Method for preparing rebaudioside A from stevioside

10472660 ยท 2019-11-12

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an in-situ method for preparing rebaudioside A from sucrose and stevioside by sucrose synthase and glycosyltransferase.

Claims

1. A method for preparing rebaudioside A from stevioside, comprising performing in a single reaction system the following two reactions: (1) reacting sucrose and nucleotide diphosphate in the presence of a sucrose synthase to prepare nucleotide diphosphate to which glucose is bonded, and (2) reacting the nucleotide diphosphate to which glucose is bonded with stevioside in the presence of a glycosyltransferase to prepare rebaudioside A, wherein the sucrose synthase comprises the sequence of SEQ ID NO:3, wherein the glycosyltransferase comprises the sequence of SEQ ID NO:4, and wherein the reaction system pH is in the range of pH 5.5 to 11.0.

2. The method for preparing rebaudioside A from stevioside according to claim 1, wherein the reaction system temperature is 20 C. to 60 C., and the reaction system pH is in the range of pH 7 o pH 8.

3. The method for preparing rebaudioside A from stevioside according to claim 1, wherein the sucrose synthase and the glycosyltransferase are independently produced from recombinant Escherichia coli, Bacillus, yeast, Corynebacterium or Agrobacterium.

4. The method for preparing rebaudioside A from stevioside according to claim 3, wherein the sucrose synthase and the glycosyltransferase are purified sucrose synthase and purified glycosyltransferase, respectively.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows HPLC analysis results, demonstrating that fructose and uridine diphosphate to which glucose is bonded are produced by sucrose synthase. In FIG. 1, (a) shows the presence of stevioside (1) only at reaction time of 0 hours, (b) shows that uridine diphosphate (2) to which glucose is bonded is produced by sucrose synthase after the completion of reaction time of 1 hour.

(2) FIG. 2 shows HPLC analysis results, demonstrating that stevioside is converted into rebaudioside A by glycosyltransferase. In FIG. 2, (a) shows the presence of stevioside (1) only at reaction time of 0 hours, (b) shows that both stevioside (1) and rebaudioside A (2) are present after a reaction time of 0.5 hour, and (c) shows that all stevioside (1) is converted into rebaudioside A (2) after a reaction time of 1 hour.

(3) FIG. 3 shows HPLC analysis results, demonstrating that rebaudioside A (2) is produced from stevioside (1) by sucrose synthase and glycosyltransferase. In FIG. 3, (a) shows the presence of stevioside (1) only at reaction time of 0 hours when stevioside substrate concentration is 100 mM, (b) shows the presence of rebaudioside A (2) only after a reaction time of 24 hours when stevioside substrate concentration is 100 mM, and (c) shows the presence of both stevioside (1) and rebaudioside A (2) after a reaction time of 24 hours when stevioside substrate concentration is 250 mM.

(4) FIG. 4 shows a graph demonstrating the results of appropriate pH evaluation for sucrose synthase and glycosyltransferase.

(5) FIG. 5 shows a graph demonstrating the results of appropriate temperature evaluation for sucrose synthase and glycosyltransferase.

BEST MODE

(6) One embodiment of the present invention relates to a method for preparing rebaudioside A, including:

(7) (1) reacting sucrose and nucleotide diphosphate in the presence of sucrose synthase to prepare nucleotide diphosphate to which glucose is bonded; and

(8) (2) reacting the nucleotide diphosphate to which glucose is bonded with stevioside in the presence of glycosyltransferase to prepare rebaudioside A. The steps (1) and (2) are performed in-situ sequentially or consecutively, preferably in-situ consecutively.

(9) Another embodiment of the present invention relates to a method for preparing rebaudioside A from stevioside, including: reacting sucrose, nucleotide diphosphate, stevioside, sucrose synthase and glycosyltransferase to prepare rebaudioside A. The reaction of sucrose, nucleotide diphosphate, stevioside, sucrose synthase and glycosyltransferase may be performed in-situ.

(10) The term in-situ used herein means that a reaction is consecutively performed in a single reaction system.

(11) Sucrose synthase plays a role in the production of sucrose by reversibly transferring glucose, which is bonded to nucleotide diphosphate, to fructose in plant sugar catabolism. In the present invention, sucrose synthase demonstrates activity to separate nucleotide diphosphate to which glucose is bonded and fructose by reacting sucrose and nucleotide diphosphate in the range of pH 5 to pH 10.

(12) ##STR00001##

(13) Nucleotide diphosphate to which glucose is bonded can be reacted with stevioside by means of glycosyltransferase to produce rebaudioside A.

(14) ##STR00002##

(15) Chemical Reactions 1 and 2 in the present invention may be performed sequentially in separate reactors, but are preferably performed consecutively in one reactor.

(16) In the present invention, Chemical Reactions 1 and 2 may be combined into one reaction formula below:

(17) ##STR00003##

(18) The present invention provides a consecutive reaction system, wherein one glucose is specifically bonded to the C-3 position of stevioside 13-O-glucose to synthesize rebaudioside A with high yield in accordance with Chemical Reaction 3 above.

(19) In the present invention, sucrose synthase may be derived from rice, corn, wheat, bamboo, Arabidopsis thaliana, grass, barley, sorghum or potato. Preferably, sucrose synthase is derived from rice, corn, wheat, or barley, particular preferably from rice, especially Oryza sativa. Sucrose synthase may be produced from recombinant Escherichia coli, Bacillus, yeast, Corynebacterium or Agrobacterium transformed with a vector containing a sucrose synthase gene. Sucrose synthase may be further purified after it is produced from Escherichia coli and the like. Sucrose synthase is well known in the art. Although it is not particularly limited, sucrose synthase may include a base sequence shown in SEQ ID NO: 3.

(20) In the present invention, sucrose is not particularly limited so long as it can serve as a substrate for sucrose synthase to provide glucose to nucleotide diphosphate. Examples of sucrose may include raw sugar or sugar.

(21) In the present invention, purine or pyrimidine may be used as the nucleotide diphosphate. Preferably, uridine diphosphate is used as the nucleotide diphosphate.

(22) In the present invention, the reaction temperature in step (1) or Chemical Reaction 1 may be 20 C. to 60 C., and the reaction pH may be in the range of pH 5 to pH 10. Preferably, the reaction temperature is 30 C. to 55 C. and the reaction pH is in the range of pH 6 to pH 9, particular preferably the reaction temperature is 35 C. to 50 C. and the reaction pH is in the range of pH 7 to pH 8. In the present invention, the reaction time in step (1) or Chemical Reaction 1 is 30 minutes to 48 hours, preferably 1 hour to 36 hours, particular preferably 1 hour to 24 hours, without being limited thereto.

(23) In the present invention, glycosyltransferase may be derived from Oryza sativa, Stevia rebaudiana Bertoni, Bambusa oldhamii, Brachypodium distachyon, Hordeum vulgare, Sorghum bicolor, Zea mays, or Arabidopsis thaliana. Preferably, glycosyltransferase is derived from Oryza sativa, Stevia rebaudiana Bertoni, or Bambusa oldhamii. Particular preferably, glycosyltransferase is derived from Stevia rebaudiana Bertoni. Glycosyltransferase may be produced from recombinant Escherichia coli, Bacillus, yeast, Corynebacterium or Agrobacterium transformed with a vector containing a glycosyltransferase gene. Glycosyltransferase may be further purified after it is produced from Escherichia coli and the like. Glycosyltransferase is well known in the art. Although it is not particularly limited, glycosyltransferase may include a base sequence shown in SEQ ID NO: 4.

(24) In the present invention, stevioside is hot water or aqueous ethanol solution extract from Stevia rebaudiana, or purified material thereof, or a by-product after the production of rebaudioside A from the extract. Stevioside may be used in an amount of 10 wt % or more, preferably 50 wt % or more, particularly preferably 70 wt % or more, more particular preferably 80 wt % or more, based on total weight of steviol glycoside.

(25) In the present invention, the reaction temperature in step (2) or Chemical Reaction 2 may be 20 C. to 60 C., and the reaction pH may be in the range of pH 5 to pH 10. Preferably, the reaction temperature is 30 C. to 55 C., and the reaction pH is in the range of pH 6 to pH 9. Particular preferably, the reaction temperature is 35 C. to 50 C., and the reaction pH is in the range of pH 7 to pH 8. In the present invention, the reaction time in step (2) or Chemical Reaction 2 may be 30 minutes to 48 hours, preferably 1 hour to 36 hours, particular preferably 1 hour to 24 hours, without being limited thereto.

(26) In the present invention, the reaction temperature for the step of preparing rebaudioside A by reacting sucrose, nucleotide diphosphate, stevioside, sucrose synthase and glycosyltransferase in-situ may be 20 C. to 60 C., and the reaction pH may be in the range of pH 5 to pH 10. Preferably, the reaction temperature is 30 C. to 55 C., and the reaction pH is in the range of pH 6 to pH 9. Particular preferably, the reaction temperature is 35 C. to 50 C., and the reaction pH is in the range of pH 7 to pH 8.

(27) In the present invention, purine or pyrimidine may be used as the nucleotide diphosphate. Preferably, uridine diphosphate is used as the nucleotide diphosphate.

(28) Another embodiment of the present invention provides rebaudioside A prepared by a method described herein.

(29) Rebaudioside A according to the present invention is characterized in that it is produced by using entire amount of stevioside residing in steviol glycoside. Such characteristics can allow stevioside content in the glycoside to be 5 wt % or less, preferably 3 wt % or less, particularly preferably 1 wt % or less, thereby capable of omitting a step of separating stevioside from rebaudioside A in a purification process, which leads to cost-savings. In addition, in case that only a small amount of rebaudioside A is present as glycoside besides stevioside in the raw materials as in the present invention, the preparation method has a merit that a high purity product wherein rebaudioside A content in steviol glycoside through enzymatic conversion is 99% or more. Furthermore, sucrose that is used as a sugar donor in the present invention can be purchased at 50 times lower cost than curdlan used as a raw material in the prior inventions. As a result, the present invention is capable of producing rebaudioside A with high purity at low cost/high efficiency as compared to the prior art.

(30) Hereinafter, the present invention will be described in more detail with reference to the following examples. It should be understood that these examples are provided for illustration only and are not to be construed in any way as limiting the present invention.

Example 1

(31) Gene Collection and Recombinant Protein Production

(32) 1) Preparation of Sucrose Synthase Gene Recombinant Escherichia coli

(33) Primers used in PCR (Polymerase Chain Reaction) had restriction enzyme recognition sequences for NdeI and HindIII that react respectively with a partial base sequence of both ends of sucrose synthase.

(34) TABLE-US-00001 (FORWARD)5-CATATGGCTGCCAAGCTAGCTCG-3 (BACKWARD)5-AAGCTTTTACTTGGATGTGCTCTCTC-3

(35) For gene amplification, the isothermal amplification procedure repeated 30 cycles consisting of denaturing at 94 C. for 30 seconds, annealing at 60 C. for 30 seconds, and extension at 72 C. for 2 minutes, thereby obtaining about 2.5 kb of PCR product.

(36) The obtained cDNA fragment was inserted into a pET-28a(+) vector and transformed into Escherichia coli BL21(DE3). The transformed Escherichia coli were streaked onto plate media containing kanamycin to initially select kanamycin resistant strains. The selected strains were subjected to liquid cultivation, followed by purification of DNAs. Finally, when DNAs were doubly cleaved with NdeI and HindIII, a strain confirmed to have about 2.5 kb of DNA fragment was selected. As a result of base sequence analysis using an automated DNA Sequencer, the base sequence (SEQ ID NO: 1) of sucrose synthase gene obtained in the present invention was identical to that of the reported sucrose synthase gene below:

(37) TABLE-US-00002 SEQIDNO:1 TGCCAACAATCGCAACATGCCATGGTGGCCCTGCTGAGATTATTGTTGAT GGGGTGTCTGGTCTGCACATTGATCCTTACCACAGTGACAAGGCTGCTGA TATCTTGGTCAACTTCTTTGAGAAGTGCAAGCAGGATTCAACCTACTGGG ACAATATTTCACAGGGAGGTCTGCAGAGGATTTACGAGAAGTACACCTGG AAGCTGTACTCTGAGAGGCTGATGACCTTGACTGGTGTATACGGATTCTG GAAGTACGTAAGCAACCTTGAGAGGCGCGAGACTCGCCGTTACATTGAGA TGTTCTATGCTCTGAAATACCGCAGCCTGGCCAGCGCCGTCCCATTGGCT GTCGATGGAGAGAGCACATCCAAGTAA

(38) 2) Preparation of Glycosyltransferase Gene Recombinant Escherichia coli

(39) Primers used in PCR had restriction enzyme recognition sequences for NdeI and HindIII that react respectively with a partial base sequence of both ends of glycosyltransferase gene derived from Stevia rebaudiana.

(40) TABLE-US-00003 (FORWARD)5-CATATGGAAAATAAAACGGA-3 (BACKWARD)5-AAGCTTTTACAACGATGAAATGT-3

(41) For gene amplification, the isothermal amplification procedure was repeated for 30 cycles consisting of denaturing at 94 C. for 30 seconds, annealing at 60 C. for 30 seconds, and extension at 72 C. for 2 minutes, thereby obtaining about 1.4 kb of PCR product. The obtained cDNA fragment was inserted into a pET-28a(+) vector and transformed into Escherichia coli BL21(DE3). The transformed Escherichia coli were streaked onto plate media containing kanamycin to initially select kanamycin resistant strains. The initially selected strains were subjected to liquid cultivation, followed by purification of DNAs. Finally, when DNAs were doubly cleaved with NdeI and HindIII, a strain confirmed to have about 1.4 kb of DNA fragment was selected. As the result of base sequence analysis using an automated DNA Sequencer, the base sequence (SEQ ID NO: 2) of glycosyltransferase gene obtained in the present invention was identical to that of the reported glycosyltransferase gene below:

(42) TABLE-US-00004 SEQIDNO:2 AGAAGTGCTAGCTCATGGAGCAATAGGCGCATTCTGGACTCATAGCGGAT GGAACTCTACGTTGGAAAGCGTTTGTGAAGGTGTTCCTATGATTTTCTCG GATTTTGGGCTCGATCAACCGTTGAATGCTAGATACATGAGTGATGTTTT GAAGGTAGGGGTGTATTTGGAAAATGGGTGGGAAAGAGGAGAGATAGCAA ATGCAATAAGAAGAGTTATGGTGGATGAAGAAGGAGAATACATTAGACAG AATGCAAGAGTTTTGAAACAAAAGGCAGATGTTTCTTTGATGAAGGGTGG TTCGTCTTACGAATCATTAGAGTCTCTAGTTTCTTACATTTCATCGTTGT AA

(43) 3) Production of Recombinant Protein

(44) A test tube containing 5 ml of LB medium was inoculated with lyophilized recombinant Escherichia coli BL21(DE3), followed by seed culturing in an incubator at 37 C. until the absorbance at 600 nm became 2.0. The seed cultured solution was added to a 2000 ml flask containing 500 ml of LB medium and then cultured. Further, 0.1 mM IPTG (isopropyl -D-1-thiogalacthiopyranoside) was added until the absorbance at 600 nm became 0.4, thereby inducing mass expression of sucrose synthase and glycosyltransferase, respectively. The culture conditions were adjusted so that the stirring speed was 180 rpm and the culture temperature was 37 C. during the procedure, while the stirring speed was 120 rpm and the culture temperature was 16 C. after the addition of IPTG. The culture solution of the transformed strain was centrifuged at 6,000 g at 4 C. for 20 minutes, followed by washing twice with 50 mM Tris-hydrochloric acid buffer, then adding 50 mM Tris-hydrochloric acid buffer, pH 7.5 in order to lyse the cell solution with a sonicator. The cell lysate was centrifuged again at 13,000 g at 4 C. for 20 minutes to separate a cell supernatant as an enzyme solution. In order to exactly identify properties of enzymes, the enzyme solution was purified using a Ni-NTA superflow column. The molecular weight of the purified enzyme was measured by SDS-PAGE. As a result, it was confirmed that sucrose synthase derived from rice (Oryza sativa) had a length of 92 kDa (SEQ ID NO: 3) and glycosyltransferase (UDP-glycosyltransferase) derived from stevia (Stevia rebaudiana) had a length of 57 kDa (SEQ ID NO: 4).

Example 2

(45) Measurement of Enzyme Activity Using HPLC

(46) 1) Measurement of Sucrose Synthase Activity

(47) The activity of sucrose synthase derived from rice (Oryza sativa) was measured by means of HPLC. Analysis conditions for HPLC to measure the activity of sucrose synthase derived from rice (Oryza sativa) were as follows:

(48) Conditions for HPLC Analysis Detector Wavelength: 260 nm Flow rate: 1 ml/min Sample injection vol.: 10 l Column: C18 4.6250 mM (5 m pore size) Solvent: A: 8 mM Tetrabutylammonium persulfate in 100 mM potassium phosphate [pH 5.3] B: 70% solvent A+30% Methanol

(49) The total analysis time was set to 30 minutes, wherein the analysis started the gradient with 100% solvent A, at run time of 15 minutes the gradient of solvent B was increased to 20%, and then at run time of 17 minutes the gradient returned to 100% solvent A.

(50) The activity of sucrose synthase derived from rice (Oryza sativa) was confirmed by enzymatic reaction to see if raw sugar or sugar (sucrose) and uridine diphosphate were reacted to produce uridine diphosphate to which glucose was bonded. The conditions for enzyme reactions were as follows:

(51) 100 mM sucrose, 10 mM uridine diphosphate and 0.1 mg/ml sucrose synthase prepared in Example 1-3) in 50 mM phosphate buffer (pH 6.5) were subjected to enzymatic reaction at 37 C. for 1 hour. After heating to 100 C. for 5 minutes to stop the reaction, HPLC analysis was performed to measure the produced amount of uridine diphosphate to which glucose was bonded. As a result, it was confirmed that uridine diphosphate was converted into uridine diphosphate to which glucose was bonded, indicating 90% conversion as compared to initial molar concentration (FIG. 1). In FIG. 1, (a) shows that only uridine diphosphate (1) is present at reaction time of 0 hours, (b) shows that uridine diphosphate to which glucose is bonded (2) is produced by means of sucrose synthase after the completion of reaction time of 1 hour.

(52) 2) Measurement of Glycosyltransferase Activity

(53) The conditions for HPLC analysis to measure glycosyltransferase (UDP-glycosyltransferase) derived from stevia (Stevia rebaudiana) were as follows:

(54) Conditions for HPLC Analysis Detector Wavelength: 210 nm Flow rate: 1 ml/min Sample injection vol.: 10 l Column: C18 4.6250 mM (5 m pore size) Solvent: Acetonitrile:10 mM sodium phosphate [pH 2.6]=32:68

(55) The activity of glycosyltransferase (UDP-glycosyltransferase) derived from stevia (Stevia rebaudiana) was confirmed by enzymatic conversion to see if bonding one molecule of glucose to stevioside leads to conversion to rebaudioside A. The conditions for enzymatic reaction were as follows: 2 mM stevioside (>96%), 10 mM uridine diphosphate glucose, and 0.1 mg/ml glycosyltransferase derived from stevia prepared in Example 1-3) in 50 mM phosphate buffer (pH 7.0) were subjected to enzymatic reaction at 37 C. for one hour. Stevioside used as a substrate for enzymatic reaction was pure stevioside with purity of 96% or more. A mixed specimen containing about 3% of rebaudioside A was used as a standard material before and after reaction at the time of HPLC analysis. The enzyme reaction was stopped by heating to 100 C. for 5 minutes, followed by performing HPLC to measure the produced amount of rebaudioside A. As an analysis result, it was confirmed that stevioside was converted into rebaudioside A with 100% conversion as compared to molar concentration (FIG. 2). FIG. 2 shows HPLC analysis results, demonstrating that stevioside is converted into rebaudioside A by glycosyltransferase. In FIG. 2, (a) shows the presence of stevioside (1) only at reaction time of 0 hours, (b) shows that both stevioside (1) and rebaudioside A (2) are present after a reaction time of 0.5 hours, and (c) shows that all stevioside (1) is converted into rebaudioside A (2) after a reaction time of 1 hour.

Example 3

(56) Measurement of Conversion Rate from Stevioside to Rebaudioside A by In-Situ Reaction of Sucrose Synthase and Glycosyltransferase

(57) The conversion rate from stevioside to rebaudioside A was confirmed by in-situ reaction of sucrose synthase and glycosyltransferase (UDP-glycosyltransferase). The conditions for enzymatic reactions were as follows:

(58) Enzymatic reactions were performed using 50 mM phosphate buffer (pH 6.5) containing 1M sucrose, 20 mM uridine diphosphate, 100250 mM stevioside and 0.1 mg/ml of sucrose synthase prepared in Example 1-3) and 0.1 mg/ml of glycosyltransferase prepared in Example 1-3) at a temperature of 45 C. for 24 hours. The substrate used in the present invention was the stevioside mixture specified in Example 2. After completion of the reactions, the reactions were stopped by heating to 100 C. for 5 minutes. After that, HPLC analysis was performed to measure the concentration of produced rebaudioside A depending on the concentration of stevioside. The conversion rate from stevioside to rebaudioside A was calculated from the molar concentration of rebaudioside A produced as compared to molar concentration of stevioside used (FIG. 3 and Table 1 (Conversion rate after reaction for 24 hours)).

(59) TABLE-US-00005 TABLE 1 Concentration of stevioside (mM) Conversion rate (%) 100 100 150 63.90 200 56.72 250 39.96

(60) FIG. 3 shows HPLC analysis results, demonstrating that rebaudioside A (2) is produced from stevioside (1) by sucrose synthase and glycosyltransferase. In FIG. 3, (a) shows the presence of stevioside (1) only at reaction time of 0 hours when the substrate concentration is 100 mM, (b) shows the presence of rebaudioside A (2) only after a reaction time of 24 hours when the substrate concentration is 100 mM, and (c) shows the presence of both stevioside (1) and rebaudioside A (2) after a reaction time of 24 hours when the substrate concentration is 250 mM.

Example 4

(61) pH Stability in In-Situ Reaction of Sucrose Synthase and Glycosyltransferase

(62) Uridine diphosphate to which glucose was bonded produced by sucrose synthase derived from rice (Oryza sativa) was converted into rebaudioside A by reacting with stevioside by glycosyltransferase, dissociating uridine diphosphate. When the two sorts of enzymes were present in a single reactor and rebaudioside A was produced, the optimum pH was checked. The conditions for HPLC analysis for measuring the optimum pH are as follows:

(63) Condition for HPLC Analysis Detector Wavelength: 210 nm Flow rate: 1 ml/min Sample injection vol.: 10 l Column: C18 4.6250 mM (5 m pore size) Solvent: Acetonitrile:10 mM sodium phosphate [pH 2.6]=32:68

(64) The optimum pH was confirmed through complex reaction of sucrose synthase and glycosyltransferase (UDP-glycosyltransferase). Conditions for enzymatic reactions were as follows: Enzymatic reactions were performed by using 50 mM phosphate buffer (pH 6.5) containing 1M sucrose, 200 mM uridine diphosphate, 40 mM stevioside and 0.1 mg/ml of sucrose synthase prepared in Example 1-3) and 0.1 mg/ml of glycosyltransferase prepared in Example 1-3) at a temperature of 45 C. for 24 hours. As a pH 2.5 to pH 12.0 buffer, Universal buffer was used. The reactions were stopped by heating to 100 C. for 5 minutes. After that, HPLC analysis was performed to measure the production rate of rebaudioside A. By comparing the produced amount of rebaudioside A, the reaction pH for the reaction system showing maximum value was deemed to be an optimum pH for the complex reaction. The optimum pH for the complex reaction of sucrose synthase and glycosyltransferase was confirmed to be approximately pH 7.5 m a reaction carried out at a temperature of 45 C. for 60 minutes (FIG. 4 and Table 2).

(65) TABLE-US-00006 TABLE 2 pH Enzyme relative activity (%) 2.5 2.99 3.0 2.85 4.0 2.66 5.0 38.55 5.5 78.66 6.0 84.54 6.5 85.45 7.0 93.24 7.5 100 8.0 93.04 8.5 86.42 9.0 85.12 10.0 84.01 11.0 80.47 12.0 52.34

Example 4

(66) Temperature Stability in an In-Situ Reaction of Sucrose Synthase and Glycosyltransferase

(67) Uridine diphosphate to which glucose was bonded produced by sucrose synthase derived from rice (Oryza sativa) was converted into rebaudioside A by reacting with stevioside by glycosyltransferase, dissociating uridine diphosphate. When the two sorts of enzymes were present in a single reactor and rebaudioside A was produced, the optimum temperature was checked. The conditions for HPLC analysis for measuring the optimum temperature were as follows:

(68) Conditions for HPLC Analysis Detector Wavelength: 210 nm Flow rate: 1 ml/min Sample injection vol.: 10 l Column: C18 4.6250 mM (5 m pore size) Solvent: Acetonitrile:10 mM sodium phosphate [pH 2.6]=32:68

(69) The optimum temperature was confirmed through a complex reaction of sucrose synthase and glycosyltransferase (UDP-glycosyltransferase). The conditions for enzymatic reactions were as follows: Enzymatic reactions were performed by using 50 mM phosphate buffer (pH 6.5) containing 1M sucrose, 200 mM uridine diphosphate, 40 mM stevioside and 0.1 mg/ml of sucrose synthase and 0.1 mg/ml of glycosyltransferase at temperatures of 4 C., 20 C., 30 C., 37 C., 45 C., 60 C., 70 C., and 80 C. The reactions were stopped by heating to 100 C. for 5 minutes. After that, HPLC analysis was performed to measure the production rate of rebaudioside A. By comparing the produced amount of rebaudioside A, the reaction temperature for the reaction system showing maximum value was deemed to be an optimum temperature for the complex reaction. The optimum temperature for the complex reaction of sucrose synthase and glycosyltransferase was confirmed to be approximately 45 C. in a reaction carried out at pH 6.5 for 60 minutes. Relative enzyme activity is summarized in FIG. 5 and Table 3.

(70) TABLE-US-00007 TABLE 3 Temperature ( C.) Relative enzyme activity (%) 4 10.19 20 17.20 30 31.21 37 80.48 45 100 60 39.24 70 9.71 80 10.40