Process for stimulating hyaluronic acid synthesis

Abstract

Compositions allowing the stimulation of hyaluronic acid synthesis via an increase in has-2 expression and their use in the treatment of conditions related to a decrease in hyaluronic acid synthesis.

Claims

1. A process for stimulating hyaluronic acid in vitro or in vivo production by a mammal cell or tissue, comprising administering a composition comprising consisting of a combination of an efficient amount of resveratrol oligomers and an efficient amount of hyaluronic acid or a salt thereof as solely active principles and wherein the mammal cell or tissue are fibroblasts, keratinocytes or epithelial cells of cornea.

2. A process according to claim 1, wherein the monomeric units forming the oligomers of resveratrol are cis-resveratrol, trans-resveratrol, -viniferin, resveratrol esters, methylated or acetylated resveratrol and the monomers including at least one ester group of the formula OCO-A, and the oligomers being formed by monomeric units joined by carbon-carbon, or ether bonds, and/or monomers cross-linked by OCORCOO group, with -A representing an alkyl radical with at least two carbon atoms, being linear or branched, saturated or unsaturated, an aryl, aralkyl or aralkylene radical, and R representing an alkylene radical with 0 to 10 carbon atoms, being saturated or unsaturated, and/or 1 arylene radical having 1 to 3 rings and/or a heterocyclic radical, and diastereomers of these units.

3. A process according to claim 1, wherein the hyaluronic acid or a salt thereof has a mean molecular weight between 50 kDa and 100 kDa.

Description

(1) The invention is illustrated by the examples 1 and 2 and FIGS. 1 and 2 that follow.

(2) FIG. 1 illustrates the effect of resveratrol (RSV) and resveratrol oligomers (OR) on the has-2 expression observed after 6 hours incubation. Untreated corresponds to incubated fibroblasts in the absence of products to be tested. The results are expressed as the averagestandard deviation of four samples per treatment.

(3) FIG. 2 illustrates the effect of resveratrol oligomers (OR), hyaluronic acid (HA) and the combination of resveratrol oligomers and hyaluronic acid (OR+HA) on has-2 expression observed after 23 hours incubation. Hatched column OR+HA corresponds to the theoretical value if there was an additive effect between OR and HA. Black column OR+HA corresponds to the synergistic effect measured. Untreated corresponds to fibroblasts incubated in the absence of products to be tested. Results are expressed as the average f standard deviation of four samples per treatment.

EXAMPLE 1: EFFECT OF RESVERATROL AND RESVERATROL OLIGOMERS ON HAS-2 EXPRESSION IN FIBROBLASTS

(4) 1.1. Operating Mode

(5) Human skin fibroblast cells are spread in DMEM medium containing 10% of fetal bovine serum (FBS) and antibiotics (penicillin/streptomycin) and incubated until a 90% confluence is reached. The medium is removed and replaced by fresh medium comprising resveratrol (RSV) or resveratrol oligomers (OR) respectively. Table 1 below indicates the different conditions tested and concentrations used.

(6) TABLE-US-00001 TABLE 1 No Type of treatment 1 Untreated 2 Resveratrol (RSV) 2 M 3 Resveratrol oligomers (OR) 2 M

(7) Human skin fibroblast cells are incubated for 6 hours at 37 C. under 5% CO.sub.2. The ARN extraction is made by using the ARN Omega extraction kit. 1 g of ARN is used and retranscribed into complementary DNA using the ADNc Bio-Rad iScript synthesis kit followed by a real time quantitative PCR quantification. The PCR reactions have been carried out using Fast-Start DNA Master SYBR Green I real-time PCR kit (Roche Molecular Biochemicals). Each PCR has been carried out in a final volume of 20 l containing 10 l of SYBR Green mix 2 (Fast start DNA master SYBR green+Taq DNA polymerase), 2 l of 10 M primer mixture (finally 1 M) and 8 l of ADNc solution (50 ng). The primers used are described in table 2 below.

(8) TABLE-US-00002 TABLE2 Oligo Name Sequence Description f-qPCR- gagactctggcatgctaactag 18SrRNA 18S r-qPCR- ggacatctaagagcatcacag 18SrRNA 18S f-qPCR- CTCTTTTGGACTGTATGGTGCC Hyaluronan hHAS2 synthase2 r-qPCR- AGGGTAGGTTAGCCTTTTCACA Hyaluronan hHAS2 synthase2
2.2. Results

(9) The results are presented in FIG. 1.

(10) These results show that after 6 h incubation, resveratrol and oligo-resveratrol (OR) significantly induce has-2 expression by fibroblasts by a factor 1.18 (+18%; p<0.043) and a factor 1.29 (+29%; p<0.0045) respectively. Under these conditions, resveratrol and resveratrol oligomers have a substantially equal activity.

EXAMPLE 2: EFFECT OF RESVERATROL OLIGOMERS ALONE OR ASSOCIATED WITH HYALURONIC ACID ON HAS-2 EXPRESSION IN FIBROBLASTS

(11) 2.1. Operating Mode

(12) Human skin fibroblast cells are spread in DMEM medium containing 10% fetal bovine serum (FBS) and antibiotics (penicillin/streptomycin) and incubated until a 60% confluence is reached. The rest of the operating mode is identical to that described hereinbefore except that the incubation time is 23 hours. Table 3 below indicates different conditions tested and concentrations used.

(13) TABLE-US-00003 TABLE 3 No Type of treatment 1 Untreated 3 Resveratrol oligomers (OR) 2 M 4 HA 150 g/ml 6 HA 150 g/ml + OR 2 M
2.2. Results

(14) The results are presented in FIG. 2.

(15) These results show that resveratrol oligomers (OR) increase by a factor 1.3 (+29%) has-2 expression by fibroblasts. has-2 expression is increased by a factor 2 (+104%) by HA. Thanks to a OR and HA mixture, a simple additive effect of both activities would enable an induction factor of 2.3 (+133%) (hatched/hashed bar in the graph) to be theoretically obtained. In practice, when fibroblasts are treated with a HA/OR mixture for 23 hours, a significant increase in the has-2 expression corresponding to a factor of 3.25 (+226%) is observed. Thus, the effect of HA+OR is synergistic in comparison with the treatment with HA alone on the one hand and OR alone on the other hand.

(16) Thus, these results show for the first time that resveratrol and the resveratrol oligomer increase the expression of has-2 gene, thus stimulating hyaluronic acid production by human fibroblasts. Moreover, these results show that resveratrol acts in synergy with hyaluronic acid, the combination of these compounds significantly increasing has-2 expression.

(17) These results confirm that the composition according to the invention can be used as a cosmetic, pharmaceutical and/or food composition for treating dysfunctions and/or conditions responsive to an increase in hyaluronic acid synthesis.