Saccharomyces Uvarum Strain Conductive To Low Production Of Higher Alcohols And Strong Degradation Of Malic Acid And Application Thereof

20230212488 · 2023-07-06

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid. After the wine using Saccharomyces uvarum recombinant strain of the present invention is fermented for 5 days, with other fermentation properties unaffected, the content of isobutanol, isoamyl alcohol and phenethyl alcohol in the wine is 28.18 mg/L, 171.76 mg/L and 13.60 mg/L respectively, which is reduced by 20.28%, 14.77% and 11.26% compared with the starting strain, the total content of main higher alcohols (n-propanol, isobutanol, isoamyl alcohol and phenethyl alcohol) is reduced by 12.97%, and the content of malic acid is reduced to 1.13 g/L after fermentation, which greatly shortens the fermentation period, overcomes the influence of lactic acid bacteria fermentation in the ordinary fermentation process and unpleasant flavor caused by higher content of higher alcohols.

    Claims

    1. A Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid, wherein, heterologously expressed Schizosaccharomyces pombe mae1 gene and Lactococcus lactis m1eS gene are introduced into Saccharomyces uvarum CICC1465.

    2. The Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid according to claim 1, wherein, the mae1 gene has a nucleotide sequence as shown in SEQ ID NO: 1; and the m1eS gene has a nucleotide sequence as shown in SEQ ID NO: 2.

    3. The Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid according to claim 1, wherein, PGK1 gene is used as a promoter, and the promoter PGK1 gene has a nucleotide sequence as shown in SEQ ID NO: 4.

    4. The Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid according to claim 3, wherein, a KanMX gene is a selection marker, the mae1 gene and the m1eS gene are simultaneously integrated into Gal80 gene locus under the regulation of the promoter PGK1.

    5. The Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid according to claim 4, wherein, the KanMX gene has a nucleotide sequence as shown in SEQ ID NO: 5.

    6. A method for constructing a Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid, characterized by comprising the following steps: (1) construction of recombinant fragments {circle around (1)} ligating the promoter gene PGK1 to BamHI and SalI cleavage sites of a plasmid Yep352 to construct a plasmid Yep-P; {circle around (2)} integrating gene fragments of mae1 gene and m1eS gene separately into the plasmid Yep-P at an XhoI site of the gene PGK1 by homologous recombination to construct plasmids Yep-Pm1 and Yep-PS; {circle around (3)} ligating a PGKp-m1eS-PGKt gene fragment of the plasmid Yep-PS with the plasmid Yep-Pm1 through SmaI digestion to construct a plasmid Yep-Pm1S; {circle around (4)} integrating a gene fragment KanMX used as selection marker into an ApaI site of the plasmid Yep-Pm1 S by homologous recombination to construct a plasmid Yep-Pm1 SK; (2) construction of a recombinant strain heterologously expressing mae1 gene and m1eS gene {circle around (1)} using the plasmid Yep-Pm1SK as a template to amplify PGK1-mae1-PGK1-m1eS-KanMX gene containing Gal80 upstream homologous arm and downstream homologous arm genes by PCR; {circle around (2)} introducing a PCR product of the PGK1-mae1-PGK1-m1eS-KanMX gene into the Saccharomyces uvarum CICC1465 to obtain a recombinant strain WYm1S capable of simultaneously expressing mae1 and m1eS genes.

    7. An application of the Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid according to claim 1 in wine fermentation.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0028] FIG. 1 shows the construction process of the Yep-KPm1S plasmid;

    [0029] FIG. 2 shows a verification diagram of the plasmids Yep-Pm1, Yep-PS, Yep-Pm1S and Yep-KPm1S and recombinant strain WY-m1S;

    [0030] wherein M is a marker; lane 1 is the result of PCR amplification using Yep352 as a template and YP-F/YP-R as a primer; lane 2 is the PGK1 gene fragment amplified by PCR using Yep-P as a template and YP-F/YP-R as a primer; lane 3 is result of PCR amplification using Yep-P as a template and Ymae1-F/Ymae1-R as a primer; lane 4 is the mae1 gene fragment amplified by PCR using Yep-Pm1 as a template and Ymae1-F/Ymae1-R as a primer; lane 5 is the result of PCR amplification using Yep-P as a template and Ym1eS-F/Ym1eS-R as a primer; lane 6 is the m1eS gene fragment amplified by PCR using Yep-PS as a template and Ym1eS-F/Ym1eS-R as a primer; lane 7 is the result of PCR amplification using Yep-Pm1 as a template and SmaI-F/SmaI-R as a primer; lane 8 is the PGK1p-m1eS-PGK1t fragment amplified by PCR using Yep-Pm1S as a template and SmaI-F/SmaI-R as a primer; lane 9 is the result of PCR amplification using Yep-Pm1S as a template and YK-F/YK-R as a primer; lane 10 is the KanMX gene fragment amplified by PCR using Yep-KPmS as a template and YK-F/YK-R as a primer.

    [0031] FIG. 3a shows a verification diagram of the plasmids Yep-Pm1, Yep-PS, Yep-Pm1S, Yep-KPm1 S and the recombinant strain WY-m1 S, wherein M is a marker; 1 and 2 are verification fragments amplified by PCR using the DNA of the starting strain CICC1465 and the recombinant strain WYm1S respectively as a template and YA-F/YA-R as a primer.

    [0032] FIG. 3b shows the verification diagram of plasmids Yep-Pm1, Yep-PS, Yep-Pm1S, Yep-KPm1 S and recombinant strain WY-m1 S, wherein M is a marker; 1 and 2 are verification fragments amplified by PCR using the DNA of the starting strain CICC1465 and the recombinant strain WYm1S respectively as a template and YB-F/YB-R as a primer.

    DESCRIPTION OF THE EMBODIMENTS

    [0033] Saccharomyces uvarum is a non-Saccharomyces yeast with potential wine-making properties, and produces more aromatic substances than Saccharomyces cerevisiae. Constructing Saccharomyces uvarum industrial strains that simultaneously regulate malic acid and higher alcohols by using molecular breeding techniques is of great significance to shorten the wine fermentation period and improve the flavor quality of wine.

    [0034] Malic-lactic fermentation is generally carried out by seeding lactic acid bacteria in the fermentation broth after the alcohol fermentation is completed. It can decarboxylate L-malic acid producing sharp mouthfeel in the wine after alcohol fermentation into L-lactic acid producting soft taste, making the wine mellow and soft. However, after the alcohol fermentation is completed, the high alcoholic strength, low pH value and content of residual sugar of the wine body will inhibit the normal metabolism of lactic acid bacteria, which will hinder the fermentation. Also, the existence of bacteriophage in the wine body will also delay or inhibit malic-lactic fermentation, and fermentation of spoilage bacteria produces peculiar smell, leading to the occurrence of wine diseases and reducing the flavor quality of wine. Therefore, in the wine-making process, construction of yeast strains that simultaneously regulate higher alcohols and strongly degrade malic acid by industrial microbial breeding is an essential approach to solve the problems of high content of higher alcohols and prolonged wine fermentation period due to lactic acid bacteria fermentation.

    [0035] The present invention will be described below through specific embodiments. Unless otherwise specified, the technical means used in the present invention are all methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are defined only by the claims. For those skilled in the art, without departing from the essence and scope of the present invention, various changes or modifications to the material components and amounts in these embodiments also belong to the protection scope of the present invention.

    [0036] The Saccharomyces uvarum strain capable of low production of higher alcohols and strong degradation of malic acid was obtained by simultaneously integrating S. pombe mae1 gene and L. lactis m1eS gene into the Gal80 gene locus of the starting Saccharomyces uvarum strain under the regulation of promoter PGK1 and with using KanMX gene as the selection marker.

    [0037] Starting strain used in this embodiment was CICC1465. The Escherichia co/i DH5a was purchased from Takara, and S. pombe CICC1757 and L. lactis NZ9000 were purchased from the China Center of Industrial Culture Collection.

    [0038] The YPD medium was a universal complete medium, and the solid medium contained 2% imported agar powder.

    [0039] The mae1 gene had a Gene ID of 2543334 with a nucleotide sequence as shown in SEQ NO: 1 in the Sequencing Listing. The m1eS gene had a Gene ID of 1114530 with a nucleotide sequence as shown in SEQ NO: 2 in the Sequencing Listing. The Gal80 gene had a Gene ID of 854954 with a nucleotide sequence as shown in SEQ NO: 3 in the Sequencing Listing. The promoter PGK1 had a Gene ID of 850370 with a nucleotide sequence as shown in SEQ NO: 4 in the Sequencing Listing. The nucleotide sequence of KanMX gene was as shown in SEQ ID NO: 5 in the Sequencing Listing.

    [0040] Based on the yeast genome data in Genebank and the integrated plasmid sequence, the following primers were designed.

    TABLE-US-00001 TABLE 1 Primers used in this example Restriction SEQ Enzyme ID Primer Sequence (5′.fwdarw.3′) cutting site NO PGK-F CGCGGATCCTCTAACTGATCTATCCAAAACT BamHI  5 G PGK-R ACGCGTCGACTAACGAACGCAGAATTTTCG SalI  6 AG mael-F GAATTCCAGATCTCCTCGAGTTCATTTTCTC  7 TCTTGGC CAC mael-R TCTATCGCAGATCCCTCGAGCTTTTGTCATG  8 AAATCCC TCTTA mleS-F GAATTCCAGATCTCCTCGAGATGCGTGCAC  9 ATGAAAT TT mleS-R TCTATCGCAGATCCCTCGAGTTAGTACTCTG 10 GATACCA TTTAAGA PGK.sub.(SmaI)-F CGGCCCGGGTCTAACTGATCTATCCAAAA SmaI 11 PGK.sub.(SmaI)-R CGGCCCGGGTAACGAACGCAGAATTTTCG SmaI 12 K-F CCGCTAACAATACCTGGGCCCCAGCTGAAG 13 CTTCGT ACGC K-R GCACACGGTGTGGTGGGCCCGCATAGGCCA 14 CTAGTG GATCTG A-F GTGCCTCTATGATGGGTATG 15 A-R TACCGAGCTCGAATTCGTAATAAGAACGGG 16 AAACCA ACTATC B-F TCCACTAGTGGCCTATGCACCTTGATGGATG 17 CTCTGATA B-R ATTCCTGGAGAACCACCTAA 18 mS-F GATAGTTGGTTTCXXGTTCTTATTACGAATT 19 CGAGCTCGGTA mS-R TATCAGAGCATCCATCAAGGTGCATAGGCC 20 ACTAGTG GAT YP-F TCTAACTGATCTATCCAAAACTGA 21 YP-R TAACGAACGCAGAATTTTC 22 Ymael-F ATGGGCTTGTTAACGAAAGTTGCTA 23 Ymael-R TCAAGCATCTAAAACACAACCGTTG 24 YmlcS-F ATGTTGAGAACTCAAGCCGCCAG 25 YmlcS-R TTATTGGTTTTCTGGTCTCAACT 26 Smal-F TTCGAGCTCGGTACCCG 27 Smal-R AGTTAGAGGATCCCCGGG 28 YK-F CAGCTGAAGCTTCGTACGC 29 YK-R GCATAGGCCACTAGTGGATCTG 30 YA-F GATCATCGTAGTGCCCAATT 31 YA-R GTACCGAGCTCGAATTCGT 32 YB-F GGTTTGGTTGATGCGAGTG 33 YB-R CCATTCATCGTGTTGTTTTGG 34 Note: what is underlined is the restriction site.

    TABLE-US-00002 TABLE 2 The PCR amplification system used in this example Reaction system Loading amount ddH.sub.2O Made up to 50 μL 10 × PCR Buffer  5.0 μL dNTP (0.2 mmol/L)   4 μL Upstream and downstream each 1.5 μL primers (10 m moI/L) Template: Yeast’s total DNA  1.0 μL LA-Taq DNA polymerase 0.25 μL

    Embodiment 1

    [0041] Construction of Saccharomyces uvarum Overexpressing Mae1 and m1eS.

    [0042] (1) Construction of Recombinant Plasmid Yep-KPm1S

    [0043] The construction process of the recombinant plasmid Yep-Pm1 is shown in FIG. 1;

    [0044] Plasmid pPGK1 was used as a template, PGK-F (SEQ ID NO: 5) and PGK-R (SEQ ID NO: 6) were used as primers, the PGK1 gene fragment (SEQ ID NO: 4) was amplified by PCR, with the PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 56° C. for 1 min, 72° C. for 108 s, 30 cycles; 72° C. for 10 min. Plasmid Yep532 and PGK1 gene fragments were digested with restriction enzymes BamHI and SalI, and then ligated to construct a plasmid Yep-P. The genome of S. pombe CICC1757 strain was used as a template, mae1-F (SEQ ID NO:7) and mae1-R (SEQ ID NO: 8) were used as primers, PCR amplification was conducted to obtain mae1 fragment, (SEQ ID NO: 1), with the PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 56° C. for 1 min, 72° C. for 108 s, 30 cycles; 72° C. for 10 min. The fragment is ligated with Yep-P plasmid digested with XhoI through homologous recombination to construct plasmid Yep-Pm1. The genome of L. lactis NZ9000 strain was used as a template, and m1eS-F (SEQ ID NO: 9) and m1eS-R (SEQ ID NO: 10) were used as primers, PCR amplification was conducted to obtain fragment m1eS (SEQ ID NO: 2), with the PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 56° C. for 1 min, 72° C. for 108 s, 30 cycles; 72° C. 10 min. The resultant fragment and the Yep-P plasmid digested with XhoI were ligated by homologous recombination to construct a plasmid Yep-PS. The plasmid Yep-PS was used as a template, and PGK.sub.(smaI)-F (SEQ ID NO: 11) and PGK.sub.(smaI)-R (SEQ ID NO: 12) were used as primers, PCR amplification was conducted to obtain a fragment PGK1p-m1eS-PGK1t, with PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 56° C. for 1 min, 72° C. for 108 s, 30 cycles; 72° C. for 10 min. The fragment was ligated with Yep-Pm1 plasmid digested with SmaI through homologous recombination to construct a plasmid Yep-Pm1S. The plasmid pUG6 (nucleotide sequence as shown in SEQ ID NO:35) was used as a template, K-F (SEQ ID NO: 13) and K-R (SEQ ID NO: 14) were used as primers, the selection marker KanMX gene fragment was amplified by PCR, with the PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 57° C. for 1 min, 72° C. for 100 s, 30 cycles; 72° C. for 10 min. The plasmid Yep-Pm1S was digested with the restriction enzyme ApaI and then ligated with the KanMX gene fragment through homologous recombination to construct a plasmid Yep-KPm1S.

    [0045] The PCR verification results are shown in FIG. 2, wherein M is a marker; lane 1 is the result of PCR amplification with Yep352 as a template and YP-F (SEQ ID NO: 21) and YP-R (SEQ ID NO: 22) as primers. Lane 2 is the PCR-amplified PGK1 gene fragment with Yep-P as a template, and YP-F (SEQ ID NO: 21) and YP-R (SEQ ID NO: 22) as primers, and the plasmid Yep-P can be amplified by PCR to obtain PGK1 gene fragment, but Yep352 cannot, indicating that gene PGK1 has been successfully ligated with plasmid Yep352, and the plasmid Yep-P is successfully constructed; lane 3 is the result of PCR amplification with Yep-P as a template, and Ymae1-F (SEQ ID NO: 23) and Ymae1-R (SEQ ID NO: 24) as primers, lane 4 is the PCR-amplified mae1 genes fragment with Yep-Pm1 as a template, and Ymae1-F (SEQ ID NO: 23) and Ymae1-R (SEQ ID NO: 24) as primers, and plasmid Yep-Pm1 can be amplified by PCR to obtain the mae1 gene fragment, but Yep-P cannot, indicating that the gene mae1 has been successfully ligated with plasmid Yep-P, and the plasmid Yep-Pm1 is successfully constructed; lane 5 is the result of PCR amplification with Yep-P as a template, and Ym1eS-F (SEQ ID NO: 25) and Ym1eS-R (SEQ ID NO: 26) as primers, lane 6 is the PCR-amplified m1eS gene fragment with Yep-PS as a template, and Ym1eS-F (SEQ ID NO: 25) and Ym1eS-R (SEQ ID NO: 26) as primers. The plasmid Yep-PS can be amplified by PCR to obtain the m1eS gene fragment, but Yep-P cannot, indicating that the gene m1eS has been successfully ligated with plasmid Yep-P, and Yep-PS is successfully constructed; lane 7 is the result of PCR amplification with Yep-Pm1 as a template, and SmaI-F (SEQ ID NO: 27) and SmaI-R (SEQ ID NO: 28) as primers, lane 8 is the PCR-amplified fragment with Yep-Pm1S as a template, and SmaI-F (SEQ ID NO:27) and SmaI-R (SEQ ID NO:28) as primers, and the plasmid Yep-Pm1S can be amplified by PCR to obtain the PGKp-m1eS-PGKt gene fragment, but Yep-Pm1 cannot, indicating that the gene fragment PGKp-m1eS-PGKt has been successfully ligated with the plasmid Yep-Pm1, and the plasmid Yep-Pm1S is successfully constructed. Lane 9 is the result of PCR amplification with Yep-Pm1 S as a template, and YK-F (SEQ ID NO: 29) and YK-R (SEQ ID NO: 30) as primers, lane 10 is the PCR-amplified KanMX gene fragment with Yep-Pm1SK as a template, and YK-F (SEQ ID NO: 29) and YK-R (SEQ ID NO: 30) as primers, and plasmid Yep-Pm1SK can be amplified by PCR to obtain the KanMX gene fragment, but Yep-Pm1 S cannot, indicating that the gene fragment KanMX has been successfully ligated with plasmid Yep-Pm1S, and the plasmid Yep-Pm1SK is successfully constructed.

    [0046] (2) Construction of Recombinant Strain WYm1S

    [0047] The plasmid Yep-KPm1S was used as a template, mS-F (SEQ ID NO: 19) and mS-R (SEQ ID NO: 20) were used as primers, the gene fragment A-PGKp-mae1-PGKt-PGKp-m1eS-PGKt-KanMX-B containing gene Gal80 upstream and downstream homologous arms was amplified by PCR, with the PCR reaction conditions being as follows: 95° C. for 5 min; 94° C. for 40 s, 56° C. for 1 min, 72° C. for 108 s, 30 cycles; 72° C. for 10 min.

    [0048] The PCR product was transferred into the starting strain CICC1465 by the lithium acetate conversion method, the recombinant strain WYm1S was selected by G418 resistance, the genomes of the recombinant strain and the starting strain CICC1465 were extracted, primers YA-F (SEQ ID NO: 31) and YB-R (SEQ ID NO: 34) were designed exterior the upstream and downstream of the Gal80 gene respectively, and primers YA-R (SEQ ID NO: 32) and YB-F (SEQ ID NO: 33) were designed in the gene fragment PGKp-mae1-PGKt-PGKp-m1eS-PGKt-KanMX. PCR was performed using each genome as a template and YA-F (SEQ ID NO: 31)/YA-R (SEQ ID NO: 32) as primers. The recombinant strain WYm1S genome could be amplified to obtain a fragment of about 860 bp in size, which is consistent with the expected size of the target product, whereas the starting strain could not be amplified to obtain the corresponding fragment. The PCR verification results are shown in FIG. 3(a), wherein M is a marker, lane 1 is the result of PCR amplification using the starting strain CICC1465 as a template, and YA-F (SEQ ID NO: 31) and YA-R (SEQ ID NO: 32) as primers, lane 2 is the PCR-amplified gene fragment using WYm1S as a template, and YA-F (SEQ ID NO: 31) and YA-R (SEQ ID NO:32) as primers. For PCR using YB-F (SEQ ID NO: 33)/YB-R (SEQ ID NO: 34), the recombinant strain WYm1S genome could be amplified to obtain a fragment of about 1400 bp in size, which is consistent with the expected size of the target product, whereas the starting strain could not be amplified to obtain the corresponding fragment. The PCR verification results are shown in FIG. 3(b), wherein M is a marker, lane 1 is the result of PCR amplification using the starting strain CICC1465 as a template, and YB-F (SEQ ID NO: 33)/YB-R (SEQ ID NO: 34) as primers, and lane 2 is the PCR-amplified gene fragment using WYm1S as a template, and YB-F (SEQ ID NO: 33)/YB-R (SEQ ID NO:34) as primers, indicating that the gene fragment PGKp-mae1-PGKt-PGKp-m1eS-PGKt-KanMX has been successfully integrated into the position of gene Gal80, and the strain WYm1S was successfully constructed.

    Embodiment 2

    [0049] Fermentation Experiment of Saccharomyces uvarum Strain Capable of Low Production of Higher Alcohols

    [0050] (1) Wine Fermentation Experiment of Recombinant Strain and Starting Strain

    [0051] {circle around (3)} Fermentation process route: Grape raw material: select, clean, dry, destem; crush; adjust sugar, adjust acid; add sulfurous acid, sterilize; inoculate; preliminarily ferment; separate dreg; measure parameters.

    [0052] {circle around (4)} Process conditions: Sugar degree: 20.45 Brix; Acidity: pH 3.5; SO.sub.2 content: 80 mg/L, standing at 4° C. for 12 h; Liquid volume in flask: 190 mL grape juice in a 250 mL triangular flask; inoculation amount: 1×10.sup.8 CFU/mL; fermentation temperature and time: 25° C., 5 d; steaming conditions: 100 mL fermentation broth steamed with 100 mL water to obtain 100 mL wine sample.

    [0053] According to the above fermentation process, Saccharomyces uvarum starting strain CICC1465 and the strain WY-m1S of the Embodiment 1 were used for wine fermentation experiment. Shaking and weighing were performed every 12 hours during the fermentation, and the weight loss was recorded. After the fermentation was completed, the cultivation was stopped and weighing was conducted. The temperature and alcoholic strength of the distillate were measured by a thermometer and an oenometer respectively, and the alcoholic strength at this temperature was converted to the corresponding alcoholic strength at 20° C. The reducing sugar content in the wine was determined using the fehlings reagent method, and the results are shown in Table 3. Table 3 shows that in the wine fermentation experiment, the basic fermentation performance of the Saccharomyces uvarum recombinant strain WY-m1S obtained by the present invention is not much changed compared with the starting strain CICC1465.

    TABLE-US-00003 TABLE 3 Determination of fermentation performance of starting strain and recombinant strain Weight Residual Alcoholic Strain loss (g) sugar (g/L) strength (% vol) CICC1465 14.95 1.94 11.20 WYmlS 15.03 2.08 11.18 Note: The data shown are the average of three parallel test results.

    [0054] (2) Contents Determination of Malic Acid and Higher Alcohols

    [0055] The contents of malic acid and higher alcohols in the wine after fermentation were determined by high-performance liquid chromatography (HPLC) and gas chromatography (GC). HPLC analysis: the wine fermentation broth was filtered by a 0.22 μm fiber filter membrane and then analyzed by high-performance liquid chromatography, with the chromatographic conditions being as follows: the column is Bio-RadHIPX-87H, 300×7.8 mm; the detector was a differential refractive index detector (RID); the mobile phase was 5 mmol/L sulfuric acid, the flow rate was 0.6 mL/min; the detector temperature was 45° C., the column temperature was 65° C., and the injection volume was 20 μl. GC analysis: after the fermentation broth was distilled, the wine sample was analyzed by high-performance gas chromatography, with the chromatographic conditions being as follows: the gas chromatograph is Agilent 7890C, and was equipped with the Agilent G4512A automatic sampler, the column was Agilent 1909N-213, 30 m×0.32 mm×0.5 m capillary column, the detector is FID. The inlet temperature was set to 200° C. and the detector temperature was 200° C. Injection volume condition: 1 μL injection volume, and split ratio of 5:1. The carrier gas was high-purity nitrogen, and the flow rate was set to be 2.0 mL/min. Heating program: the initial column temperature was set to be 50° C. and held for 8 min, and then increased to 120° C. at a heating rate of 5° C./min and kept for 5 min. The results are shown in Table 4.

    [0056] Table 4 shows that the content of isobutanol, isoamyl alcohol and phenylethanol in the wine after fermentation with the recombinant strain WY-m1S is 28.184 mg/L, 171.756 mg/L and 13.604 mg/L, respectively, which is reduced by 20.28%, 14.77% and 11.26% as compared with the starting strain, the total content of higher alcohols (isobutanol, isoamyl alcohol, phenethyl alcohol) is 213.54 mg/L, which is reduced by 15.33% as compared with the starting strain.

    [0057] Moreover, the content of malic acid obtained with the recombinant strain WYm1S of the present invention reaches 1.130 mg/L, which is almost consistent with the content of malic acid in wine fermented with lactic acid bacteria. This shows that the strain obtained by the present invention can greatly reduce the content of higher alcohols in wine, and can effectively degrade malic acid during alcohol fermentation, thereby eliminating the effect of lactic acid bacteria fermentation, and greatly shortening the wine fermentation period. Meanwhile, it provides a theoretical basis for enriching the taste of wine and improving the flavor quality of wine.

    TABLE-US-00004 TABLE 4 Content of malic acid and higher alcohols for the starting strain and the recombinant strain (mg/L) Malic n- Isoamyl Phenethyl acid propanol Isobutanol alcohol alcohol Strain (g/L) (mg/L) (mg/L) (mg/L) (mg/L) CICC1465 3.681 51.830 35.354 201.530 15.330 WYmlS 1.130 51.068 28.184 171.756 13.604 Note: The data shown is the average of three parallel test results.