Nucleic Acid Sequence for Detecting Soybean Plant DBN8002 and Detection Method Therefor

Abstract

The present invention relates to nucleic acid sequences for detecting soybean plant DBN8002 and detection methods thereof, wherein said nucleic acid sequences comprise SEQ ID NO: 1 or a complementary sequence thereof, and/or SEQ ID NO: 2 or a complementary sequence thereof. The soybean plant DBN8002 of the present invention has good resistance against Lepidoptera insects as well as good tolerance to glufosinate herbicide without compromising the yield, and the detection methods can accurately and rapidly identify whether a biological sample contains the DNA molecule of the transgenic soybean event DBN8002.

Claims

1. A nucleic acid sequence, characterized in that it comprises at least 11 consecutive nucleotides at positions 1-642 of SEQ ID NO: 3 or a complementary sequence thereof, and at least 11 consecutive nucleotides at positions 643-1524 of SEQ ID NO: 3 or a complementary sequence thereof; and/or at least 11 consecutive nucleotides at positions 1-347 of SEQ ID NO: 4 or a complementary sequence thereof, and at least 11 consecutive nucleotides at positions 348-656 of SEQ ID NO: 4 or a complementary sequence thereof; preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides at positions 1-642 of SEQ ID NO: 3 or a complementary sequence thereof, and 22-25 consecutive nucleotides at positions 643-1524 of SEQ ID NO: 3 or a complementary sequence thereof; and/or 22-25 consecutive nucleotides at positions 1-347 of SEQ ID NO: 4 or a complementary sequence thereof, and 22-25 consecutive nucleotides at positions 348-656 of SEQ ID NO: 4 or a complementary sequence thereof; preferably, the nucleic acid sequence comprises SEQ ID NO: 1 or a complementary sequence thereof, and/or SEQ ID NO: 2 or a complementary sequence thereof; preferably, the nucleic acid sequence comprises SEQ ID NO: 3 or a complementary sequence thereof, and/or SEQ ID NO: 4 or a complementary sequence thereof.

2. The nucleic acid sequence according to claim 1, characterized in that the nucleic acid sequence comprises SEQ ID NO: 5 or a complementary sequence thereof.

3. A method for detecting the presence of the DNA corresponding to the transgenic soybean event DBN8002 in a sample, characterized in comprising: contacting a sample to be detected with at least two primers for amplifying a target amplification product in a nucleic acid amplification reaction; performing the nucleic acid amplification reaction; and detecting the presence of the target amplification product; wherein the target amplification product comprises the nucleic acid sequence according to claim 1 or 2; preferably, the target amplification product comprises SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and/or SEQ ID NO: 7 or a complementary sequence thereof.

4. The method for detecting the presence of the DNA corresponding to the transgenic soybean event DBN8002 in a sample according to claim 3, characterized in that the primers comprise a first primer and a second primer, wherein the first primer is selected from SEQ ID NO: 1, SEQ ID NO: 8 and SEQ ID NO: 10; and the second primer is selected from SEQ ID NO: 2, SEQ ID NO: 9 and SEQ ID NO: 11.

5. A method for detecting the presence of the DNA corresponding to the transgenic soybean event DBN8002 in a sample, characterized in comprising: contacting a sample to be detected with a probe, wherein the probe comprises the nucleic acid sequence according to claim 1; preferably, the probe comprises SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and/or SEQ ID NO: 7 or a complementary sequence thereof; Subjecting the sample to be detected and the probe to stringent hybridization conditions; and detecting the hybridization of the sample to be detected with the probe.

6. The method for detecting the presence of the DNA corresponding to the transgenic soybean event DBN8002 in a sample according to claim 5, characterized in that at least one probe is labeled with at least one fluorophore.

7. A method for detecting the presence of the DNA corresponding to the transgenic soybean event DBN8002 in a sample, characterized in comprising: contacting a sample to be detected with a marker nucleic acid molecule, wherein the marker nucleic acid molecule comprises the nucleic acid sequence according to claim 1; preferably, the marker nucleic acid molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, and/or SEQ ID NOs: 6-11 or complementary sequences thereof; Subjecting the sample to be detected and the marker nucleic acid molecule to stringent hybridization conditions; detecting the hybridization of the sample to be detected with the marker nucleic acid molecule, and further performing a marker-assisted breeding analysis to determine whether the insect resistance and/or herbicide tolerance is genetically linked to the marker nucleic acid molecule.

8. A DNA detection kit, characterized in comprising at least one DNA molecule, wherein the DNA molecule comprises the nucleic acid sequence according to claim 1, and the DNA molecule can act as a DNA primer or a probe specific for the transgenic soybean event DBN8002 or progeny thereof; preferably, the DNA molecule comprises SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and/or SEQ ID NO: 7 or a complementary sequence thereof.

9. A method for protecting a soybean plant from insect invasion, characterized in comprising providing at least one transgenic soybean plant cell in the diet of the target insect, wherein the transgenic soybean plant cell comprises in its genome the sequence as set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2; and ingestion of the transgenic soybean plant cell inhibits the target insect from further feeding on the transgenic soybean plant; preferably, the transgenic soybean plant cell comprises in its genome the sequence as set forth in SEQ ID NO: 3 and/or SEQ ID NO: 4; preferably, the transgenic soybean plant cell successively comprises in its genome SEQ ID NO: 1, the nucleic acid sequence at positions 1032-6444 of SEQ ID NO: 5 and SEQ ID NO: 2, or comprises the sequence as set forth in SEQ ID NO: 5.

10. A method for protecting a soybean plant from damage caused by a herbicide or controlling weeds in a field in which a soybean plant is planted, characterized in comprising applying an effective amount of glufosinateherbicide into the field in which at least one transgenic soybean plant is planted, wherein the transgenic soybean plant comprises in its genome the sequence as set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2, and the transgenic soybean plant has glufosinate herbicide tolerance; preferably, the transgenic soybean plant comprises in its genome the sequence as set forth in SEQ ID NO: 3 and/or SEQ ID NO: 4. preferably, the transgenic soybean plant successively comprises in its genome SEQ ID NO: 1, the nucleic acid sequence at positions 1032-6444 of SEQ ID NO: 5 and SEQ ID NO: 2, or comprises the sequence as set forth in SEQ ID NO: 5.

11. A method for breeding an insect resistant and/or glufosinate herbicide tolerant soybean plant, characterized in comprising: planting at least one soybean seed, wherein the soybean seed comprises in its genome a nucleic acid sequence encoding the insect resistant Vip3Aa protein and/or a nucleic acid sequence encoding the glufosinate herbicide tolerant PAT protein, and a nucleic acid sequence of a specific region, or the soybean seed comprises in its genome the nucleic acid sequence as set forth in SEQ ID NO: 5; growing the soybean seed into a soybean plant; and invading the soybean plant with a target insect, and/or spraying the soybean plant with an effective amount of glufosinate herbicide, and then harvesting the plant with reduced plant damage compared to other plants which do not comprise the nucleic acid sequence of the specific region; wherein the nucleic acid sequence of the specific region is the sequence as set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2; preferably, the nucleic acid sequence of the specific region is the sequence as set forth in SEQ ID NO: 3 and/or SEQ ID NO: 4.

12. A method for producing an insect resistant and/or glufosinate herbicide tolerant soybean plant, characterized in comprising: introducing a nucleic acid sequence encoding the insect resistant Vip3Aa protein and/or a nucleic acid sequence encoding the glufosinate herbicide tolerant PAT protein, and a nucleic acid sequence of a specific region in the genome of a first soybean plant, or the nucleic acid sequence as set forth in SEQ ID NO: 5 in the genome of the first soybean plant, into a second soybean plant, thereby producing a plurality of progeny plants; and selecting the progeny plants comprising the nucleic acid sequence of the specific region, which are also insect resistant and/or glufosinate herbicide tolerant; wherein the nucleic acid sequence of the specific region is the sequence as set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2; preferably, the nucleic acid sequence of the specific region is the sequence as set forth in SEQ ID NO: 3 and/or SEQ ID NO: 4; preferably, the method comprises sexually crossing the transgenic soybean event DBN8002, with a soybean plant that lacks the insect resistance and/or glufosinate tolerance, thereby producing a plurality of progeny plants; selecting the progeny plants comprising the nucleic acid sequence of the specific region; invading the progeny plants with a target insect, and/or treating the progeny plants with glufosinate; and selecting the progeny plants which are insect resistant and/or glufosinate herbicide tolerant.

13. An agricultural product or commodity derived from the transgenic soybean event DBN8002, characterized in that the agricultural product or commodity is lecithin, fatty acids, glycerol, sterols, soy flakes, soy flours, soy proteins or their concentrates, soybean oils, soy protein fibers, soy milk clots or bean curd.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0139] FIG. 1 is a structural scheme of the junction sites between the transgenic inserted sequences and the soybean genome, and a scheme of relative positions of nucleic acid sequences for detecting soybean plant DBN8002 (for the scheme of relative positions, please refer to Wm82.a2 RefGen) in the nucleic acid sequences for detecting soybean plants DBN8002 and detection methods thereof according to the present invention;

[0140] FIG. 2 is a structural scheme of the recombinant expression vector pDBN4006 in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0141] FIG. 3 shows the bioassay effect of the transgenic soybean event DBN8002 against Helicoverpa armigera (Hubner) in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0142] FIG. 4 shows the bioassay effect of the transgenic soybean event DBN8002 against Spodoptera litura in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0143] FIG. 5 shows the bioassay effect of the transgenic soybean event DBN8002 against Spodoptera exigua in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0144] FIG. 6 shows the bioassay effect of the transgenic soybean event DBN8002 against Clanis bilineata in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0145] FIG. 7 shows the field effect of the transgenic soybean event DBN8002 inoculated with Helicoverpa armigera (Hubner) in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention;

[0146] FIG. 8 shows the field effect of the transgenic soybean event DBN8002 in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention, under the conditions of naturally occurring Spodoptera exigua;

[0147] FIG. 9 shows the field effect of the transgenic soybean event DBN8002 in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention, under the conditions of naturally occurring Spodoptera litura;

[0148] FIG. 10 shows the bioassay effect of the transgenic soybean event DBN8002 against Spodoptera frugiperda in the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention.

PARTICULAR EMBODIMENTS OF THE INVENTION

[0149] Technical solutions of the nucleic acid sequences for detecting the soybean plant DBN8002 and detection methods thereof according to the present invention will be further illustrated below with reference to the specific examples.

Example 1: Cloning and Transformation

1.1 Vector Cloning

[0150] A recombinant expression vector pDBN4006 (as shown in FIG. 2) was constructed by using standard gene cloning techniques. Vector pDBN4006 comprises two transgenic expression cassettes arranged in tandem: the first expression cassette consisting of an Arabidopsis ACTIN2 promoter (prAtAct2), operably linked to the insect resistant mVip3Aa gene of Bacillus thuringiensis (CN103509808B), further operably linked to a nopaline synthetase terminator (tNos); the second expression cassette consisting of a cauliflower mosaic virus 35S promoter (pr35S), operably linked to a glufosinate tolerant phosphinothricin-N-acetyltransferase gene (cPAT) of Streptomyces, further operably linked to a cauliflower mosaic virus 35S transcriptional terminator (t35S).

[0151] Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No: 18313-015) was transformed with the vector pDBN4006 by liquid nitrogen method, and 4-[hydroxy(methyl)phosphinyl]-DL-homoalanine was used as a selective marker for screening transformed cells.

1.2 Plant Transformation

[0152] Transformation was performed by a conventional Agrobacterium-mediated transformation method, comprising: co-culturing the sterile-cultured soybean cotyledonary node tissues with Agrobacterium as described in Example 1.1 to transfer the T-DNA in the recombinant expression vector pDBN4006 into the soybean chromosomes, so as to produce the transgenic soybean event DBN8002.

[0153] Briefly, the Agrobacterium-mediated soybean transformation comprises: germinating mature soybean seeds in a soybean germination medium (3.1 g/L B5 salt, B5 vitamin, 20 g/L sucrose, and 8 g/L agar; pH 5.6); inoculating the seeds onto the germination medium; and culturing them under the conditions of a temperature of 25 ± 1° C. and a photoperiod (light/dark) of 16 h/8 h; at 4-6 days after germination, collecting fresh green soybean sterile plantlets with inflated cotyledonary node; excising the hypocotyls approximately 3-4 mm below the cotyledonary node; making longitudinal cuts through the cotyledons, and removing apical buds, lateral buds and seminal roots; wounding at the cotyledonary node with the back of a surgical blade, and contacting the wounded cotyledonary node tissues with an Agrobacterium suspension; wherein Agrobacterium can deliver the nucleotide sequence of mVip3Aa gene and the nucleotide sequence of PAT gene to the wounded cotyledonary node tissues (step 1: infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD.sub.660=0.5-0.8, infection medium (2.15 g/L MS salt, B5 vitamin, 20 g/L sucrose, 10 g/L glucose, 40 mg/L acetosyringone (AS), 4 g/L 2-morpholine ethanesulfonic acid (MES), and 2 mg/L zeatin (ZT); pH 5.3) to start the infection. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the cotyledonary node tissues were cultured in a solid medium (containing 4.3 g/L MS salt, B5 vitamin, 20 g/L sucrose, 10 g/L glucose, 4 g/L MES, 2 mg/L ZT, and 8 g/L agar; pH 5.6) after the infection step. After the co-culture step, there may be an optional “recovery” step. In the “recovery” step, the recovery medium (3.1 g/L B5 salt, B5 vitamin, 1 g/L MES, 30 g/L sucrose, 2 mg/L ZT, 8 g/L of agar, 150 mg/L cephalosporin, 100 mg/L glutamic acid, and 100 mg/L aspartic acid; pH 5.6) comprises at least one antibiotic (150-250 mg/L cephalosporin) known to inhibit the growth of Agrobacterium, while does not comprise any selective agent for plant transformants (step 3: recovery step). Preferably, the tissue blocks regenerated from the cotyledonary node were cultured in a solid medium comprising antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary node were cultured on a medium containing a selective agent (4-[(hydroxy(methyl)phosphinyl)]-DL-homoalanine), and the growing transformed calli were selected (step 4: selection step). Preferably, the tissue blocks regenerated from the cotyledonary node were cultured in a solid selective medium (3.1 g/L B5 salt, B5 vitamin, 1 g/L MES, 30 g/L sucrose, 1 mg/L 6-benzyladenine (6-BAP), 8 g/L agar, 150 mg/L cephalosporin, 100 mg/L glutamic acid, 100 mg/L aspartic acid, and 10 mg/L 4-(hydroxy(methyl)phosphinyl)-DL-homoalanine; pH 5.6) comprising a selective agent, which resulted in the continuous growth of the transformed cells. Then, the transformed cells regenerated into plants (step 5: regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary node growing on the medium containing a selective agent were cultured in a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0154] The resistant tissues obtained from screening were transferred to B5 differentiation medium (3.1 g/L B5 salt, B5 vitamin, 1 g/L MES, 30 g/L sucrose, 1 mg/L ZT, 8 g/L agar, 150 mg/L cephalosporin, 50 mg/L glutamic acid, 50 mg/L aspartic acid, 1 mg/L gibberellin, 1 mg/L auxin, and 5 mg/L 4-(hydroxy(methyl)phosphinyl)-DL-homoalanine; pH 5.6), and cultured for differentiation at 25° C. The differentiated plantlets were transferred to B5 rooting medium (3.1 g/L B5 salt, B5 vitamin, 1 g/L MES, 30 g/L sucrose, 8 g/L agar, 150 mg/L cephalosporin, and 1 mg/L indole-3-butyric acid (IBA)), and cultured at 25° C. When the plantlets reached about 10 cm in height, they were moved to greenhouse and cultured until fruiting. In the greenhouse, they were cultured at 26° C. for 16 hours and then at 20° C. for 8 hours per day.

1.3. Identification and Screening of Transgenic Events

[0155] A total of 288 independent transgenic T.sub.0 plants were produced. In order to screen out a transgenic event with optimum performance, the above 288 independent transgenic T.sub.0 single plants were moved into the greenhouse for transplantation, cultivation and propagation to afford transgenic T.sub.1 single plants.

[0156] Since the genetic transformation process of soybean using mature soybean seeds and glufosinate as a selective agent tends to generate false-positive transgenic events, the T.sub.1 generation was sprayed with glufosinate to identify positive transgenic events, and a total of 154 positive transgenic single plants were obtained. By TaqMan™ analysis, the above 154 transgenic soybean plants were detected for the presence of single-copy mVip3Aa and PAT genes and the absence of backbone sequences of the vector; and a total of 90 transgenic single plants were obtained. By analysis of the transgenic insertion sites, a total of 24 transgenic single plants were obtained by screening, in which the sequences on both sides of T-DNA were intact, the T-DNA was not inserted into important genes of the soybean genome and the gene insertion did not result in any large open reading frame (ORF). By evaluation and comparison of the resistance against major target insects (such as Helicoverpa armigera (Hubner), Prodenia litura, and Spodoptera exigua), a total of 21 transgenic single plants with good insect resistance were obtained by screening. Since genetic transformation and gene insertion may affect agronomic traits of soybean plants (such as seedling vigor, propagation period, plant height or lodging), the above 21 transgenic T.sub.2-generation single plants were planted in a field to identify the agronomic trait performance of the transgenic T.sub.2 single plants at different stages (seedling stage to full flowering stage, initial grain-forming stage to maturity stage). By means of selfing and backcross breeding, it is screened whether the agronomic traits, molecular biology, resistance against the target insects and glufosinate herbicide tolerance of the transgenic soybean plants can be stably inherited under the conditions of different generations, different geographical environments and/or different background materials, and the transgenic soybean event DBN8002 was selected as an excellent event, which has a single copy of the transgenes (see Example 2), good insect resistance, glufosinate herbicide tolerance and agronomic trait performance (see Examples 6 and 7).

Example 2: Detection of the Transgenic Soybean Event DBN8002 by TaqMan

[0157] Using a plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen), the genomic DNA was extracted from the leaf (about 100 mg) of the transgenic soybean event DBN8002 as a sample, and the copy numbers of mVip3Aa and PAT genes were detected by a fluorescent quantitative PCR method using Taqman probe. Meanwhile, a wild-type soybean plant as a control was subject to the detection and analysis according to the above methods. Experiments were carried out in triplicate and the average value was calculated.

[0158] The specific method is as follows: [0159] Step 1: 100 mg leaf of the transgenic soybean event DBN8002 was ground to a homogenate in a mortar with liquid nitrogen, and each sample was prepared in triplicate; [0160] Step 2: the genomic DNAs of the above samples were extracted using a plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen, for detailed methods, please refer to the Product Instructions); [0161] Step 3: the concentrations of the genomic DNAs of the above samples were measured using ultra micro-spectrophotometer (NanoDrop 2000, Thermo Scientific); [0162] Step 4: the concentrations of the genomic DNAs of the above samples were adjusted to the same concentration value ranging from 80 to 100 ng/.Math.L; [0163] Step 5: the copy number of the samples was identified by a fluorescent quantitative PCR method using Taqman probe, wherein the identified sample with a known copy number was used as a standard and a sample from a wild-type soybean plant was used as control. Each sample was tested in triplicate and the average value was calculated. The sequences of primers and probes for fluorescent quantitative PCR are as follows: [0164] The following primers and probe are used for detecting the sequence of mVip3Aa gene: [0165] Primer 1: cgaatacagaaccctgtcggc as set forth in SEQ ID NO: 16 in SEQUENCE LISTING; [0166] Primer 2: cgtgaggaaggtctcagaaatgac as set forth in SEQ ID NO: 17 in SEQUENCE LISTING; [0167] Probe 1: cgacgatggcgtgtatatgcctcttgg as set forth in SEQ ID NO: 18 in SEQUENCE LISTING;

[0168] The following primers and probe are used for detecting the sequence of PAT gene: [0169] Primer 3: gagggtgttgtggctggtattg as set forth in SEQ ID NO: 19 in SEQUENCE LISTING; [0170] Primer 4: tctcaactgtccaatcgtaagcg as set forth in SEQ ID NO: 20 in SEQUENCE LISTING; [0171] Probe 2: cttacgctgggccctggaaggctag as set forth in SEQ ID NO: 21 in SEQUENCE LISTING.

[0172] PCR reaction system comprises:

TABLE-US-00002 JumpStart™ Taq ReadyMix™ (Sigma) 10 .Math.L 50 x primer/probe mix 1 .Math.L Genomic DNA 3 .Math.L Double distilled water (ddH.sub.2O) 6 .Math.L

wherein the 50 × primer/probe mix comprises 45 .Math.l of each primer at a concentration of 1 mM, 50 .Math.l of the probe at a concentration of 100 .Math.M, and 860 .Math.l of 1 × TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0), and was stored in an amber tube at 4° C.

[0173] PCR reaction condition comprises:

TABLE-US-00003 Step Temperature Time 1 95° C. 5 minutes 2 95° C. 30 seconds 3 60° C. 1 minute 4 go back to step 2 and repeat 40 times

[0174] Data was analyzed using fast real-time fluorescent quantitative PCR system software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, Applied Biosystems). The results demonstrate that the resultant transgenic soybean event DBN8002 is a single copy.

Example 3: Analysis of the Insertion Site of the Transgenic Soybean Event DBN8002

3.1 Extraction of Genomic DNA

[0175] DNA was extracted by the conventional CTAB (cetyl trimethyl ammonium bromide) method: after 2 g young leaf of the transgenic soybean event DBN8002 was ground to powder in liquid nitrogen, 0.5 mL CTAB DNA extraction buffer (20 g/L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, and 20 mM EDTA (edetic acid), with a pH adjusted to pH 8.0 with NaOH) preheated at 65° C. was added, then they were mixed thoroughly and extracted at 65° C. for 90 min; 0.5 volume of phenol and 0.5 volume of chloroform were added and mixed by inversion; the mixture was centrifuged at 12,000 rpm (revolution per minute) for 10 min; the supernatant was pipetted and 2 volumes of absolute ethanol was added; the centrifuge tube was gently shaken and then left standing at 4° C. for 30 min; the centrifuge tube was centrifuged again at 12,000 rpm for 10 min such that DNA was collected to the bottom of the tube; the supernatant was discarded, and the pellet was washed with 1 mL of 70% (mass concentration) ethanol; the mixture was centrifuged at 12,000 rpm for 5 min; the pellet was dried in vacuum or blown dry on a super clean bench; and the resultant DNA pellet was dissolved in an appropriate amount of TE buffer and stored at -20° C.

3.2 Analysis of Flanking DNA Sequences

[0176] The concentration of the above extracted DNA sample was measured. The concentration of the sample to be tested is 80-100 ng/.Math.L. The genomic DNA was digested using restriction enzymes EcoR I (5′ end analysis) and EcoR V (3′ end analysis) respectively. Each enzymatic digestion system was added with 26.5 .Math.L of genomic DNA, 0.5 .Math.L of the above restriction enzymes and 3 .Math.L of enzymatic digestion buffer (all employed restriction enzymes are enzymes with assorted buffers thereof or generic buffers from NEB company (now known as NEBCutSmart)), and was digested for 1 hour. After digestion, the enzymatic digestion system was added with 70 .Math.L of absolute ethanol, kept in ice bath for 30 min, and centrifuged at 12,000 rpm for 7 min. After discarding the supernatant, the pellet was blow-dried, then added with 8.5 .Math.L of double distilled water, 1 .Math.L of 10 × T.sub.4-DNA ligase buffer (NEB T4 DNA Ligase Reaction Buffer; for its specific formulation, please visit the websites of NEB or refer to https://www.neb.com/products/restriction-endonucleases or https://www.neb.com/products/b0202-t4-dna-ligase-reaction-buffer) and 0.5 .Math.L of T.sub.4-DNA ligase, and then ligated overnight at 4° C. The 5′ and 3′ end genomic DNAs were isolated by PCR amplification using a series of nested primers. Specifically, the primer combination for isolating the 5′ end genomic DNA comprises SEQ ID NO: 13 and SEQ ID NO: 26 as first primers, SEQ ID NO: 27 and SEQ ID NO: 28 as second primers, and SEQ ID NO: 13 as a sequencing primer. The primer combination for isolating 3′ end genomic DNA comprises SEQ ID NO: 15 and SEQ ID NO: 29 as first primers, SEQ ID NO: 30 and SEQ ID NO: 31 as second primers, and SEQ ID NO: 15 as a sequencing primer. PCR reaction conditions were shown in Table 3.

[0177] The amplification product resulted from the above PCR amplification was subject to electrophoresis on an agarose gel with a mass fraction of 2.0% to isolate the PCR amplification product; subsequently, the target fragment was isolated from agarose matrix using a gel extraction kit (QIAquick Gel Extraction Kit, catalog #_28704, Qiagen Inc., Valencia, CA). Then the purified PCR amplification product was sequenced (e.g., using ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzed (e.g., using DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0178] The 5′ and 3′ flanking sequences and junction sequences were confirmed using standard PCR procedures. The 5′ flanking and junction sequences were confirmed using SEQ ID NO: 8 or SEQ ID NO: 12 in combination with SEQ ID NO: 9, SEQ ID NO: 13 or SEQ ID NO: 26. The 3′ flanking and junction sequences were confirmed using SEQ ID NO: 11 or SEQ ID NO: 14 in combination with SEQ ID NO: 10, SEQ ID NO: 15 or SEQ ID NO: 29. PCR reaction systems and amplification conditions were shown in Tables 2 and 3. It will be recognized by those skilled in the art that other primer sequences could also be used to confirm the flanking and junction sequences.

[0179] DNA sequencing of the PCR amplification products provides a DNA that could be used to design other DNA molecules which could be used as primers and probes for identifying soybean plants or seeds derived from the transgenic soybean event DBN8002.

[0180] The inserted sequence of the transgenic soybean event DBN8002 was found to be flanked on the right border (5′ flanking sequence) by the soybean genomic sequence shown in the nucleotides 1-647 of SEQ ID NO: 5 and flanked on the left border (3′ flanking sequence) by the soybean genomic sequence shown in the nucleotides 6647-7344 of SEQ ID NO: 5. The 5′ junction sequence was set forth in SEQ ID NO: 1 and the 3′ junction sequence was set forth in SEQ ID NO: 2.

3.3. PCR Assay for Zygosity

[0181] Junction sequence is a relatively short polynucleotide molecule, which is a new DNA sequence and is diagnostic for the DNA of the transgenic soybean event DBN8002 when detected in polynucleotide detection and analysis. The junction sequences in SEQ ID NO: 1 and SEQ ID NO: 2 respectively are 11 polynucleotides on either side of the insertion site of the transgenic fragment and soybean genomic DNA in the transgenic soybean event DBN8002. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO: 3 or SEQ ID NO: 4. The junction sequences (SEQ ID NO: 1 used as 5′ junction region, and SEQ ID NO: 2 used as 3′ junction region) were useful in the method for detecting DNA as DNA probes or DNA primer molecules. The junction sequences SEQ ID NO: 6 and SEQ ID NO: 7 were also new DNA sequences of the transgenic soybean event DBN8002, and could also be used for detecting the presence of the transgenic soybean event DBN8002 as DNA probes or DNA primer molecules. SEQ ID NO: 6 (the nucleotides 911-1129 of SEQ ID NO: 3) spans a DNA sequence and a prAtAct2 transcription origin sequence in the pDBN4006 construct, and SEQ ID NO: 7 (the nucleotides 1-243 of SEQ ID NO: 4) spans a t35S transcriptional termination sequence and a DNA sequence in the pDBN4006 construct.

[0182] Furthermore, an amplicon was generated by using at least one primer derived from SEQ ID NO: 3 or SEQ ID NO: 4, and said primer, when used in a PCR method, generated an amplicon diagnostic for the transgenic soybean event DBN8002.

[0183] Specifically, the PCR amplification product was generated from the 5′ end of the transgenic inserted sequence, comprising a portion of the genomic DNA at 5′ end flanking the T-DNA inserted sequence in the genome of plant materials derived from the transgenic soybean event DBN8002. The PCR amplification product comprises SEQ ID NO: 3. For PCR amplification, primer 5 (SEQ ID NO: 8), which may hybridize to a genomic DNA sequence at 5′ end flanking the transgenic inserted sequence, and primer 6 (SEQ ID NO: 9), which was in pair with primer 5 and located in the prAtAct2 transcription origin sequence of the T-DNA inserted sequence, were designed.

[0184] The PCR amplification product was generated from the 3′ end of the transgenic inserted sequence, comprising a portion of the genomic DNA at 3′ end flanking the T-DNA inserted sequence in the genome of plant materials derived from the transgenic soybean event DBN8002. The PCR product comprises SEQ ID NO: 4. For PCR amplification, primer 7 (SEQ ID NO: 10), which was located in the t35S transcriptional termination sequence of the T-DNA inserted sequence and primer 8 (SEQ ID NO: 11), which was in pair with primer 7 and may hybridize to a genomic DNA sequence at 3′ end flanking the transgenic inserted sequence, were designed.

[0185] DNA amplification conditions described in Tables 2 and 3 could be used in the above PCR assays for zygosity to generate an amplicon diagnostic for the transgenic soybean event DBN8002. Detection of amplicons could be conducted by using a thermocycler such as Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient, or by the methods and apparatus known to those skilled in the art.

TABLE-US-00004 The steps and conditions of reaction mixture in the PCR reaction for the identification of the 5′ end transgenic insert/genomic junction region of the transgenic soybean event DBN8002 Step Reagent Amount Note 1 Nuclease-free water Added to a final volume of 20 .Math.L 2 10 × reaction buffer (with MgCl.sub.2) 2.0 .Math.L The final concentration of 1 × buffer; the final concentration of MgCl.sub.2: 1.5 mM 3 10 mM solution of dATP, dCTP, dGTP and dTTP 0.2 .Math.L The final concentration of each dNTP: 200 .Math.M 4 Primer 5 (SEQ ID NO: 8) resuspended in 1 × TE buffer or nuclease-free water to a concentration of 10 .Math.M 0.2 .Math.L The final concentration: 0.1 .Math.M 5 Primer 6 (SEQ ID NO: 9) resuspended in 1 × TE buffer or nuclease-free water to a concentration of 10 .Math.M 0.2 .Math.L The final concentration: 0.1 .Math.M 6 RNase; DNase-free (500 .Math.g/ml) 0.1 .Math.L 50 ng/reaction 7 REDTaq® DNA polymerase (1 unit/.Math.L) 1.0 .Math.L (recommended to change a pipette prior to next step) 1 unit/reaction 8 Extracted DNA (Template): leaves of the samples to be analyzed 200 ng of genomic DNA Negative control 50 ng of non-transgenic soybean genomic DNA Negative control No template DNA (the solution for resuspending DNA) Positive control 50 ng of soybean genomic DNA comprising DBN8002

TABLE-US-00005 Amplification conditions of thermocycler Cycle No. Setting 1 94° C. 3 min 34 94° C. 30 sec 64° C. 30 sec 72° C. 1 min 1 72° C. 10 min

[0186] The reaction solutions were gently mixed, and if there is no hot top on thermocycler, added with 1-2 drops of mineral oil on the top of each reaction solution. PCR reaction was conducted in a thermocycler such as Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) using the cycle parameters shown in Table 3. MJ Engine or Eppendorf Mastercycler Gradient thermocycler should be run in the calculated mode. The Perkin-Elmer 9700 thermocycler should have a ramp speed set at maximum when running.

[0187] The experiments show the following results: when used in a PCR reaction of the transgenic soybean event DBN8002 genomic DNA, primers 5 and 6 (SEQ ID NO: 8 and 9) result in a 1524 bp fragment of amplification product, but when the primers were used in PCR reactions of a non-transformed soybean genomic DNA and non-DBN8002 soybean genomic DNA, no fragment was amplified; when used in a PCR reaction of the transgenic soybean event DBN8002 genomic DNA, primers 7 and 8 (SEQ ID NO: 10 and 11) result in a 656 bp fragment of amplification product, but when the primers were used in PCR reactions of a non-transformed soybean genomic DNA and non-DBN8002 soybean genomic DNA, no fragment was amplified.

[0188] PCR assays for zygosity could also be used to identify whether the material derived from the transgenic soybean event DBN8002 is homozygous or heterozygous. Primer 9 (SEQ ID NO: 12), primer 10 (SEQ ID NO: 13) and primer 11 (SEQ ID NO: 14) were used in an amplification reaction to produce an amplicon diagnostic for the transgenic soybean event DBN8002. DNA amplification conditions described in Tables 4 and 5 could be used in the above assays for zygosity to produce an amplicon diagnostic for the transgenic soybean event DBN8002.

TABLE-US-00006 Reaction solution for the assays for zygosity Step Reagent Amount Note 1 Nuclease-free water Added to a final volume of 5 .Math.l 2 2 × Universal Master Mix (Applied Biosystems Catalog No. 4304437) 2.5 .Math.L 1 × final concentration 3 Primer 9 (SEQ ID NO: 12) and primer 10 (SEQ ID NO: 13) resuspended in nuclease-free water to a concentration of 10 .Math.M 0.05 .Math.L The final concentration: 0.25 .Math.M 4 Primer 11 (SEQ ID NO: 14) resuspended in 1 × TE buffer or nuclease-free water to a concentration of 10 .Math.M 0.01 .Math.L The final concentration: 0.15 .Math.M 5 REDTaq® DNA polymerase (1 unit/.Math.l) 1.0 .Math.l (recommended to change a pipette prior to next step) 1 unit/reaction 6 Extracted DNA (template): leaves of the samples to be analyzed 200 ng of genomic DNA Negative control 50 ng of non-transgenic soybean genomic DNA Negative control No template DNA (the solution for resuspending DNA) Positive control 50 ng of soybean genomic DNA comprising DBN8002

TABLE-US-00007 Thermocycler amplification conditions for the assays for zygosity Cycle No. Setting 1 95° C. 10 min 10 95° C. 15 sec 64° C. 1 min (-1° C./cycle) 30 95° C. 15 sec 54° C. 1 min 1 10° C. immersion

[0189] PCR reaction was conducted in a thermocycler such as Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) using the cycle parameters shown in Table 5. MJ Engine or Eppendorf Mastercycler Gradient thermocycler should be run in the calculated mode. The Perkin-Elmer 9700 thermocycler should have a ramp speed set at maximum when running.

[0190] In the amplification reaction, the biological sample comprising template DNA contains the DNA diagnostic for the presence of the transgenic soybean event DBN8002. Alternatively, the amplification reaction would result in two different DNA amplicons generated from the biological sample comprising the DNA derived from soybean genome, and the DNA derived from soybean genome is heterozygous for the corresponding allele of the inserted DNA present in the transgenic soybean event DBN8002. The two different amplicons would correspond to a first amplicon (SEQ ID NO: 12 and SEQ ID NO: 14) derived from the locus of wild-type soybean genome and a second amplicon (SEQ ID NO: 12 and SEQ ID NO: 13) diagnostic for the presence of the transgenic soybean event DBN8002 DNA. A soybean DNA sample that only generates a single amplicon corresponding to the second amplicon as described in regard to heterozygous genome could be diagnosed as the presence of the transgenic soybean event DBN8002 in that sample, and the sample was produced from soybean seeds homozygous for the corresponding allele of the insert DNA present in the transgenic soybean plant DBN8002.

[0191] It should be noted that the primer pairs for the transgenic soybean event DBN8002 are used to produce an amplicon diagnostic for genomic DNA of the transgenic soybean event DBN8002. These primer pairs include but are not limited to primers 5 and 6 (SEQ ID NO: 8 and SEQ ID NO: 9), and primers 7 and 8 (SEQ ID NO: 10 and SEQ ID NO: 11), and are used in the DNA amplification method. In addition, control primers 12 and 13 (SEQ ID NOs: 22 and 23) for amplification of an endogenous soybean gene are included as an internal standard for reaction conditions. The analysis of the DNA extraction sample of the transgenic soybean event DBN8002 should include a tissue DNA extract from the transgenic soybean event DBN8002 as positive control, a DNA extract from a soybean plant that is not the transgenic soybean event DBN8002 as negative control, and a negative control without template soybean DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO: 3 or a complementary sequence thereof, or SEQ ID NO: 4 or a complementary sequence thereof, can be used. When these primers are used for DNA amplification reaction, they respectively produce amplicons comprising SEQ ID NO: 1 or SEQ ID NO: 2 and are diagnostic for tissues derived from the transgenic soybean event DBN8002. DNA amplification conditions as described in Tables 2 to 5 can be used in the production of an amplicon diagnostic for the transgenic soybean event DBN8002 by using suitable primer pairs. The DNA extract of soybean plants or seeds which produces an amplicon diagnostic for the transgenic soybean event DBN8002 in a DNA amplification method and is presumed to contain the transgenic soybean event DBN8002, or a product derived from the transgenic soybean event DBN8002 can be used as a template for amplification to determine the presence of the transgenic soybean event DBN8002.

Example 4: Detection of the Transgenic Soybean Event DBN8002 by Southern Blot

4.1 DNA Extraction for Use in Southern Blot

[0192] Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and a pestle. 4 to 5 g of the ground plant tissue was resuspended in 20 mL of CTAB lysis buffer (100 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, 0.2% v/v β-mercaptoethanol, 2% w/v CTAB), and incubated at a temperature of 65° C. for 60 minutes. During incubation, the sample was uniformly mixed by inversion once per 10 minutes. After incubation, an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) was added, and gently mixed by inversion for extraction, and then centrifuged at a rotation speed of 4,000 rpm for 20 minutes. The aqueous phase was collected and re-extracted once with an equal volume of chloroform/isoamyl alcohol (24:1). The aqueous phase was re-collected and added with an equal volume of isopropanol. The mixture was mixed uniformly, left standing at a temperature of -20° C. for 1 hour to precipitate DNA, and then centrifuged at a rotation speed of 4,000 rpm for 5 minutes to obtain the DNA pellet, which was subsequently resuspended in 1 mL of TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0). In order to degrade any possible RNA, the DNA was incubated with 40 .Math.L of 10 mg/mL RNase A at a temperature of 37° C. for 30 minutes, centrifuged at a rotation speed of 4,000 rpm for 5 minutes, and then centrifuged at a rotation speed of 12,000 rpm for 10 minutes in the presence of 0.1-fold volume of 3 M sodium acetate (pH 5.2) and 2-fold volumes of absolute ethanol to precipitate DNA. After the supernatant was discarded, the pellet was washed with 1 mL of 70% (v/v) ethanol and dried under room temperature, and then the DNA was re-dissolved in 1 mL of TE buffer.

4.2 Restriction Enzyme Digestion

[0193] The concentration of genomic DNA in the above-mentioned sample was measured by using an ultra micro-volume spectrophotometer (NanoDrop 2000, Thermo Scientific).

[0194] In a 100 .Math.L of reaction system, 5 .Math.g DNA was digested each time. Genomic DNA was digested respectively with restriction enzymes Mfe I and Nco I, using a portion of the sequences of mVip3Aa and PAT genes in T-DNA as probes. For each enzyme, the digestion products were incubated overnight at an appropriate temperature. The sample was spun in a centrifugal vacuum concentrator (speed Vacuum, Thermo Scientific) to reduce the volume to 20 .Math.l.

4.3 Gel Electrophoresis

[0195] Bromophenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and electrophoresed for isolation in TAE electrophoresis buffer (40 mM Tris-acetic acid, 2 mM EDTA, pH 8.5). The gel electrophoresis was run overnight at a voltage of 20 V.

[0196] After the electrophoresis, the gel was treated with 0.25 M HCl for 10 minutes to depurinate the DNA, and then treated with a denaturation solution (1.5 M NaCl, 0.5 M NaOH) and a neutralization solution (1.5 M NaCl, 0.5 M Tris-HCl; pH 7.2) for 30 minutes, respectively. 5 × SSC (3 M NaCl, 0.3 M Sodium citrate; pH 7.0) was poured into a porcelain dish; a piece of glass was covered; and then a wet filter paper bridge, a gel, a positively charged nylon membrane (Roche, Cat. No. 11417240001), three pieces of filter paper, a paper tower, and a heavy object were placed successively. After membrane-transfer at room temperature overnight, the nylon membrane was rinsed with deionized water twice, and the DNA was immobilized onto the membrane by ultraviolet crosslinker (UVP, UV Crosslinker CL-1000).

4.4 Hybridization

[0197] A suitable DNA sequence was amplified by PCR for probe preparation. The DNA probes were SEQ ID NO: 24 or SEQ ID NO: 25, or partially homologous or complementary to the above sequences. The DIG labeling of the probes, Southern blot, membrane washing, and other operations were performed by using the DNA Labeling and Detection Starter Kit II (Roche, Cat. No. 11585614910). For specific methods, please refer to their Product Instructions. Finally, an X-ray film (Roche, Cat. No. 11666916001) was used to detect the position where the probe was bound.

[0198] Each Southern blot included two control samples: (1) DNA from a negative (untransformed) segregant, which was used to identify any endogenous soybean sequences that could hybridize to the element-specific probe; and (2) DNA from a negative segregant, into which Hind III-digested pDBN4006 plasmid was introduced in an amount equivalent to a single copy number based on the length of the probe, which was used as a positive control to show the sensitivity of the experiment when a single copy of gene was detected in the soybean genome.

[0199] The hybridization data provides corroboratory evidence to support TaqMan™ PCR analysis, namely, the soybean plant DBN8002 contains mVip3Aa and PAT genes in a single copy. By using the probe for mVip3Aa gene, the enzymatic digestions of Mfe I and Nco I respectively generate single bands of about 5.5 kb and 11 kb; and by using the probe for PAT gene, the enzymatic digestions of Mfe I and Nco I respectively generate single bands of about 2.5 kb and 10 kb. This indicates that mVip3Aa and PAT genes were respectively present in the soybean plant DBN8002 in one copy. Furthermore, no hybridization band was obtained using the backbone probe. This indicates that no backbone sequence of the vector pDBN4006 was introduced into the genome of the soybean plant DBN8002 during transformation.

Example 5: Detection of Protein Expression in the Transgenic Soybean Event DBN8002 by ELISA

[0200] The expression ranges of Vip3Aa and PAT proteins in the transgenic soybean event DBN8002 can be detected by ELISA.

[0201] 2 mg lyophilized leaf of the transgenic soybean event DBN8002 was weighed and taken as the sample. The leaf was ground in liquid nitrogen and then added with 1 mL extraction buffer (8 g/L NaCl, 0.27 g/L KH.sub.2PO.sub.4, 1.42 g/L Na.sub.2HPO.sub.4, 0.2 g/L KCl, and 5.5 ml/L Tween-20; pH 7.4). The mixture was mixed uniformly, left standing at a temperature of 4° C. for 30 minutes, and then centrifuged at a rotation speed of 12,000 rpm for 10 minutes. The supernatant was pipetted and diluted with the above extraction buffer to suitable dilution. 80 .Math.L diluted supernatant was collected for detection by ELISA.

[0202] The protein (Vip3Aa and PAT proteins) amounts in the sample by the dry weight of leaf were measured and analyzed by ELISA (Enzyme-Linked Immunosorbent Assay) detection kits (ENVIRLOGIX Company, Vip3Aa kit (AP085) and PAT kit (AP014)). For specific methods, please refer to their Product Instructions. Meanwhile, a wild-type soybean plant leaf (non-transgenic, NGM) was used as a control sample. Detection and analysis were carried out according to the above-mentioned method, with 6 replicates per plant.

[0203] The experimental results of the protein (Vip3Aa and PAT proteins) contents of the transgenic soybean event DBN8002 were as shown in Table 6. The average expression levels of Vip3Aa proteins in the transgenic soybean event DBN8002 and wild-type soybean plant leaves by dry weight of leaf (.Math.g/g) were 14.49 and 0, respectively; and the average expression levels of PAT proteins in the transgenic soybean event DBN8002 and wild-type soybean plant leaves by dry weight of leaf (.Math.g/g) were 227.29 and 0, respectively.

TABLE-US-00008 Average results of the assays on the protein expression levels (.Math.g/g) in the transgenic soybean event DBN8002 Protein/plant DBN8002 NGM Vip3Aa protein 14.49±2.62 0±0 PAT protein 227.29±11.30 0±0

Example 6: Detection of the Resistance of the Event Against Insects

6.1 Bioassay of the Soybean Plant DBN8002 in China

[0204] Two kinds of plants, the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM), were tested using Helicoverpa armigera (CBW), Spodoptera litura (TCW), Spodoptera exigua (BAW) and Clanis bilineata (BHM) via the following bioassays:

[0205] Top second leaves at V3 stage from two kinds of plants, the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM), were prepared respectively. They were rinsed with sterile water and aspirated to dryness with a gauze. Then with the removal of veins, soybean leaves were cut into shapes of about 2.5 cm × 3 cm. 1 to 3 pieces of the leaf (the number of the leaf was determined based on the leaf intake of insect) were placed on filter paper moistened with distilled water at the bottom of round plastic Petri dishes. 10 newly hatched larvae by artificial feeding were placed in each dish. Then the Petri dishes were covered with lids and kept for 3 days under the conditions including a temperature of 26-28° C., relative humidity of 70%-80%, and a photoperiod (light/dark) of 16:8 prior to obtaining a statistic result. Three indicators, larvae development rate, mortality of tested insects and leaf damage ratio, were statistically analyzed to obtain a total score of resistant trait (full score: 300 points). The total score of resistant trait = 100 × mortality + [100 × mortality + 90 × (number of newly hatched insect/a total of the inoculated larvae) + 60 × (number of newly hatched insects for negative control/a total of the inoculated larvae) + 10 × (number of insects for negative control/a total of the inoculated larvae)] + 100 × (1 - leaf damage ratio), wherein a total of the inoculated larvae refers to the total number of the larvae inoculated, i.e. 10 larvae in each dish; the larvae development rate was reflected by the formula of the total score of resistant trait; and the leaf damage ratio refers to the proportion of insect-feeding area in total area of the leaf. For each insect, five plants from the transgenic soybean event DBN8002 and the wild-type soybean plant (non-transgenic, NGM) were tested, 6 replicates per plant. The results were shown in Tables 7-8 and FIGS. 3-6, respectively.

TABLE-US-00009 The bioassay result of insect resistance of the transgenic soybean event DBN8002 in China - Mortality (%) Insect/plant DBN8002 NGM CBW 60±12 7±3 TCW 99±1 3±4 BAW 98±1 4±3 BHM 85±6 7±3

TABLE-US-00010 The bioassay result of the insect resistance of the transgenic soybean event DBN8002-Total score of resistant trait (points) Insects/plants DBN8002 NGM CBW 198±22 35±12 TCW 289±3 42±20 BAW 286±10 55±17 BHM 284±7 34±15

[0206] The results show that the transgenic soybean event DBN8002 exhibits significantly higher mortality of tested insects and total score of resistant trait than the NGM, indicating that the transgenic soybean event DBN8002 has good resistance against Helicoverpa armigera, Spodoptera litura, Spodoptera exigua and Clanis bilineata.

6.2 Field Test of the Transgenic Soybean Event DBN8002 in China

[0207] The transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM) were planted in a field. Randomized block design with 3 replicates was employed. The district had an area of 30 m.sup.2 (5 m × 6 m), row spacing of 60 cm and plant spacing of 10 cm. The plants were conventionally cultivated and managed, avoiding spray of insecticides during the whole propagation period.

Helicoverpa Armigera

[0208] The soybeans were only subject to natural infestation in the area with serious natural occurrence of Helicoverpa armigera (the conditions for occurrence of natural insect damage: the most severe damage occurs from June to July and the optimum temperature for pest growth ranges from 20 to 30° C.). When the soybean plants grew to V3 stage (trifoliate), they were tracked for investigating the NGM leaves fed by larvae of Helicoverpa armigera. When the top second and third leaves of the NGM were not consumed, the damage area rate (the damage area rate = the sum of the leaf damage area in each single plant/the total area of plant leaves × 100%) of Helicoverpa armigera on soybean plants was investigated one by one. The result of resistance of the transgenic soybean event DBN8002 against Helicoverpa armigera is shown in Table 9.

TABLE-US-00011 The result of resistance of the transgenic soybean event DBN8002 against Helicoverpa armigera under the conditions of natural infestation Program/plant DBN8002 NGM Damage area rate (%) 5±3 24±7

[0209] The results show that under the conditions of natural occurrence of Helicoverpa armigera, as compared with the NGM, the transgenic soybean event DBN8002 exhibits significantly reduced damage area rate of Helicoverpa armigera, thus indicating that the transgenic soybean event DBN8002 has good resistance against Helicoverpa armigera. The field effect of the transgenic soybean event DBN8002 under the conditions of natural occurrence of Helicoverpa armigera is shown in FIG. 7.

Spodoptera Exigua

[0210] The soybeans were only subject to natural infestation in the area with serious natural occurrence of Spodoptera exigua (the conditions for occurrence of natural insect damage: the most severe damage occurs from June to July and the optimum temperature for pest growth ranges from 20 to 30° C.). When the soybean plants grew to V3 stage, they were tracked for investigating the NGM leaves fed by larvae of Spodoptera exigua. When the top second and third leaves of the NGM were not consumed, the damage area rate (the damage area rate = the sum of the leaf damage area in each single plant/the total area of plant leaf × 100%) of Spodoptera exigua on soybean plants was investigated one by one. The result of resistance of the transgenic soybean event DBN8002 against Spodoptera exigua is shown in Table 10.

TABLE-US-00012 The result of resistance of the transgenic soybean event DBN8002 against Spodoptera exigua under the conditions of natural infestation Program/plant DBN8002 NGM Damage area rate (%) 2±1 22±4

[0211] The results show that under the conditions of natural occurrence of Spodoptera exigua, as compared with the NGM, the transgenic soybean event DBN8002 exhibits significantly reduced damage area rate of Spodoptera exigua, thus indicating that the transgenic soybean event DBN8002 has good resistance against Spodoptera exigua. The field effect of the transgenic soybean event DBN8002 under the conditions of natural occurrence of Spodoptera exigua is shown in FIG. 8.

Spodoptera Litura

[0212] The artificial inoculation was carried out twice at V3 stage of soybean plants. 100 plants in the vicinity of the central region in each district were selected and subject to artificial inoculation. The top second leaf of each soybean plant was inoculated with about 10 newly hatched larvae by artificial feeding. 3 days after the inoculation, a second inoculation was carried out with the same density of larvae as the first inoculation. 5-21 days after the inoculation, the leaf areas fed by larvae of the plant were investigated one by one. The investigation was generally carried out 14 days after the inoculation. If the damage area rate (the damage area rate = the sum of the leaf damage area in each single plant/the total area of plant leaf × 100%) of leaves in the NGM reached 15%, it was considered valid. If the damage area rate did not reach 15%, the investigation could be delayed properly; however, if the damage area rate still did not reach 15% after 21 days, this inoculation was considered invalid. The average value of the damage area rate of Spodoptera litura on soybean leaves during V3 stage of soybean plants in each district was calculated. The result of resistance of the transgenic soybean event DBN8002 against Spodoptera litura is shown in Table 11.

TABLE-US-00013 The result of resistance of the transgenic soybean event DBN8002 against Spodoptera litura under the condition of artificial inoculation Program/plant DBN8002 NGM Damage area rate (%) 3±2 26±5

[0213] The results show that under the condition of artificial inoculation, the transgenic soybean event DBN8002 exhibits significantly lower damage area rate than NGM, thus indicating that the transgenic soybean event DBN8002 has good resistance against Spodoptera litura. The field effect of the transgenic soybean event DBN8002 inoculated with Spodoptera litura is shown in FIG. 9.

6.3 Bioassay of the Soybean Plant DBN8002 in Argentina

[0214] Two kinds of plants, the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM), were tested using Chrysodeixis includens (SBL), Rachiplusia nu, (SFL), Spodoptera frugiperda (FAW) and Spodoptera cosmioides (BLAW) via the following bioassays:

[0215] Top second leaves at V3 stage from two kinds of plants, the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM), were prepared respectively. They were rinsed with sterile water and aspirated to dryness with a gauze. Then with the removal of veins, the soybean leaves were cut into circular shapes with a diameter of about 1 cm. 1 to 3 pieces (the number of the leaf was determined based on the leaf intake of insect) of the circular leaf were placed on filter paper moistened with distilled water in the wells of bioassay plates (as shown in FIG. 10). One newly hatched larva was placed in each well. Then the plates were covered with lids and kept for 5 days under the conditions including a temperature of 26-28° C., relative humidity of 70%-80%, and a photoperiod (light/dark) of 16:8 prior to obtaining a statistic result. Mortality of tested insects and leaf damage ratio (the leaf damage ratio refers to the proportion of leaf area fed by insects in the total area of leaf) were statistically analyzed. For each insect, 6 plants with equivalent growth vigor from the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM) were tested, with 32 bioassay wells per plant. The results are shown in Table 12 and FIG. 10 (Spodoptera frugiperda).

TABLE-US-00014 The bioassay results of the transgenic soybean event DBN8002 in Argentina Insect Plant Mortality (%) Leaf damage ratio (%) SBL DBN8002 84.8±4.3 0.3±0.0 NGM 10.6±3.2 2.7±0.8 SFL DBN8002 77.6±7.6 0.9±0.2 NGM 8.9±3.1 8.0±1.2 FAW DBN8002 97.4±2.7 0.1±0.0 NGM 2.1±0.5 10.3±3.2 BLAW DBN8002 86.5±4.3 0.3±0.0 NGM 10.1±5.2 9.6±2.8

[0216] The results show that the transgenic soybean event DBN8002 exhibits significantly higher mortality of tested insects of the above-mentioned insect species than the NGM, indicating that the transgenic soybean event DBN8002 has good resistance against Chrysodeixis includens (SBL), Rachiplusia nu (SFL), Spodoptera frugiperda (FAW) and Spodoptera cosmioides (BLAW) (typical pests found on soybeans in South America).

6.4 Field Test of the Transgenic Soybean Event DBN8002 in Argentina

[0217] Two kinds of plants, the transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM), were planted in a field; and in vivo bioassays in field were carried out using Chrysodeixis includens (SBL), Rachiplusia nu (SFL), Anticarsia gemmatalis (VBC) and Spodoptera frugiperda (FAW) according to the following method.

[0218] Large bioassay cages (screen mesh type) were prepared in a field. Each bioassay cage was used for testing one insect only. The individual bioassay cages were not arranged in communication and they were further physically separated by artificially planted corn and weeds naturally growing in the field. The transgenic soybean event DBN8002 and wild-type soybean plant (non-transgenic, NGM) were randomly planted in each individual bioassay cage, with 3 replicates per plant type and each replicate planted in one row (row length: 3 m, 30 plants per row, row spacing: 50 cm). The plants were conventionally cultivated and managed, avoiding spray of insecticides during the whole propagation period. When the plants grew to around V5 stage (penta-foliate), suitable amount of adult insects of the above-mentioned species were released into the cage. After 10 days, the leaf damage ratio (which refers to the proportion of leaf area fed by insects in the total area of leaf) was investigated. The results are shown in Table 13.

TABLE-US-00015 The results of resistance of the transgenic soybean event DBN8002 against pests under the condition of artificial inoculation in Argentina Insect Plant Leaf damage ratio (%) SBL DBN8002 2.0±0.2 NGM 10.2±2.1 SFL DBN8002 5.3±2.5 NGM 35.4±7.9 VBC DBN8002 0.3±0.0 NGM 11.7±2.3 FAW DBN8002 0.1±0.0 NGM 9.5±3.1

[0219] The results show that under the condition of artificial inoculation, the transgenic soybean event DBN8002 exhibits lower leaf damage rate than NGM, indicating that the transgenic soybean event DBN8002 has good resistance against Chrysodeixis includens (SBL), Rachiplusia nu (SFL), Anticarsia gemmatalis (VBC) and Spodoptera frugiperda (FAW) (typical pests found on soybeans in South America).

Example 7: Detection of Herbicide Tolerance of the Event

[0220] Basta herbicide (in which the active ingredient is 18% glufosinate aqueous solution) was selected for spray application in the experiment. Randomized block design with three replicates was employed. The district had an area of 15 m.sup.2 (5 m × 3 m), row spacing of 60 cm and plant spacing of 25 cm. The plants were conventionally cultivated and managed, and one-meter interval was set among the districts. The transgenic soybean event DBN8002 was subject to the following two treatments: (1) no spray application, but spraying an equal volume of clean water when spraying the herbicide during treatment (2); and (2) spray application of Basta herbicide at V2-V3 leaf stage (bi- or tri-foliate) at a dose of 800 g a.i./ha (a.i./ha means “active ingredient per hectare”). It should be noted that glufosinate herbicide (such as Basta) is a contact-type herbicide; if the herbicide is manipulated inappropriately in the field, e.g., accumulating too much herbicide solution locally, phytotoxicity symptom may occur; this does not mean that the transgenic soybean event DBN8002 has impaired tolerance; and glufosinate herbicides of various concentrations and formulations are also applicable to the following conclusion if they are converted to the above equivalent amount of the active ingredient glufosinate.

[0221] The investigation of phytotoxicity symptoms was respectively carried out at 1 week and 2 weeks after application, and the yields of the districts were determined at the time of harvest. The phytotoxicity symptom grading is shown in Table 14. The herbicide tolerance of the transformation event was assessed by using the damage rate of herbicide as an indicator. In particular, the damage rate of herbicide (%) = .Math. (number of plants of the same damage level × level number) / (total number of plants × highest level), wherein the damage rate of herbicide refers to the damage rate of glufosinate, which was determined according to the result of phytotoxicity investigation two weeks after glufosinate treatment; and the tolerance level of soybean to the herbicide was assessed based on the damage rate of herbicide (glufosinate). The soybean yield of each district was obtained by weighing the total yield (by weight) of soybean grains of 3 rows in the middle of each district. The yield difference among different treatments was measured as percentage of yield. The percentage of yield (%) = yield with spray application / yield without spray application. Results of herbicide tolerance of the transgenic soybean event DBN8002 and the soybean yield are shown in Table 15.

TABLE-US-00016 Grading standard of phytotoxicity degree of glufosinate herbicide on soybean Phytotoxicity level Description of symptoms 1 Regularly growing without any damage symptom 2 Slight phytotoxicity of less than 10% 3 Moderate phytotoxicity, which can be recovered later without affecting yield 4 Serious phytotoxicity, which is difficult to recover and results in reduced yield 5 Serious phytotoxicity, which cannot be recovered and results in significantly reduced yield or no yield

TABLE-US-00017 Results of glufosinate herbicide tolerance of the transgenic soybean event DBN8002 and the soybean yield Program/plant DBN8002 Damage rate by glufosinate % (control) 0±0 Damage rate by glufosinate % (800 g a.i./ha) 0±0 percentage of yield % (800 g a.i./ha) 99.1±0.3

[0222] The results show that, in terms of the damage rate by glufosinate herbicide: the damage rate of the transgenic soybean event DBN8002 treated with glufosinate herbicide (800 g a.i./ha) is 0. Thus, the transgenic soybean event DBN8002 has good glufosinate herbicide tolerance.

[0223] In regards to the yield, there is no significant difference in the yields of the transgenic soybean event DBN8002 between the treatment without spray application and the treatment with spray application of 800 g a.i./ha of glufosinate. Thus, this further shows that the transgenic soybean event DBN8002 has good glufosinate herbicide tolerance and the yield is not compromised.

Example 8

[0224] Agricultural products or commodities can be produced from the transgenic soybean event DBN8002. If sufficient expression is detected in the agricultural products or commodities, they are expected to contain the nucleotide sequences that can be diagnostic for the presence of materials from the transgenic soybean event DBN8002 in the agricultural products or commodities. The agricultural products or commodities include, but are not limited to, soybean cakes, powders and oils, specifically lecithin, fatty acids, glycerol, sterols, edible oils, defatted soy flakes, defatted and baked soy flours, soy milk clots, bean curd, soy protein concentrates, isolated soy proteins, hydrolyzed vegetable proteins, organized soy proteins, soy protein fibers, and any other foods intended for consumption as a food source by an animal, etc. Probes or primer pairs-based nucleic acid detection methods and/or kits can be developed to detect the nucleotide sequences derived from the transgenic soybean event DBN8002 in a biological sample, such as those shown in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the probe sequence or primer sequence is selected from the sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 or portions thereof, so as to diagnose the presence of the transgenic soybean event DBN8002.

[0225] In conclusion, the transgenic soybean event DBN8002 of the present invention has good resistance against Lepidoptera insects and high tolerance to glufosinate herbicide without compromising the yield, and the detection methods of the present invention can accurately and rapidly identify whether a biological sample contains DNA molecules of the transgenic soybean event DBN8002.

[0226] The seeds corresponding to the transgenic soybean event DBN8002 were deposited under the Budapest Treaty at the General Microbiological Center of China Microbiological Culture Collection Management Committee (CGMCC for short, Address: No.3, No. 1 Precinct, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Academy of Sciences of China, zip code 100101) on Feb. 19, 2019, of which the classification and nomenclature are soybean (Glycine max), the deposit status is viable, and the accession number is CGMCC No. 17299. The deposit will be deposited in the depository for 30 years.

[0227] At last, it should be noted that the above Examples are only used to illustrate the technical solutions of the present invention rather than limit the present invention. Although the present invention is described in detail with reference to the preferred Examples, those skilled in the art should understand that the technical solutions of the present invention could be modified or substituted equivalently without departing from the spirit and scope of the technical solutions of the present invention.