USE OF A NUCLEASE FOR REDUCING THE VISCOSITY AND/OR PREVENTING AN INCREASE IN VISCOSITY OF A FERMENTATION BROTH

Abstract

The invention relates to the use of a protein having nuclease activity for reducing the viscosity and/or preventing an increase in viscosity of a fermentation broth, which comprises intact microorganisms after termination of the fermentation process. The invention moreover relates to a method for reducing the viscosity and/or preventing an increase in viscosity of a fermentation broth comprising intact microorganisms after fermentation and comprising a step of introducing a protein having nuclease activity into the fermentation broth during the fermentation until the start of recovering the end product. The invention further relates to fermentation processes comprising said use of a protein having nuclease activity to allow more flexibility to the downstream processing of the fermentation broth.

Claims

1. (canceled)

2. A method for reducing the viscosity and/or preventing an increase in viscosity of a fermentation broth comprising intact microorganisms after termination of the fermentation process, comprising a step of introducing a protein having nuclease activity into the fermentation broth before recovering an end product of the fermentation process.

3. The method of claim 2, wherein the end product of the fermentation process is a microorganism of interest or a target product produced by a microorganism.

4. The method of claim 3, wherein the target product produced is selected from an enzyme, a hormone, an immunoglobulin, a vaccine, an antibiotic, an amino acid, a sugar or a vitamin.

5. The method of claim 2, wherein the protein having nuclease activity reduces the thixotropy of the fermentation broth after the end of the fermentation process.

6. The method of claim 2, wherein the protein having nuclease activity is selected from nucleases, preferably bacterial nucleases, more preferably bacterial nucleases belonging to the Pfam family PF14040, even more preferably NucB or NucA from the group comprising Gram-positive bacteria such as a Bacillus, Brevibacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Lysinibacillus, Oceanobacillus, Paenibacillus, Staphylococcus, Streptococcus, Streptomyces, or Thermoactinomyces or Gram-negative bacteria such as an Acinetobacter, Agrobacterium, Burkholderia, Enterobacter, Erwinia, Escherichia, Lysobacter, Methylomonas, Mesorhizobium, Photobacterium, Pseudomonas, Rhizobium, Serratia, or Xenorhabdus, such as Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis.

7. The method of claim 2, wherein the microorganism is selected from filamentous fungi, yeast or bacteria, preferably from Actinoplanes, Agrobacterium, Bacillus, Brevibacillus, Clostridium, Enterococcus, Escherichia, Erwinia, Geobacillus, Haemophilus, Lactobacillus, Lactococcus, Lysinibacillus, Oceanobacillus, Paenibacillus, Proteus, Pseudomonas, Rhizobium, Staphylococcus, Streptococcus, Streptomyces, Thermoactinomyces, Xanthomonas, Acremonium, Hyprocrea, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Kluyveromyces, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Pichia, Piromyces, Pleurotus, Saccharomyces, Schizophyllum, Streptomyces, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.

8. The method of claim 7, wherein the filamentous fungus, yeast or bacterium is preferably selected from Hyprocrea jecorina, Trichoderma reesei, Trichoderma viride, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Aspergillus niger, Aspergillus oryzae, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Humicola insolens, Humicola grisea, Streptomyces sp., Streptomyces violaceoruber, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus clausii, Bacillus pumilus, Bacillus subtilis, Bacillus sp, Bacillus megaterium, Geobacillus stearothermophilus, or Thermotoga maritima.

9. The method of claim 2, wherein the nuclease is added at the end of the fermentation process or is produced by expression by a microorganism during fermentation.

10. The method of claim 9, wherein the nuclease is added to the fermentation process at a final concentration of at least 10 mg, at least 1 mg, at least 0.1 mg, at least 0.01 mg, at least 0.001 mg, at least 0.0001 mg nuclease per 100 ml fermentation broth.

11. The method of claim 9, wherein the nuclease is expressed by the microorganism of interest or a microorganism capable of producing a target product or by a separate co-cultivated microorganism.

12. The method of claim 2, wherein at least the following steps are encompassed: (i) cultivating a microorganism of interest or a microorganism capable of producing a target product, (ii) adding a nuclease by direct addition or by co-expression of the nuclease by the microorganism of interest or the microorganism capable of producing a target product, (iii) obtaining a fermentation broth comprising a nuclease and a) the microorganism of interest or b) a microorganism capable of producing target product and the target product, and (iv) recovering a) the microorganism of interest or b) the target product.

13. The method of claim 2, wherein at least the following steps are encompassed: (i) cultivating a microorganism of interest or a microorganism capable of producing a target product, (ii) obtaining a fermentation broth comprising a microorganism of interest or the target product and the microorganism capable of producing a target product, (iii) adding a nuclease to the fermentation broth, and (iv) recovering the microorganism of interest or the target product.

14. The method of claim 2, wherein at least the following steps are encompassed: (i) cultivating a microorganism of interest or a microorganism capable of producing a target product, and co-cultivating a microorganism capable of producing a nuclease, (ii) obtaining a fermentation broth comprising a microorganism capable of producing a nuclease and a nuclease, and a) a microorganism of interest or b) a target product and the microorganism capable of producing a target product, and (iii) recovering a) the microorganism of interest or b) the target product.

15. The method of claim 12, wherein the step of recovering the target product may be carried out within a time interval of one hour to two weeks preferably one hour to ten days, more preferably one hour to eight days, still more preferably one hour to six days, still more preferably one hour to 4 days, still more preferably one hour to two days, still more preferably one hour to 1 day after the end of the fermentation process.

16. The method of claim 13, wherein the step of recovering the target product may be carried out within a time interval of one hour to two weeks preferably one hour to ten days, more preferably one hour to eight days, still more preferably one hour to six days, still more preferably one hour to 4 days, still more preferably one hour to two days, still more preferably one hour to 1 day after the end of the fermentation process.

17. The method of claim 14, wherein the step of recovering the target product may be carried out within a time interval of one hour to two weeks preferably one hour to ten days, more preferably one hour to eight days, still more preferably one hour to six days, still more preferably one hour to 4 days, still more preferably one hour to two days, still more preferably one hour to 1 day after the end of the fermentation process.

18. The method of claim 6, wherein the nuclease is a NucB nuclease from B. amyloliquefaciens.

Description

DESCRIPTION OF THE FIGURES

[0056] The following figures explain the subject-matter of the present invention.

[0057] FIG. 1 shows a plasmid for the expression of the NucB nuclease from B. amyloliquefaciens.

[0058] FIG. 2 shows an SDS-PAGE analysis of the supernatant of the fermentation of strain B. pumilus RH11925. The protein band of nuclease NucB was detectable at 11 kDa and is marked by an arrow. Amersham Low Molecular Weight Calibration Kit (GE Healthcare) was used for molecular weight determination.

[0059] FIG. 3 shows two plasmids for co-expression of the nuclease NucB from B. amyloliquefaciens with xylanase as a model enzyme in B. pumilus (pEV12::nucB) and B. amyloliquefaciens (pTP15::nucB).

[0060] FIG. 4 shows the measurement of the viscosity of a fermentation broth of Bacillus pumilus strain RH12006 after a standing time of 0 hours. The fermentation broth was treated either with 0.1 or 1% (v/v) NucB (3.5 mg/ml) and compared to the untreated reference. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The untreated reference was set to 100% and used to calculate the relative viscosity.

[0061] FIG. 5 shows the measurement of the viscosity of the fermentation broth of Bacillus pumilus strain RH12006 after a standing time of 72 hours. The fermentation broth was treated either with 0.1 or 1% (v/v) NucB (3.5 mg/ml) and compared to the untreated reference. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The untreated reference was set to 100 and used to calculate the relative viscosity.

[0062] FIG. 6 shows the measurement of the viscosity of samples from the fermentation broth of an Aspergillus oryzae fermentation producing alpha amylase after a standing time of 24 hours. The fermentation broth was treated with 0.1% (v/v) NucB (3.5 mg/ml) and compared to the untreated reference. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 3 points of measurement per minute and a duration of measurement of 5 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0063] FIG. 7 shows the measurement of the viscosity of samples from the fermentation broth of an Aspergillus oryzae fermentation producing alpha amylase after a standing time of 72 hours. The fermentation broth was treated with 0.1% (v/v) NucB (3.5 mg/ml) and compared to the untreated reference. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 3 points of measurement per minute and a duration of measurement of 5 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0064] FIG. 8 shows the measurement of the viscosity of the fermentation broth of Bacillus pumilus strain with (RH12091) and without nuclease NucB coexpression (RH12006) after a standing time of 0 hours. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0065] FIG. 9 shows the measurement of the viscosity of the fermentation broth of Bacillus pumilus strain with (RH12091) and without nuclease NucB coexpression (RH12006) after a standing time of 30 hours. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0066] FIG. 10 shows the measurement of the viscosity of the fermentation broth of Bacillus amyloliquefaciens with (RH12111) and without nuclease NucB coexpression (RH11094) after a standing time of 5 hours. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0067] FIG. 11 shows the measurement of the viscosity of the fermentation broth of Bacillus amyloliquefaciens with (RH12111) and without nuclease NucB coexpression (RH11094) after a standing time of 70 hours. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 20 points of measurement per minute and a duration of measurement of 3 seconds. The starting point of the untreated reference was set to 100% and used to calculate the relative viscosity.

[0068] FIG. 12 shows the change in viscosity of slime formed after the fermentation of Bacillus pumilus strain RH12006 before and after treatment with nuclease. 1% (v/v) of Nuclease NucB (3.5 mg/ml) was added to the fermentation broth after 10 minutes. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 8 points of measurement per minute and a duration of measurement of 7.5 seconds. The baseline before addition of the nuclease NucB (timeframe 0 600 sec) was set to 100% and used to calculate the relative viscosity.

[0069] FIG. 13 shows the change in viscosity of the fermentation broth of Bacillus amyloliquefaciens strain RH11094 before and after treatment with nuclease NucB. 1% (v/v) of Nuclease NucB (3.5 mg/ml) was added to the fermentation broth after 10 minutes. Viscosity was measured with a constant stirring rate of 100 rounds per minute, 8 points of measurement per minute and a duration of measurement of 7.5 seconds. The baseline before addition of the nuclease NucB (timepoints 0-600 sec) was set to 100% and used to calculate the relative viscosity.

[0070] The following examples explain the invention further.

EXAMPLES

Example 1: Construction of a Strain for Expression of a Nuclease

[0071] Two types of plasmids have been prepared. The first plasmid type is a plasmid in which a NucB variant (from B. amyloliquefaciens) is overexpressed in a separate fermentation process. The second plasmid type is a plasmid for the co-expression of a nuclease activity together with a target product (xylanase).

[0072] 1.1 Cloning of a Plasmid for the Expression of a Nuclease

[0073] The nucB gene from B. amyloliquefaciens was placed under the control of the PaprE promotor from B. licheniformis DSM13. As a signal peptide the naturally occurring signal peptide was used. The cloning was effected by means of a PCR amplification and a consequent Gibson assembly using the following primers. Backbone and insert were amplified with the listed primers using the Phusion® High-Fidelity DNA Polymerase (New England Biolabs). Purification of the resulting PCR products was performed using the Wizard® SV Gel & PCR Clean-Up Kit (Promega). Assembly of the purified backbone and insert was subsequently achieved with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs).

TABLE-US-00001 TABLE 1 name of the primer SEQ ID NO sequence 5′.fwdarw.3′ Tm target fragment pEV1_1 SEQ ID NO: 01 GACAGAGATATACCGACAGTG 58 pEV1 vector pEV1_2 SEQ ID NO: 02 TACTCACTCTCCTCCTTTTTATTC 58 backbone nucB_fw1 SEQ ID NO: 03 GGAGGAGAGTGAG- 73 Insert_nucB TAATGAATGCGTTTATGAAATGGGCGGC nucB_rv SEQ ID NO: 04 CGGTATATCTCTGTCTTACTGAACGA- 72 TAAATAATACTCTCGTGCCG

[0074] The cloning batch was subsequently transformed into a supercompetent Bacillus subtilis strain (SCK6; Zhang & Zhang 2010). The thus constructed expression plasmid was checked as to its integrity by means of a plasmid preparation, restriction enzyme digest and Sanger sequencing. Plasmid isolation was done from a fresh overnight culture in Luria Bertani medium with the aid of the QIAprep Spin Miniprep Kit (QIAGEN). Restriction enzyme digest was performed and evaluated via gel electrophoresis. Sanger sequencing was performed externally by SeqLab (Microsynth AG). The plasmid was then transformed into a B. pumilus strain resulting in the nuclease overexpressing strain RH11925. The thus obtained clones were verified via plasmid preparation, restriction enzyme digest and Sanger sequencing and three clones were further cultivated in shake flasks. The plasmid map of the created construct is shown in FIG. 1.

[0075] 0.5 L MBR (Mini BioReactor) Fermentation

[0076] The strain RH11925 was then fermented in a scale of 0.5 L MBR in a standard fermentation process as described in EP2145006 B1.

[0077] After termination of the fermentation the culture broth was harvested and centrifuged. The supernatant was sterile filtered and stored at −20° C. for further use. Additionally, the supernatant was analysed by means of a qualitative SDS-PAGE. Amersham Low Molecular Weight Calibration Kit (GE Healthcare) was used for molecular weight determination. The results are presented in FIG. 2. The size of the nuclease NucB was determined as 11 kDa. To verify that samples contain active Nuclease NucB spiking experiments were carried out with purified plasmid DNA. 150 ng of plasmid DNA were spiked into 5 μl of supernatant and incubated for 30 min at room temperature. Finally, the samples were mixed with 10× loading buffer and analyzed by agarose gel electrophoresis. Plasmid DNA spiked into supernatant of strain B. pumilus RH11925 was fully digested after 30 min, whereas plasmid DNA in supernatant of the reference strain B. pumilus RH11689 still remained intact after 30 min. Total protein (Bio-Rad Protein Assay) was measured in the supernatant of the fermentation sample from B. pumilus RH11925. The concentration of the nuclease NucB was determined with 3.5 mg/ml.

[0078] 1.2 Cloning of the Plasmids for the Co-Expression of a Nuclease

[0079] The nuclease NucB of B. amyloliquefaciens as used under item 1.1 was further cloned together into the xylanase expression plasmids pEV12 (EP 3385377 A1) and a derivative of pTP15 (EP2145006 B1). The corresponding plasmids are shown in FIG. 3. The cloning was effected by means of PCR amplification and a consequent Gibson assembly as detailed above using the following primers:

TABLE-US-00002 TABLE 2 Name of the primer SEQ ID NO Sequence 5′.fwdarw.3′ Tm target pEV_1 SEQ ID NO: 05 GTTCAAAATGG- 49 Backbone TATGCGTTTTG pEV_2 SEQ ID NO: 06 TCGGCAAAAAATGATCTC 1330_nucB_fw SEQ ID NO: 07 ACGCATACCATTTT- 51 Nuclease with GAACTTTATCTGCCGAAGA- promotor CACTG 1330_nuCB_rv SEQ ID NO: 08 GAGATCATTTTTTGCCGAC- GAACCGGAGAAGTTACTG

[0080] The construction of the plasmids and of the expression strains was carried out as described in section 1.1 above. The following strains were constructed and used for fermentation and standing time experiments (Table 3).

TABLE-US-00003 TABLE 3 Species Strain Plasmid Bacillus pumilus RH12006 pEV12 Bacillus pumilus RH12091 pEV12::nucB Bacillus amyloliquefaciens RH11094 pTP15 Bacillus amyloliquefaciens RH12111 pTP15:nucB

Example 2: Fermentation for Producing Enzyme Containing Fermentation Broth

[0081] 1. Fermentations for Separate Nuclease Treatment

[0082] a. Bacillus pumilus Fermentation (Xylanase):

[0083] The xylanase producing strain B. pumilus RH12006 was cultivated in a 30 L fermenter in a standard fermentation process as described in EP2145006 B1.

[0084] The fermentation broth obtained at the end of the fermentation was used for the determination of the viscosity with and without addition of nuclease NucB.

[0085] b. Aspergillus oryzae Fermentation (Amylase):

[0086] A 30 L fermentation was carried out using an A. oryzae strain which is a classical amylase expression strain. The fermentation medium and the fermentation conditions are similar to what is described in Bailey and Linko (1990) and Carlsen et al. 1995.

[0087] 2. Fermentations for Nuclease Coexpression

[0088] The coexpression strains for B. pumilus and B. amyloliquefaciens described in section 1.2 were used for fermentation experiments. Fermentation conditions were applied as stated in section 1.1. Fermentation broth was harvested and used for standing time experiments. The coexpressed nuclease was not detectable in SDS PAGE analysis which indicates a low expression level of the nuclease but has a clear effect on the viscosity of the fermentation broth.

[0089] 3. Determination of the Viscosity

[0090] The viscosity of the fermentation broth as obtained above was determined using a RheolabQC rotation viscosimeter of the company AntonPaar.

[0091] With this measurement a stirrer rotates within the liquid which exerts a counterforce on said stirrer. Said counterforce is higher, the higher the viscosity of the solution is. In the present setting a spade is rotated at a constant speed in a beaker containing the fermentation broth. The dynamic viscosity is measured and expressed in the unit mPa*s and transferred in relative viscosity by setting the reference (no nuclease treatment) as 100%.

[0092] 4. Standing Time Experiment

[0093] At the end of the above 30 L fermentations samples from each supernatant were taken and treated with nuclease at different concentrations (0.1% and 1%). The viscosity was measured (viscosity between 0 h and 5 h) unless otherwise stated. Said samples were left standing for 72 hours at room temperature without stirring and then the viscosity was measured again. The following results were obtained.

[0094] 4.1 Measurement of Samples from B. pumilus Fermentation after a Standing Time of 0-5 h and 72 h with and without Nuclease Treatment

[0095] Measurement after 0 h-5 h:

[0096] 1.5 kg fermentation broth from fermentation of B. pumilus RH12006 was taken and filled into three 600 mL beakers in portions of 500 g each. Beaker No. 1 was treated with 1% nuclease supernatant (from strain RH11925-3.5 mg/ml NucB). Beaker No. 2 was treated with 0.1% nuclease supernatant (from strain RH11925-3.5 mg/ml NucB). Beaker No. 3 was not treated and served as a control sample. The viscosities were measured and the results are presented in FIG. 4.

[0097] It was found that shortly after the addition of nuclease a lowering of viscosity compared to the reference sample was obtained (reduction of 30% compared to referential sample). There was no difference between the two types of dosage which indicates a dosage independent effect for concentrations similar or above 0.1% (v/v) NucB (3.5 mg/ml).

[0098] Measurement after 72 h:

[0099] The beakers described above were left standing for 72 h at room temperature. In contrast to the samples treated with nuclease, the comparative sample showed the formation of slime after 72 hours. Then the viscosity was measured again and the results are presented in FIG. 5.

[0100] It was found that in the referential sample the viscosity increased significantly in contrast to the samples treated with nuclease. For the NucB treated samples a viscosity was obtained that revealed only 10% of the viscosity measured for the referential sample. Again there were no differences between the two types of dosage.

[0101] 4.2 Determination of the Viscosity of Samples from the Fermentation with Aspergillus oryzae after Standing Times of 0 h and 72 h with and without Nuclease Treatment

[0102] Samples of a fermentation of Aspergillus oryzae having produced an alpha amylase were aliquoted in 500 g portions at the end of the fermentation and treated either with or without 1% nuclease NucB (3.5 mg/ml). Due to the fact that viscosity of Aspergillus oryzae culture samples are influenced stronger by mechanical shear forces than Bacillus culture samples (thixotropic effect) the first time point for measurement was moved to 24 hours to exclude an influence of the initial mixing procedure to the viscosity measurement. The samples were incubated and measured after 24 h and 72 h. Measurements were taken every 20 seconds for five seconds over a time span of 5 minutes.

[0103] Measurement after 24 h:

[0104] The results are presented in FIG. 6. It could be clearly observed that the thixotropic effect is no longer present in the NucB treated sample whereas the nontreated samples show a higher viscosity and an influence by the stirring procedure applied during measurement. The viscosity of the culture broth was reduced by 15% compared to the starting point of the referential sample.

[0105] Measurement after 72 h:

[0106] Compared to the results received after 24 h standing time a further reduction of 30% compared to referential strain was observed after 72 h, whereas the thixotropic character of the referential sample is still present. The results are presented in FIG. 7.

[0107] 4.3 Determination of the Viscosity of Samples from the Fermentation with Bacillus pumilus Coexpression Strains after Standing Times of 0 h and 30 h

[0108] Samples of fermentations from Bacillus pumilus RH12006 and RH12091 (nuclease coexpression) having produced a xylanase were harvested and the viscosity was measured after standing times of 0 h and 24 h.

[0109] Measurement after 0 h:

[0110] The viscosity of both samples was measured continuously over a time span of 90 seconds. It was found that the sample with nuclease coexpression has a significantly lower viscosity than the reference without coexpression. The results are shown in FIG. 8.

[0111] Measurement after 30 h:

[0112] The samples described above were left standing for 30 h. Then the viscosity was measured and again the sample with coexpression showed significantly lower viscosity. The results are presented in FIG. 9.

[0113] 4.4 Determination of the Viscosity of Samples from the Fermentation with Bacillus amyloliquefaciens Coexpression after Standing Times of 0 h and 70 h

[0114] Samples of fermentations from Bacillus amyloliquefaciens RH11094 and the nuclease coexpression strain B. amyloliquefaciens RH12111 having produced a xylanase were harvested and the viscosity was measured after standing times of 0 h and 70 h. The reduction was in a range of 40 to 85% compared to the referential sample for both time points.

[0115] Measurement after 0 h:

[0116] The viscosity of both samples was measured continuously over a time span of 90 seconds. It was found that the sample with nuclease coexpression has a significantly lower viscosity than the reference without nuclease coexpression. The results are shown in FIG. 10.

[0117] Measurement after 70 h:

[0118] The samples described above were left standing for 70 h. Then again the viscosity was measured and the results are presented in FIG. 11. The results were similar as observed for time point 0 h.

[0119] 4.5 Treatment of the Slime in the Referential Sample from Bacillus pumilus with Nuclease

[0120] In the following the viscosity of the referential sample (B. pumilus RH12006) was measured for 30 minutes. After 10 minutes 1% nuclease NucB (3.5 mg/ml) was added and again the viscosity was recorded for 20 minutes. The results are presented in FIG. 12.

[0121] It was found that the viscosity decreased significantly after the addition of nuclease (reduction of 85%). After approximately 70 seconds 50% of viscosity reduction was already achieved. This indicates that a steady state is reached within minutes and not hours after addition of nuclease NucB.

[0122] 4.6 Treatment of the Slime in the Referential Sample from Bacillus amyloliquefaciens with Nuclease

[0123] In the following the viscosity of the referential sample was measured for 20 minutes. After 10 minutes 1% nuclease supernatant (from strain RH11925-3.5 mg/ml)) was added and again the viscosity was recorded for 10 minutes. The results are presented in FIG. 13.

[0124] It was found that the viscosity decreased significantly after the addition of nuclease. Also for B. amyloliquefaciens a similar effect was observed as seen for B. pumilus. The steady state was reached within minutes after addition of nuclease.