Polymer grade lactic acid monomer production bacteria and construction method thereof and technology for manufacturing lactic acid

10472654 ยท 2019-11-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed are very high optically pure D- and L-lactic acid fermentation production strains and construction methods thereof and the method for preparing very high optically pure D- and L-lactic acids using the strains, wherein the deposit number of the D-lactic acid fermentation production strain is CGMCC No. 11059, and the deposit number of the L-lactic acid fermentation production strain is CGMCC No. 11060.

Claims

1. A polymer grade lactic acid monomer producing strain for producing extremely high optically pure L-lactic acid by fermentation, wherein, the deposit number of the strain is CGMCC No. 11060, an extremely high optical purity means that the optical purity of L-lactic produced by the strain99.9%.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 Physical map of mutant cassette pUC-ldhAp:: kan-clts857-pR-pL;

(2) FIG. 2 Physical map of mutant cassette pUC-thiE:: difGm;

(3) FIG. 3 Physical map of mutant cassette pUC-dld:: difGm;

(4) FIG. 4 Physical map of mutant cassette pUC-ackA-pta:: difGm;

(5) FIG. 5 Physical map of mutant cassette pUC-pps::difGm;

(6) FIG. 6 Physical map of mutant cassette pSK-pflB:: difGm;

(7) FIG. 7 Physical map of mutant cassette pUC-poxB:: difGm;

(8) FIG. 8 Physical map of mutant cassette pSKsym-frdA:: difGm;

(9) FIG. 9 Physical map of mutant cassette pUC-adhE:: difGm;

(10) FIG. 10 Physical map of mutant cassette pUC-ldhA:: difGm;

(11) FIG. 11 Physical map of mutant cassette pUC-lldD::PldhA-ldhBcoa-difGm;

(12) FIG. 12 Physical map of mutant cassette pUC-lldD::PldhA-ldhLca-difGm;

(13) FIG. 13 Physical map of mutant cassette pUC-lldD::PldhA-ldhStrb-difGm;

(14) FIG. 14 Physical map of mutant cassette pUC-ldhA::PldhA-ldhLca-difGm;

(15) FIG. 15 Physical map of mutant cassette pUC-ldhA::PldhA-ldhStrb-difGm;

(16) FIG. 16 Physical map of mutant cassette pUC-thiE::PldhA-ldhLca-difGm;

(17) FIG. 17 Physical map of mutant cassette pUC-thiE::PldhA-ldhStrb-difGm;

(18) FIG. 18 Physical map of mutant cassette pUC-thiE::PldhA-ldhBcoa-difGm;

(19) FIG. 19 Screening result of the extremely high optical pure D-lactic acid producing strain;

(20) FIG. 20 Screening result of the extremely high optical pure L-lactic acid producing strain;

(21) FIG. 21 Producing process of the extremely high optical pure D-lactic acid;

(22) FIG. 22 Optical purity detection spectrum of D-lactic acid;

(23) FIG. 23 Producing process of the extremely high optical pure L-lactic;

(24) FIG. 24 Optical purity detection spectrum of L-lactic acid.

DEPOSIT INFORMATION

(25) Classification name: Escherichia coli

(26) Deposit institution: China General Microbiological Culture Collection Deposit institution address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing

(27) Deposit data: Jul. 7, 2015

(28) Deposit number: CGMCC No. 11059

(29) Reference biomaterial (strain): B0013-090B

(30) [The strain was deposited at CGMCC under the Budapest Treaty and will be made available to the public upon issuance of a patent.]

(31) Classification name: Escherichia coli

(32) Deposit institution: China General Microbiological Culture Collection Deposit institution address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing

(33) Deposit data: Jul. 7, 2015

(34) Deposit number: CGMCC No. 11060

(35) Reference biomaterial (strain): B0013-101J

(36) [The strain was deposited at CGMCC under the Budapest Treaty and will be made available to the public upon issuance of a patent.]

DETAILED DESCRIPTION

(37) The technical schemes of the present disclosure are further described below with reference to specific examples.

(38) A extremely high optical pure D-lactic acid producing strain and a extremely high optical pure L-lactic acid producing strain, the construction method thereof, and the high-efficiency preparation process of the extremely high optical pure D-lactic acid and L-lactic are provided in the present disclosure, the strain grow rapidly at 25-36 C. with glucose to form high-activity cells, then accumulate the extremely high optical pure D-lactic acid and L-lactic at 37-50 C., and the chemical purity of the accumulated lactic acid is extremely high. The preparation method is characterized that: strains experienced a cultivation stage and a temperature-variable high-efficiency acid production stage at 25-50 C., the yield of D-lactic acid is up to 15% (w/v) or more, the optical purity is more than 99.9%, the chemical purity is more than 97%; the yield of L-lactic acid is up to 18% (w/v) or more, the optical purity is more than 99.9%, the chemical purity is more than 98%.

(39) The invention relates to a specific method:

(40) Chromosome gene integration technology: the upstream and downstream gene sequences about 50-700 bp of the target integration site on chromosome are amplified by PCR from the genome of E. coli. The target integrated expression gene is ligated with the resistance gene, and the obtained fragment is cloned into a position between the upstream gene sequence and the downstream gene sequence of the target integration site to form target gene integration sequences, e.g. ldhAp:: kan-clts857-pR-pL; thiE:: difGm; dld:: difGm; ackA-pta:: difGm; pps:: difGm; pflB:: difGm; poxB:: difGm; frdA:: difGm; adhE:: difGm; ldhA:: difGm; lldD::PldhA-ldhBcoa-difGm; lldD::PldhA-ldhLca-difGm; lldD::PldhA-ldhStrb-difGm; ldhA::PldhA-ldhLca-difGm; ldhA::PldhA-ldhStrb-difGm; thiE::PldhA-ldhLca-difGm; thiE::PldhA-ldhStrb-difGm; thiE::PldhA-ldhBcoa-difGm. The gene integration sequences are transformed into E. coli independently or in any combination of two or more. Transformants are selected from the selective medium. Chromosome DNA of the transformants is extracted, then the target gene mutation of the transformant is verified by PCR. The optimal extremely high optical pure D-lactic acid high-yield strain such as B0013-090B and extremely high optical pure L-lactic acid high-yield strain such as B0013-101J is screened by virtue of a fermentation test.

(41) The construction of a dynamically regulated D-lactic acid production recombinant strain is carried out according to the following steps with the recombinant method above mentioned.

(42) 1. Strain for research: E. coli B0013 (Zhou L. et al., Curr Microbiol, 2011, 62: 981-989),

(43) 2. The promoter of the lactate dehydrogenase gene in the starting strain obtained in step 1 was replaced from ldhAp to pR-pL (Love C. A. et al., Gene, 1996, 176:49-53) by the gene integration technology, and a recombinant E. coli 1 is obtained.

(44) 3. The mutant cassette thiE:: difGm used for deleting the encoding gene of thiamine phosphate synthase (thiE) is constructed by using the gene integration technology, and then a recombinant E. coli 2 is obtained after deleting the thiE gene of recombinant strain obtained in step 2.

(45) 4. The mutant cassette dld:: difGm used for deleting the encoding gene of FDA-dependent D-lactate dehydrogenase (dld) is constructed by using the gene integration technology, and then a recombinant E. coli 3 is obtained by deleting the dld gene of recombinant strain obtained in step 3.

(46) 5. The mutant cassette ackA-pta::difGm used for deleting the encoding gene of acetokinase (ackA) and phosphotransacetylase (pta) is constructed by using the gene integration technology, and a recombinant E. coli 4 is obtained by deleting the ackA-pta gene of recombinant strain obtained in step 4.

(47) 6. The mutant cassette pps::difGm used for deleting the encoding gene of phosphoenol pyruvate synthase (pps) is constructed by using the gene integration technology, and a recombinant E. coli 5 and 6 are obtained by deleting the pps gene of recombinant strain obtained in step 4 and 5.

(48) 7. The mutant cassette pflB::difGm used for deleting the encoding gene of pyruvate formate-lyase (pflB) is constructed by using the gene integration technology, and a recombinant E. coli 7-10 are obtained by deleting the pflB gene of recombinant strain obtained in step 4, 5 and 6.

(49) 8. The mutant cassette poxB::difGm used for deleting the encoding gene of pyruvic oxidase (poxB) is constructed by using the gene integration technology, a recombinant E. coli 11-18 are obtained by deleting the poxB gene of recombinant strain obtained in step 4, 5, 6 and 7.

(50) 9. The mutant cassette frdA::difGm used for deleting the encoding gene of fumaric reductase (frdA) is constructed by using the gene integration technology, a recombinant E. coli 19-34 is obtained by deleting the frdA gene of recombinant strain obtained in steps 5, 6, 7 and 8.

(51) 10. The mutant cassette adhE::difGm used for deleting the encoding gene of ethanol dehydrogenase (adhE) is constructed by using the gene integration technology, a recombinant E. coli 35-66 is obtained by deleting the adhE gene of recombinant strain obtained in step 4, 5, 6, 7, 8 and 9.

(52) 11. The mutant cassette ldhA::difGm used for deleting the encoding gene of D-lactate dehydrogenase (ldhA) is constructed by using the gene integration technology, a recombinant E. coli 67 is obtained by deleting the ldhA gene of recombinant strain B0013-070.

(53) 12, The mutant cassette ldhA::PldhA-ldhLca-difGm used for deleting the encoding gene of D-lactate dehydrogenase (ldhA) is constructed by using the gene integration technology, a recombinant E. coli 68 is obtained by deleting the ldhA gene of recombinant strain B0013-070.

(54) 13. The mutant cassette ldhA::PldhA-ldhStrb-difGm used for deleting the encoding gene of D-lactate dehydrogenase (ldhA) is constructed by using the gene integration technology, a recombinant E. coli 69 is obtained by deleting the ldhA gene of recombinant strain B0013-070.

(55) 14. The mutant cassette lldD::PldhA-ldhBcoa-difGm used for deleting the encoding gene of L-lactic dehydrogenase (lldD) which take FMN as coenzyme is constructed by using the gene integration technology, a recombinant E. coli 70-73 are obtained by deleting the lldD gene of recombinant strain B0013-070 and recombinant strains obtained in step 11, 12 and 13.

(56) 15. The mutant cassette lldD::PldhA-ldhLca-difGm used for deleting the encoding gene of L-lactic dehydrogenase (lldD) which take FMN as coenzyme is constructed by using the gene integration technology, a recombinant E. coli 74-77 are obtained by deleting the lldD gene of recombinant strain B0013-070 and recombinant strains obtained in step 11, 12, 13 and B0013-170.

(57) 16. The mutant cassette lldD::PldhA-ldhBcoa-difGm used for deleting the encoding gene of L-lactate dehydrogenase (lldD) which take FMN as coenzyme is constructed by using the gene integration technology, a recombinant E. coli 74-77 are obtained by deleting the lldD gene of recombinant strain B0013-070 and recombinant strains obtained in step 11, 12 and 13.

(58) 17. The mutant cassette thiE:: difGm used for deleting the encoding gene of thiamine phosphate synthase (thiE) is constructed by using the gene integration technology, a recombinant E. coli 82-96 are obtained by deleting the thiE gene of recombinant strains obtained in step 11, 12, 13, 14, 15 and 16.

(59) 18. The mutant cassette thiE::PldhA-ldhLca-difGm used for deleting the encoding gene of thiamine phosphate synthase (thiE) is constructed by using the gene integration technology, a recombinant E. coli 97-111 are obtained by deleting the thiE gene of recombinant strains obtained in step 11, 12, 13, 14, 15 and 16.

(60) 19. The mutant cassette thiE::PldhA-ldhStrb-difGm used for deleting the encoding gene of thiamine phosphate synthase (thiE) is constructed by using the gene integration technology, a recombinant E. coli 112-126 are obtained by deleting the INF gene of recombinant strain obtained in step 11, 12, 13, 14, 15 and 16.

(61) 20. The mutant cassette thiE::PldhA-ldhBcoa-difGm used for deleting the encoding gene of thiamine phosphate synthase (thiE) is constructed by using the gene integration technology, a recombinant E. coli 127-156 are obtained by deleting the thiE gene of recombinant strain obtained in steps 11, 12, 13, 14, 15 and 16.

(62) 21. The recombinant strains obtained in steps 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 are subjected to shake flask culture at 200 r/min, 30 C. and 45 C., and the starting strain B0013-070 is used as a control to analyze specific activity of lysine dehydrogenase, identify the functions of the p.sub.R-p.sub.L promoter and thiE, and screen out the optimal strains.

(63) 22. The optimal strains obtained in step 21 are subjected to shake flask culture at the 25-36 C. and 200 r/min respectively, and the starting strain B0013-070 is used as a control strain to analyze the cell density, the lactic acid, metabolic main intermediates, other organic acid products and the like, and then the growth culture temperature of the strains are determined.

(64) 23. The optimal strains obtained in step 21 are aerobically cultured at 25-36 C., and 200 r/min for 6-10 h firstly, then the lactic acid fermentation is carried out by stationary culture at 37-45 C., and the starting strain B0013-070 is used as a control to analyze the cell density, sugar consumption, productivity of lactic acid, main metabolic intermediates, other organic acid products and the like, to determine the induction time of lactic acid synthesis.

(65) 24. The optimal strains obtained in above step are subjected to shake flask culture with 0.06-100 g/L thiamine at 200 r/min respectively, and the starting strain B0013-070 is used as a control to analyze the cell density, the lactic acid, metabolic main intermediates, other organic acid products and the like, to determine the addition amount of the thiamine.

(66) 25. The lactic acid fermentation of the optimal strains obtained in the step 20 are carried out in 7 L-30,000 L fermentation tanks, and the starting strain B0013-070 is used as a control to analyze the cell density, sugar consumption, productivity of lactic acid, main metabolic intermediates, other organic acid products and the like by timing sampling during a fermentation process.

(67) The technical solution of the present disclosure is described in further detail below with specific examples.

Example 1Construction of Mutant Cassette ldhA::kan-clts857-pR-pL

(68) An ldhA gene segment ldhA on a chromosome of B0013 is amplified by primers ldhA1 and ldhA2 through PCR (polymerase chain reaction), and introduced into a carrier pUC18 by cloning, to obtain a recombinant plasmid pUC-ldhA. The plasmid pP451 is subjected to a reverse PCR amplification by primers PPL1 and PPL2, and then ligated to a kanamycin resistance gene segment (plasmid pSKsymKm is subjected to enzyme digestion by SmaI, and gel recycle 966 bp segment), to obtain a recombinant plasmid pPL-Kan. The plasmid pPL-kan is subjected to a PCR amplification by using primers PPL3 and PPL4. And then the resulting product is subjected to double digestion by EcoRI and EcoRV, (and ligated to the product which obtained by a reverse PCR amplification with the pUC-ldhA as a template by using primers Ec-RlA1 and Ec-RlA2, and enzyme digestion by using EcoRI), thus to obtain a recombinant plasmid pUC-ldhAp::kan-clts857-pR-pL. The physical map of the obtained recombinant plasmid is shown in FIG. 1. The recombinant plasmid pUC-ldhAp::kan-clts857-pR-pL is subjected to enzyme digestion by KpnI, and the linearized plasmids are recycled through glue extraction. Then a gene segment ldhAp:: kan-clts857-pR-pL is obtained following a PCR amplification with ldhA1 and ldhA2 as primers.

Example 2Construction of Mutant Cassette thiE::difGm

(69) A thiE gene part sequence with a length of 0.6 kb is obtained by an amplification using the E. coli. B0013 chromosome DNA as the template and ThiE1p and ThiE2p as primers. And then it is introduced into pUC18 by cloning, to obtain a recombinant plasmid pUC-thiE. A difGm segment with length of 1.2 kb is introduced to StuI site in the middle of the thiE by cloning, to obtain a recombinant plasmid pUC-thiE::difGm. The physical map of the recombinant plasmid pUC-thiE::difGm is shown in FIG. 2. The recombinant plasmid is subjected to enzyme digestion by ApaLI, and the linearized plasmids are recycled through glue extraction. Then a gene segment thiE::difGm is obtained following a PCR amplification by using ThiE1p and ThiE2p as primers.

Example 3Construction of Mutant Cassette dld:: difGm

(70) A dld gene segment (0.9 kb) is obtained by a PCR amplification using strain B0013 chromosome DNA as the template and Dld1 and Dld2 as primers. The resulting PCR product is introduced to the SmaI site of vector pUC18 by cloning, to obtain a recombinant plasmid pUC-dld. Then, the recombinant plasmid pUC-dld is subjected to an enzyme digestion by EcoRV, and a 0.4 kb gene segment in the middle of dld gene is removed and replaced into a dif-Gm-dif segment by cloning to obtain a recombinant plasmid pUC-dld::difGm. The physical map of the recombinant plasmid is shown in FIG. 3. The recombinant plasmid pUC-dld::difGm is subjected to enzyme digestion by EcoRI, and the linearized plasmids are recycled through glue extraction. Then a gene segment dld::difGm is obtained following a PCR amplification by using Dld1 and Dld2 as primers.

Example 4Construction of Mutant Cassette ackA-pta::difGm

(71) An ackA-pta gene segment (2.8 kb) is obtained by a PCR amplification using strain B0013 chromosome DNA as the template and AckA-Pta1 and AckA-Pta2 as primers. The PCR product is introduced to a vector pUC18 by cloning, to obtain a recombinant plasmid pUC-ackA-pta. Then, the recombinant plasmid pUC-ackA-pta is subjected to an enzyme digestion by EcoRV, and a 2.6 kb gene segment in the middle of ackA-pta gene is removed and replaced into a dif-Gm-dif segment by cloning to obtain a recombinant plasmid pUC-ackA-pta::difGm. The physical map of the recombinant plasmid is shown in FIG. 4. The recombinant plasmid pUC-ackA-pta::difGm is subjected to enzyme digestion by KpnI, and the linearized plasmids are recycled through glue extraction. Then a gene segment ackA-pta::difGm is obtained following a PCR amplification by using AckA-Pta1 and AckA-Pta2 as primers.

Example 5Construction of Mutant Cassette pps::difGm

(72) A pps gene segment (2.3 kb) is obtained by a PCR amplification using strain B0013 chromosome DNA as the template and Pps1 and Pps2 as primers. The PCR product is introduced to a vector pUC18 by cloning, to obtain a recombinant plasmid pUC-pps. Then, a reverse PCR amplification is carried out using the plasmid pUC-pps as a template and RPps1 and RPps2 as primers, and a 2.1 kb gene segment in the middle of pps gene was removed and replaced into a dig-Gm-dif segment by cloning to obtain a recombinant plasmid pUC-pps::difGm. The physical map of the recombinant plasmid is shown in FIG. 5. The recombinant plasmid pUC-pps::difGm is subjected to enzyme digestion by ApaLI, and the linearized plasmids are recycled through glue extraction. Then a gene segment pps::difGm is obtained following a PCR amplification by using Pps1 and Pps2 as primers.

Example 6Construction of Mutant Cassette pflB::difGm

(73) A PCR amplification is carried out using strain B0013 chromosome DNA as a template and PflB1 and PflB2 as primers. The resulting product PflB is introduced to EcoRV and SmaI site of vector pSK by cloning (during this process, PstI and EcoRI disappeared) to obtain a recombinant plasmid pSK-pflB. The plasmid pSK-pflB is subjected to an enzyme digestion by PstI, then an filling-in is ligated to difGm in the pSK-EcdifGm to obtain a recombinant plasmid pSK-pflB::difGm. The physical map of the obtained recombinant plasmid is shown in FIG. 6. The recombinant plasmid pSK-pflB::difGm is subjected to a digestion by ApaLI, and the linearized plasmids are recycled through glue extraction. Then a gene segment pflB::difGm is obtained following a PCR amplification by using PflB1 and PflB2 as primers.

Example 7Construction of Mutant Cassette poxB::difGm

(74) A poxB gene segment of E. coli is amplified by using PoxB1 and PoxB2 as primers, the PCR product is introduced to a SmaI site of vector pUC18 by cloning, to obtain a recombinant plasmid pUC-poxB. Then, the recombinant plasmid pUC-poxB is subjected to an enzyme digestion by EcoRV, and introduced into a dif-Gm segment by cloning to obtain a recombinant plasmid pUC-poxB::difGm. The physical map of the recombinant plasmid is shown in FIG. 7. The recombinant plasmid pUC-poxB::difGm is subjected to enzyme digestion by ApaLI, and the linearized plasmids are recycled through glue extraction. Then a gene segment poxB::difGm is obtained following a PCR amplification by using PoxB1 and PoxB2 as primers.

Example 8Construction of Mutant Cassette frdA:: difGm

(75) A frdA gene segment (1.6 kb) is obtained by a PCR amplification using strain B0013 chromosome DNA as the template and FrdA1 and FrdA2 as primers. The PCR product is introduced to the SmaI site of vector pSKsym by cloning, to obtain a recombinant plasmid pSKsym-frdA. Then, the recombinant plasmid pSKsym-frdA is subjected to an enzyme digestion by PstI, a 1.3 kb gene segment in the middle of frdA is removed, smoothing the sticky tail end of the PstI by using a T4 DNA polymerase, and introducing into a dif-Gm-dif segment by cloning, so that a recombinant plasmid pSKsym-frdA::difGm is obtained. The physical map of the recombinant plasmid is shown in FIG. 8. The recombinant plasmid pSKsym-frdA::difGm is subjected to enzyme digestion by ApaLI, and the linearized plasmids are recycled through glue extraction. Then a gene segment frdA::difGm is obtained following a PCR amplification by using FrdA1 and FrdA2 as primers.

Example 9Construction of Mutant Cassette adhE: difGm

(76) An adhE gene segment (1.4 kb) is obtained by a PCR amplification using strain B0013 chromosome DNA as the template and AdhE1 and AdhE2 as primers. The PCR product is introduced to a vector pUC19 SmaI site by cloning, to obtain a recombinant plasmid pUC-adhE. Then, the recombinant plasmid pUC-adhE is subjected to an enzyme digestion by EcoRV, a 1 kb gene segment in the middle of adhE is removed, and introduced into a dif-Gm-dif segment is by cloning, so that a recombinant plasmid pUC-adhE::difGm is obtained. The physical map of the recombinant plasmid is shown in FIG. 9. The recombinant plasmid pUC-adhE::difGm is subjected to a double digestion by EcoRI and PstI, and a segment adhE1-dif-Gm-dif-adhE2 is recycled.

Example 10Construction of Mutant Cassette ldhA::difGm

(77) A ldhA gene is obtained by a PCR amplification using the E. coli strain B0013 chromosome DNA as a template and ldhA1 and ldhA2 as primers. The resulting product is introduced to EcoRI site of vector pUC18 by cloning to obtain a recombinant plasmid pUC-ldhA. A 400 bps segment is removed by digestion using PstI, and a filing-in with T4 DNA polymerase is carried out on the sticky tail end, then the resulting product is ligated to difGm segment to obtain a recombinant plasmid pUC-ldhA::Gmdif. The physical map of the obtained recombinant plasmid is shown in FIG. 10. The recombinant plasmid is subjected to a digestion by EcoRI, then a ldhA deleting segment ldhA-dif-Gm-dif-ldA is obtained, that is ldhA::Gmdif.

Example 11Construction of Mutant Cassette lldD::PldhA-ldhBcoa-difGm

(78) An amplification (ldhA5 and ldhA6 as primers) is carried out using E. coli strain B0013 chromosome DNA as a template to obtain all promoters and partial structural region fragments of the ldhA gene, and the segment ldhA is introduced to the vector pUC18 by cloning to obtain a recombinant plasmid pUC-ldhA. A reverse PCR amplification is carried out using the plasmid pUUC-ldhA as a template and RldhA1 and RldhA2 as primers, and a self-link is carried out between the products, then a recombinant plasmid pUC-PldhA is obtained. A PCR amplification is carried out using Bacillus coagulants CICIM B1821 chromosome DNA as a template to obtain the ldhBcoa gene segment. After digestion by BamHI and EcoRI, it is introduced to BglII and EcoRI of pUC-PldhA to obtain a recombinant plasmid pUC-PldhA-ldhBcoa. Then, the difGm segment is introduced to the EcoRV site of the recombinant plasmid pUC-PldhA-ldhBcoa, to obtain a recombinant plasmid pUC-PldhA-ldhBcoa-difGm. A lldD gene segment is obtained by PCR amplification (primers are lldD1 and lldD2), and is introduced to a sub-cloning vector pUC18 to obtain a recombinant plasmid pUC-lldD. A PldhA-ldhBcoa-difGm segment is obtained from the recombinant plasmid pUC-PldhA-ldhBcoa-difGm by digestion using BamHI, and is introduced to the BamHI site of the recombinant plasmid pUC-lldD to obtain a recombinant plasmid pUC-lldD::PldhA-ldhBcoa-difGm. The physical map of the recombinant plasmid is shown in FIG. 11. The recombinant plasmid pUC-lldD::PldhA-ldhBcoa-difGm is digested by SmaI, and a lldD::PldhA-ldhBcoa-difGm gene segment is obtained by glue extraction.

Example 12Construction of Mutant Cassette lldD:PldhA-ldhLca-difGm

(79) An amplification (ldhA5 and ldhA6 as primers) is carried out using E. coli CICIM B0013 chromosome DNA as a template to obtain all promoters and partial structural region fragments of the ldhA gene, and the segment ldhA is introduced to the vector pUC18 by cloning to obtain a recombinant plasmid pUC-ldhA. A reverse PCR amplification is carried out using the plasmid pUC-ldhA as a template and RldhA1 and RldhA2 as primers, and a self-link is carried out between the products, then a recombinant plasmid pUC-PldhA is obtained. A PCR amplification (LcaLDH1 and LcaLDH4 as primers) is carried out using Lactobacillus casei B1192 chromosome DNA as a template to obtain the ldhLca gene segment. After digestion by BamHI and EcoRI, it is introduced to BglII and PstI of pUC-PldhA to obtain a recombinant plasmid pUC-PldhA-ldhLca. Then, the difGm segment is introduced to the EcoRV site of the recombinant plasmid pUC-PldhA-ldhLca, to obtain a recombinant plasmid pUC-PldhA-ldhLca-difGm.

(80) A lldD gene segment is obtained by PCR amplification (primers are lldD1 and lldD2), and is introduced to a sub-cloning vector pUC18 to obtain a recombinant plasmid pUC-lldD. A PldhA-ldhLca-difGm segment is obtained from the recombinant plasmid pUC-PldhA-ldhLca-difGm by digestion using BamHI, and is introduced to the BamHI site of the recombinant plasmid pUC-lldD to obtain a recombinant plasmid pUC-lldD::PldhA-ldhLca-difGm. The physical map of the recombinant plasmid is shown in FIG. 12. The recombinant plasmid pUC-lldD::PldhA-ldhLca-difGm is digested by SmaI, and a lldD::PldhA-ldhLca-difGm gene segment is obtained by glue extraction.

Example 13Construction of Mutant Cassette lldD:PldhA-ldhStrb-difGm

(81) A PCR amplification (ldhA5 and ldhA6 as primers) is carried out using E. coli CICIM B0013 chromosome DNA as a template to obtain all promoters and partial structural region fragments of the ldhA gene. And the segment ldhA is introduced to the vector pUC18 by cloning to obtain a recombinant plasmid pUC-ldhA. A reverse PCR amplification is carried out using the plasmid pUC-ldhA as a template and RldhA1 and RldhA2 as primers, and a self-link is carried out between the products, then a recombinant plasmid pUC-PldhA is obtained. A PCR amplification (StrbLDH1 and StrbLDH2 as primers) is carried out using Steptococcus. bovis 1.1624 chromosome DNA as a template to obtain the ldhStrb gene segment. After digestion by BamHI and EcoRI, it is introduced to BglII and EcoRI of pUC-PldhA to obtain a recombinant plasmid pUC-PldhA-ldhStrb. Then, the difGm segment is introduced to the EcoRV site of the recombinant plasmid pUC-PldhA-ldhStrb, to obtain a recombinant plasmid pUC-PldhA-ldhBcoa-difGm.

(82) A lldD gene segment is obtained by PCR amplification (primers are lldD1 and lldD2), and is introduced to a sub-cloning vector pUC18 to obtain a recombinant plasmid pUC-lldD. A PldhA-ldhStrb-difGm segment is obtained from the recombinant plasmid pUC-PldhA-ldhBcoa-difGm by digestion using BamHI, and is introduced to the BamHI site of the recombinant plasmid pUC-lldD to obtain a recombinant plasmid pUC-lldD::PldhA-ldhStrb-difGm. The physical map of the recombinant plasmid is shown in FIG. 13. The recombinant plasmid pUC-lldD::PldhA-ldhStrb-difGm is digested by SmaI, and a lldD::PldhA-ldhStrb-difGm gene segment is obtained by glue extraction.

Example 14Construction of Mutant Cassette ldhA: PldhA-ldhLca-difGm

(83) The recombinant plasmid pUC-ldhA in example 10 is digested using PstI for removing 400 bps fragments therein, and pfu polymerase is used to make the sticky ends blunt. Then it is ligated to the segment PldhA-ldhLca-difGm obtained by a digestion of the recombinant plasmid pUC-PldhA-ldhLca-difGm in example 12 by BamHI followed by blunting with pfu polymerase, so that a recombinant plasmid pUC-ldhA::PldhA-ldhLca-difGm is obtained. The physical map of the obtained recombinant plasmid is shown in FIG. 14. The recombinant plasmid is digested by ApaLI, and the linearized plasmid is recycled through glue extraction. Then a PCR amplification is carried out using ldhA3 and LDH4 as primers to obtain ldhA::PldhA-ldhLca-difGm gene fragment.

Example 15Construction of Mutant Cassette ldhA: PldhA-ldhStrb-difGm

(84) The recombinant plasmid pUC-ldhA in example 10 is digested using PstI for removing 400 bps fragments therein, and the sticky tail end is blunted by a pfu polymerase. Then it is ligated to the segment pldhA-ldhStrb-difGm obtained by a digestion of the recombinant plasmid pUC-PldhA-ldhStrb-difGm in example 13 by BamHI followed by a blunting with pfu polymerase, so that a recombinant plasmid pUC-ldhA:: PldhA-ldhStrb-difGm is obtained. The physical map of the obtained recombinant plasmid is shown in FIG. 15. The recombinant plasmid is digested by ApaLI, and the linearized plasmid is recycled through glue extraction. Then a PCR amplification is carried out using ldhA3 and LDH4 as primers to obtain ldhA::PldhA-ldhStrb-difGm gene fragment.

Example 16Construction of Mutant Cassette thiE::PldhA-ldhLca-difGm

(85) The recombinant plasmid pUC-PldhA-ldhLca-difGm in example 12 is digested using BamHI to obtain PldhA-ldhLca-difGm segment, and the segment is blunted by DNA polymerase pfu. Then it is introduced to the StuI site of the recombinant plasmid pUC-thiE in example 2 to obtain a recombinant plasmid pUC-thiE::PldhA-ldhLca-difGm. The physical map of the obtained recombinant plasmid is shown in FIG. 16. The recombinant plasmid pUC-thiE::PldhA-ldhLca-difGm is digested by ApaLI, and the linearized plasmid is recycled through glue extraction. Then a PCR amplification is carried out using ThiE1p and ThiE2p as primers to obtain thiE::PldhA-ldhLca-difGm gene fragment.

Example 17Construction of Mutant Cassette thiE:: PldhA-ldhStrb-difGm

(86) The recombinant plasmid pUC-PldhA-ldhStrb-difGm in example 13 is digested using BamHI to obtain PldhA-ldhStrb-difGm segment, and the segment is blunted by DNA polymerase pfu. Then it is introduced to the StuI site of the recombinant plasmid pUC-thiE in example 2 to obtain a recombinant plasmid pUC-thiE::PldhA-ldhStrb-difGm. The physical map of the obtained recombinant plasmid is shown in FIG. 17. The recombinant plasmid pUC-thiE::PldhA-ldhStrb-difGm is digested by ApaLI, and the linearized plasmid is recycled through glue extraction. Then a PCR amplification is carried out using ThiE1p and ThiE2p as primers to obtain thiE::PldhA-ldhStrb-difGm gene fragment.

Example 18Construction of Mutant Cassette thiE::PldhA-ldhBcoa-difGm

(87) The recombinant plasmid pUC-PldhA-ldhBcoa-difGm in example 11 is digested using BamHI to obtain PldhA-ldhBcoa-difGm segment, and the segment is blunted by DNA polymerase pfu. Then it is introduced to the StuI site of the recombinant plasmid pUC-thiE in example 2 to Obtain a recombinant plasmid pUC-thiE::PldhA-ldhBcoa-difGm. The physical map of the obtained recombinant plasmid is shown in FIG. 18. The recombinant plasmid pUC-thiE::PldhA-ldhBcoa-difGm is digested by ApaLI, and the linearized plasmid is recycled through glue extraction. Then a PCR amplification is carried out using ThiE1p and ThiE2p as primers to obtain thiE::PldhA-ldhBcoa-difGm gene fragment.

Example 19Construction of Temperature Controllable Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(88) Promoter ldhAp of lactic dehydrogenase gene in starting strain B0013 is replaced with promoter pR-pL by means of gene integration technology (Love C. A. et al., Gene, 1996, 176:49-53) to obtain a recombinant sham E. coli B0013-010 B (B0013 ldhA::kan-clts857-pR-pL).

Example 20Construction of GrowthQuantitatively Controllable Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(89) A gene integration technology is utilized to construct a thiamine phosphate synthase (thiE) coding gene deletion mutant cassette thiE::difGm, deleting the thiE gene of the recombinant strain obtained in step 2, and the recombinant strain E. coli B0013-020 B (B0013 010B thiE::dif).

Example 21Construction of D-lactic Acid Metabolism Utilization Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(90) A gene integration technology is utilized to construct a mutant cassette dld::difGm used for deleting FAD-dependent type D-lactic dehydrogenase (dld) encoding gene, then the dld gene of the recombinant strain obtained in the step 3 is deleted, thus the recombinant strain E. coli B0013-030B (B0013-020B dld::dif) is obtained.

Example 22Construction of Anaerobic Acetic Acid Synthesis Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(91) A gene integration technology is utilized to construct a mutant cassette ackA-pta::difGm used for deleting acetic acetokinase (ackA) and phosphotransacetylase (pta) coding gene, then the ackA-pta gene of the recombinant strain obtained in step 4 is deleted, thus the recombinant strain E. coli B0013-040B (B0013-030B ackA-pta::dif) is obtained.

Example 23Construction of Pyruvic Acid Reflux Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(92) A gene integration technology is utilized to construct a mutant cassette pps:: difGm used for deleting phosphoenol pyruvate synthase (pps) coding gene, then the pps gene of the recombinant strains obtained in step 4 and step 5 are deleted, and thus the recombinant strain E. coli B0013-040C (B0013-030B pps::dif) and B0013-050 B (B0013-040B pps::dif) are obtained.

Example 24Construction of Formic Acid Anaerobic Synthesis Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(93) A gene integration technology is utilized to construct a mutant cassette pflB:: difGm used for deleting pyruvate formate-lyase (pflB) coding gene, then the pflB gene of the recombinant strains obtained in step 4, step 5 and step 6 are deleted, and thus the recombinant strain E. coli B0013-040D (B0013-030B pflB::dif) B0013-050C(B0013-040B pflB::dif), B0013-050 D (B0013-040C pflB::dif) and B0013-060 B (B0013-050B pflB::dif) are obtained.

Example 25Construction of Acetic Acid Aerobic Synthesis Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(94) A gene integration technology is utilized to construct a mutant cassette poxB:: difGm used for deleting pyruvate oxidase (poxB) coding gene, then the poxB gene of the recombinant strains obtained in step 4, step 5, step 6 and step 7 are deleted, and thus the recombinant strain E. coli B0013-040E (B0013-030B poxB::dif), B0013-050E (B0013-040B poxB::dif), B0013-050 F(B0013-040C poxB::dif), B0013-060C (B0013-050B poxB::dif), B0013-050G (B0013-040D poxB::dif), B0013-060D (B0013-050C poxB::dif), B0013-060F (B0013-050D poxB::dif), and B0013-070B (B0013-060B poxB::dif) are obtained.

Example 26Construction of Butanedioic Acid Synthesis Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(95) A gene integration technology is utilized to construct a mutant cassette frdA:: difGm used for deleting fumaric reductase (frdA) coding gene, then the frdA gene of the recombinant strains obtained in step 4, step 5, step 6, step 7 and step 8 are deleted, and thus the recombinant strain E. coli B0013-040F (B0013-030B frdA::dif), B0013-050H (B0013-040B frdA::dif), B0013-050I (B0013-040C frdA::dif), B0013-060G (B0013-050B frdA::dif), B0013-050J (B0013-040D frdA::dif), B0013-060H (B0013-050C frdA::dif), B0013-060I (B0013-050D frdA::dif), B0013-070C (B0013-060B frdA::dif), B0013-050K (B0013-040E frdA::dif), B0013-060J (B0013-050E frdA::dif), B0013-060K (B0013-050F frdA::dif), B0013-070D (B0013-060C frdA::dif), B0013-060L (B0013-050G frdA::dif), B0013-070E (B0013-060D frdA::dif), B0013-070F (B0013-060F frdA::dif) and B0013-080B (B0013-070B frdA::dif) are obtained.

Example 27Construction of Ethanol Synthesis Pathway Blocking Type of Extremely High Optical Pure D-lactic Acid Producing Strain

(96) A gene integration technology is utilized to construct a mutant cassette adhE:: difGm used for deleting ethanol dehydrogenase (adhE) coding gene, then the adhE gene of the recombinant strains obtained in step 4, step 5, step 6, step 7, step 8 and step 9 are deleted, and thus the recombinant strain E. coli B0013-040G (B0013-030B adhE::dif), B0013-050L (B0013-040B adhE::dif), B0013-050M (B0013-040C adhE::dif), B0013-060M (B0013-050B adhE::dif), B0013-050N (B0013-040D adhE::dif), B0013-060N (B0013-050C adhE::dif), B0013-060O (B0013-050D adhE::dif), B0013-070G (B0013-060B adhE::dif), B0013-050O (B0013-040E adhE::dif), B0013-060P (B0013-050E adhE::dif), B0013-060Q (B0013-050F adhE::dif), B0013-070H (B0013-060C adhE::dif), B0013-060R (B0013-050G adhE::dif), B0013-070I (B0013-060D adhE::dif), B0013-070J (B0013-060F adhE::dif), B0013-080C (B0013-070B adhE::dif), B0013-050P (B0013-040F adhE::dif), B0013-060S (B0013-050H adhE::dif), B0013-060T (B0013-050I adhE::dif), B0013-070K (B0013-060G adhE::dif), B0013-060U (B0013-050J adhE::dif), B0013-070L (B0013-060H adhE::dif), B0013-070M (B0013-060I adhE::dif), B0013-080D (B0013-070C adhE::dif), B0013-060V (B0013-050K adhE::dif), B0013-070N (B0013-060J adhE::dif), B0013-070O (B0013-060K frdA::dif), B0013-080E (B0013-070D adhE::dif), B0013-070P (B0013-060L adhE::dif), B0013-080F (B0013-070E adhE::dif), B0013-080G (B0013-070F adhE::dif) and B0013-090B (B0013-080B adhE::dif) are obtained.

Example 28Construction of D-lactic Acid Synthesis Pathway Blocking Type of Strain

(97) A gene integration technology is utilized to construct a mutant cassette ldhA:: difGm used for deleting D-lactate dehydrogenase (ldhA) coding gene, then the ldhA gene of the recombinant strains B0013-070 is deleted, and thus the recombinant strain E. coli B0013-080H (B0013-070 ldhA::dif) is obtained.

Example 29Construction of D-lactic Acid Synthesis Pathway Blocking Type Extremely High Optical Purity D-lactic Acid Producing Strain

(98) A gene integration technology is utilized to construct a mutant cassette ldhA:: PldhA-ldhLca-difGm used for deleting D-lactate dehydrogenase (ldhA) coding gene, then the ldhA gene of the recombinant bacterium B0013-070 is deleted, and thus the recombinant strain E. coli B0013-080I (B0013-070 ldhA::PldhA-ldhLca-dif) is obtained.

Example 30Construction of D-lactic Acid Synthesis Pathway Blocking Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(99) A gene integration technology is utilized to construct a mutant cassette ldhA:: PldhA-ldhStrb-difGm used for deleting D-lactate dehydrogenase (ldhA) coding gene, then the ldhA gene of the recombinant strain B0013-070 is deleted, and thus the recombinant strain E. coli B0013-080J (B0013-070 ldhA::PldhA-ldhStrb-dif) is obtained.

Example 31Construction of L-lactic Acid Metabolism Utilization Pathway Blocking Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(100) A gene integration technology is utilized to construct a mutant cassette lldD:: PldhA-ldhBcoa-difGm used for deleting D-lactic dehydrogenase gene (lldD) coding gene, then the lldD gene of the recombinant strain B0013-070, B0013-080H, B0013-080I and B0013-080J are deleted, and thus the recombinant strains E. coli B0013-080K (B0013-070 lldD::PldhA-ldhBcoa-dif), B0013-090C (B0013-080H lldD::PldhA-ldhBcoa-dif), B0013-090D (B0013-080I lldD::PldhA-ldhBcoa-dif) and B0013-090E (B0013-080J lldD::PldhA-ldhBcoa-dif) are obtained.

Example 32Construction of L-lactic Acid Metabolism Utilization Pathway Blocking Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(101) A gene integration technology is utilized to construct a mutant cassette lldD:: PldhA-ldhLca-difGm used for deleting the coding gene of L-lactic dehydrogenase gene (lldD) adopted FMN as coenzyme, then the lldD gene of the recombinant strains B0013-070, B0013-080H, B0013-080I and B0013-080J are deleted, and thus the recombinant strain E. coli B0013-080L (B0013-070 lldD::PldhA-ldhLca-dif), B0013-090F (B0013-080H lldD::PldhA-ldhLca-dif), B0013-090G (B0013-080I lldD:: PldhA-ldhLca-dif) and B0013-090H (B0013-080J lldD:: PldhA-ldhLca-dif) are obtained.

Example 33Construction of L-lactic Acid Metabolism Utilization Pathway Blocking Type Extremely High Optical Pure L-lactic Acid Producing Strain

(102) A gene integration technology is utilized to construct a mutant cassette lldD:: PldhA-ldhLca-difGm used for deleting the coding gene of L-lactic dehydrogenase gene (lldD) in which FMN is taken as coenzyme, then the lldD gene of the recombinant strains B0013-070, B0013-080H, B0013-080I and B0013-080J are deleted, and thus the recombinant strain E. coli B0013-080M (B0013-070 lldD:: PldhA-ldhStrb-dif), B0013-090I (B0013-080H lldD:: PldhA-ldhStrb-dif), B0013-090J (B0013-080I lldD:: PldhA-ldhStrb-dif) and B0013-090K (B0013-080J lldD:: PldhA-ldhStrb-dif) are obtained.

Example 34Construction of GrowthQuantitatively Controllable Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(103) A gene integration technology is utilized to construct a mutant cassette thiE::difGm used for deleting the coding gene of thiamine phosphate synthase (thiE), then the thiE gene of the recombinant strains in step 11, step 12, step 13, step 14, step 15 and step 16 are deleted, and thus the recombinant strains E. coli B0013-090L (B0013-080H thiE::dif), B0013-090M (B0013-080I thiE::dif), B0013-090N (B0013-080J thiE::dif), B0013-090O (B0013-080K thiE::dif), B0013-100B (B0013-090C thiE::dif), B0013-100C (B0013-090D thiE::dif), B0013-100D (B0013-090E thiE::dif), B0013-090E (B0013-080L thiE::dif), B0013-100E (B0013-090F thiE::dif), B0013-100F (B0013-090G thiE::dif), B0013-100G (B0013-090H thiE::dif), B0013-080N (B0013-070 thiE::dif), B0013-100H (B0013-090I thiE::dif), B0013-100I (B0013-090J thiE::dif) and B0013-100J (B0013-090K thiE::dif) are obtained.

Example 35Construction of GrowthQuantitatively Controllable Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(104) A gene integration technology is utilized to construct a mutant cassette thiE:: PldhA-ldhLca-difGm used for deleting the coding gene of thiamine phosphate synthase (thiE), then the thiE gene of the recombinant strains in step 11, step 12, step 13, step 14, step 15 and step 16 are deleted, and thus the recombinant strains E. coli B0013-090P (B0013-080H thiE::PldhA-ldhLca-dif), B0013-090Q (B0013-080I thiE::PldhA-ldhLca-dif), B0013-090R (B0013-080J thiE::PldhA-ldhLca-dif), B0013-090S (B0013-080K thiE::PldhA-ldhLca-dif), B0013-100K (B0013-090C thiE::PldhA-ldhLca-dif), B0013-100L (B0013-090D thiE::PldhA-ldhLca-dif), B0013-100M (B0013-090E thiE::PldhA-ldhLca-dif), B0013-090T (B0013-080L thiE::PldhA-ldhLca-dif), B0013-100N (B0013-090F thiE::PldhA-ldhLca-dif), B0013-100O (B0013-090G thiE::PldhA-ldhLca-dif), B0013-100P (B0013-090H thiE::PldhA-ldhLca-dif) B0013-080O (B0013-070 thiE::PldhA-ldhLca-dif), B0013-100Q (B0013-090I thiE::PldhA-ldhLca-dif), B0013-100R (B0013-090J thiE::PldhA-ldhLca-dif) and B0013-100S (B0013-090K thiE::PldhA-ldhLca-dif) are obtained.

Example 36Construction of GrowthQuantitatively Controllable Type of Extremely-High Optical Pure L-lactic Acid Producing Strain

(105) A gene integration technology is utilized to construct a mutant cassette thiE:: PldhA-ldhStrb-difGm used for deleting the coding gene of thiamine phosphate synthase (thiE), then the thiE gene of the recombinant strains in step 11, step 12, step 13, step 14, step 15 and step 16 are deleted, and thus the recombinant strains E. coli B0013-090U (B0013-080H thiE::PldhA-ldhStrb-dif), B0013-090V (B0013-080I thiE::PldhA-ldhStrb-dif), B0013-090W (B0013-080J thiE::PldhA-ldhStrb-dif), B0013-090X (B0013-080K thiE::PldhA-ldhStrb-dif), B0013-100T (B0013-090C thiE::PldhA-ldhStrb-dif), B0013-100U (B0013-090D thiE::PldhA-ldhStrb-dif), B0013-100V (B0013-090E thiE::PldhA-ldhStrb-dif), B0013-090Y (B0013-080L thiE::PldhA-ldhStrb-dif), B0013-100W (B0013-090F thiE::PldhA-ldhStrb-dif), B0013-100X (B0013-090G thiE::PldhA-ldhStrb-dif), B0013-100Y (B0013-090H thiE::PldhA-ldhStrb-dif), B0013-080P (B0013-070 thiE::PldhA-ldhStrb-dif), B0013-100Z (B0013-090I thiE::PldhA-ldhStrb-dif), B0013-100BB (B0013-090J thiE::PldhA-ldhStrb-dif) and B0013-100BC (B0013-090K thiE::PldhA-ldhStrb-dif) are obtained.

Example 37Construction of GrowthQuantitatively Controllable Type of Extremely High Optical Pure L-lactic Acid Producing Strain

(106) A gene integration technology is utilized to construct a mutant cassette thiE:: PldhA-ldhBcoa-difGm used for deleting the coding gene of thiamine phosphate synthase (thiE), then the thiE gene of the recombinant strains in step 11, step 12, step 13, step 14, step 15 and step 16 are deleted, and thus the recombinant strains E. coli B0013-090Z (B0013-080H thiE::PldhA-ldhBcoa-dif), B0013-090BB (B0013-080I thiE::PldhA-ldhBcoa-dif), B0013-090BC (B0013-080J thiE::PldhA-ldhBcoa-dif), B0013-090BD (B0013-080K thiE::PldhA-ldhBcoa-dif), B0013-100BD (B0013-090C thiE::PldhA-ldhBcoa-dif), B0013-100BE (B0013-090D thiE::PldhA-ldhBcoa-dif), B0013-100BF (B0013-090E thiE::PldhA-ldhBcoa-dif), B0013-090BE (B0013-080L thiE::PldhA-ldhBcoa-dif), B0013-100BG (B0013-090F thiE::PldhA-ldhBcoa-dif), B0013-100BH (B0013-090G thiE::PldhA-ldhBcoa-dif), B0013-100BI (B0013-090H thiE::PldhA-ldhBcoa-dif), B0013-080Q (B0013-070 thiE::PldhA-ldhBcoa-dif), B0013-100BJ (B0013-090I thiE::PldhA-ldhBcoa-dif), B0013-100BK (B0013-090J thiE::PldhA-ldhBcoa-dif), B0013-100BL (B0013-090K thiE::PldhA-ldhBcoa-dif), B0013-100BM (B0013-090U thiE::PldhA-ldhBcoa-dif), B0013-100BN (B0013-090V thiE::PldhA-ldhBcoa-dif), B0013-100BO (B0013-090W thiE::PldhA-ldhBcoa-dif), B0013-100BP (B0013-090X thiE:PldhA-ldhBcoa-dif), B0013-101B (B0013-100T thiE:PldhA-ldhBcoa-dif), B0013-101C (B0013-100U thiE::PldhA-ldhBcoa-dif), B0013-101D (B0013-100V thiE::PldhA-ldhBcoa-dif), B0013-100BQ (B0013-090Y thiE::PldhA-ldhBcoa-dif), B0013-101E (B0013-100W thiE::PldhA-ldhBcoa-dif), B0013-101F (B0013-100X thiE::PldhA-ldhBcoa-dif), B0013-101G (B0013-100Y thiE::PldhA-ldhBcoa-dif), B0013-090BF (B0013-080P thiE::PldhA-ldhBcoa-dif), B0013-101H (B0013-100Z thiE:: thiE::PldhA-ldhBcoa-dif), B0013-101I (B0013-100BB thiE::PldhA-ldhBcoa-dif) and B0013-101J (B0013-100BC thiE::PldhA-ldhBcoa-dif) are obtained.

Example 38Screening of D-lactic Acid High-Yield Strain with Extremely High Optical Purity

(107) The recombinant strains obtained in the steps 19-27 are aerobically cultured respectively at 25-36 C., 200 r/min for 6-10 h with 0.06-100 g/L thiamine firstly, then the lactic acid fermentation is carried out by stationary culture at 37-50 C. Adopting the starting strain B0013-070 as a control, the synthesis level of D-lactic acid, the optical purity and the chemical purity of the producted D-lactic acid are analyzed, to screen out the optimal strain. The screening result is shown in FIG. 19 and table 1.

(108) TABLE-US-00001 TABLE 1 screening result of D-lactic acid high-yield strain with extremely high optical purity Strain Strain Yield optical purity chemical purity No. Numbering (%, w/v) (%, w/w) (%, w/w) 0 B0013-070 0.6 99.9 75 1 B0013-010B 12 99.95 79 2 B0013-020B 14 99.96 80 3 B0013-030B 40 99.95 85 4 B0013-040B 43 99.97 88 5 B0013-040C 43 99.96 85 6 B0013-050B 45 99.97 90 7 B0013-040D 43 99.95 90 8 B0013-050C 44 99.96 89 9 B0013-050D 47 99.95 89 10 B0013-060B 49 99.97 92 11 B0013-040E 42 99.96 78 12 B0013-050E 45 99.97 87 13 B0013-050F 46 99.97 88 14 B0013-060C 48 99.96 90 15 B0013-050G 43 99.97 86 16 B0013-060D 43 99.97 90 17 B0013-060F 44 99.95 89 18 B0013-070B 52 99.96 94 19 B0013-040F 42 99.95 87 20 B0013-050H 45 99.97 90 21 B0013-050I 44 99.96 85 22 B0013-060G 45 99.97 86 23 B0013-050J 41 99.97 87 24 B0013-060H 48 99.95 90 25 B0013-060I 48 99.96 91 26 B0013-070C 49 99.95 88 27 B0013-050K 42 99.97 85 28 B0013-060J 40 99.95 78 29 B0013-060K 45 99.96 89 30 B0013-070D 49 99.95 90 31 B0013-060L 46 99.97 88 32 B0013-070E 47 99.96 81 33 B0013-070F 49 99.97 89 34 B0013-080B 56 99.95 94 35 B0013-040G 43 99.96 79 36 B0013-050L 47 99.95 86 37 B0013-050M 45 99.95 88 38 B0013-060M 43 99.96 90 39 B0013-050N 47 99.95 87 40 B0013-060N 43 99.97 80 41 B0013-060O 43 99.96 83 42 B0013-070G 48 99.95 89 43 B0013-050O 43 99.96 77 44 B0013-060P 48 99.95 91 45 B0013-060Q 48 99.95 90 46 B0013-070H 41 99.96 93 47 B0013-060R 47 99.95 88 48 B0013-070I 49 99.97 90 49 B0013-070J 48 99.95 89 50 B0013-080C 48 99.96 92 51 B0013-050P 41 99.95 86 52 B0013-060S 47 99.95 88 53 B0013-060T 46 99.95 87 54 B0013-070K 48 99.96 90 55 B0013-060U 45 99.95 88 56 B0013-070L 50 99.95 92 57 B0013-070M 51 99.96 92 58 B0013-080D 50 99.95 94 59 B0013-060V 47 99.96 89 60 B0013-070N 49 99.95 90 61 B0013-070O 47 99.95 88 62 B0013-080E 50 99.96 86 63 B0013-070P 44 99.95 90 64 B0013-080F 53 99.97 93 65 B0013-080G 55 99.95 95 66 B0013-090B 56 99.96 97

Example 39Screening of L-lactic Acid High-Yield Strain with Extremely High Optical Purity

(109) The recombinant strains obtained in the steps 28-37 are aerobically cultured respectively at 25-36 C., and 200 r/min for 6-10 h with 0.06-100 g/L thiamine firstly, then the lactic acid fermentation is carried out by stationary culture at 37-50 C. Adopting the starting strain B0013-070 as a control, the synthesis level of L-lactic acid, the optical purity and the chemical purity of the producted L-lactic acid are analyzed, to screen out the optimal strain. The screening result is shown in FIG. 20 and table 2.

(110) TABLE-US-00002 TABLE 2 Screening result of extremely high optical pure L-lactic acid strain with high-yield Strain Strain Yield optical purity chemical purity No. Numbering (%, w/v) (%, w/w) (%, w/w) 0 B0013-070 0 0 0 67 B0013-080H 0 0 0 68 B0013-080I 40 99.96 88 69 B0013-080J 45 99.97 85 70 B0013-080K 49 99.96 88 71 B0013-090C 46 99.96 85 72 B0013-090D 47 99.95 90 73 B0013-090E 47 99.96 90 74 B0013-080L 51 99.97 89 75 B0013-090F 41 99.96 97 76 B0013-090G 48 99.95 92 77 B0013-090H 48 99.97 96 78 B0013-080M 49 99.96 87 79 B0013-090I 42 99.95 88 80 B0013-090J 40 99.96 86 81 B0013-090K 45 99.97 92 82 B0013-090L 58 99.97 98 83 B0013-090M 45 99.95 89 84 B0013-090N 49 99.96 94 85 B0013-090O 46 99.97 87 86 B0013-100B 47 99.95 90 87 B0013-100C 55 99.96 93 88 B0013-100D 56 99.97 86 89 B0013-090E 41 99.97 87 90 B0013-100E 48 99.95 95 91 B0013-100F 48 99.96 91 92 B0013-100G 49 99.95 88 93 B0013-080N 53 99.95 93 94 B0013-100H 46 99.97 89 95 B0013-100I 47 99.96 89 96 B0013-100J 57 99.95 90 97 B0013-090P 56 99.95 88 98 B0013-090Q 41 99.95 81 99 B0013-090R 48 99.97 89 100 B0013-090S 55 99.97 92 101 B0013-100K 49 99.96 97 102 B0013-100L 52 99.95 86 103 B0013-100M 40 99.95 88 104 B0013-090T 49 99.96 90 105 B0013-100N 56 99.95 87 106 B0013-100O 41 99.97 80 107 B0013-100P 48 99.96 83 108 B0013-080O 48 99.96 89 109 B0013-100Q 49 99.96 77 110 B0013-100R 42 99.95 91 111 B0013-100S 59 99.95 88 112 B0013-090U 45 99.97 93 113 B0013-090V 49 99.95 88 114 B0013-090W 48 99.97 93 115 B0013-090X 56 99.95 89 116 B0013-100T 49 99.95 92 117 B0013-100U 46 99.95 88 118 B0013-100V 47 99.95 88 119 B0013-090Y 47 99.95 87 120 B0013-100W 56 99.96 90 121 B0013-100X 41 99.95 88 122 B0013-100Y 53 99.96 92 123 B0013-080P 48 99.95 92 124 B0013-100Z 49 99.95 94 125 B0013-100BB 42 99.96 89 126 B0013-100BC 49 99.96 90 127 B0013-090Z 46 99.95 88 128 B0013-090BB 57 99.96 86 129 B0013-090BC 47 99.95 90 130 B0013-090BD 56 99.97 93 131 B0013-100BD 60 99.95 95 132 B0013-100BE 48 99.97 97 133 B0013-100BF 48 99.96 89 134 B0013-090BE 53 99.95 90 135 B0013-100BG 42 99.97 88 136 B0013-100BH 40 99.96 81 137 B0013-100BI 49 99.97 89 138 B0013-080Q 54 99.95 94 139 B0013-100BJ 49 99.96 79 140 B0013-100BK 46 99.95 86 141 B0013-100BL 59 99.95 88 142 B0013-100BM 47 99.96 90 143 B0013-100BN 56 99.95 87 144 B0013-100BO 41 99.97 80 145 B0013-100BP 48 99.95 83 146 B0013-101B 55 99.95 89 147 B0013-101C 59 99.96 77 148 B0013-101D 42 99.95 91 149 B0013-100BQ 60 99.95 90 150 B0013-101E 41 99.97 93 151 B0013-101F 59 99.96 88 152 B0013-101G 49 99.97 90 153 B0013-090BF 48 99.95 89 154 B0013-101H 66 99.96 92 155 B0013-101I 41 99.95 86 156 B0013-101J 67 99.95 98

Example 40Fermentation of Extremely High Optical Pure D-lactic Acid

(111) The optimal strain obtained by example 38 is subjected to a lactic acid fermentation test in a 7 L-30,000 L fermentation tank. During the fermentation process, samples are sampled regularly, and the cell density, the sugar consumption, the lactic acid yield, the metabolic main intermediate product and other organic acid products are analyzed. An aerobic culture at 25-30custom character is carried out until OD.sub.600 value is about 15-40; and the temperature of the fermentation tank is set to be 37-50custom character to continue the aerobic culture for 0-120 min, and then the ventilation quantity is set to be 0-0.2 vvm to carry out a limited oxygen fermentation, in which the fermentation temperature ranges from 33-39custom character during 0-3 h, 37-42custom character during 3-6 h, 38-45custom character during 6-10 h, 40-48custom character during 10-16 h, and 45-50custom character during 16-24 h; and the fermentation medium is (g/L): diammonium hydrogen phosphate 0-25, monopotassium phosphate 0-5, disodium hydrogen phosphate 0-25, sodium chloride 0-5, MgSO.sub.4 0-0.5, FeSO.sub.4 0-1, FeCl.sub.3 0-1, CoCl.sub.2 0-1, CuCl.sub.2 0-1, Na.sub.2MoO.sub.4 0-1, H.sub.3BO.sub.3 0-1, MnCl.sub.2 0-1, citric acid 0-25, thiamine 0-1, xylose 0-50, glycerol 0-50, glucose 0-50, sulfuric acid 0-5, and pH 6.0-7.5.

(112) Detailed fermentation results are shown in FIG. 21 and FIG. 22.

Example 41Fermentation Production of L-lactic Acid High-Yield Strain with Extremely High Optical Purity

(113) The optimal strain obtained by example 39 is subjected to a lactic acid fermentation test in a 7 L-30,000 L fermentation tank. During the fermentation process, samples are sampled regularly, and the cell density, the sugar consumption, the lactic acid yield, the metabolic main intermediate product and other organic acid products are analyzed. An aerobic culture at 25-36custom character is carried out until OD.sub.600 value is about 15-40; and the temperature of the fermentation tank is set to be 37-50custom character to continue the aerobic culture for 0-120 min, and then the ventilation quantity is set to be 0-0.2 vvm to carry out a limited oxygen fermentation, in which the fermentation temperature ranges from 37-50custom character; and the fermentation medium is (g/L): diammonium hydrogen phosphate 0-25, monopotassium phosphate 0-5, disodium hydrogen phosphate 0-25, sodium chloride 0-5, MgSO.sub.4 0-0.5, FeSO.sub.4 0-1, FeCl.sub.3 0-1, CoCl.sub.2 0-1, CuCl.sub.2 0-1, ZnCl.sub.2 0-1, Na.sub.2MoO.sub.4 0-1, H.sub.3BO.sub.3 0-1, MnCl.sub.2 0-1, citric acid 0-25, thiamine 0-1, xylose 0-50, glycerol 0-50, glucose 0-50, sulfuric acid 0-5, and pH 6.0-7.5.

(114) Detailed fermentation results are shown in FIG. 23 and FIG. 24.

Example 42Fermentation of Strain to Product Extremely High Optical Pure D-lactic Acid by Five-Batch Fermentation in 10-Ton Tank

(115) The optimal strain of producing extremely high pure D-lactic acid obtained by example 38 is subjected to a fermentation in a 10-ton fermentation tank for five batches.

(116) (1) Primary Seed Culture

(117) 1 mL strain preserved in an ultra low-temperature glycerol tube was taken and inoculated into to 5 L shake flask with 1 L dedicated liquid medium (ZT1 medium), and cultured at 37custom character, 200 r/min for 10-13 h.

(118) Preparation of ZT1 Medium

(119) Components 1, total of 12.6 g, is dissolved by water to 700 mL, and is subjected to sterilization at 121custom character for 20 min.

(120) Components 2, total of 18 g, is dissolved by water to 150 mL, and is subjected to a separate sterilization, and added when inoculating.

(121) Components 3, total of 5 g, is dissolved by water to 150 mL, and is subjected to a separate sterilization, and added when inoculating.

(122) In which the ZT1 medium comprises (g/L): diammonium hydrogen phosphate 0-25, monopotassium phosphate 0-5, disodium hydrogen phosphate 0-25, sodium chloride 0-5, MgSO.sub.4 0-0.5, FeSO.sub.4 0-1, FeCl.sub.3 0-1, CoCl.sub.2 0-1,CuCl.sub.2 0-1, ZnCl.sub.2 0-1, Na.sub.2MoO.sub.4 0-1, H.sub.3BO.sub.3 0-1, MnCl.sub.2 0-1, citric acid 0-25, thiamine 0-1, xylose 0-50, glycerol 0-50, glucose 0-50, sulfuric acid 0-5, and pH 6.0-7.5.

(123) (2) Secondary Seed Culture

(124) The above seed fermentation broth of 1 L is inoculated into a 100 L secondary seed tank with a loading volume of 50 L, and then cultured at 33-37custom character, low-ventilation for 10-13 h.

(125) Preparation of ZT2 Medium of the Secondary Seed Tank

(126) Components 1, total of 570 g, is dissolved by water to 30 L, and is subjected to sterilization at 121custom character for 20 min.

(127) Components 2, total of 810 g, is dissolved by water to 5 L, and is subjected to a separate sterilization, and added when inoculating.

(128) Components 3, total of 1350 g, is dissolved by water to 5 L, and is subjected to a separate sterilization, and added When inoculating.

(129) In which the ZT1 culture medium comprises (g/L): diammonium hydrogen phosphate 0-25, monopotassium phosphate 0-5, disodium hydrogen phosphate 0-25, sodium chloride 0-5, MgSO.sub.4 0-0.5, FeSO.sub.4 0-1, FeCl.sub.3 0-1, CoCl.sub.2 0-1,CuCl.sub.2 0-1, ZnCl.sub.2 0-1, Na.sub.2MoO.sub.4 0-1, H.sub.3BO.sub.3 0-1, MnCl.sub.2 0-1, citric acid 0-25, thiamine 0-1, xylose 0-50, glycerol 0-50, glucose 0-50, sulfuric acid 0-5, and pH 6.0-7.5.

(130) (3) Fermentation

(131) The above secondary enlarged seed fermentation broth of 50 L is transferred to a 10 m.sup.3 fermentation tank. The starting volume is 5 m.sup.3, and the ZT2 medium is selected as the basis of the fermentation medium. The content in the tank is cultured at 33-37custom character, low-ventilation, for 8-9 h; and the starting ventilation rate is 1:0.3 (feedstock: air), the dissolved oxygen is controlled to no lower than 20% during the culture by increasing rotate speed and ventilation. The pH is maintained to be 7.0 by Ca(OH).sub.2. Then, it is into non-ventilation fermentation phase, the temperature is kept at 40-45custom character, the pH is maintained to be 7.0 by Ca(OH).sub.2. Glucose is replenished to the final concentration of 50 g/L (calculated based on the starting volume), the replenishment is carried out in 4 batches with a interval of 3 h. The fermentation is carried out for 20-22 h, the concentration of the remaining glucose is measured to be lower than 0.1%, and then the contents in the fermentation can be released. The above process is repeated for performing 5 batches of fermentation production. The fermentation result is shown in table 3.

(132) TABLE-US-00003 TABLE 3 fermentation production result of extremely high optical pure D-lactic acid by five-batch fermentation in a 10-ton tank Concentra- convert ratio Fermen- tion of D- of substrate Optical Chemical tation lactic acid to product purity purity batches period (h) (%, w/v) (%, w/w) (%, w/w) (%, w/w) 1405 30 14.5 86.3 99.96 97.7 1406 29 14.9 87.6 99.97 98.4 1407 32 15.4 86.1 99.95 97.8 1408 28 14.8 87.0 99.96 98.6 1409 31 14.8 86.7 99.98 97.2

Example 43Fermentation of Strain to Product Extremely High Optical Pure L-lactic Acid by Five-Batch Fermentation in 10-Ton Tank

(133) According to the processes in example 42, the optimal strain obtained by the example 39 is selected as the producing strain to carry out fermentation production in a 10-ton fermentation tank for 5 batches. The fermentation result is shown in table 4.

(134) TABLE-US-00004 TABLE 4 fermentation production result of extremely high optical pure L-lactic acid by five-batch fermentation in a 10-ton tank Concentra- convert ratio Fermen- tion of D- of substrate Optical Chemical tation lactic acid to product purity purity batches period (h) (%, w/v) (%, w/w) (%, w/w) (%, w/w) 1410 34 18.5 88.7 99.96 98.7 1411 35 17.9 89.1 99.98 99.4 1412 34 18.4 88.4 99.96 98.6 1413 36 18.4 89.3 99.97 99.1 1414 35 17.8 88.5 99.96 99.2

Example 44Preparation of High Optical Pure D-lactic Acid and L-lactic Acid Product

(135) Sulfuric acid with the concentration of 1%-50% is added slowly to the fermentation broth after fermentation to perform acidification. The sulfuric acid is added while stirring, wherein it is firstly added with 1%-18% of volume. The acidity is measured by BaCl.sub.2 and ammonium oxalate reagent, and the addition of sulfuric acid is terminated when weak-acidity is shown. Then a reaction under stirring is conducted for 6 h, wherein the reaction end point is respectively verified by using BaCl.sub.2 and an ammonium oxalate reagent.

(136) Filtration by frame filter: the acidified fermentation broth is subjected to filter pressing through a plate-and-frame filter. After this, the resulting filter cake is washed by hot-water of 85custom character until the concentration of the lactic acid in the washing fluid is lower than 0.1%. And then, the washed filter cake is dried by compressed air, the washing liquid is merged into the clear liquid. The thallus and the solid calcium salt are used as cement or concrete materials.

(137) Ultrafiltration: pigments, proteins, amino acids, residual thallus and the like are removed by ultrafiltration. In order to improve the efficiency of the ultrafiltration, an evaporation concentration is carried out before ultrafiltration, wherein the concentration ratio is 4:1. And the ultrafiltration is carried out on the resulting concentrated solution.

(138) Ion exchange: the filtrate obtained after ultrafiltration is subjected to an ion-exchange.

(139) Cation exchange: 732 cation exchange resin, which is a cation resin with a sulfonic acid group (SO3H) on a styrene-divinyl copolymer of 7% degree of crosslinking (SO3H) (0017 (732) strong-acidic styrene-based cation exchange resin); the to-be treated liquid is cooled to the room temperature before performing ion-exchange. The resin is subjected to a regeneration treatment by 5% w/v of HCl solution. Intermediate inspection: Fe.sup.2+ does not exceed 1 ppm, and the exchange flow rate is 300 mL/min (depending on the detection result).

(140) Anion exchange: 330 (701) weak-alkaline anion exchange resin (weakly alkaline epoxy based anion exchange resin, and is mainly used for removing Cl.sup.1, SO.sub.4.sub.2 in water treatment, and removing inorganic acid, extracting organic acid and decolorizing, and recovering copper and silver ions); The resin is subjected to a regeneration treatment by 5% w/v of NaOH solution; the exchange flow rate is 300 mL/min (depending on the detection result); intermediate inspection: Cl.sup.1 does not exceed 1 ppm, SO.sub.4.sub.2 does not exceed 5 ppm.

(141) Concentration for the product: a concentration is performed until the required lactic acid concentration is reached. The product is polymer grade of D-lactic acid/L-lactic acid.

(142) In conclusion, the present disclosure adopts the genetic engineering technology to perform dynamic regulation on the expression of the lactic acid dehydrogenase coding gene of the L- and D-lactic acid high yield recombinant strain, so that the simple fermentation process for efficiently and solely producing the D-lactic acid and L-lactic acid from glucose is realized. The method of the present disclosure, after adopting simple modification, also can be used for the construction of strain, fermentation production and the establishment and the application of novel process technology for other important microbial metabolites, but is not limited to, for example, citric acid, formic acid, acetic acid, pyruvic acid, succinic acid, malic acid, -ketoglutaric acid, succinic acid, adipic acid, pentamethylene diamine, methacrylic acid, isoprene, itaconic acid and other organic acids and organic amines; or proline, alanine, lysine, methionine, glutamic acid, arginine and the like; thiamine, vitamin B12 and the like; or short-chain alcohol such as ethanol and propanol; or various functional sugars such as isomalto-oligosaccharide, fructo-oligosaccharide and galactooligosaccharide.

(143) In the above examples, the nucleotide sequence of ldhA1 is a sequence shown in a sequence table<400>1, the nucleotide sequence of ldhA2 is a sequence shown in a sequence table <400>2, the nucleotide sequence of PPL1 is a sequence shown in the sequence table<400>3, the nucleotide sequence of PPL2 is a sequence shown in the sequence table<400>4, the nucleotide sequence of PPL3 is a sequence shown in the sequence table<400>5, the nucleotide sequence of PPL4 is a sequence shown in the sequence table<400>6, the nucleotide sequence of Ec-RlA1 is a sequence shown in the sequence table<400>7, the nucleotide sequence of Ec-RlA2 is a sequence shown in the sequence table<400>8, the nucleotide sequence of ThiE1p is a sequence shown in the sequence table<400>9, the nucleotide sequence of ThiE2p is a sequence shown in the sequence table<400>10, the nucleotide sequence of Dld1 is a sequence shown in the sequence table<400>11, the nucleotide sequence of Dld2 is a sequence shown in the sequence table<400>12, the nucleotide sequence of AckA-Pta1 is a sequence shown in a sequence table <400>13, the nucleotide sequence of AckA-Pta2 is a sequence shown in the sequence table<400>14, and the nucleotide sequence of Pps 1 is a sequence shown in a sequence table <400>15, and the nucleotide sequence Pps 2 of is a sequence shown in the sequence table <400>16, the nucleotide sequence of RPps 1 is a sequence shown in a sequence table <400>17, the nucleotide sequence of the RPps 2 is a sequence shown in the sequence table <400>18, the nucleotide sequence of PflB1 is a sequence shown in a sequence table <400>19, the nucleotide sequence of PflB2 is a sequence shown in the sequence table <400>20, the nucleotide sequence of PoxB1 is a sequence shown in the sequence table <400>21, the nucleotide sequence of PoxB2 is a sequence shown in the sequence table <400>22, the nucleotide sequence of FrdA1 is a sequence shown in a sequence table <400>23, the nucleotide sequence of FrdA2 is a sequence shown in a sequence table <400=24, the AdhE1 nucleotide sequence is a sequence shown in a sequence table <400>25, the nucleotide sequence of AdhE2 is a sequence shown in the sequence table <400>26, the nucleotide sequence of ldhA3 is a sequence shown in the sequence table <400>27, the nucleotide sequence of ldhA4 is a sequence shown in a sequence table <400>28, the nucleotide sequence of ldhA5 is a sequence shown in the sequence table <400>29, the nucleotide sequence of ldhA6 is a sequence shown in the sequence table <400>30, the nucleotide sequence of RldhA1 is a sequence shown in a sequence table <400>31, the nucleotide sequence of RldhA2 is a sequence shown in the sequence table <400>32, the nucleotide sequence of BcoaLDH1 is a sequence shown in a sequence table <400>33, the nucleotide sequence of BcoaLDH4 is a sequence shown in a sequence table <400>34, the nucleotide sequence of LldD1 is a sequence shown in the sequence table <400>35, the nucleotide sequence of LldD2 is a sequence shown in a sequence table <400>36, the nucleotide sequence of LcaLDH1 is a sequence shown in a sequence table <400>37, the nucleotide sequence of LcaLDH4 is a sequence shown in the sequence table <400>38, the nucleotide sequence of StrbLDH1 is a sequence shown in the sequence table <400>39, the nucleotide sequence of the StrbLDH2 is a sequence shown in the sequence table <400>40. The specific information is as follows:

(144) The information of SEQ ID No. 1:

(145) (i) sequence features:

(146) (A) length: 27 bp

(147) (B) type: nucleic acid

(148) (C) chain property: single chain

(149) (D) topological structure: linear

(150) (ii) molecular type: oligonucleotide

(151) (iii) description to the sequence: SEQ ID No. 1

(152) ldhA1: TCCGGTACCCAGCCCGAGCGTCATCAG; KpnI

(153) The information of SEQ ID No. 2:

(154) (i) sequence features:

(155) (A) length: 25 bp

(156) (B) type: nucleic acid

(157) (C) chain property: single chain

(158) (D) topological structure: linear

(159) (ii) molecular type: oligonucleotide

(160) (iii) description to the sequence: SEQ ID No. 2

(161) ldhA2: GTCAAGGTCGACGTTATTGAAACCG;

(162) The information of SEQ ID No. 3:

(163) (i) sequence features:

(164) (A) length: 28 bp

(165) (B) type: nucleic acid

(166) (C) chain property: single chain

(167) (D) topological structure: linear

(168) (ii) molecular type: oligonucleotide

(169) (iii) description to the sequence: SEQ ID No. 3

(170) PPL1: AGCTTGGCTGCAGGTGATGATTATCAGC;

(171) The information of SEQ ID No. 4:

(172) (i) sequence features:

(173) (A) length: 24 bp

(174) (B) type: nucleic acid

(175) (C) chain property: single chain

(176) (D) topological structure: linear

(177) (ii) molecular type: oligonucleotide

(178) (iii) description to the sequence: SEQ ID No. 4

(179) PPL2: ATCGCCGGCAATTCGTAATCATGG; EcoRI

(180) The information of SEQ ID No. 5:

(181) (i) sequence features:

(182) (A) length: 30 bp

(183) (B) type: nucleic acid

(184) (C) chain property: single chain

(185) (D) topological structure: linear

(186) (ii) molecular type: oligonucleotide

(187) (iii) description to the sequence: SEQ ID No. 5

(188) PPL3: TAAGATATCCCATGATTACGAATTGCCGGC; EcoRV

(189) The information of SEQ ID No. 6:

(190) (i) sequence features:

(191) (A) length: 37 bp

(192) (B) type: nucleic acid

(193) (C) chain property: single chain

(194) (D) topological structure: linear

(195) (ii) molecular type: oligonucleotide

(196) (iii) description to the sequence: SEQ ID No. 6

(197) PPL4: TAAGAATTCAGTTAACCTCCTTAGGATCCCAATGCTT EcoRI

(198) The information of SEQ ID No. 7:

(199) (i) sequence features:

(200) (A) length: 39 bp

(201) (B) type: nucleic acid

(202) (C) chain property: single chain

(203) (D) topological structure: linear

(204) (ii) molecular type: oligonucleotide

(205) (iii) description to the sequence: SEQ ID No. 7

(206) Ec-RlA1: TAAGAATTCATGAAACTCGCCGTTTATAGCACAAAACAG; EcoRI

(207) The information of SEQ ID No. 8:

(208) (i) sequence features:

(209) (A) length: 30 bp

(210) (B) type: nucleic acid

(211) (C) chain property: single chain

(212) (D) topological structure: linear

(213) (ii) molecular type: oligonucleotide

(214) (iii) description to the sequence: SEQ ID No. 8

(215) Ec-RlA2: AAGACTTTCTCCAGTGATGTTGAATCACAT;

(216) The information of SEQ ID No. 9:

(217) (i) sequence features:

(218) (A) length: 29 bp

(219) (B) type: nucleic acid

(220) (C) chain property: single chain

(221) (D) topological structure: linear

(222) (ii) molecular type: oligonucleotide

(223) (iii) description to the sequence: SEQ ID No. 9

(224) ThiE1p: AGAGAATTCATTCATCGCCAACTCCTGCA

(225) The information of SEQ ID No. 10:

(226) (i) sequence features:

(227) (A) length: 32 bp

(228) (B) type: nucleic acid

(229) (C) chain property: single chain

(230) (D) topological structure: linear

(231) (ii) molecular type: oligonucleotide

(232) (iii) description to the sequence: SEQ No. 10

(233) ThiE2p: AGAGAATTCGGTGGACAGCGTACAGTGGATCG;

(234) The information of SEQ ID No. 11:

(235) (i) sequence features:

(236) (A) length: 26 bp

(237) (B) type: nucleic acid

(238) (C) chain property: single chain

(239) (D) topological structure: linear

(240) (ii) molecular type: oligonucleotide

(241) (iii) description to the sequence: SEQ ID No. 11

(242) Dld1: AGTACGTCTTGATACCTTCGAAGCGG;

(243) The information of SEQ ID No. 12:

(244) (i) sequence features:

(245) (A) length: 23 bp

(246) (B) type: nucleic acid

(247) (C) chain property: single chain

(248) (D) topological structure: linear

(249) (ii) molecular type: oligonucleotide

(250) (iii) description to the sequence: SEQ ID No. 12

(251) Dld2: GGATTCATGCTGTTGGTCGGATC;

(252) The information of SEQ ID No. 13:

(253) (i) sequence features:

(254) (A) length: 23 bp

(255) (B) type: nucleic acid

(256) (C) chain property: single chain

(257) (D) topological structure: linear

(258) (ii) molecular type: oligonucleotide

(259) (iii) description to the sequence: SEQ ID No. 13

(260) AckA-Pta1: TGAACATCATCACCTGCCACCTG;

(261) The information of SEQ ID No. 14:

(262) (i) sequence features:

(263) (A) length: 19 bp

(264) (B) type: nucleic acid

(265) (C) chain property: single chain

(266) (D) topological structure: linear

(267) (ii) molecular type: oligonucleotide

(268) (iii) description to the sequence: SEQ ID No. 14

(269) AckA-Pta2: CAGCGCAAAGCTGCGGATG

(270) The information of SEQ No. 15:

(271) (i) sequence features:

(272) (A) length: 25 bp

(273) (B) type: nucleic acid

(274) (C) chain property: single chain

(275) (D) topological structure: linear

(276) (ii) molecular type: oligonucleotide

(277) (iii) description to the sequence: SEQ ID No. 15

(278) Pps1: CGGCATGAATGATGTAGACAGGGTT

(279) The information of SEQ ID No. 16:

(280) (i) sequence features:

(281) (A) length: 23 bp

(282) (B) type: nucleic acid

(283) (C) chain property: single chain

(284) (D) topological structure: linear

(285) (ii) molecular type: oligonucleotide

(286) (iii) description to the sequence: SEQ ID No. 16

(287) Pps2: TAACCAGGTTTGCACCACGGTGT

(288) The information of SEQ ID No. 17:

(289) (i) sequence features:

(290) (A) length: 21 bp

(291) (B) type: nucleic acid

(292) (C) chain property: single chain

(293) (D) topological structure: linear

(294) (ii) molecular type: oligonucleotide

(295) (iii) description to the sequence: SEQ ID No. 17

(296) RPps1: TGTGGCGAAACCATTCGGAAC

(297) The information of SEQ ID No. 18:

(298) (i) sequence features:

(299) (A) length: 22 bp

(300) (B) type: nucleic acid

(301) (C) chain property: single chain

(302) (D) topological structure: linear

(303) (ii) molecular type: oligonucleotide

(304) (iii) description to the sequence: SEQ ID No. 18

(305) RPps2: GTCCGACCACGAAGACTTTGCC

(306) The information of SEQ ID No. 19:

(307) (i) sequence features:

(308) (A) length: 23 bp

(309) (B) type: nucleic acid

(310) (C) chain property: single chain

(311) (D) topological structure: linear

(312) (ii) molecular type: oligonucleotide

(313) (iii) description to the sequence: SEQ ID No. 19

(314) PflB1: TTCAGACTTCGGACCAACCTGCA

(315) The information of SEQ ID No. 20:

(316) (i) sequence features:

(317) (A) length: 20 bp

(318) (B) type: nucleic acid

(319) (C) chain property: single chain

(320) (D) topological structure: linear

(321) (ii) molecular type: oligonucleotide

(322) (iii) description to the sequence: SEQ ID No. 20

(323) PflB2: CCGCGAACTGGATCCGATGA;

(324) The information of SEQ ID No. 21:

(325) (i) sequence features:

(326) (A) length: 24 bp

(327) (B) type: nucleic acid

(328) (C) chain property: single chain

(329) (D) topological structure: linear

(330) (ii) molecular type: oligonucleotide

(331) (iii) description to the sequence: SEQ ID No. 21

(332) PoxB1: CAAACGGTTGCAGCTTATATCGCC

(333) The information of SEQ ID No 22:

(334) (i) sequence features:

(335) (A) length: 24 bp

(336) (B) type: nucleic acid

(337) (C) chain property: single chain

(338) (D) topological structure: linear

(339) (ii) molecular type: oligonucleotide

(340) (iii) description to the sequence: SEQ ID No. 22

(341) PoxB2: TGCGGTGGAATGGCTAACTCTTCT

(342) The information of SEQ ID No. 23:

(343) (i) sequence features:

(344) (A) length: 23 bp

(345) (B) type: nucleic acid

(346) (C) chain property: single chain

(347) (D) topological structure: linear

(348) (ii) molecular type: oligonucleotide

(349) (iii) description to the sequence: SEQ. ID No. 23

(350) FrdA1: CTTTCAAGCCGATCTTGCCATTG

(351) The information of SEQ ID No. 24:

(352) (i) sequence features:

(353) (A) length: 24 bp

(354) (B) type: nucleic acid

(355) (C) chain property: single chain

(356) (D) topological structure: linear

(357) (ii) molecular type: oligonucleotide

(358) (iii) description to the sequence: SEQ ID No. 24

(359) FrdA2: ACTCTTTACGTGCCATTGCGGAGT

(360) The information of SEQ ID No. 25:

(361) (i) sequence features:

(362) (A) length: 24 bp

(363) (B) type: nucleic acid

(364) (C) chain property; single chain

(365) (D) topological structure: linear

(366) (ii) molecular type: oligonucleotide

(367) (iii) description to the sequence: SEQ ID No. 25

(368) AdhE1: ATCTGATCGGCTGGATCGATCAAC

(369) The information of SEQ No. 26:

(370) (i) sequence features:

(371) (A) length: 22 bp

(372) (B) type: nucleic acid

(373) (C) chain property: single chain

(374) (D) topological structure: linear

(375) (ii) molecular type: oligonucleotide

(376) (iii) description to the sequence: SEQ ID No. 26

(377) AdhE2: GAACCAGGTTGGCGTCGACAAT

(378) The information of SEQ ID No. 27:

(379) (i) sequence features:

(380) (A) length: 35 bp

(381) (B) type: nucleic acid

(382) (C) chain property: single chain

(383) (D) topological structure: linear

(384) (ii) molecular type: oligonucleotide

(385) (iii) description to the sequence: SEQ ID No. 27

(386) ldhA3: TAAGAATTCTTATGAAACTCGCCGTTTATAGCACA EcoRI

(387) The information of SEQ ID No. 28:

(388) (i) sequence features:

(389) (A) length: 38 bp

(390) (B) type: nucleic acid

(391) (C) chain property: single chain

(392) (D) topological structure: linear

(393) (ii) molecular type: oligonucleotide

(394) (iii) description to the sequence: SEQ ID No. 28

(395) ldhA4: CTTGAATTCAAGCTTGCTGCCGGAAATCATCATTTTTT EcoRI, HindIII

(396) The information of SEQ ID No. 29:

(397) (i) sequence features:

(398) (A) length: 21 bp

(399) (B) type: nucleic acid

(400) (C) chain property: single chain

(401) (D) topological structure: linear

(402) (ii) molecular type: oligonucleotide

(403) (iii) description to the sequence: SEQ ID No. 29

(404) ldhA5: GGGCAGCCCGAGCGTCATCAG

(405) The information of SEQ ID No. 30:

(406) (i) sequence features:

(407) (A) length: 23 bp

(408) (B) type: nucleic acid

(409) (C) chain property: single chain

(410) (D) topological structure: linear

(411) (ii) molecular type: oligonucleotide

(412) (iii) description to the sequence: SEQ No. 30

(413) ldhA6: GCTGCCGGAAATCATCATTTTTT

(414) The information of SEQ ID No. 31:

(415) (i) sequence features:

(416) (A) length: 30 bp

(417) (B) type: nucleic acid

(418) (C) chain property: single chain

(419) (D) topological structure: linear

(420) (ii) molecular type: oligonucleotide

(421) (iii) description to the sequence: SEQ ID No. 31

(422) RldhA1; GGAAGATCTTCCGCGAGTTTCATAAGACTT BglII

(423) The information of SEQ ID No. 32:

(424) (i) sequence features;

(425) (A) length: 24 bp

(426) (B) type: nucleic acid

(427) (C) chain property: single chain

(428) (D) topological structure: linear

(429) (ii) molecular type: oligonucleotide

(430) (iii) description to the sequence: SEQ ID No. 32

(431) RldhA2: CGGAATTCCGAACGAACTGGTTTA EcoRcustom character

(432) The information of SEQ ID No. 33:

(433) (i) sequence features:

(434) (A) length: 33 bp

(435) (B) type: nucleic acid

(436) (C) chain property: single chain

(437) (D) topological structure: linear

(438) (ii) molecular type: oligonucleotide

(439) (iii) description to the sequence: SEQ ID No. 33

(440) BcoaLDH1 CCGGATCCAATCAGGGTGTTGCAGAAGAGCTTG BamHI

(441) The information of SEQ ID No. 34:

(442) (i) sequence features;

(443) (A) length: 34 bp

(444) (B) type: nucleic acid

(445) (C) chain property: single chain

(446) (D) topological structure: linear

(447) (ii) molecular type: oligonucleotide

(448) (iii) description to the sequence: SEQ ID No. 34

(449) BcoaLDH4 GCGGAATTCTTACAATACAGGTGCCATCGTTTCT EcoRI

(450) The information of SEQ ID No. 35:

(451) (i) sequence features:

(452) (A) length: 28 bp

(453) (B) type: nucleic acid

(454) (C) chain property: single chain

(455) (D) topological structure: linear

(456) (ii) molecular type: oligonucleotide

(457) (iii) description to the sequence: SEQ ID No. 35

(458) LldD1 GGCCCGGGCATGATTATTTCCGCAGCCA SmaI

(459) The information of SEQ ID No. 36:

(460) (i) sequence features:

(461) (A) length: 30 bp

(462) (B) type: nucleic acid

(463) (C) chain property: single chain

(464) (D) topological structure: linear

(465) (ii) molecular type: oligonucleotide

(466) (iii) description to the sequence: SEQ ID No. 36

(467) LldD2: GGCCCGGGCAGGCAACTCTTTACCCAGCCC SmaI

(468) The information of SEQ ID No. 37:

(469) (i) sequence features:

(470) (A) length: 30 bp

(471) (B) type: nucleic acid

(472) (C) chain property: single chain

(473) (D) topological structure: linear

(474) (ii) molecular type: oligonucleotide

(475) (iii) description to the sequence: SEQ ID No. 37

(476) LcaLDH1 CGCGGATCCAGTATTACGGATAAGGATCAC BamHI

(477) The information of SEQ ID No. 38:

(478) (i) sequence features:

(479) (A) length: 25 bp

(480) (B) type: nucleic acid

(481) (C) chain property: single chain

(482) (D) topological structure: linear

(483) (ii) molecular type: oligonucleotide

(484) (iii) description to the sequence: SEQ ID No. 38

(485) LcaLDH4 CGCCTGCAGTCCTGTTCTTCGTTTG PstI

(486) The information of SEQ ID No. 39:

(487) (i) sequence features:

(488) (A) length: 28 bp

(489) (B) type: nucleic acid

(490) (C) chain property: single chain

(491) (D) topological structure: linear

(492) (ii) molecular type: oligonucleotide

(493) (iii) description to the sequence: SEQ ID No. 39

(494) StrbLDH1 CGCGGATCCACTAAACAACACAAAAAAG BamHI

(495) The information of SEQ ID No. 40:

(496) (i) sequence features:

(497) (A) length: 28 bp

(498) (B) type: nucleic acid

(499) (C) chain property: single chain

(500) (D) topological structure: linear

(501) (ii) molecular type: oligonucleotide

(502) (iii) description to the sequence: SEQ ID No. 40

(503) StrbLDH2 CCGGAATTCTACAGGGATTGTTGCCGCA EcoRI

(504) The above is the detailed description of polymer grade lactic acid monomer production bacteria and construction methods thereof and technology for manufacturing lactic acid with reference to the above examples. The description is intended to be illustrative but not restrictive, and several examples can be listed according to the defined range. Therefore, any changes and modifications departing from the general concept of the present invention shall fall within the protection scope of the present invention.