Double stranded linear nucleic acid probe
10472668 ยท 2019-11-12
Assignee
Inventors
- Klara X. Abravaya (Kenilworth, IL, US)
- John R. Hackett (Libertyville, IL, US)
- Shihai X. Huang (Lincolnshire, IL, US)
- Ka-Cheung X. Luk (Lake Bluff, IL, US)
- John A. Salituro (Union Grove, WI)
- Larry E. Morrison (Oro Valley, AZ, US)
Cpc classification
C12Q1/6818
CHEMISTRY; METALLURGY
C12Q2565/525
CHEMISTRY; METALLURGY
C12Q1/6818
CHEMISTRY; METALLURGY
International classification
C12Q1/6818
CHEMISTRY; METALLURGY
Abstract
A double-stranded nucleic acid hybridization probe and methods of using the same are described. The probe described is particularly suited for real-time RT-PCR reactions and has high tolerance to mismatches.
Claims
1. A composition comprising a pair of labeled nucleotide sequences, the first member of the pair being selected from the group consisting of [SEQ ID NO: 6] and [SEQ ID NO: 7], and; the second member of the pair comprises [SEQ ID NO: 11].
2. The composition of claim 1, wherein the first member of the pair is labeled with a fluorescent label and the second member of the pair is labeled with a quencher.
3. The composition of claim 1, wherein the first member of the pair is labeled with a quencher and the second member of the pair is labeled with a fluorescent label.
4. The composition of claim 1, wherein the pair of labeled nucleotide sequences comprises [SEQ ID NO: 6] and [SEQ ID NO: 11].
5. The composition of claim 4, wherein the one member of the labeled pair of nucleotide sequences is labeled with a fluorescent label and the other member of the labeled pair of nucleotide sequences is labeled with a quencher.
6. The composition of claim 1, wherein the pair of labeled nucleotide sequences comprises [SEQ ID NO: 7] and [SEQ ID NO: 11].
7. The composition of claim 6, wherein the one member of the labeled pair of nucleotide sequences is labeled with a fluorescent label and the other member of the labeled pair of nucleotide sequences is labeled with a quencher.
8. A composition comprising a labeled nucleotide sequence, wherein the label is a quencher and the nucleotide sequence comprises [SEQ ID NO: 11].
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION
(7) The present invention provides nucleic acid probes as described below useful to detect the presence of a nucleic acid of interest (also commonly called a target). Of course, the first oligonucleic acid can also bind to amplified portions of the nucleic acid of interest. For ease of description and understanding, references to nucleic acids of interest or targets refer both to these moieties as found in a test sample and to amplified copies of portions of these nucleic acids, unless specifically noted to the contrary.
(8) The present invention provides a nucleic acid probe that comprises a first oligonucleic acid and a second oligonucleic acid. The first oligonucleic acid is labeled by a fluorophore and is substantially complementary to a nucleic acid of interest, such that when the nucleic acid of interest is present, the first oligonucleic acid can bind to the nucleic acid of interest. For purposes of the present invention, the term substantially complementary means that equal or more than 80% of nucleobases on one strand of the probe finds its Watson-Crick binding partner on the other strand of the probe (or in the nucleic acid of interest) in an alignment such that the corresponding nucleotides can hybridize to each other. Binding of the first oligonucleic acid to the nucleic acid of interest prevents the second oligonucleic acid from binding to the first oligonucleic acid of the probe. The second oligonucleic acid has a quencher molecule and is also substantially complementary to the first oligonucleic acid. Accordingly, the first and second oligonucleic acids can bind together when the nucleic acid of interest is not present to form a double-stranded nucleic acid. When the first oligonucleic acid is bound with the second oligonucleic acid, the fluorescent emission of the fluorophore attached to the first oligonucleic acid is quenched (i.e., detectably changed, and preferably lessened, compared to the emission of the same fluorophore when the first oligonucleic acid and second oligonucleic acid are not bound together). Binding of the first oligonucleic acid to the nucleic acid of interest, therefore, changes and preferably increases the fluorescence in a test system, thereby indicating whether the nucleic acid of interest is present. In one embodiment, the first oligonucleic acid contains 15-75 nucleobases (m) substantially complementary to target, and the second oligonucleic acid contains n nucleobases substantially complementary to the first oligonucleic acid, whereas n is significantly shorter than m. The second oligonucleic acid can be of any suitable length with the primary consideration being that when the nucleic acid of interest is not present, the second oligonucleic acid must bind with the first oligonucleic acid under temperature and solvent conditions in which the probe will be used to infer the presence or absence of the nucleic acid of interest in a test sample.
(9) Table 1 sets forth preferred and more preferred lengths of the first and second oligonucleic acids incorporated into two-stranded probes of this embodiment of the present invention
(10) TABLE-US-00001 TABLE 1 Second Oligonucleic Acid** First Oligonucleic Acid* Preferred More Preferred <25 <13 6-10 25-30 8-13 8-10 31-34 8-15 10-14 35-39 8-20 12-18 40-44 9-25 12-22 45-49 10-30 15-28 50-54 10-35 25-32 55-59 10-40 28-35 60-64 11-45 30-40 65-69 11-50 35-45 70-75 15-55 48-50 *Length in nucleobases (m) substantially complementary to target. **Length in nucleobases (n) substantially complementary to first oligonucleic acid.
(11) While not desiring to be bound by any particular theory, it is believed that the long single strand portion of the first oligonucleic acid strongly favors binding of the first oligonucleic acid to the target nucleic acid of interest thereby increasing the sensitivity of the probe and under some conditions improving the kinetics of the detection reaction. Additionally, the longer length of the first oligonucleic acid allows the use of hybridization conditions that permit mismatch hybridization.
(12) Oligonucleic acids are oligomers of naturally occurring or modified nucleobases. While guanine, adenine, thymine, uridine, cytosine, and optionally inosine and/or indole, are among the preferred nucleobases incorporated in the oligonucleic acids of the present invention, any suitable nucleobase can be incorporated into the probes of the present invention. Oligonucleic acids are not necessarily acids or residues of acids. Rather an oligonucleic acid as used herein is a polymer of nucleobases or nucleobase analogs that are capable of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, or the like. Most commonly, the monomers are linked by phosphodiester bonds. Less commonly, the monomers are linked by analogs of phosphodiester bonds, such as (deoxyribosyl)phosphonyl polymers or phosphothiorate polymers. Also less commonly employed are peptide nucleic acids, commonly referred to in the art as PNAs, in which the nucleobases are linked in sequence by a polymer containing amide bonds at regular intervals (Nielsen et al., Science, Vol. 254: 1497-1500 (1991)).
(13) Methods of synthesizing oligonucleic acids incorporated into probes of the present invention are well known in the art and any suitable method of obtaining the oligonucleic acids of the present invention can be used.
(14) A fluorophore, or a fluorescent label, can be any suitable moiety capable of emitting light. The light can be generated chemically, biologically, in response to excitational photons, or from any other suitable cause. Preferably, fluorophores are fluorescent organic dyes derivatized for attachment to the oligonucleic acids of the probe via a linking moiety. When ribosyl or deoxyribosyl polymers are used to link the nucleobases together the dyes can advantageously be derivatized to link to the terminal 3 carbon or terminal 5 carbon of the polymer.
(15) Fluorophores suitable in the context of the present invention include (without limitation) the Violet/Blue dyes (Em.sub.max 375-491 nm) 7-methoxycoumarin-3-carboxy, AMCA-X (7-aminocoumarin-X), 6-MI or 6-MAP (6-methyl-8-(2-deoy--D-ribofuranosyl)isoxanthopteridine); the Green/Yellow dyes (Em.sub.max 492-585 nm) DTAF (4,6-dichlorotriazinyl)aminofluorescein, 6-FAM (fluorescein, 6-carboxyfluorescein), Dansyl-X (6-((5-dimethtylaminonaphtalene-1-sulfonyl)amino)hexanoate, 6-JOE (6-carboxy-4,5-dichloro-2,7-dimethoxyfluorescein), HEX (hexachlorofluorescein), BODIPY-TMR-X (tetramethylrhodamine substitute), PyMPO (1-(3-carboxybenzyl)-4-(5-(4-methoxyphenyl)oxazol-2-yl)pyridinium bromide), TAMRA-X (6-(tetramethylrhodamine-5(6)-carboxamido)hexanoate); the Orange dyes (Em.sub.max 586-647 nm) rhodamine derivatives BODIPY 576/589, BODIPY 581/591, ROX (carboxyrhodamine), VIC (Applied Biosystems Inc., Foster City, Calif.), NED (Applied Biosystems Inc., Foster City, Calif.) and the Red dyes (E.sub.max 647-700 nm) as carboxynaphthofluorescein.
(16) A quencher as used herein is a moiety that decreases the light emitted by the fluorophore at the wavelength at which signal is measured, or is a fluorescent moiety that serves to shift the wavelength of light emitted by the fluorophore of the nucleic acid probe. Quenchers suitable in the context of the present invention include (without limitation) DABCYL (4-(4-dimethylaminophenylazo)benzoic acid), QSY-7 (9-[2-[[4-[[(2,5-dioxo-1-pyrrolidinyl)oxy]carbonyl]-1-piperidinyl]sulfonyl]phenyl]-3,6-bis(methylphenylamino)), BHQ-1, BHQ-2, BHQ-3 (Biosearch Technologies Inc., 2003, Cat. Nos. BG5-5041T, BG5-5042T, and BG5-5043T) and TAMRA ((6-tetramethylrhodamine-5(6)-carboxamido)hexanoate). Additionally, a quencher can be an organic dye, which may or may not be fluorescent, depending on the embodiment of the invention.
(17) In yet another embodiment, the present invention comprises a probe wherein the first and second oligonucleic acids comprise additional nucleobases that are not complementary to the nucleic acid of interest or to the first nucleic acid, respectively, at the 5 or the 3 end.
(18) In another embodiment the present invention comprises a probe wherein the ratio of the second oligonucleic acid comprising the quencher to the first oligonucleic acid comprising the fluorophore may be more than 1.1. Additionally, another embodiment comprises a probe in which the ratio of the second oligonucleic acid comprising the quencher to the first oligonucleic acid comprising the fluorophore may be more than 0.1 and less than 0.9.
(19) In another embodiment of the present inventive probe the first oligonucleic acid comprises two label moieties, one fluorophore and one quencher. The incorporation of a quencher (in addition to the fluorophore) in the first oligonucleic acid reduces background fluorescent emission (or background signal) that would occur when first oligonucleic acid is bound neither to target, nor to a second oligonucleic acid comprising a quencher. Another embodiment comprises a probe in which the molar ratio of the second oligonucleic acid (comprising a quencher) to the first oligonucleic acid (comprising one fluorophore and one quencher) is more than 0.1 and less than 0.9. Additionally, another embodiment comprises a probe in which the molar ratio of the second oligonucleic acid to the first oligonucleic acid (with two label moieties) is more than 1.1.
(20) To improve the fluorescent signal from the nucleic acid probe of the present invention, more than one fluorophore may be linked to the oligonucleic acid that binds to the target. Probes of the present invention comprising more than one fluorophore preferably emit substantially more fluorescent signal than equivalent probes comprising only a single fluorophore. Unexpectedly, the probes containing at least three fluorophores have been found to be tolerant of mismatches (i.e., less than perfect complementarity) with target molecules. This can be especially advantageous when the target nucleic acid is highly polymorphic as is the case with portions of HIV-1 and other retroviruses. Because the mismatch tolerance of the probes of the present invention is independent of the number of fluorophores attached to the first oligonucleic acid of the probe, and a probe with more than one fluorophore shows the same high tolerance for targets with 2, 3 or 4 mismatches as a probe of similar length with only one fluorophore, the probes of the present invention are particularly well suited to the detection and quantitation of viral target sequences.
(21) In another embodiment, the nucleic acid probe of the present invention comprises three oligonucleic acids, the first oligonucleic acid comprises a fluorophore and the second comprises a quencher. The third oligonucleic acid preferably also comprises a quencher. While not desiring to be bound by any particular theory, it is believed that the incorporation of an additional quencher in the third oligonucleic acid reduces background fluorescent emission (or background signal). Generally, background signal is the emission of fluorescence that is not caused by binding of a fluorescently labeled oligonucleic acid of the probe to a target nucleic acid of interest.
(22) In another embodiment, the longer oligonucleic acid comprises a quencher and the shorter oligonucleic acid comprises a fluorophore. Additionally, this embodiment comprises a probe in which the first and the second oligonucleotides further comprise additional nucleobases that are not complementary to the nucleic acid of interest and the first oligonucleotide, respectively, at the 5 and 3 ends. Additionally, both the first and second oligonucleic acids can also comprise a plurality of label moieties. For example, both the first oligonucleic acid and the second oligonucleic acid can comprise both a fluorophore and a quencher. Typically, the fluorophore and the quencher are incorporated into the oligonucleic acids such that when bound to an unlabeled oligonucleotide sequence (e.g., a target) the fluorophore and the quencher are separated and the fluorophore can emit light. However, when the first oligonucleic acid and the second oligonucleic acid of the probe are bound together the fluorophore of the first oligonucleic acid is brought into proximity with the quencher of the second oligonucleic acid, as well as the converse (i.e., the fluorophore of the second oligonucleic acid is brought into proximity with the quencher of the first oligonucleic acid). In this way, both the first and second oligonucleic acids can emit light in the presence of a target, but are mutually quenched in the absence of the target. Furthermore, the first and second oligonucleic acids of this embodiment may comprise additional nucleobases that are not complimentary to the nucleic acid of interest or to the first nucleic acid, respectively, at the 5 or the 3 end.
(23) Additionally, this embodiment comprises a nucleic acid probe wherein the ratio of the first oligonucleic acid comprising the quencher to the second oligonucleic acid comprising the fluorophore is more than 1.1. In yet another embodiment, the first oligonucleic acid comprises an additional quencher. This embodiment allows for a probe in which the ratio of the first oligonucleic acid to the second oligonucleic acid is More than 0.1 and less than 0.9. Also, this embodiment allows for a probe in which the ratio of the first oligonucleic acid to the second oligonucleic acid is more than 1.1.
(24) In a preferred embodiment, the difference in the fluorescence signal between the double stranded form when the fluorophore and quencher are close, and the target-hybridized state when the fluorophore is separated from the quencher can differ by as much as a factor of 20. This effect is due to the fact that when both are in close proximity there is relatively efficient quenching of the fluorophore, whereas, when the first oligonucleic acid is annealed to the target nucleic acid, it is separated from the second oligonucleic acid (comprising a quencher) and the fluorophore is not quenched anymore. As used herein, the terms quenching refers to any process whereby when a fluorophore molecule and a quencher molecule are in close proximity, a substantial loss of fluorescence occurs. Including in the group of quenchers are non-fluorescent molecules and fluorescent molecules, which can accept light energy from the fluorophore.
(25) In a preferred embodiment, the 3 terminal of the first oligonucleic acid only, or together with the 3 terminal of the second oligonucleic acid of the probe is/are rendered incapable of extension by a nucleic acid polymerase, to prevent interference with the PCR polymerization step thereby to prevent reduction of the stepwise efficiency of the amplification.
(26) In another embodiment of the present invention, the first oligonucleic acid, or the first and second oligonucleic acids of the double stranded probe are rendered impervious to degradation by the 5.fwdarw.3 exonuclease activity of a nucleic acid polymerase. Preferably, the 5 end of the oligonucleic acid is rendered resistant to digestion by including one or more modified internucleotide linkages into the 5 end of the oligonucleic acid. Minimally, the 5-terminal internucleotide linkage must be modified, however, up to all the internucleotide linkages in the oligonucleotide may be modified. Such internucleotide modifications may include modified linkages of the type used in the synthesis of anti-sense oligonucleotides. Examples of such nuclease resistant linkages include peptide nucleic acid (PNA) linkages, e.g., Nielsen et al., Science, Vol. 254, pages 1497-1500 (1991), and other like exonuclease resistant linkages. Alternatively, the 5 end can be rendered resistant to degradation by the 5.fwdarw.3 exonuclease activity by adding a sequence that is not complementary to the nucleic acid of interest, or by the addition of a derivative moiety at the 5 end of the oligonucleic acid.
(27) Advantageously, any of the probes described above, each of which comprise two oligonucleic acids, can be used in a method of determining the presence or quantity of a target nucleic acid. In the following methods, any suitable nucleic acid of interest can be the target nucleic acid. The target nucleic acid, however, is preferably RNA, such as a viral RNA or an mRNA. In some embodiments, the target RNA is preferably reverse transcribed prior to amplification, which amplification is also preferably carried out in the same tube and reaction mixture as the reverse transcription step.
(28) The present inventive method of detecting, or quantifying, a nucleic acid of interest in a test sample comprises mixing test sample with DNA amplification reagents to amplify a portion of the nucleic acid of interest. The reagents can optionally include reverse transcription reagents. The mixture of the amplification reagents and nucleic acid of interest is then incubated under suitable conditions to reverse transcribe the target RNA into a target complementary DNA if applicable, and then to amplify the target DNA. The method also comprises adding a nucleic acid fluorescent probe comprising a first oligonucleic acid with a fluorophore and a second oligonucleic acid with a quencher such as those described above, and measuring fluorescence from the fluorescent probe as an indication of whether the test sample contains the nucleic acid of interest. In some embodiments, the probe is contacted to the nucleic acid of interest before or substantially simultaneously with the amplification reagents, and optionally is mixed with the amplification reagents prior to contacting the amplification reagents to the nucleic acid of interest. In other embodiments, the probe is contacted to the nucleic acid of interest after incubating the nucleic acid of interest and the amplification reagents under suitable amplification conditions (so as to amplify a portion of the nucleic acid of interest).
(29) Amplification reagents refer to the chemicals, apart from the target nucleic acid sequence, needed to perform the PCR process. These chemicals can conveniently be classified into four classes of components: (i) an aqueous buffer, often including without limitation a magnesium salt, (ii) amplification substrates, such as four ribonucleotide triphosphates (NTPs) or preferably at least four deoxyribonucleotide triphosphates (dNTPs) in polymerization-based amplification or ATP in ligation-based amplification, (iii) one or more oligonucleotide primers or probes (normally two primers for each target sequence, the sequences defining the 5 ends of the two complementary strands of the double-stranded target sequence when PCR is employed), and (iv) an amplification enzyme such as a polynucleotide polymerase (for example, Tag polymerase for PCR or RNA polymerase for TMA), or a ligase. Additional reagents or additives can also be included at the discretion of the skilled artisan and selection of these reagents is within the skill of the ordinary artisan. Of course, when the amplification reagents are used to cause both reverse transcription and amplification, then reverse transcription reagents are also included in the amplification reagents. Selection of amplification reagents, according to the method of amplification reaction used, is within the skill of the ordinary artisan.
(30) In embodiments employing homogeneous amplification and detection steps, i.e., when performing combined amplification and probe hybridization detection in a single reaction mixture in a single tube, then: (i) any of the two oligonucleic acids of the probe preferably do not block or otherwise interfere or participate in the PCR or other amplification step; (ii) neither oligonucleic acid of the probe is degraded by the enzyme (e.g., by exonuclease activity of a polymerase enzyme); and (iii) the oligonucleic acids of the probe preferably are not extended or otherwise modified by the enzyme, e.g., the polymerization activity of the polymerase.
(31) In another embodiment of the present inventive method, an additional quantity of the second oligonucleic acid (which comprises a quencher) is added to the vessel prior to closing the vessel and incubating the reaction mixture under amplification conditions so as to obtain a molar ratio of the second oligonucleic acid comprising a quencher to the first oligonucleic acid comprising a fluorophore that is greater than 1, optionally not less than 1.1 or 1.2, and is less than 20, preferably not greater than 5, more preferably not greater than 2.5, yet more preferably not greater than 2, and optionally is not greater than 1.5.
(32) In a preferred embodiment of the inventive method, the probe is prevented from interfering with, or participating in, the PCR polymerization step by linking to the 3 terminal end of the nucleic acid an organic or inorganic moiety capable of blocking nucleic acid polymerization known in the art. Advantageously, this polymerization blocking moiety can be a fluorophore or a quencher molecule and can be attached to one or both of the oligonucleic acids of the probe by a linking moiety, or by making the 3-terminal nucleotide a dideoxynucleotide. Similarly, the oligonucleic acids of the probe can be completely or partially a PNA such that the oligonucleic acid of the probe cannot prime enzyme-mediated polymerization. Alternatively, the 3 end of the oligonucleic acid is rendered impervious to the 5.fwdarw.3 extension activity of a polymerase by including one or more modified polymerase resistant internucleotide linkages into the 3 end of the oligonucleotide, such as without limitation a phosphonate or phosphothiorate linkage. Similarly, a non-complementary sequence to the nucleic acid of interest can be attached to the 3 end of one or both of the oligonucleic acids of the probe such that the mismatch impedes or prevents enzyme-mediated polymerization.
(33) In another preferred embodiment, oligonucleic acids of the probe of the present invention can be made resistant or impervious to exonuclease digestion. Suitable methods of impeding or preventing exonuclease digestion include (without limitation) introducing a 5 extension that is not complementary to the nucleic acid of interest, adding a non-phosphodiester linkage between two nucleotidyl bases of the oligonucleic acid, and adding an organic or inorganic blocking moiety known in the art (per se) to the 5 end of one or both the oligonucleic acids.
(34) Similarly, enzymatic degradation of the oligonucleic acids of the probe can be impeded or prevented by using an amplification enzyme that lacks such activity. In the case of amplification-based reactions, for example, a polymerase which lacks a 5.fwdarw.3 exonuclease activity can be used. Polymerases lacking a 5.fwdarw.3 exonuclease activity are known in the art and include without limitation the Klenow fragment of DNA polymerase I, T4 DNA polymerase, and T7 DNA polymerase, the Stoffel fragment of Taq polymerase, and other like 5.fwdarw.3 exonuclease minus DNA polymerases.
(35) The polymerase optionally can also be rendered inactive, at least with respect to its exonuclease activity, during the hybridization step. Such inactivation can be achieved in a number of ways including (i) introducing a temperature sensitive inhibitor into the reaction which will inhibit the 5.fwdarw.3 exonuclease activity of the polymerase at the hybridization temperature, e.g., a solid adsorbent, a specific antibody molecule, or other like reversible or irreversible polymerase inhibitors; (ii) using a polymerase whose activity is greatly reduced at the hybridization temperature; or (iii) introducing an enzyme deactivation step prior to the hybridization step which irreversibly deactivates the polymerase enzyme, i.e., an extended period at high temperature.
(36) In certain embodiments, the reverse transcription efficiency is increased by using a probe comprising an oligonucleic acid that is complementary to a target RNA of interest that has a T.sub.m (melting temperature) of the first oligonucleic acid to the second oligonucleic acid that is lower than the temperature at which the reaction mixture is incubated during reverse transcription. While not desiring to be bound by any particular theory, it is believed that, by carrying out the reverse transcription step at a temperature above each of the Tm of the probe, the probe does not compete with the target RNA by competitively binding to the enzyme mediating reverse transcription.
(37) Similarly, in embodiments employing reverse transcription in the presence of the probe, neither (or none) of the oligonucleic acids of the probe bind to the target RNA at the temperature at which reverse transcription occurs.
EXAMPLES
(38) The present invention will be further clarified by the following examples, which are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.
Example 1. Effect of the Length Difference Between the Two Oligonucleic Acids of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by Melting Curve Assays
(39) Melting reactions were performed in a Stratagene Mx4000 multiplex quantitative PCR system with the following cycle conditions: 1 cycle of denaturation at 95 C. for 3 min; 75 cycles of 1-minute holding at a range of temperatures from 85 C. to 10 C. with an 1 C. decrement per cycle. Fluorescein (FAM) fluorescence measurements were recorded during each 1-minute hold of the 75 cycles. At the end of each run, the data were analyzed and melting curves were generated.
(40) Table 2 sets forth the sequences of PCR primers and linear probes used in this and the following examples.
(41) TABLE-US-00002 TABLE2 Name Sequence PCRPrimers FP-29 5-ATTCCCTACAATCCCCAAAGTCAAGGAGT-3 (SEQIDNO:1) RP-25 5-CCCCTGCACTGTACCCCCCAATCCC-3(SEQIDNO:2) RP-24 5-CCCCTGCACTGTACCCCCCAATCC-3(SEQIDNO:3) LinearProbes.sup.1labeledwithFAM 520-20 6-FAM-(5)-ACAGCAGTACAAATGGCAGT-(3)-DABCYL(SEQID NO:4) 520-31 6-FAM-(5)-ACAGCAGTACAAATGGCAGTATTCATCCACA-(3)- DABCYL(SEQIDNO:5) lin-41 6-FAM-(5)- GCTACAGCAGTACAAATGGCAGTATTCATCCACAATTTCCC-(3)- DABCYL(SEQIDNO:6) slin-47 6-FAM-(5)- GCACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAA A-(3)-DABCYL(SEQIDNO:7) dfam-50 6-FAM-(5)- GCACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAA ACGC-(3)-6-FAM(SEQIDNO:8) fam-650 6-FAM-(5)-GCACAGCAGTACAAATGGCAGTATTCATCCACAAT(dT- FAM)TTAAAAGAAAACGC-(3)-6-FAM(SEQIDNO:9) QuenchingOligos.sup.2labeledwithDABCYL que-12 (5)-GTATTGTACTGCTGT-(3)-DABCYL(SEQIDNO:10) que-14 (5)-CGGATTTGTACTGCTGT-(3)-DABCYL(SEQIDNO:11) que-16 (5)-GACCCATTTGTACTGCTGT-(3)-DABCYL(SEQIDNO:12) que-22 DABCYL-(5)-GACCCATTTGTACTGCTGTAGC-(3)-DABCYL(SEQ IDNO:13) que-23 DABCYL-(5)-TGAGCCATTTGTACTGCTGTAGC-(3)-DABCYL (SEQIDNO:14) sque-15BH 5-TTTGTACTGCTGTGC-(3)-BHQ-1(SEQIDNO:15) bhq-5015 BHQ-1-(5)-GCGTTTTCTTTTAAA-(3)-BHQ-1(SEQIDNO:16) .sup.1Sequences substantially complementary with targets are underlined (m). .sup.2Sequences substantially complementary with linear FAM probes are underlined (n).
(42) In each assay, 100 l reaction contained 1.25RT-PCR buffer (62.5 mM Bicine, pH 8.05-8.25, 143.75 mM potassium acetate, 10% glycerol, 0.125 mM EDTA, 0.0125 mg/ml acetylated bovine serum albumin (acetylated-BSA), 0.078% (v/v) Tween 20, and 0.025% (w/v) sodium azide), 2.5 mM MnCl.sub.2, 0.2 M FAM-labeled oligonucleic acid (oligo), 0.2 M DABCYL-labeled quenching oligo and 1 M single-stranded complementary target oligo that was 48 nucleotides long and comprised 0, 1, 2, 3, or 4 mismatches with the FAM labeled oligo (oligos were obtained from Sigma-Genosys). The length of the FAM-labeled oligo was either 20 or 31 nucleotides long, while the DABCYL-labeled quenching oligo was 12, 14 or 16 nucleotides in length.
(43) At high temperatures, the FAM-labeled oligo and the shorter complementary DABCYL-labeled quenching oligo of each double-stranded linear probe set were separated, thus leading to the restoration of FAM fluorescence. In the absence of target oligo, these two oligos tended to gradually hybridize with each other as the incubation temperature decreased and formed a non-fluorescent duplex due to the close proximity of the fluorophore FAM and the quencher DABCYL. The Tm's of the quenching oligos determined the incubation temperatures at which the non-fluorescent duplexes started to form. The quenching oligo que-16 carrying a length of 16 complementary nucleotides (Table 2) began the formation of the non-fluorescent duplexes at about 60 C. (
Example 2. Effect of the Length Difference Between the Two Oligonucleic Acids of a Nucleic Acid Probe on Mismatch Tolerance Evaluated by Quantitative Real-Time RT-PCR Assays
(44) This example shows the evaluations on three different probe sets 520-20/que-16, 520-20/que-12 and 520-31/que-14 for their mismatch tolerances by performing the quantitative real-time RT (reverse transcription)-PCR assays. Five transcripts carrying different mutations were employed to test these three probe sets. In these non-competitive quantitative assays, each 100 l RT-PCR reaction contained 1.25RT-PCR buffer (62.5 mM Bicine, pH 8.05-8.25, 143.75 mM potassium acetate, 10% glycerol, 0.125 mM EDTA, 0.0125 mg/ml acetyl bovine serum albumin (BSA), 0.078% (v/v) Tween 20, and 0.025% (w/v) sodium azide), 2.5 mM MnCl.sub.2, 0.375 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 13.13 units of rTth DNA polymerase (Applied Biosystems), 0.6 M HIV forward PCR primer FP-29, 1.6 M HIV reverse PCR primer RP-25 (Table 2), 0.1 M internal control (IC) forward primer-196, 0.3 M IC reverse primer-310, 0.2 M FAM-labeled oligo probe for detection of the HIV PCR products, 0.2 M DABCYL-labeled quenching oligo for quenching fluorescence signal of the FAM probe, 0.1 M VIC-labeled beacon probe for detecting the IC PCR products (all fluorophore-labeled and quencher-labeled oligos obtained from TriLink), 1 FRETROX (Applied Biosystems) as the reference dye for signal normalization, 5,000 copies of IC transcript and different levels of HIV wild type transcript standards (0, 4.1710.sup.1, 4.1710.sup.2, 4.1710.sup.3, 4.1710.sup.4 or 4.1710.sup.5 copies per reaction). To quantify the five transcripts by each of the three probe sets, each transcript at 110.sup.4 copies/reaction was used to run the assay along with the wild type transcript standards. Amplification reactions were performed in an Applied Biosystems 7000 Sequence Detection PCR system with the following cycle conditions: 1 cycle of reverse transcription at 59 C. 30 min; 2 cycles of low-stringent amplification at 95 C. 1 Min and 54 C. 1 min; 10 cycles of high-stringent amplification at 95 C. 15 sec and 59 C. 1 min; and 40 amplification and detection cycles of 95 C. 15 sec and 45 C. 2 min 30 sec. Fluorescence measurements were recorded during each 45 C. step of the 40 cycles. At the end of each real-time PCR run, the data was automatically analyzed by the system and amplification plots were obtained. Quantities of the five sample transcripts were determined by using the calibration curve obtained from plotting the log.sub.10 HIV standard copy numbers against their respective fluorescence threshold cycles (C.sub.T).
(45) TABLE-US-00003 TABLE 3 Quantifications of transcripts (4.0 log10 per reaction) with 0 or 2 mismatches by using the double-stranded probe 520-20/que-16 Number of Positions of Quantity Mismatches Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.42 0 n/a 4.41 2 6, 12 3.03 2 9, 12 2.90 2 12, 18 3.37 .sup.1Positions of mismatches show the positions of mismatched nucleotides starting from the 5 end of the HIV FAM probe 520-20. n/a: not applicable.
(46) TABLE-US-00004 TABLE 4 Quantifications of transcripts (4.0 log10 per reaction) with 0 or 2 mismatches by using the double-stranded probe 520-20/que-12 Number of Positions of Quantity Mismatches Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.47 0 n/a 4.46 2 6, 12 4.03 2 9, 12 4.13 2 12, 18 4.13 .sup.1Positions of mismatches show the positions of mismatched nucleotides starting from the 5 end of the HIV FAM probe 520-20. n/a: not applicable.
(47) TABLE-US-00005 TABLE 5 Quantifications of transcripts (4.0 log10 per reaction) with 0, 2, 3 or 4 mismatches by using the double-stranded probe 520-31/que-14 Number of Positions of Quantity Mismatches Mismatches.sup.1 (log 10 cps/reaction) 0 n/a 4.50 2 6, 12 4.31 3 9, 12, 22 4.31 3 12, 18, 27 4.11 4 21, 24, 25, 27 4.31 .sup.1Positions of mismatches show the positions of mismatched nucleotides starting from the 5 end of the HIV FAM probe 520-31. n/a: not applicable.
Example 3. Inhibition of RT-PCR by a Quenching Oligonucleotide with a Tm Higher than the RT Temperature
(48) To examine the impact of utilizing a quencher probe with a Tm that is above the incubation temperature of the RT reaction, performance of the probe combination, lin-41 and que-23 (Table 2), was evaluated in a quantitative real-time reverse transcription (RT)-PCR assay. The quenching oligo, que-23, has a Tm of 60.27, above the 59 C. RT incubation temperature. In this competitive quantitative assay, each 100 l RT-PCR reaction was carried out in the presence of 1EZ buffer (containing 50 mM Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA polymerase (all from Applied Biosystems), 0.2 M HIV forward PCR primer FP-29, 1.0 M HIV reverse PCR primer RP-24, 0.1 M FAM-labeled oligo probe lin-41 for detection of the HIV wild type PCR products, 0.2 M DABCYL-labeled quenching oligo que-23 to quench the FAM probe, 0.1 M Texas Red-labeled beacon probe bpic-7 for detecting the internal control (IC) PCR products, 0.04 g/ml Alexa (Molecular Probes) as the reference dye for signal normalization, 100 copies of internal control transcript and different copy numbers of HIV wild type transcript (0, 10, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 copies). Amplification reactions were performed in a Stratagene Mx4000 multiplex quantitative PCR system with the following cycle conditions: 1 cycle of reverse transcription at 95 C. 5 sec and 59 C. 30 min; 2 cycles of low-stringent amplification at 95 C. 30 sec, 54 C. 30 sec and 72 C. 30 sec; 10 cycles of high-stringent amplification at 95 C. 30 sec, 59 C. 30 sec and 72 C. 30 sec; 33 amplification and detection cycles of 95 C. 30 sec, 50 C. 1 min and 72 C. 30 sec. Fluorescence measurements were recorded during each 50 C. step of the 33 cycles. At the end of each real-time PCR run, the data was automatically analyzed by the system and amplification plots were obtained. Amplification curves of the wild type and the internal control transcripts are shown in
Example 4. Elimination of Inhibition by a Quenching Oligonucleic Acid with a Tm Lower than the RT Temperature in RT-PCR
(49) To evaluate the relationship between the Tm of the quenching oligo and RT-PCR assay performance, the FAM-labeled probe, lin-41, was used in combination with the quenching oligo, que-22 (Table 2). The oligo, que-22, has a Tm of 55.86 C., below the 59 C. incubation temperature of reverse transcription (RT). A quantitative real-time RT-PCR assay was performed as described in Example 3, with the exception that the quenching oligo, que-22, was substituted for que-23. The resulting data is presented in
Example 5. Signal Enhancements by Using Linear Probes Labeled with More than One Fluorescent Molecule
(50) To examine whether fluorescence signals generated in RT-PCR assays could be enhanced by use of linear probes carrying more than one fluorescent label, a quantitative real-time RT-PCR. assay was set-up with multiply labeled probes. Three FAM-labeled linear probes, slin-47, dfam-50 and fam-650 (Table 2) were used, along with two quenching oligos, sque-15BH and bhq-5015. Both quenching oligo probes bind to all three FAM-labeled linear probes. Probe slin-47 carries one FAM (1FAM) at the 5 end and a DABCYL at the 3 end, while probe dfam-50 has one FAM at both 5 and 3 ends (2FAM); probe fam-650 possesses an internal FAM in addition to its two terminal FAMs (3FAM). The RT-PCR reactions in this competitive quantitative assay were carried out under the condition similar to that described in Example 3. Each 100 l RT-PCR reaction contained 1EZ buffer (containing 50 mM Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA polymerase,(all from Applied Biosystems), 0.1 M HIV forward PCR primer FP-29, 1.0 M HIV reverse PCR primer RP-24, 0.2 M FAM-labeled oligo probe (slin-47, dfam-50 or fam-650) for detection of the HIV wild type PCR products, 0.25 M BHQ-labeled quenching oligo sque-15BH to quench the 5 end of the FAM probe, 0.25 M BHQ-labeled quenching oligo bhq-5015 to quench the 3 end of the FAM probe, 0.2 M Texas Red-labeled beacon probe bpic-7BH for detecting the internal control (IC) PCR products, 0.04 g/ml Alexa as the reference dye for signal normalization, 100 copies of internal control transcript and different copy numbers of HIV wild type transcript (0, 10, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 copies). Amplification reactions were performed in a Stratagene Mx4000 multiplex quantitative PCR. system with the following cycle conditions: 1 cycle of reverse transcription at 59 C. 60 min; 2 cycles of low-stringent amplification at 95 C. 1 min and 54 C. 1 min; 10 cycles of high-stringent amplification at 95 C. 15 sec and 59 C. 1 min; 33 amplification and detection cycles of 95 C. 15 sec and 40 C. 2 min 30 sec. Fluorescence measurements were recorded during each 40 C. step of the 33 cycles. At the end of each real-time PCR run, the data were automatically analyzed by the system and amplification plots were obtained. Typical amplification profiles were observed at all input levels of wild type transcript by all three FAM-labeled probes.
Example 6. Quantification of Transcripts with or Without Mutations
(51) To examine the utility of partially double-stranded probes for reliably detecting and quantifying templates with mismatches, probe set fam-650 (3 FAM labels)/sque-15BH+bhq-5015 (Table 2) was used to quantify transcripts with multiple mutations. Each of five transcripts carrying 0, 2, 3, 4 or 5 mutations was quantified in a real-time RT-PCR assay. Transcript copy number was determined by OD260 measurement. The assay was standardized using different copy numbers of wild type transcript. The RT-PCR reactions in this competitive quantitative assay were carried out under the condition similar to that described in Example 5. Each 100 l RT-PCR reaction contained 1EZ buffer (containing 50 mM Bicine, pH 8.2, 115 mM potassium acetate and 8% glycerol), 2.5 mM Mn(OAc)2, 0.4 mM of each deoxynucleotide-triphosphate (dATP, dCTP, dGTP, dTTP), 20 units of RNase inhibitor, 10 units of Tth DNA polymerase, 0.1 M HIV forward PCR primer FP-29, 1.0 M HIV reverse PCR primer RP-24, 0.15 M FAM-labeled oligo probe fam-650 for detection of the HIV wild type PCR products, 0.25 M BHQ-labeled quenching oligo sque-15BH to quench the 5 end of the FAM probe, 0.25 M BHQ-labeled quenching oligo bhq-5015 to quench the 3 end of the FAM probe, 0.1 M Texas Red-labeled linear probe trp-34 for detecting the internal control (IC) PCR products, 0.1 M BHQ-labeled quenching oligo etrp-15bhq to quench the Texas Red IC, 0.04 g/ml Alexa as the reference dye for signal normalization, 200 copies of internal control transcript and different copy numbers of HIV wild type standard transcript (0, 10, 10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 or 10.sup.6 copies). To quantify the five transcripts, 810.sup.3 copies of each transcript instead of the wild type standard were added into one RT-PCR reaction and amplified along with the seven HIV standards. Amplification reactions were performed in a Stratagene Mx4000 multiplex quantitative PCR system with the following cycle conditions; 1 cycle of reverse transcription at 59 C. 60 min; 2 cycles of low-stringent amplification at 95 C. 1 min and 54 C. 1 min; 10 cycles of high-stringent amplification at 95 C. 15 sec and 59 C. 1 min; 33 amplification and detection cycles of 95 C. 15 sec and 40 C. 2 min 30 sec. Fluorescence measurements were recorded during each 40 C. step of the 33 cycles. At the end of each real-time PCR run, the data were automatically analyzed by the system and amplification plots were obtained.