used to parse out individual contributions of 24a-24c. First, 24a (
[0142] It was initially thought that using SAS adjuvant could help boost the IgG immune response similar to the effect noticed with 24a. However, no discernible differences were observed. The immune response with 24b remained exclusively an IgM isotype with high titer values observed towards TF-BSA (
[0143] The oxime conjugation of both 22 and 23 was turned to oxidized PS A1, giving 24c (
[0144] In order to validate MGL2 interaction with 24a and 24c, four biotinylated PS A1 conjugate probes (
[0145] To further support the notion of increased antibody recognition through bivalent construct Tn-TF-PS A1, flow cytometry was used to determine polyclonal antibody binding to human tumor cells MCF-7 (
[0146] After evaluating antibody binding on flow cytometry, antibody function was assessed using complement dependent cytotoxicity (CDC) (
[0147] The development of a bivalent Tn-TF-PS A1 construct, using a semi-synthetic approach, has led to the increased immunogenicity of the TF antigen. This increased immune response can be attributed to a targeted MGL2 strategy leading to an increased uptake of TACAs. This stands in contrast to other multivalent approaches that have been engineered in which there was no major effect on the individual TACAs alone. The success of 24c is distinct from other polyvalent immunogens (globular protein conjugates) mostly likely due to the linear and repetitive nature of 21 or 24c, leading to higher surface area contact to DCs and multivalent interactions. This demonstrates that a bivalent Tn-TF conjugate has had an enhanced immune response in increasing the binding events to TF.
[0148] Construct 24a was consistent in mounting an IgG specific immune response to the Tn antigen when TMG or SAS were used as external adjuvants. However, proving the same strategy to accommodate the TF antigen was more challenging in 24c. The results indicated that the use of adjuvants had relatively no effect on IgG titer values. When PS A1 was bivalently conjugated with both Tn and TF (24c), there was a profound difference in anti-TF IgGs compared to 24b. A comparable result was also observed in
[0149] The rationale behind using Sigma Aldrich Adjuvant (SAS) was the incorporation of an MPLA-based adjuvant to overcome potential suppressive Treg responses. This adjuvant is distinct from TMG as a potent oil and water emulsion that allows slow release immunogen. When SAS was administered with 24c, there was increased immunogenicity to the TF antigen but also enhanced immunogenicity was observed in formulations with TMG. It is important to note the overall titers from
[0150] The incorporation of the Tn antigen to TF-PS A1 has had a profound influence on the respective immunological activity corresponding to an increase of the following parameters: a) IgG antibodies specific towards TF, b) binding to tumor cells, and c) complement dependant cytotoxicity. The mechanism behind this activity is increased MGL2 binding by the Tn antigen, which reveals a targeted vaccine method for enhanced antigen uptake and greater immunological activity. Since PS A1 has been noted to bind to DC-SIGN, it is a possibility that other lectins could be involved in the initiation of this immune response. This method thus has the capability of being adapted to multiple vaccines formats including peptides, proteins, nanoparticles, and lipids, to increase the therapeutic ability of carbohydrate-based vaccines.
[0151] Materials and Methods
[0152] Synthesis of Tn-TF PS A1 (24c)
[0153] A 2 mM solution of NaIO.sub.4 was used to oxidize 1 mg of PS A1 in 0.5 mL of NaOAc buffer pH 5.2 for 90 min. KCl was used to quench excess NaIO.sub.4. A1:1 molar ratio of Tn-ONH.sub.2 (2) to TF-ONH.sub.2 (3) (1.0 mg and 1.7 mg respectfully) were allowed to react with oxidized PS A1 for 24 hours followed by a long stint of dialysis using 10 kDa MWCO Snakeskin? tubing. Percent loading was calculated from the following formula: For TF-ONH.sub.2 (% loading=MW TF-ONH.sub.2/MW TF-PS A1 hexasaccharide conjugate?mol fraction). The mol fraction was obtained from NMR integration of the respective two NHAc methyl protons from PS A1 and the NHAc from the TF antigen. Percent Tn-ONH.sub.2 loading was determined by using the formula: For Tn-ONH.sub.2 (% loading=MW Tn-ONH.sub.2/MW Tn-PS A1 pentasaccharide conjugate?mol fraction). The mol fraction was obtained from NMR integration of the respective two NHAc methyl protons from PS A1 and the NHAc from Tn antigen.
[0154] Biotinylated PS A1/Conjugate Probes (25a-25d)
[0155] 1.0 mg of either PS A1 (1), Tn-PS A1 (24a), TF-PS A1 (24b), or Tn-TF-PS A1 (24c) was reacted with 0.5 mg of sulfo-NHS-biotin (100?equivalents) (ProteoChem) in 0.5 mL of 1?PBS buffer pH 7.4 for 24 h at room temperature. The PS A1 probes were dialyzed, lyophilized, and reconstituted in 1? DPBS buffer (with CaCl.sub.2/MgCl.sub.2) pH 7.2 at a concentration of 1 mg/mL. Activity of the probes were evaluated in streptavidin based assays, as described below, in the MGL2 binding assay.
[0156] 3-oxopropyl ethanethioate (mercaptoaldehyde) (28)
[0157] A catalytic amount of of piperidine (5.0 ?L) was added to 0.5 mL acrolein (26) at 0? C. Then 0.52 mL of thioacetic acid (27) was added dropwise over a period of 30 minutes. The reaction was carried out for 12 hours and the reaction mixture was then concentrated under vacuum and purified by column chromatography using 30% EtOAc/70% DCM as the eluent to give mercaptoaldehyde (28) in 95% yield. 1H NMR (CHLOROFORM-d, 600 MHz): ? 9.67 (d, J=1.0 Hz, 1H), 3.03 (t, J=1.0 Hz, 2H), 2.73 (t, J=1.0 Hz, 2H), 2.25 ppm (d, J=1.0 Hz, 3H); .sup.13C NMR (150 MHz, D.sub.2O): ? 200.1, 195.6, 43.8, 30.7, 21.7. LRMS:ESI [M+(Na).sup.+] calcd for 155.01 found 155.0.
[0158] General Procedure for TACA Linkers Tn and TF
[0159] Aminooxy Tn (22) (5.0 mg) was reacted with 2.8 mg of mercaptoaldehyde (28) for 18 h in sodium acetate buffer (pH 5.5) at room temperature and purified using Sephadex G-10 and deionized/distilled H.sub.2O as the eluent. Fractions containing the Tn-linker were lyophilized. .sup.1H NMR (D.sub.2O, 600 MHz): ? 7.51-7.54 (m, 1H), 6.89-6.92 (m, 1H), 5.37 (d, J=3.7 Hz, 1H), 5.28-5.30 (m, 1H), 4.15-4.21 (m, 1H), 3.90-3.95 (m, 1H), 3.80-3.88 (m, 2H), 3.59-3.68 (m, 2H), 2.92-3.03 (m, 2H), 2.58-2.71 (m, 1H), 2.43 (ddd, J=9.5, 6.2, 2.9 Hz, 1H), 2.24-2.29 (m, 2H), 1.91-1.97 (m, 3H), 1.80 ppm (br. s., 1H); .sup.13C NMR (150 MHz, D.sub.2O): ? 200.9, 174.5, 154.6, 104.7, 98.7, 76.8, 74.9, 72.4, 70.5, 68.5, 60.8, 47.6, 30.0, 29.3, 25.8, 25.4, 25.0, 23.2, 21.9. LRMS:ESI [M+(Na).sup.+] calcd for 373.10 found 373.1.
[0160] Aminooxy TF (23) (5.0 mg) was reacted with 1.7 mg of mercaptoaldehyde (28) for 18 h in sodium acetate buffer (pH 5.5) at room temperature and purified using Sephadex G-10 and deionized/distilled H.sub.2O as the eluent. Fractions containing the TF-linker were lyophilized. .sup.1H NMR (D.sub.2O, 600 MHz): ? 7.53 (t, J=6.2 Hz, 1H), 6.91 (s, 1H), 5.37 (d, J=4.0 Hz, 1H), 5.28 (d, J=4.0 Hz, 1H), 4.40 (d, J=8.1 Hz, 1H), 4.32-4.39 (m, 1H), 4.19 (d, J=2.9 Hz, 1H), 4.16 (d, J=2.9 Hz, 1H), 3.95 (dt, J=11.2, 2.7 Hz, 1H), 3.84-3.89 (m, 1H), 3.80 (d, J=2.9 Hz, 1H), 3.59-3.69 (m, 2H), 3.49-3.58 (m, 1H), 3.42 (dt, J=9.9, 7.7 Hz, 1H), 2.92-3.05 (m, 1H), 2.57-2.75 (m, 1H), 2.44 (q, J=6.6 Hz, 1H), 2.33 (s, 1H), 2.24-2.28 (m, 1H), 1.91 (s, 1H), 1.80 ppm (s, 1H); .sup.13C NMR (150 MHz, D.sub.2O): ? 200.9, 174.5, 154.6, 104.7, 98.7, 76.8, 74.9, 72.4, 70.5, 68.5, 60.8, 47.6, 30.0, 29.3, 25.8, 25.4, 25.0, 23.2, 21.9. LRMS:ESI [M+(Na).sup.+] calcd for 535.15 found 535.1.
[0161] BSA-Maleimide
[0162] 1.0 mg of BSA was dissolved in 300 ?L of 1?PBS buffer with 1 mM EDTA (pH 7.2) and reacted for 30 min with 100 ?L of a 2 mM of 3-(maleimido)propionic acid N-hydroxysuccinimide solution in 1 mL of DMF. Excess 3-maleimidopropionate was removed by centrifugal ultrafiltration (Vivaspin? 6 MWCO 10 kDa) and washed three times with 5 mL of 1?PBS buffer containing 1 mM EDTA (pH 7.2). Conjugation was analyzed by MALDI-TOF and determined to be M/Z 71686.967. Mass loading was calculated using the following equation: (MW of BSA-maleimide?MW of BSA (664303)/(MW of maleimide linker). Based on the molecular weight, we were able to determine that there were 34 molecules of maleimide linked to BSA.
[0163] Tn-BSA (12)
[0164] 2.5 mg of Tn-linker was deacetylated using Zemplen's method consisting of NaOMe in methanol followed by neutralization with DOWEX 50W?8-100 ion exchange resin. The solution was then filtered and concentrated under reduced pressure. The deacetylated Tn-linker was dissolved in 0.1 mL of 1?PBS buffer with 1 mM EDTA (pH 7.2) and added to a 1.0 mg solution of BSA-maleimide in 0.2 mL 1?PBS buffer. Conjugation was analyzed by MALDI-TOF (M/Z 78273.845). Mass loading was calculated using the following equation: (MW of Tn-BSA?MW of BSA-maleimide)/(MW of Tn-linker). From this method, we determined that there were 14 molecules of Tn-linker conjugated per BSA-maleimide.
[0165] TF-BSA
[0166] 2.5 mg of TF-linker was deacetylated using Zemplen's method consisting of NaOMe in methanol followed by neutralization with DOWEX 50W?8-100 ion exchange resin. The solution was then filtered and concentrated under reduced pressure. The deacetylated TF-linker was dissolved in 0.1 mL of 1?PBS buffer with 1 mM EDTA (pH 7.2) and added to a 1.0 mg solution of BSA-maleimide in 0.2 mL 1?PBS buffer. Conjugation was analyzed by MALDI-TOF (M/Z 78273.845). Mass loading was calculated using the following equation: (MW of TF-BSA?MW of BSA-maleimide)/(MW of TF-linker). It was determined there were 14 molecules of TF-linker conjugated per BSA-maleimide. .sup.1H NMR (D.sub.2O, 600 MHz): ? 7.53 (t, J=6.2 Hz, 1H), 6.91 (s, 1H), 5.37 (d, J=4.0 Hz, 1H), 5.28 (d, J=4.0 Hz, 1H), 4.40 (d, J=8.1 Hz, 1H), 4.32-4.39 (m, 1H), 4.19 (d, J=2.9 Hz, 1H), 4.16 (d, J=2.9 Hz, 1H), 3.95 (dt, J=11.2, 2.7 Hz, 1H), 3.84-3.89 (m, 1H), 3.80 (d, J=2.9 Hz, 1H), 3.59-3.69 (m, 2H), 3.49-3.58 (m, 1H), 3.42 (dt, J=9.9, 7.7 Hz, 1H), 2.92-3.05 (m, 1H), 2.57-2.75 (m, 1H), 2.44 (q, J=6.6 Hz, 1H), 2.33 (s, 1H), 2.24-2.28 (m, 1H), 1.91 (s, 1H), 1.80 ppm (s, 1H); .sup.13C NMR (150 MHz, D.sub.2O): ? 200.9, 174.5, 154.6, 104.7, 98.7, 76.8, 74.9, 72.4, 70.5, 68.5, 60.8, 47.6, 30.0, 29.3, 25.8, 25.4, 25.0, 23.2, 21.9. LRMS:ESI [M+(Na).sup.+] calcd for 535.15 found 535.1.
[0167] Immunizations
[0168] Jax C57BL/6 male mice (6 weeks) were obtained from Jackson Laboratories and maintained by the Department of Laboratory Animal Resources (DLAR) at the University of Toledo. All animal protocols were performed in compliance with the relevant laws and institutional guidelines set forth by the Institutional Animal Care and Use Committee (IACUC) of the University of Toledo.
[0169] Sample sizes (n=5) were chosen based on desired amount of blood sera (1 mL/mouse). Mice were distributed randomly without bias. Criterion for inclusion of mice depended on the health status of the mouse. If mice were shown to have ascites or signs of distress the mouse was euthanized. However, no abnormalities occurred throughout the duration of the experiment.
[0170] Vaccinations with Titermax Gold Individual Tn-, TF- and Tn-TF-PS A1 constructs (20 ?g) were mixed in a 1:1 ratio of 50 uL of TiterMax? Gold and injected into 7 wk old C57BL/6 mice (Jackson Laboratory) (each construct was administered individuallynot mixed). Mice groups (n=5) were immunized by intraperitoneal injections (i.p.) on day 0, 14, 28, 42. Blood sera were obtained using a cardiac puncture technique on day 52.
[0171] Vaccinations with Sigma Adjuvant System
[0172] Individual Tn-, TF-, and Tn-TF-PS A1 constructs (20 ?g) were mixed in a 1:1 ratio of 100 ?L of Sigma Adjuvant System (Sigma-Aldrich) and injected into 7 wk old C57BL/6 mice (Jackson Laboratory) (each construct was administered individuallynot mixed). Mice groups (n=5) were immunized by intraperitoneal injections (i.p.) on day 0, 21, 42, per manufacture's instructions. Blood sera were obtained using a cardiac puncture technique on day 52.
[0173] Enzyme Linked Immunosorbant Assay (ELISA)
[0174] Either Tn- or TF-BSA was coated on Immulon? Microtiter? 4 HBX 96 well plates using 3 ?g/mL in carbonate buffer (pH 9.2) and then the plates were incubated for 18 h at 4? C. Plates were washed three times with 200 ?L of washing buffer (1?PBS buffer with 0.05% Tween? 20) and blocked with 200 ?L of 3% BSA for 1 h. Serum from mice was initially diluted at 1:100 and then serially half-log.sub.10 diluted, put into wells and incubated for 2 h at 37? C. for a final volume of 100 ?L in each well. After incubation for 2 h, the plates were washed three times with 200 ?L of washing buffer Alkaline phosphatase linked secondary antibodies (Anti-IgM and Anti-IgG) was used to detect primary antibodies bound to either Tn- or TF-BSA. The procedure for the use of secondary anti-IgM (Southern Biotech) were diluted (1:1000) and 100 ?L were placed in wells corresponding for IgM detection and incubated for 1 h at 37? C. The procedure for the use of secondary anti-IgG antibodies (light chain, Jackson Immunoresearch) were diluted (1:5000) and 100 ?L were placed into wells corresponding to light chain IgG detection and incubated for 1 h at 37? C. The plates were washed three times with 200 ?L of washing buffer and p-Nitrophenyl Phosphate (PNPP) (1 mg/mL) in diethanolamine buffer (pH 9.8) was added at a 100 ?L per well and incubated for 30 min and optical density was read at 405 nm using BioTek PowerWave HT Microplate Spectrophotometer. All assays were performed in triplicate. Titers were determined by regression analysis with dilutions plotted against absorbance. The titer cutoff value was set at 0.2 for titer determination, which is two times the value from control mice. Statistical analysis from ELISAs for experimental groups were compared with the controls using paired t test using GraphPad Prism 6.
[0175] MGL2 Binding Assay
[0176] Mouse recombinant MGL2 (R&D systems) 2.5 ?g/mL was used to coat Immulon? Microtiter? 4 HBX 96 well plates in 1?DPBS buffer (with CaCl.sub.2/MgCl.sub.2) pH 7.2 for 18 h at 4? C. The plates were then washed with 200 ?L of 1?DPBS washing buffer (with CaCl.sub.2)/MgCl.sub.2 and 0.05% Tween 20) three times. PS A1-biotin and respective biotinylated conjugates (24a-24c) were serially diluted from 40-0.625 ?g/mL and incubated for 2 h at 37? C. in 1?DPBS with CaCl.sub.2)/MgCl.sub.2. Plates were then washed with 200 ?L of 1?DPBS buffer three times. A strepavidin-alkaline phosphatase (Sigma Aldrich) was diluted (1:1000) and 100 ?L was added to each well and incubated for 1 h at 37? C. The plates were washed three times with 200 ?L of 1?DPBS washing buffer and PNPP (1 mg/mL) in diethanolamine buffer (pH 9.8) was added at a 100 ?L per well and incubated for 30 min and optical density was read at 405 nm. Experiments were performed in triplicate and data are illustrated as mean?s.e.m.
[0177] Percent inhibition by Tn-BSA following the same procedure noted above was then conducted, however, 10 ?g/mL was co-incubated with 24a-24c before binding competition to MGL2 was attempted. Percent inhibition was calculated using equation: [(O.D of 24a-24c binding to MGL2)?(O.D. of co-incubation of 24a-24c with Tn-BSA)/(O.D. of 24a-24c binding to MGL2)]?100.
[0178] Flow Cytometry
[0179] MCF-7 and OVCAR-5 (obtained from Henry Fold Health Systems mycoplasma free) were cultured in 10% FBS RPMI 1640. 1.0?10.sup.6 cells of each cell line was incubated at 4? C. for 1 h in the dark with 1:50 dilution of the following separate anti-sera: 1?PBS control, 21, 24a-24c. The cells were washed three times in 250 ?L of FACs buffer (2% FBS in 1?PBS, 0.001% sodium azide) by centrifuging at 1000 rpm. 100 ?L Anti-IgG Alexa Fluor? 488 (1:50 dilution) was added to the cells and incubated at 4? C. in the dark for 1 h followed by three washes with 250 ?L of FACS staining buffer. The cells were fixed with freshly prepared 1% paraformaldehyde and analyzed using BD Biosciences FACSCalibur at the University of Toledo Core Flow Cytometry Facility. FlowJo analysis software was used to process flow cytometry data.
[0180] Complement Dependent Cytotoxicity Assay
[0181] MCF-7 cells (1.0?10.sup.4) and OVCAR-5 cells (1.0?10.sup.4) were seeded in 96 wells plates and incubated overnight in a 5% CO.sub.2 incubator at 37? C. The plates were washed with 2% BSA in DPBS and 100 ?L of experimental anti-serum in 1:20 dilution of (1, 4a-4c, and PBS control) was incubated for 1 h. The experimental wells were washed and incubated with 10% rabbit complement (Pel-Freez) for 1 h at 37? C. The control values of the LDH assay kit (Roche) was determined from spontaneous LDH release (low control) and 1% Triton X-100 (high control) and incubated for 1 h at 37? C., simultaneously with the experimental values. 50 ?L of cell supernatant was transferred to a new 96 well plate containing 50 ?L of DPBS. According to manufactures protocols 100 ?L of the colorimetric LDH detection reagent was added to each well and the O.D was read at 490 nm. The percentage cellular cytotoxicity was calculated by the following equation: Cell cytotoxicity %=(experimental values?low control values)/(high control values?low control values)?100.
Example 3Bacterial Growth and Isolation, and Purification of PS A1
[0182] B. fragilis (ATCC 25285/NCTC 9141) was purchased from Presque Isle Cultures. To begin the initial growth procedure, the bacteria were streaked on blood agar-containing BBE plates. The plates were prepared in an anaerobic glove bag in a CO.sub.2 environment. After the cultures were initiated, the plates were transferred to an anaerobic jar with gas packs in the presence of O.sub.2 indicator strips and placed in an incubator at 37? C.
[0183] PYG broth was used for the growth of B. fragilis. Proteose-peptone (20 g), yeast extract (5 g), NaCl (5 g), and 0.001 g of reazurin per 1 L of nanopure H.sub.2O were autoclaved. Glucose 25% (2 mL), potassium phosphate 25% (2 mL), cysteine 5% (1 mL), 0.5% of hemin in 1N NaOH (100 ?L), and 0.5% vitamin K1 in absolute ethanol (50 ?L) were filtered using a 0.22 ?m filter, and added to the autoclaved PYG broth. Anaerobic conditions were achieved by degassing solutions for 30 min under an atmosphere of 80% N.sub.2, 10% CO.sub.2, 10% H.sub.2. A resazurin indicator was used to assure an anaerobic environment. The agar plates or liquid media were ready for inoculation as soon as the media was no longer pink in color. The agar plates were cut in sections and placed into the degassed media under an inert atmosphere. For liquid media transfer, 5 mL of culture was seeded in a degassed jar by cannulation. Every 24 hr the pH of the media was tested and adjusted to 7.2. During the first 24 h of growth, the pH would drop to 5, and 5M NaOH was used to adjust the pH in 1 mL portions until pH 7.2 was noted. A total of 20 L of bacteria fermentation was accomplished.
[0184] The growth media was centrifuged at 4,000?g for 20 min at 4? C. in 500 mL bottles. The supernatant was poured off and the cells were resuspended and washed in 500 mL of 0.15 M NaCl. Then, 500 mL of 75% phenol was stirred with the washed cells at 70? C. for 30 min. The phenol layer was separated by centrifuging at 5,000?g for 30 min at 4? C. The aqueous layer was then extracted three times with ether. After extraction the aqueous layer was concentrated under reduced pressure at 60? C., and redissovled in a minimal amount of water and subjected to dialysis for 7 days and lyophilized. The crude material was then subjected to 5.0 mg/mL of RNase (Promega) and 5.0 mg/mL DNase (Promega) in 0.1 M acetate buffer followed by 10 mg/mL of Protease (Sigma-Aldrich) to degrade any RNA, DNA, and protein. The material was then purified on two size exclusion columns and an anion exchange column. The first size exclusion column was packed with Sephacryl S-400 (GE Lifesciences) using 0.5% sodium deoxycholate, 50 mM glycine, and 10 mM EDTA (pH 9.8). Crude bacterial lysate was then loaded onto the column and 2 mL fractions were collected and analyzed by UV absorbance measuring at 220, 260, and 280, and TLC charring with anisaldehyde. Fractions containing more than 0.1 ABS at 260 and 280 nm were pooled for further purification. The fractions that showed absorbance at 220 nm were pooled and dialyzed.
[0185] The polysaccharide obtained was further purified using Sephacryl S-300 (GE Lifesciences) to remove excess buffer and further separate lipid capsular polysaccharides. UV absorbance and TLC charring again analysed fractions. Finally, the last step in the purification was the use of anion exchange chromatography. The crude PS A1 was treated with 5% acetic acid for 1 h at 100? C., loaded onto the column, and eluted with 50 mM Tris-HCl, pH 7.3 and an increasing NaCl concentration from 0 M to 2 M. Nuclear magnetic resonance (NMR) was used to determine purity, and gel electrophoresis was used to determine size and was stained with a carbohydrate staining kit.
Example 4Murine IgM Monoclonal Antibody Generated from Tn-PS A1 with In Vivo and In Vitro Activity
[0186] An important criterion for the consideration in generating specific anti-carbohydrate mAbs is the ability to produce antibodies that are specific for glycosides without influence from peptide/hydrocarbon linkers. To avoid the cross reactivity between carbohydrate antigens, monoclonal antibodies were generated from the zwitterionic polysaccharide Tn-PS A1 to focus the immune response specifically onto Tn.
[0187] Results
[0188] Monoclonal antibodies were generated from mice immunized with Tn-PS A1, an entirely carbohydrate immunogen. PS A1 was chosen as the immunogen because it is a zwitterionic polysaccharide that induces a T cell mediated immune response. The intended use behind this construct was to generate mAbs that are entirely based on carbohydrate binding. After immunizing mice, the spleen cells were fused with Sp2/0-Ag14 and screened the cell supernatant for the ability to bind with the Tn antigen conjugated to bovine serum albumin (BSA) in order to specifically isolate carbohydrate Tn-specific antibodies. The hybridoma cell supernatant that demonstrated the best ability to bind to Tn-BSA was chosen for scale up procedures for in vivo and in vitro evaluations. Kt-IgM-8 (IgM) demonstrated optimal binding in the titration of the antibody at 0.3 ?g/mL with an optical density of (O.D.) above 0.2 (
[0189] The next step in characterizing Kt-IgM-8 was to determine if the antibody could bind to whole cancer cells in flow cytometry. MCF-7 (Breast) and HCT-116 (Colon) were chosen due to both the presence of Tn and the fact that they represent two of the most common forms of cancers. Binding tumor cell lines is the first step in determining how well an immunotherapeutic will stand up against in vivo models. Anti-IgM Alexa Fluor?647 was used as the fluorescent secondary antibody to detect IgM antibody binding to the primary antibody adhered on the cancer cell lines. KT-IgM-8 shows the ability to bind to both tumor cell lines at 30 ug/mL. (
[0190] In order to determine antibody function, a chromium-51 coupled CDC assay was used to determine the cytotoxicity of mIgM towards MCF-7 cells. In
[0191] As a platform to examine human tumors in mice models, severe combined immunodeficient (SCID) mice are the optimal host for xenografted human tumors for immunotherapeutic evaluations, taking advantage of naturally occurring complement proteins in the absence of any functional immune system. Since the SCID mice lack B and T lymphocytes, xenografted tumors are able to be implanted and grow in the absence of an amounting immune response that would compromise tumor cell survival. Consequently, the use of MCF-7 cells represents studying breast cancer without the need for using human models. The tumor growth was measured by tumor volume (using micro-calipers) and effectiveness of the immunotherapeutic, and was assessed by the comparison of tumor volume in the control mice (PBS).
Discussion
[0192] The zwitterionic nature of PS A1 exploits a natural CD4+ immune response, which assists in a glycan-specific antibody development, which is a concept only seen in bacterial polysaccharides based mAbs. In order to confirm this, this structure was adapated to accommodate the Tn antigen. The in antigen makes the PS A1 construct more immunogenic due to the interactions with C-type lectin receptor (MGL2), which facilitates increased antigen uptake in mice. The reason for using an entirely carbohydrate immunogen (Tn-PS A1) was to focus the antibody binding on glycosides in order to generate antibodies that have no affinity towards peptides/lipids. This is a challenging endeavor because antibody binding of glycans results in low Kd values and yet the IgM antibodies compensate by having multiple binding sites, leading to higher avidity. This is a reason why IgM antibodies can be favored over IgGs when considering carbohydrates as the antigen. Targeting glycosides is essentially one of the most important features because Tn can be associated with different peptides and can ultimately effect antibody recognition. Therefore, producing a mAb that is selective for glycosides provides specificity for the Tn antigen by not having cross reactivity with peptides/lipids/proteins that are naturally occurring.
[0193] A particular concern when using an entirely carbohydrate construct is antibody cross reactivity with normally expressed carbohydrates. To examine the binding properties of the Kt-IgM-8, a small panel of in related antigens ?/?-Tn-Thr-BSA, ?-Tn-BSA, ?-TF-BSA, Blood Group A, and Blood Group B were screened on ELISA (
[0194] IgM antibodies have proven to be effective in treating carcinomas. From the data in this Example, it is shown that IgM antibodies, both monoclonal and polyclonal, may be more effective in killing tumor cells than IgG due to the potent CDC activity. In
[0195] The IgM antibody has been overlooked for immunotherapies due to the superior nature of high affinity IgG's binding peptide/protein moieties. However, the IgG antibodies may not always be the preferred choice when it relates to glycosides, as IgM antibodies have demonstrated potent CDC responses to tumor cells. Kt-IgM-8 represents a biological tool that demonstrates in vitro complement activity and in vivo reduction of tumor growth. Additionally, only a handful of other Tn specific antibodies have been used for in vivo data, (MLS 128, GOD3-2C4, and KM3413), all of which are mIgGs. Kt-IgM-8 is likely one of the first IgM antibodies specific towards the Tn-antigen to be used in passive immunotherapies for cancer that utilizes CDC as the main source of cytotoxicity.
[0196] Experimental
[0197] Immunizations
[0198] C57BL/6 mice immunizations of Tn-PS A1, PS A1, and PBS were conducted using known methods.
[0199] Hybridoma Fusion Protocol
[0200] Mice spleens were obtained on day 60 in DMEM media. The spleenocytes were obtained by gently homogenizing the spleens. Cells were washed with serum free DMEM by centrifuging at 1000 rpm for 10 minutes and resuspending the final pellet in 30 ml of serum free DMEM. Simultaneously, Sp2/0-Ag14 (ATCC CRL-1581) were cultured and washed with serum free DMEM serum free by centrifuging at 1000 rpm for 10 minutes and resuspending in 30 ml in serum free DMEM.
[0201] 2?10.sup.7 myeloma cells and 1?10.sup.8 viable spleenocytes were added in a 50 mL centrifuge tube and were washed with serum free DMEM three times. Clona Cell-HYPEG (1 ml) was added to the tube without stirring. Cells were stirred for 1 minute by gently shaking the tube. 4 mL of serum free DMEM media was added to the fusion mixture and stirred for 4 minutes. 10 mL of serum free DMEM was slowly added and incubated at 37? C. for 15 minutes. 30 mL of 10% FCS-DMEM was added and washed with 40 mL of DMEM and the supernatant was discarded. 10 mL of 20% FCS-DMEM was used to resuspend the pellet and was transferred to a T-175 flask containing 20 mL of 20-DMEM and was incubated for 24 hr in 5% CO.sub.2. Cells were centrifuged and resuspended with 10 mL of 20-DMEM and added to 90 mL of semi-solid methyl cellulose media (ClonaCell Flex). The bottle was mixed by inverting and was aliquoted in 10 petri dishes and placed in a 5% CO.sub.2 incubator for 10-14 days. Cell colonies were picked (5 ?L) and placed in 96 well plates containing 10-DMEM in 200 ?L. The cell supernatants were screened by ELISA with plates coated with Tn-BSA when sufficient antibody was produced.
[0202] IgM Purification
[0203] IgM antibodies were purified. Cell culture supernatant was dialyzed against distilled water causing a precipitation of the IgM antibody after 1 day at 4? C. The resulting precipitate was centrifuged to remove water. The precipitate was dissolved in 1?PBS buffer and was followed by ammonium sulfate precipitation by adding 17.1 g of ammonium sulfate forming a precipitate, which was concentrated and purified further with size exclusion chromatography (sephacryl S-300). Fractions were individually checked and monitored at 280 nm. The resulting fractions containing IgM antibody were pooled, sterile filtered and stored at 4? C.
[0204] ELISA
[0205] IgM Purification
[0206] Purification of IgM antibodies followed a known protocol. In short, cell culture supernatant was dialyzed using distilled water causing a precipitation of the IgM antibody after 1 day at 4? C. The resulting precipitate was centrifuged to remove water. The precipitate was dissolved in 1?PBS buffer and was followed by ammonium sulfate precipitation by adding 17.1 g of ammonium sulfate, which was concentrated and purified further with size exclusion chromatography (Sephacryl? S-300). Fractions were individually checked and monitored at 280 nm. The resulting fractions containing IgM antibody were pooled, sterile filtered and stored at 4? C.
[0207] Complement Dependent Cytotoxicity
[0208] MCF-7 cells (2?10.sup.4) were adhered to a 96-well plate overnight. Cr was exposed to the cells for 4 hrs and washed with cell media. 100 ?L of KT-IgM-8, anti-Tn-PS A1 whole sera, purified anti-Tn-PS A1 IgG, anti-PS A1, and anti-PBS sera was added to each well and was done in triplicate. The antibodies were incubated for 1 h at 37? C. in 5% CO.sub.2 incubator, and the cells were washed and 10% complement was added to each well. Cr release was measured after 18 h by liquid scintillation to quantify Cr release and % cytotoxicity was calculated by using the following formula: (experimental?spontaneous)/(max?spontaneous)?100. Spontaneous wells only received media.
[0209] Flow Cytometry
[0210] mAb was diluted to 30 ug/mL and incubated with the cell lines (MCF-7 and HCT-116, 2.0?10.sup.6) for 30 min on ice and washed three times. Cells were labeled with either Alexa Fluor? 647 and acquired using BD FACSCalibur? and analyzed using FlowJo software.
[0211] SCID Mice Tumor Implantation and Adoptive Transfer of Immunotherapeutic
[0212] SHO? mice (Crl:SHO-PrKdc.sup.ScidHr.sup.hr) (Charles River), female/4 weeks old, were surgically implanted with 17?-estradiol 60 day release pellet (0.72 mg/pellet) (Innovative Research of America) behind the shoulders. Two days later, 5?10.sup.5 MCF-7 (tumors cells) with mixed with Geltrex? Matrix (1:1) at 4? C. and subcutaneously injected into mice on their flanks (2?per mouse). The mice tumors were measured three times a week using micro-calipers and the equation (Tumor Volume mm.sup.3=(Length?width.sup.2)/2). Four days after tumor implantation, Tn-PS A1 whole sera, purified pIgGs from Tn-PS A1 sera, PBS, and Kt-IgM-8 were I.P. injected once every week until the humane endpoint was reached. Data was analyzed using GraphPad Prism, and Student t-tests were performed for determining statistical significance.
[0213] The SCID model allows for xenographed human tumors into mice, and the use of the MCF-7 breast carcinoma cell line represents treatment potential.
[0214] These results are excellent for breast oncology because the MCF-7 cells had reduction in size. One reason why the Tn-PS A1 and -sera had a profound reduction in tumors compared to Kt-IgM-8 was the order of magnitude difference in protein concentration. However, the Tn-PS A1 purified anti-IgG did not induce sufficient ADCC, as demonstrated by the growth of the tumors compared to PBS
[0215] Kt-IgM-8 Heavy and Light Chain Sequencing
TABLE-US-00005 LightChain: (SEQIDNO:1) CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGA GAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGCACT GGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACA TCCAAACTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGG GACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCA CTTATTACTGCCAGCAGTGGAGTAGTAACCCGCTCACGTTCGGTGCTGGG ACCAAGCTGGAGCTGAAA. HeavyChain: (SEQIDNO:2) CAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGAC AGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACCTATGGAA TGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGG ATAAACACCTACTCTGGAGTGCCAACATATGCTGATGACTTCAAGGGACG GTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCA ACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAAGACATTAC TACGGAGGGGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA.
[0216] Kt-IgM-8 Glycopeptide Array
[0217] Antigen arrays provide a high-throughput platform for analyzing binding to numerous antigens. The glycan binding specificity of Kt-IgM-8 was analyzed with a glycopeptide array, at antibody amounts of 2 ?g and 20 ?g. The results are depicted graphically in
Example 5TF-PS B
[0218] PS B (52) was oxidized using the Malaprade reaction with 10 mM sodium periodate in NaOAc buffer (pH 5) to reveal aldehydes that specifically reat with aminooxy-TF antigen (53) for conjugation to produce TF-PS B (54) (
[0219] In order to determine the effectiveness of the TF-PS B construct (54), Jax C57BL/6J mice were immunized, blood sera were collected, and anti-TF immune responses were examined Three different immunogens were administered to the mice: 1) PS B (52), 2) TF-PS B (54), and 3) TF-BSA (55) (
[0220] The ELISA results, as noted in
[0221] To validate that antibodies generated from TF-PS B construct, with or without TMG, could recognize the TF antigen alone, sera from PS B TMG immunizations (
[0222] Since polyclonal antibodies from anti-TF-PS B (TMG) immunized mice (
[0223] In this case, when the anti-IgG isotypes from TF-BSA immunization were specifically examined, an observable larger titer response was generated towards TF-PS B (with TiterMax? Gold) (
[0224] Based on the ELISA results, which concluded that a TF-PS B construct could elicit selective TF binding polyclonal antibodies generated in mice, the binding preference of those antibodies towards a human MCF-7 (breast) tumor cell line was examined. It is known that MCF-7 cells express the TF antigen. To achieve this aim, a fluorescent binding technique was employed, and flow cytometry was used to determine binding efficiency. The principles of FACS (Fluorescent Activated Cell Sorting) are similar to the ELISA technique but primary antibodies and secondary fluorescently labeled cells can be sorted based on fluorescent intensity. The TF-PS B (with TMG) anti-serum (blue line) produced higher fluorescent IgM/IgG binding events to MCF-7 (
[0225] Antibody dependent cellular cytotoxicity (ADCC) is an in vivo and in vitro technique that can be used to determine the potency of antibody responses (
[0226] Conclusions
[0227] Zwitterionic polysaccharides can be a viable alternative to protein carriers in cancer vaccine development. Entirely carbohydrate based immune constructs for specific anti-carbohydrate immune responses, as opposed to heterogeneous protein constructs consisting of peptide(s)/protein(s) and sugars combined, are useful. One key feature of this approach is that the zwitterionic charges on polysaccharides 51 and 52, which are essential components for immune activation, are most likely due to the electrostatic similarities of peptides and specific uptake through C-type lectins. Therefore, using ZPSs as immunogens in cancer vaccine development can be supported through the innate and adaptive immune responses for ZPSs.
[0228] The immune response(s) generated from TF-PS B resulted in antibodies specific for the TF disaccharide, void of amino acids, chemical linkers or proteins. The majority of antibody isotypes obtained were IgM; their pentavalent nature allows for increased binding due to higher avidity towards glycans which can result in complement mediated killing. The generation of IgG1 and IgG2b isotypes indicates the activation of Th2 and Th1 mediated immunity, which is useful in antibody directed cellular cytotoxicity. This contrasts the immune response generated by TACA-PS A1, which induces a Th1/Th17 immunity. However, IgM/IgG antibodies generated by TF-PS B showed greater fluorescent binding events in flow cytometry than anti-PS B immunoglobulins (
[0229] To determine the efficacy of the ZPS-based tumor immune responses, data was compared with a TF-BSA protein conjugate (
[0230] Experimental
[0231] Culturing B. fragilis and Purification of PS B (52)
[0232] 20 L of B. fragilis was harvested after 48 h of growth and centrifuged at 4,000?g for 20 min at 4? C. in 500 mL centrifuge bottles. Cell supernatant was removed and the pellet was re-suspended in 500 mL of 0.15 M NaCl. Liquefied phenol (EMD Millipore) (500 mL) was added to the re-suspended cell pellet and stirred at 70? C. for 30 min. The aqueous layer was removed from the liquefied phenol using a separatory funnel. The aqueous layer was back extracted three times with diethyl ether and dialyzed with SnakeSkin? dialysis tubing (10K MWCO). Crude bacterial lysate was treated with RNase (Sigma) and DNase (Sigma) in 0.1 M sodium acetate buffer (pH 4.5), followed by Pronase? (Roche) treatment (pH 7.0) and finally dialysis. The crude mixture was purified by size exclusion chromatography (Sephacryl S-300 HR) with elution buffer (0.5% sodium deoxycholate, 50 mM glycine, and 10 mM EDTA (pH 9.8)). Fractions were collected and analyzed using UV-spectroscopy; fractions were pooled if there was no absorbance at 260 and 280 nm. The elution buffer was removed by dialysis and crude samples were analyzed by .sup.1H NMR. The final step in purification required anion-exchange chromatography (DEAE-Sepharose) to separate the zwitterionic polysaccharides using Tris-HCl (pH 7.3) and a salt gradient from 0 M-2 M NaCl for elution of the polysaccharides was used. Purity of PS B was assessed by .sup.1H and .sup.31P NMR.
[0233] Synthesis of Anomeric Aminooxy TF (53)
[0234] Synthesis of TF-ONH.sub.2 was conducted using known methods.
[0235] Synthesis of TF-PS B (54)
[0236] Random oxidization of 1.0 mg of PS B using 10 mM of sodium periodate in 0.5 mL 0.1 M sodium acetate buffer pH 5.0 was accomplished by allowing the reaction to stir for 90 min in the dark, followed by quenching with 1 M KCl. TF-ONH.sub.2 (53) 2.0 mg was then added to the solution of oxidized PS B and the reaction was allowed to stir overnight. TF-PS B was dialyzed and lyophilized. Conjugation was observed by oxime formation (7.4-8.0 ppm) using H.sup.1 NMR (see below for spectral data).
[0237] TF-BSA (55)
[0238] Aminooxy TF (53) 5.0 mg was reacted with mercaptoaldehyde (56) for 18 h in sodium acetate buffer (pH 5.5) at room temperature and purified using Sephadex G-10 and deionized/distilled H.sub.2O as the eluent. Fractions containing the TF-linker were lyophilized. 2.5 mg of (7) was deacetylated using Zemplen's method with NaOMe in methanol followed by base neutralization with DOWEX 50W?8-100 ion exchange resin. The solution was then filtered and concentrated under reduced pressure.
[0239] NMR and MS Analysis for Compound (57)
[0240] .sup.1H NMR (600 MHz, D.sub.2O): (E and Z isomers): ? 7.4 (dd, J.sub.1=15.1 Hz, J.sub.2=8.6 Hz, 1H.sub.E), 5.3 (dd, J.sub.1=13.9 Hz, J.sub.2=4.0 Hz), 4.4-4.3 (m, 4H), 4.2 (dd, J.sub.1=12 Hz, J.sub.2=2.3 Hz, 1H), 4.0 (d, J.sub.1=5.7 Hz, 1H), 3.9-3.8 (m, 2H), 3.8 (d, J=3.1 Hz, 2H), 3.6-3.5 (m, 9H), 3.5-3.5 (m, 4H), 3.4-3.4 (m, 2H), 3.1 (q, 3H), 3.0-2.9 (m, 3H), 2.3-2.2 (m, 4H), 1.9 (d, 7H), 1.5-1.4 (m, 5H), 1.2 (t, 6H), 0.8-0.8 (m, 6H). .sup.13C NMR (150 MHz, D.sub.2O): (E and Z isomers): ? 200.9, 174.6, 158.3, 104.7, 98.6, 76.9, 75.0, 72.5, 71.0, 68.6, 60.8, 52.1, 47.6, 46.6, 42.4, 42.0, 30.8, 30.0, 24.7, 21.9, 10.9. LRMS:ESI [M+(Na).sup.+] calcd for 563.19 found 563.1.
[0241] Analysis of Compound (55)
[0242] 2.0 mg of BSA-maleimide (Pierce Biotechnology) was dissolved in 0.3 mL of reaction buffer (1?PBS buffer with 0.1 M EDTA (pH 7.2). Compound 58 was then dissolved in 0.2 mL of reaction buffer and added to a solution containing BSA-maleimide. The reaction proceeded for 24 hr at 4? C. and was extensively dialyzed at 4? C. Conjugation was analyzed by MALDI-TOF (M/Z 90080.640). Mass loading was calculated using the following equation: (MW of TF-BSA?MW of BSA Mal)/(MW of TF-linker). It was determined that there were 34 molecules of TF-linker conjugated per BSA-maleimide.
[0243] Immunizations
[0244] Jax C57BL/6 male mice, 6 weeks, were obtained from Jackson Laboratories and maintained by the Department of Laboratory Animal Resources (DLAR). All animal protocols were performed in compliance with the relevant laws and institutional guidelines and have been approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Toledo. Mice were immunized by intraperitoneal injections (i.p.) with 10 ?g of TF-PS B, PS B and TF-BSA with and without TiterMax? Gold. Injections were performed on Day 0, 7, 14, and 28. Blood was collected and pooled in a BD Vacutainer? SST? on Day 32 using a cardiac puncture technique to draw blood. Blood was allowed to clot and serum was separated in BD Vacutainer? SST? using a manufacture protocol.
[0245] PS B poly-L-lysine (PS B-PLL) and TF-PS B poly-L-lysine (TF-PSB-PLL)
[0246] 100 ?g of PS B or TF-PS B was added to a test tube containing 0.5 mL of 0.01 M NaOH (0.001% phenolphthalein indicator) and 0.5 mg of cyanuric chloride. The mixture was vortexed for 1 min and 0.1 mL of 0.1% poly-L-lysine (PLL) was then added to the mixture, vortexed for 1 min and allowed to react for 3 h at 4? C. on a shaker. The conjugate was diluted to 30 mL with 0.1 M carbonate buffer (pH 9.2).
[0247] ELISA
[0248] Immulon? 4 HBX 96 well plates (coated with either PS B/TF-PS B-PLL or TF-BSA) and maleic anhydride activated 96 well plates (coated with TF-ONH.sub.2) (Thermo Scientific) were used to determine titers from immunized PS B, TF-PS B, and TF-BSA mice. The Immulon? 4 HBX plates were coated with TF-BSA or TF-PSB/or PS B-PLL (3 ?g/mL in 0.1 M carbonate buffer (pH 9.2). Maleic anhydride plates were coated with TF-ONH.sub.2 (3) as per manufacture instructions. Plates were left at 37? C. for 1 h with shaking and then continued overnight at 4? C. The plates were then washed three times with washing buffer (1?TBS, 0.05% Tween 20, pH 7.3) and blocked with blocking buffer (2% BSA, 1?TBS, pH 7.3) and incubated for 1 h, followed by washing three more times with washing buffer. Anti-sera were initially diluted 1:300 for total antibody titers and 1:100 for IgG isotypes, then serially diluted in half-log.sub.10 dilutions and incubated for 2 hr at 37? C. followed by washing three times with washing buffer Alkaline phosphatase secondary antibodies anti-(kappa, IgG) diluted (1:2000) and (IgM, IgG1, IgG2a, IgG2b, and IgG3) were purchased from (Southern Biotech) diluted (1:1000) and incubated for 1 h, followed by washing three times with washing buffer. PNPP tablets (Pierce) were dissolved in diethanolamine substrate buffer (pH 9.8) and then 100 ?L was added to each well for 30 min for sufficient color to develop to detect secondary antibodies. The reaction was quenched with 2 M NaOH. Optical density measurements were obtained using a UV plate reader (Bio-Tek PowerWave HT) and the 96 well plates were read at 405 nm using Gen5 2.0 plate reading software. All assays were performed in triplicate. Titers were determined by regression analysis with half-log.sub.10 dilutions plotted against absorbance. The titer cutoff value was set at 0.2 for titer determination. Statistically analysis from ELISAs for experimental groups were compared with the controls using paired t test using GraphPad Prism 6.
[0249] Flow Cytometry
[0250] MCF-7 and HCT-116 cells lines were provided by (Dr. Frederick Valeriote, Henry Ford Health Systems). Anti-sera were diluted to 1:200 with FACS buffer (1?PBS, 2% FBS, and 0.001% azide) and incubated with the cell lines (1?10.sup.6 cells) for 30 min on ice. Cells were washed with FACS buffer three times and incubated with secondary antibodies using either AlexaFluor? 488/647 and washed three times. Cells were analyzed by flow cytometry using BD FACSCalibur? and data analysis obtained using FlowJo software.
[0251] Synthesis of STn-PS B (59)
[0252] Random oxidization of 1.0 mg of PS B using 10 mM of sodium periodate in 0.5 mL 0.1 M sodium acetate buffer pH 5.0 was accomplished by allowing the reaction to stir for 90 min in the dark, followed by quenching with 1 M KCl. 2.0 mg of STn-ONH.sub.2 was then added to the solution of oxidized PS B and the reaction was allowed to stir overnight. TF-PS B was dialyzed and lyophilized. Conjugation was observed by oxime formation (7.4-8.0 ppm) using H.sup.1 NMR (see below for spectral data).
[0253] Periodate-Rescorcinol Assay for Sialic Acid
[0254] A linear gradient of sialic acid, N-acetyl galactose, and galactose amine was generated from 40, 35, 30, 25, 20, 15, 10, 7.5, 5, 2.5, 1, and 0.5 ?g. STn-PS B (59) and PS B (52) were added in triplicate in separate wells at 50 ?g per well. 40 ?L was placed in triplicate for each concentration in a 96 well plate. 10 ?L of 5 mM NaIO.sub.4 was placed in each well and incubated for 35 min at 4? C. making a final concentration of 1 mM. 100 ?L of rescorinol solution (0.6 g of resorcinol in 100 mL of 17% HCl solution and 0.0025 mM of CuSO.sub.4) was added to the well-plate and incubated for 60 min at 90? C. The unknowns were determined from the sialic acid concentration at 580 nM.
[0255] Percent Loading of STn-PS B
[0256] Sialic acid by weight was determined from the periodate rescorinol assay and STn percent loading was calculated by the following equation:
(Amount of sialic acid (?g) from assay)/(weight of glyconjugate)?(molecular weight STn/molecular weight of sialic acid)?100%.
[0257] Alexa Fluor? 488 Percent Loading
[0258] 100 ?g of oxidized PS B was reacted with 100 ?g of Alex Fluor? 488-hydrazide (Molecular Probes) for 24 h in PBS buffer pH 7.4 followed by dialysis. The solution was lyophilized and re-dissolved with 100 ?l of PBS. Optical density measurements were obtained using a UV plate reader (Bio-Tek PowerWave HT) and then the 96 well plates were read at 495 nm using Gen5 2.0 plate reading software. The percent loading of Alexa Fluor? 488 was determined using the manufacturer protocol(s) (Invitrogen Alex Fluor? 488 Protein labeling Kit). The following equation was used: Moles of dye per mol of PS B=A.sub.494/(71000 cm.sup.?1M.sup.?1?PS B concentration).
Example 6Immunological Evaluation of Globo H-PS A1 Conjugates
[0259] Globo H is a unique ganglioside based hexasaccharide tumor associated carbohydrate antigen (TACA) and is anchored in tumor cells through a lipid ceramide. It is overexpressed in many tumor cells such as breast, ovarian, prostate, etc., and it was first identified on the MCF-7 cell line in 1984. Its hexasaccharide nature is unique and has recently been involved in clinical trials with Globo H conjugated to KLH or CRM 197, but to date no TACA based vaccine has been granted approval.
[0260] Globo H remains an important carbohydrate target not only because of the expression on breast cancers, but also its contribution to angiogenesis and expression on cancer stem cells (CSC), leading to tumor initiation and progression. Globo H has been shown to induce immunosuppression by shedding from the tumor and decreasing T and B cell populations by reducing Notch1 signaling. Therefore, targeting Globo H can be vital for the clearance of primary tumor cells and CSCs by halting tumor cell recurrence. Additionally, Globo H shares a common trisaccharide core (Gal?1-4Gal?1-4Glc) structure with GB3, which is also expressed on CSCs but not on normal stem cells. The mechanism for increased expression of gangliosides is facilitated by glycosyltransferases A4GALT (GB3) and FUT1/FUT2 for Globo H. Therefore, not only would an effective vaccine be able to act as an angiogenesis inhibitor but also as a potent mediator of cytotoxicity by ADCC and CDC of CSC. Increasing the immunogenicity of TACAs is a common theme to clinically validate these targets, but the use of adjuvants remains essential to augment immune responses.
[0261] CLRs are an important part of carbohydrate based immunity (especially with ZPS) by promoting targeted carbohydrate based immunogens. However, focusing on certain carbohydrate antigens can modulate the immune responses by promoting proinflammatory cytokines such as IL-6 and increased antigen uptake. These effects were noted when a unimolecular bivalent Tn-TF-PS A1 construct was able to increase the immune response towards the TF antigen, when compared to the monovalent TF-PS A1 alone. Conjugating Globo H to a ZSP can effectively produce a vaccine that has targeted function towards dendritic cells due to the multivalent binding effects.
[0262] Results and Discussion
[0263] PS A1 was oxidized using sodium periodate and three separate conjugates were semi-synthetically prepared through an oxime link. The formation of the oxime linkage provides greater hydrolytic stability than hydrazones, hydrazides, and imines due to the electronegativity of the oxygen compared to either nitrogen or carbon. This added stability is important in ensuring the TACA-ONH.sub.2 is tethered to PS A1 after being subjected to acidic lysosomes en route for presentation to T cells by MHC II. Globo H-PS A1 (GH-PS A1) and a unimolecular bivalent construct Tn-GH-PS A1 was injected into C57/BL6 mice and the immunological evaluation was assessed with and without Sigma Aldrich Adjuvant (SAS) or TiterMax Gold (TMG). SAS is a mixture including monophosphloryl lipid A (MPLA), a TLR 4 agonist, and synthetic trehalose dicorynomycolate (STDCM), which binds to C-type lectins, minicle, and dectin-2, which increases production of proinflammatory cytokines. TMG is a potent oil in water emulsion which provides slow release of antigens and its main component CRL-8300, is composed of conjugated copolymer of polyethylene oxide and polypropylene oxide.
[0264] When comparing both adjuvants while investigating the unimolecular bivalent construct Tn-GH-PS A1, an interesting phenomenon occurred. The Tn-GH-PS A1 with TMG had an increased anti-IgG titer of 15,700 compared to 9,700 from GH-PS A1 with TMG. This result indicates the presence of Tn alone can augment the selectivity and specificity of the anti-IgG immune response towards GH-BSA. However, when Tn-GH-PS A1 was administered with SAS, there was an enormous reduction of both anti-IgG and anti-IgM. Without wishing to be bound by theory, it is believed that simultaneous activation of CLRs (DC-SIGN and DCIR) reduces activation and presentation to T cells by APCs. Another interesting result that occurred through the immunological evaluation of GH-PS A1 constructs, was the higher generated immune response against GB3-BSA (
[0265] A particular concern of creating an immune response with a construct containing both fucose and N-acetyl galactosamine is there could be immense cross reactivity with blood group A and blood group B. Therefore, anti-serum from the GH-PS A1 based constructs were screened for binding to both of the blood groups in ELISA (
[0266] Similar results were observed with the TMG series binding with OVCAR-5 with a 95% positive (Tn-GH-PS A1 TMG) and 84% positive with (GH-PS A1 TMG) compared to the controls of PBS (5%) and PS A1 (4%). When examining the SAS series, as expected, the Tn-GH-PS A1 SAS showed the lowest anti-IgG binding with 71% binding to MCF-7 and 62% OVCAR-5. However, GH-PS A1 SAS showed the highest binding to MCF-7 cell line with 94% positive fluorescent anti-IgG binding events and 81% binding to OVCAR-5.
[0267] For determining the LDH assay (
[0268] The combined effects from having multiple TACAs on a unimolecular bivalent construct lead to greater binding to tumor cells. The Globo H-PS A1 SAS also had significant binding to MCF-7 and OVCAR-5 with 63% and 49%, respectively. Collectively, both the Tn-GH-PS A1 TMG and GH-PS A1 demonstrated excellent cytotoxicity between cell lines.
[0269] Conclusions
[0270] The synthesis of Globo H-PS A1 and Tn-GH-PS A1 and subsequent immunizations have generated high immune responses towards Globo H which resulted in tumor cell binding and high cytotoxicity of both MCF-7 and OVCAR-5. The advantages of using the ZPS platform are related to the entirely carbohydrate vaccine construct with entirely carbohydrate specificity and targeted uptake by dendritic cells through CLRs.
[0271] The results indicated the use of adjuvants play a major effect in the immunogenicity in both Globo H-PS A1 and Tn-Globo H-PS A1. The use of SAS had a significant impact on the anti-IgG response from GH-PS A1 with a titer of 22,000 compared to 9,700 from GH-PS A1. This indicates the proinflammatory cytokines generated from MPLA and STDCM assist in producing a larger immunological titer. However, the same proinflammatory environment from SAS did not produce the same desired results with Tn-GH-PS A1. In fact, using SAS with Tn-GH-PS A1 dampened the IgG antibody response nearly tenfold in comparison to the response generated from Tn-GH-PS A1 TMG. The difference in binding may be contributed to the over stimulation of CLRs with the adjuvant of SAS leading to less effective antibody binding responses. An interesting phenomena has been demonstrated when a ligand interacted simultaneously with both DC-SIGN and dendritic cell immunoreceptor (DCIR), showing reduced activation and presentation to T cells. It can be concluded that multiple interactions from C-type lectins and multiple interactions of TLRs can ultimately affect T cell presentation and subsequent immune response.
[0272] Analysis through flow cytometry of the GH-based PS A1 constructs revealed high recognition of both tumor cell lines MCF-7 and OVCAR-5 due to the cell lines expression of both Tn and Globo H.
[0273] Experimental
[0274] GH-PS A1 (91a)
[0275] 1.0 mg of PS A1 was oxidized using 1 mM sodium periodate in sodium acetate buffer pH 5.0 for 90 min in the dark. Excess sodium periodate was quenched with KCl and desalted using centrifugal filter (10 kDa MWCO). 1.3 mg of Globo H-ONH.sub.2 reacted with oxidized PS A1 for 16 h. The resulting reaction was desalted using centrifugal filter (10 kDa MWCO). .sup.1H NMR was used to determine oxime formation.
[0276] Bivalent Tn-GH-PS A1 (91b)
[0277] 1.0 mg of PS A1 was oxidized using conditions as described above. A1:1 molar ratio of 1.1 mg of Globo H-ONH.sub.2 and 0.25 mg of Tn-ONH.sub.2 was reacted with freshly oxidized PS A1. Excess salts and by products were removed by centrifugal filtration. .sup.1H NMR was used to determine two separate oxime formation.
[0278] GB3-PS A1 (91c)
[0279] 1.0 mg of PS A1 was oxidized using conditions as described above. 1.2 mg of GB3-ONH.sub.2 was reacted with 1.0 mg of oxidized PS A1 for 16 h. The reaction was dialyzed and lyophilized. .sup.1H NMR was used to determine oxime formation.
[0280] Immunizations
[0281] Individual GH, Tn-GH, or GB3-PS A1 constructs (20 ?g) were mixed in a 1:1 ratio of 50 uL of TiterMax? Gold and injected into 7 wk old C57BL/6 mice (Jackson Laboratory) (each construct was administered individuallynot mixed). Mice groups (n=5) were immunized by intraperitoneal injections (i.p.) on day 0, 14, 28, 42. Blood sera were obtained using a cardiac puncture technique on day 52.
[0282] Vaccinations with Sigma Adjuvant System
[0283] Individual GH and Tn-GH-PS A1 constructs (20 ?g) were mixed in a 1:1 ratio of 100 ?L of Sigma Adjuvant System (Sigma-Aldrich) and injected into 7 wk old C57BL/6 mice (Jackson Laboratory) (each construct was administered individually not mixed). Mice groups (n=5) were immunized by intraperitoneal injections (i.p.) on day 0, 21, 42, per manufactures instructions. Blood sera were obtained using a cardiac puncture technique on day 52.
[0284] Enzyme Linked Immunosorbent Assay (ELISA)
[0285] Either GH-BSA, GB3-BSA, blood group A/or blood group B was coated on Immulon? Microtiter? 4 HBX 96 well plates using 3 ?g/mL in carbonate buffer (pH 9.2) and then the plates were incubated for 18 h at 4? C. ELISA procedures described above were followed.
[0286] Synthesis of GH-Thio Linker
[0287] 3.0 mg of Globo H-ONH.sub.2 was reacted with 1.0 mg of 3-oxopropyl ethanethioate (mercaptoaldehyde) for 24 h. The reaction was purified by Sephadex G-10 and deionized/distilled H.sub.2O as the eluent. Fractions containing the GH linker were lyophilized. .sup.1H NMR (D.sub.2O, 600 MHz): ?=7.56 (t, J=6.2 Hz, 1H), 5.34 (d, J=3.7 Hz, 1H), 5.12 (d, J=4.4 Hz, 1H), 4.75-4.83 (m, 8H), 4.74 (br. s., 7H), 4.64-4.70 (m, 11H), 4.49-4.53 (m, 1H), 4.40-4.46 (m, 3H), 4.27-4.31 (m, 1H), 4.10-4.15 (m, 3H), 3.98-4.01 (m, 1H), 3.90-3.93 (m, 2H), 3.77-3.89 (m, 9H), 3.71-3.76 (m, 7H), 3.51-3.70 (m, 26H), 3.49-3.50 (m, 1H), 3.48 (t, J=2.0 Hz, 1H), 2.95-3.03 (m, 2H), 2.40-2.50 (m, 1H), 2.24-2.29 (m, 3H), 1.91-1.95 (m, 4H), 1.07-1.13 ppm (m, 4H). .sup.13C NMR (D.sub.2O, 151 MHz): ?=201.1, 201.0, 174.3, 104.0, 103.2, 102.0, 100.4, 99.2, 91.5, 78.2, 77.1, 76.3, 76.1, 75.4, 75.0, 74.6, 73.5, 72.1, 71.8, 71.7, 71.1, 70.8, 70.2, 70.1, 69.4, 69.2, 69.0, 68.4, 68.0, 67.8, 66.7, 60.9, 60.3, 59.4, 51.6, 30.0, 29.9, 29.2, 25.8, 25.4, 25.2, 22.2, 18.5, 15.3 ppm.
[0288] Globo H-BSA
[0289] 2.0 mg of Globo H-thiol linker was deacetylated by a solution of concentrated K.sub.2CO.sub.3 for 1.5 h. Zemplen conditions were not used because Globo H is insoluble in MeOH. Globo H-thiol linker and reacted with freshly prepared BSA-Malemide (procedure described previously) in PBS buffer with 1 mM EDTA pH 7.2. After 16 h at 4 C, the reaction was dialyzed 10,000 MWCO. Conjugation was confirmed with MALDI-TOF (92249.938) for a total conjugation of 15.5%.
[0290] GB3 Thiol Linker
[0291] 2.0 mg of GB3-ONH.sub.2 reacted with 1.5 mg of mercaptoaldehyde for 18 h in sodium acetate buffer (pH 5.5) at room temperature and purified using Sephadex G-10 and deionized/distilled H.sub.2O as the eluent. Fractions containing the ?GB3 linker were lyophilized. 2.5 mg of (97) was deacetylated using Zemplen's method with NaOMe in methanol followed by base neutralization with DOWEX 50W?8-100 ion exchange resin. The solution was then filtered and concentrated under reduced pressure. .sup.1H NMR (D.sub.2O, 600 MHz): ?=7.52 (dd, J=8.5, 3.7 Hz, 1H), 5.46 (t, J=4.2 Hz, 1H), 4.96 (d, J=3.4 Hz, 1H), 4.54 (dd, J=7.7, 6.5 Hz, 1H), 4.37 (t, J=6.2 Hz, 1H), 4.03-4.07 (m, 3H), 3.90-3.97 (m, 4H), 3.82-3.90 (m, 6H), 3.80 (br. s., 2H), 3.69-3.78 (m, 9H), 3.57-3.62 (m, 1H), 2.97-3.15 (m, 1H), 2.42 (td, J=9.2, 4.6 Hz, 1H), 2.38 (d, J=3.2 Hz, 3H), 1.51-1.68 (m, 1H), 0.90 ppm (dt, J=15.0, 7.5 Hz, 4H). .sup.13C NMR (D.sub.2O, 151 MHz): ?=200.9, 200.8, 181.5, 158.6, 103.1, 100.3, 99.2, 92.4, 78.1, 78.0, 77.3, 77.3, 75.4, 72.1, 71.6, 70.9, 70.8, 70.8, 70.3, 70.2, 69.1, 68.9, 68.5, 60.4, 60.3, 59.4, 42.2, 42.1, 30.8, 29.9, 29.9, 24.8, 24.6, 23.2, 10.8, 10.7 ppm.
[0292] Flow Cytometry
[0293] MCF-7 and OVCAR-5 was cultured in 10% FBS RPMI 1640. 1.0?10.sup.6 cells of each cell line was incubated at 4 C for 1 h in the dark with 1:50 dilution of the following separate anti-serums (PBS control, PS A1, Globo H-PS A1, Tn-Globo H-PS A1). The cells were washed three times in FACs buffer (2% FBS in PBS, 0.001% sodium azide) by centrifuging at 1000 rpm. 100 ?L Anti-IgG Alexa Fluor 488 (1:50 dilution) was added to the cells and incubated at 4 C in the dark for 1 h followed by three washes with FACS staining buffer. The cells were fixed with freshly prepared 1% paraformaldehyde and obtained using BD Biosciences FACsCaliber by the University of Toledo Core flow cytometry facility. FlowJo FACs analysis was used to analyze the data.
[0294] Certain embodiments of the compositions and methods disclosed herein are defined in the above examples. It should be understood that these examples, while indicating particular embodiments of the invention, are given by way of illustration only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications to adapt the compositions and methods described herein to various usages and conditions. Various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the disclosure. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the disclosure without departing from the essential scope thereof.